Recombinant cell line TMDK562-21 exhibiting ability to activate and proliferate human NK cells
Patent Information
- Authority / Receiving Office
- RU · RU
- Patent Type
- Patents
- Current Assignee / Owner
- OBSHCHESTVO S OGRANICHENNOJ OTVETSTVENNOSTYU TEKON MEDITSINSKIE PRIBORY
- Filing Date
- 2025-01-28
- Publication Date
- 2026-07-07
Smart Images

Figure 00000002 
Figure 00000003 
Figure 00000004
Abstract
Description
[0001] The invention relates to the field of medicine, cellular and molecular biotechnology and immunology.
[0002] The proposed cell line can be used for the expansion and activation of human natural killer (NK) cells during their co-cultivation and is a promising direction for adoptive immunotherapy.
[0003] NK cells are effectors of the innate immune system with immunoregulatory and cytotoxic functions [1]. Because NK cells proliferate poorly in vitro, have a limited lifespan in vivo, and represent a small fraction of peripheral lymphocytes, obtaining sufficient numbers and optimally functioning cells is a major hurdle for immunotherapy. Therefore, there is a need for additional interventions targeting NK cells. This requires focusing on the molecular machinery governing NK cell physiology to identify differences between “resistant” and “sensitive” target cells for the design of helper and feeder cells, as well as antigen-presenting cells (APCs) to improve mediated contact [2].
[0004] At present, the main method of NK cell expansion remains their cultivation in a medium with the addition of various cytokines and growth factors [3].
[0005] Interleukin 21 (IL-21) is known to promote the activation, proliferation and survival of tumor-specific CD8 + cytotoxic T cells, and also enhances B cell proliferation and the antitumor activity of NK cells [4]. IL-21 can activate the lytic activity of NK cells by upregulating costimulatory receptors, perforin, and granzyme [5], has multidirectional effects on antitumor immunity, and is mainly produced by CD4 + T cells and NKT, and the IL-21 receptor (IL-21R) is expressed on many hematopoietic cells, including CD4 + T-follicular helper (Tfh), Treg and T-helper type 17 (Th17), naive CD8 +Memory T cells, as well as B, NK, and dendritic cells (DC) [1]. IL-21 R is a heterodimer consisting of a common γ-chain subunit and a specific subunit (CD360) [4]. IL-21 synergistically interacts with IL-15, inducing the generation of NK cells, and the combined action with IL-15 and IL-18 increases the synthesis and production of IFNγ mRNA [6]. Comparison of IL-15 and IL-21 receptors is important because they transmit signals primarily through different transcription factors, leading to different outcomes. Without being bound to a specific theory or mechanism, it is believed that because IL-15 primarily signals through the cell growth proteins STAT5A / STAT5B, while IL-21 primarily signals through the cell death proteins STAT1 and STAT3, co-expression of IL-15 and IL-21 mediated by nucleic acids and polypeptides may reduce or prevent the unwanted cell overgrowth that can be observed in the presence of IL-15 alone [7].
[0006] Since NK cells are extremely sensitive to culture conditions, the standard method for activating and stimulating NK cell expansion in vitro is culturing them in a cytokine-rich medium in the presence of pre-irradiated (inactivated by radiation or cytostatics) feeder cells, which are easily recognizable targets for NK cells. One of the most effective methods for stimulating NK cell proliferation is culturing them in the presence of feeder cells, which are targets for NK cells.
[0007] The K562 line of poorly differentiated human myeloid cells is most often used as a feeder. Contact interaction of NK cells with the feeder dramatically increases the rate of NK cell expansion [8, 9]. To enhance the effect, K562 cells are modified so that they express membrane-bound forms of cytokines and their combinations required by NK cells [10, 11, 12, 13]. IL-2 and IL-15 are most important for the survival, activation and proliferation of NK cells, while IL-12, IL-18, IL-21 and other costimulatory molecules (e.g., 4-1BBL, FLT3L, GAB3) are also capable of activating NK cells
[14] . For specific modification of NK cells, IL-21 can be used to generate APC. The IL-21 receptor (IL21R), closely related to the IL-2 receptor beta chain, is capable of signaling through its dimerization with the common gamma chain.While IL-21, a type I cytokine, modulates T, B, and NK cell functions, only human NK cells have been found to undergo significant proliferation through activation of the IL-21 receptor signaling pathway. Conversely, IL-21 plays a significant role in CD8 cell depletion. + T cells. IL21R signaling is primarily enhanced by STAT3, a highly active activator of cell proliferation. IL21R-STAT3 communication is mediated by IL-21-induced STAT3 binding to DNA with GAS and cis-inducible elements. IL21R signaling is important for NK cell cytotoxicity.
[0008] Genetically engineered artificial antigen-presenting cells (aAPCs) expressing membrane-bound IL-15 (mbIL15) were used to expand NK cells for adoptive immunotherapy clinical trials, but ex vivo proliferation was limited by telomere shortening.
[0009] The ability of a K562-based aAPC with membrane-bound IL-21 (mbIL21) to support human NK cell proliferation was assessed. NK cells cultured in the presence of mbIL21, despite significantly increasing proliferation, also showed a significant increase in telomere length compared to freshly isolated NK cells, suggesting a possible mechanism for their sustained proliferation.
[0010] They were similar in phenotype and cytotoxicity to cells generated with mbIL15, with high expression of NCR, CD 16 and NKG2D, but had increased cytokine secretion, unlike NK cells with the addition of soluble IL-15 [1].
[0011] Also shown increased transcription of the activating receptor CD160, demonstrated significant cytotoxicity against all tumor cell lines tested. The line retained sensitivity to inhibitory ligands of KIR and had high antibody-dependent cellular cytotoxicity. Thus, aAPCs expressing mbIL21 were shown to promote improved proliferation of human NK cells with longer telomeres and less senescence factor, which supports their clinical use for adoptive immunotherapy [1, 15]. The combination of mbIL-21-CD137L-K562 induced the generation of highly functional NK cells with robust proliferation and cytotoxicity from peripheral blood mononuclear cells through activation of specific signal transducer and activator of transcription-3 (STAT-3)
[15] . IL21R signaling is primarily enhanced by the highly active activator of cell proliferation STAT3.The IL21R-STAT3 association is driven by IL-21-induced STAT3 binding to DNA with GAS and cis-inducible element phosphorylation of STAT1 and STAT3.
[0012] Available literature data show that 4-1BBL together with mbIL21 provides a higher cell yield than 4-1BBL together with mbIL15, and that mbIL21 provides a less depleted transcriptome profile
[16] . IL-2 is usually added to the medium in soluble form, and the classic combinations of membrane-bound forms of cytokines are IL-15 + 4-1BBL and IL-21 + 4-1BBL [17, 18]. Various studies have shown that these feeder cell line variants significantly increase the rate of NK cell expansion, but the advantages of each of these variants remain controversial. Long-term expression of markers on the surface of K562 has also not been achieved.
[0013] According to patent WO 2021251707A1, a cell line genetically modified K562-OX40L-mbIL18-mbIL21 and intended for the amplification and activation of NK cells is known. The described cell line is capable of expressing functionally significant markers CD16, CD57, CD69, CD161, CD94, CD158a, CD158b, NKp30, NKp44, NKp46, DNAM-1, 2B4, the KIR family of inhibitory receptors (KIR2DL1, KIR2DL2 / 3, KIR3DL1) and the NKG2 family of activating receptors (NKG2A, NKG2C, NKG2D) on NK cells
[19] .
[0014] K562-OX40L-mbIL18-mbIL21 expresses membrane-bound IL-18 (mbIL-18), membrane-bound IL-21 (mbIL21), and OX40. Human-derived genes mbIL18 and mbIL21 were cloned into the lentiviral vector pCDH-CMV-RFP to generate a recombinant lentiviral production vector. The recombinant gene (pCDH-CMV-RFP-mbIL-1821), obtained for virus production, was then transfected into 293FT cells along with a packaging vector for viral particle assembly.
[0015] The human-derived OX40L gene was cloned into the pLVX-IRES-ZsGreen lentiviral vector. The recombinant gene (OX40L-pLVX-IRES-ZsGreen) was then processed and subsequently lentivirally transduced into K562 cells to produce the virus.
[0016] To select only infected cells, cells expressing both green and red fluorescence were selected using an automated ultrafast flow cytometer (FACS) and the expression of mbIL18-mbIL21 was analyzed in the K562 cell line
[19] .
[0017] The use of lentiviral transduction is a drawback of this cell line, as it does not allow for sustained expression of the introduced genetic construct over a long period of time through multiple cell divisions. Furthermore, the use of fluorescent proteins RFP and ZsGreen reduces transduction efficiency and increases the size of the construct used.
[0018] The closest analogue, prototype, is the well-known genetically modified antigen-presenting cell line UAPC, which is described above in patent RU2809113C2 [2].
[0019] UAPC is designed to express CD48 and / or CS1 (CD319), membrane-associated interleukin-21 (mbIL-21), and 4-1BB ligand (4-1BBL). UAPC expresses CD48 and lacks expression of endogenous HLA class I, II, or CD1d molecules.
[0020] UAPC is designed for the activation and expansion of chimeric antigen receptor CAR-T cells. The described cell line is obtained by retroviral transduction of the K562 cell line with genetic constructs (GCs) containing the antigen-binding domain for CD19, CD123, mesothelin, CD5, CD47, CLL-1, CD33, CD99, U5snRNP200, CD200, CS1, BAFF-R, ROR-1 or BCMA and IL-15. To solve the problem of obtaining clinically significant quantities of NK cells, the current UAPC platform technology used IL-21 as a means of directing NK cell proliferation [2].
[0021] The present platform technology has the advantage of specific combinatorial therapeutic pathways to provide practical methods for generating large numbers of highly functional and clinical-grade cytotoxic NK cells for cancer immunotherapy [2].
[0022] A disadvantage of UAPC is the presence of CS1 (£D319), which lengthens the construct. CD319 is a product of the human SLAMF7 gene and is a marker for normal plasma cells and malignant plasma cells in multiple myeloma. CD319 is used to isolate malignant plasma cells from long-term stored and even frozen samples. CD319 is not associated with NK cell activation and proliferation. UAPC also lacks antibiotic resistance genes, making the process of obtaining monoclones from polyclonal cells problematic. The construct also contains the green fluorescent protein (GFP) gene, which complicates and lengthens the construct, reduces transduction efficiency, and stains the cells green during flow cytometry. This fact complicates the analysis of other antigenic determinants on the cell that glow in the same range when performing flow cytometry, which is a limitation for their identification.
[0023] The objective of the present invention is to eliminate the above-described disadvantages and obtain a feeder cell line of chronic myelogenous leukemia TMDK562-21, which has a high surface expression of a membrane-bound form of a chimeric protein consisting of IL-21 in combination with 4-1BBL, exhibiting the ability to activate and proliferate NK cells when they are co-cultured.
[0024] All this will allow us to expand the collection of recombinant cell lines for the purposes of stimulating the activation and proliferation, and long-term cultivation of highly viable human NK cells. The new recombinant cell line TMDK562-21 stably expresses high concentrations of the CD 137 receptor ligand protein (TNFRSF9L) in more than 99% of cells over several months of cultivation, and a membrane-bound chimeric protein consisting of IL-21 and a portion of CD137L in more than 80% of cells. The use of the CD137L fragment as part of the mbIL21 / CD137L chimeric protein avoids a critical increase in the size of the genetic construct, while maintaining the effect on the ability of the resulting cell line to proliferate and activate NK cells in vitro. CD 137, also known as 4-1BB, is another member of the TNF superfamily. CD 137L is also known as tumor necrosis factor receptor superfamily member 9 (TNFRSF9L) and 41BBL.TMDK562-21 contains the hygromycin resistance gene (HygR), which significantly simplifies clone selection and monocloning when culturing cells with the inserted construct. The GC also contains the SV40 promoter for studying DNA sequence elements and cellular factors involved in transcription control and initiation. LTR2 (5' LTR) ensures high-level expression of the gene of interest and acts as a promoter to direct viral genome transcription, while the 3' LTR acts as a polyadenylation signal to terminate upstream transcription. MMLV Psi is required for packaging viral RNA into the virus.
[0025] The technical result of the claimed invention is achieved by the fact that:
[0026] 1) a retroviral expression plasmid carrying cassettes of the mbIL21-P2A-41BBL composition with genes for resistance to hygromycin was constructed;
[0027] 2) a preparation of pseudotyped retroviral particles carrying the material of the cassettes from point 1 was obtained;
[0028] 3) monocloning of polyclonal lines was carried out and a monoclonal cell line was obtained on their basis.
[0029] The obtained cell line corresponds morphologically and in terms of the main surface markers (CD45+, CD 19-, CD22-) to human erythroleukemia cells, expresses the mbIL21 / 41BBL construct on the surface and is resistant to hygromycin (Fig. 5).
[0030] The constructed recombinant retroviral plasmid pBABE-hygro-mbIL21-P2A-41BBL has the following characteristics: it encodes the membrane-bound form of the chimeric protein IL-21 (mbIL21) and the human transmembrane protein 41BBL.
[0031] Consists of the following elements:
[0032] a) a sequence encoding the main functional and structural elements of the costimulatory domain of the transmembrane chimeric protein IL-21 / 41BBL;
[0033] b) self-cleaving sequence P2A for post-translational separation of transmembrane protein fragments;
[0034] c) genetic markers:
[0035] AmpR is the ampicillin resistance gene (bla), which determines resistance to ampicillin during transformation of Escherichia coli and HygR is the selective gene for resistance to hygromycin;
[0036] d) modified genetic elements (MMLV psi, gag) necessary for the correct processing of viral RNA and assembly of pseudoretroviral particles;
[0037] d) the sv40 polyomavirus promoter, to ensure a high level of expression of the sequences used and correct processing of viral RNA.
[0038] The invention is illustrated by the following figures: Fig. 1 shows a map of the genetic structure of the recombinant plasmid pBABE-hygro- mbIL21-P2A-41BBL, where
[0039] LTR1 - Moloney murine leukemia virus long terminal repeat (3' LTR),
[0040] MMLV Psi is a retrovirus packaging signal that is part of the murine leukemia virus,
[0041] gag (truncated) - a shortened sequence of the HIV-1 gag gene,
[0042] mbIL21- membrane-bound IL-21 promotes proliferation and expansion
[0043] NK cells,
[0044] P2A is a self-splitting sequence,
[0045] 41BBL (TNFRSF9L) is a transmembrane glycoprotein receptor,
[0046] provides costimulatory signals for various lymphocytes,
[0047] SV40 promoter - polyomavirus sv40 promoter,
[0048] HygR - hygromycin resistance gene,
[0049] AmpR promoter - promoter of the penicillin resistance gene,
[0050] AmpR is a gene that provides resistance to ampicillin,
[0051] LTR2 - Moloney murine leukemia virus long terminal repeat (5' LTR).
[0052] Figure 2 shows the morphology of cell lines obtained using a light inverted microscope, where:
[0053] A. K562 original line cells;
[0054] B. Recombinant cell line TMDK562-21.
[0055] Figure 3 shows the viability of the TMGZh562-21 cell line using cytometric analysis with 7AAD vital dye staining, where:
[0056] A. Number of viable cells before irradiation;
[0057] B. Number of viable cells after irradiation;
[0058] Figure 4 shows the average proliferation level of NK cells during co-culture of peripheral blood mononuclear cells with the TMDK562-21 line using cytometric analysis of the surface expression of CD3 and CD56 markers.
[0059] Figure 5 shows IL-21 expression in the hygromycin-resistant monoclonal cell line K562 mbIL21-41BBL using cytometric analysis. Staining was performed with an anti-IL21 antibody (Miltenyi Biotec, Germany). The proportion of IL21-positive cells was 70%.
[0060] A. Expression of IL-21 before transfection of K562 cell line;
[0061] B. IL-21 expression after transfection of the hygromycin-resistant K562 mbIL21-41BBL cell line.
[0062] Figure 6 shows the proportion of activated NK cells expressing CD38 and HLA-DR using cytometric analysis, where:
[0063] A. Proportion of NK cells expressing the surface marker CD38 before co-culture with the TMDK562-21 cell line;
[0064] B. The proportion of NK cells expressing the surface marker CD38 on day 14 of co-culture with the TMDK562-21 cell line;
[0065] C. Proportion of NK cells expressing the surface marker HLA-DR before co-culture with the TMDK562-21 cell line;
[0066] D. The proportion of NK cells expressing the surface marker HLA-DR on day 14 of co-culture with the TMDK562-21 cell line.
[0067] Transduction was performed by spinoculation with different MOIs (multiplicity of infection) in the presence of 8 μg / ml polybrene (Sigma, USA). 48 hours after transduction, the cells were selected for 5 days in a medium supplemented with hygromycin B (3 μg / ml). TMDK562-21 cells were stained with phycoerythrin (PE)-conjugated antibodies to TNFRSF9L (clone REA254, Miltenyi Biotec, Germany). Then, to obtain a homogeneous cell line expressing inbIL21 / CD137L (TNFRSF9L), the cells were cloned using a Sony SH800 cell sorter (Sony, Japan) (Fig. 5).
[0068] The resulting human myelogenous leukemia cell line TMDK562-21 was shown to possess stable morphological characteristics during culture. The cell line is represented by cells with a morphology of large granular cells with a large nucleus, growing singly or forming clusters (Fig. 2).
[0069] The marker features of TMDK562-21 cell line are as follows:
[0070] - surface expression of IL-21 is observed in more than 80% of cells;
[0071] - Surface expression of 41BBL protein is observed in more than 99% of cells (Fig. 3).
[0072] The TMDK562-21 cell line is cultured in RPMI-1640 nutrient medium (PanEco, Russia), in the presence of 10% fetal bovine serum (FBS) (GIBCO, USA), 100 U / ml penicillin and 100 μg / ml streptomycin (Capricorn-Scientific, Germany), in an atmosphere of 5% CO2 at 37°C.
[0073] The culture has a suspension growth type. During subculture, cells are replanted every 2-3 days to a concentration of 0.3-0.5 × 106 cells / ml.
[0074] The following cryopreservation conditions are used. CryoMed-M medium (PanEco, Russia). The standard freezing mode is 3×10 7 cells / ampoule with a temperature decrease of one degree Celsius per minute in a Biofreeze BV-65 programmed freezer (Biofreeze, France). Storage in liquid nitrogen at -196°C. Rapid defrosting at 37°C. Then 1.5 ml of the cell suspension is diluted in 10 ml of RPMI-1640 medium or phosphate-buffered saline and pelleted by centrifugation at 800 rpm, the cells are resuspended in RPMI-1640 growth medium and seeded into culture flasks. Cell viability after cryopreservation is >75% (staining with trypan blue).
[0075] Contamination analysis. No bacteria or fungi were detected in the culture after long-term cultivation. Ureaplasma and mycoplasma were analyzed by real-time RT-PCR using the primer pair 5'GGCGAATGGGTAAGTAACACG3' and 5'CGATAACGCTTGCGACCTAT3', which allows for the detection of Mycoplasma hyorhinis, fermentans, arginini, orale, genitalium, hominis, pimm, pneumoniae, salivarium, Acholeplasma laidlawii, and Ureaplasma urealyticum. The test for mycoplasma and ureaplasma is negative.
[0076] Example 1. Production of recombinant cell line TMDK5 62-21.
[0077] The TMDK5 62-21 cell line was obtained on the basis of the K562 cell line (transferred from the Russian Collection of Vertebrate Cell Cultures (RCVC P) of the Irkutsk Scientific Center of the Russian Academy of Sciences) by transducing it (infecting) with pseudoretroviral particles. To obtain pseudoretroviral particles, DNA of the recombinant retroviral plasmid pBABE-hygro-mblL21-P2A-41BBL was mixed with DNA of the auxiliary plasmids pUMVC and PCMV-VSV-G, necessary for packaging of pseudoretroviral particles, in a ratio of 4:1:3 and HEK293T cells were transformed by the calcium phosphate transfection method, after which they were cultured for 6 h in IMDM medium supplemented with 10% FBS, 100 μg / ml streptomycin and 100 units / ml penicillin in an atmosphere of 5% CO2 at 37°C. Then the medium in the dishes was replaced with new one and the cells were incubated for 48 h. The conditioned medium supernatants were then filtered through 0.45 μm PES filters and used to infect the K562 cell line by spinoculation in the presence of 8 μg / ml polybrene.After infection, transductants were selected on a medium supplemented with 3 μg / ml hygromycin for 5 days. Finally, TMDK562-21 cells were stained with phycoerythrin (PE)-conjugated antibodies to TNFRSF9L (Miltenyi Biotec, Germany) and cloned on a Sony SH800 cell sorter (Sony, Japan) to obtain a homogeneous IL-21 / TNFRSF9L-3KcnpeccHpyronjefi cell line. Surface expression of IL-21 fused to the CD137L protein domain (TNFRSF9L), analyzed by flow cytometry (staining with CD137L antibodies, clone 5F4, BioLegend, USA), was observed in 99% of the cells (Fig. 3).
[0078] Example 2. Limitation of proliferation of recombinant cell line TMDK562-21.
[0079] TMDK562-21 cells were cultured to a total cell count of 500 million. Cell viability in suspension was greater than 92%. The resulting suspension was transferred to 25 ml tubes (Eppendorf, Germany) and irradiated with γ-irradiation using a cobalt-60 source at a dose of 100 Gy. After irradiation, the viable cell count was greater than 86%. To assess the proliferation rate after irradiation, irradiated cells were cultured for 3 days; viability remained unchanged, and proliferative activity was absent (Fig. 2).
[0080] Example 3. Using genetically modified cells to expand NK cells.
[0081] To evaluate the effect of TMGZh562-21 on the expansion and functional activity of immune cells, the resulting cell culture was co-cultivated with peripheral blood mononuclear cells (PBMCs). For this purpose, PBMCs were isolated using the standard Hystopague-1077 density gradient technique (Sigma Aldrich, USA) from heparinized blood of a healthy donor. Cultivation was carried out in RPMI-1640 nutrient medium containing 10% FBS with the addition of IL-2 at a concentration of 200 IU / ml in a CO2 incubator in a humidified atmosphere at 5% CO2 and 37°C. TMDK5 62-21 cells after gamma irradiation were added to the cultured PBMCs on days 0 and 7. The proportion of NK cells with the CD3-CD56+ phenotype in the cultured PBMC mixture by day 14 averaged 82.2% and increased by more than 52.9 times in most donors (Fig. 4). As a result of culturing, the proportion of activated NK cells expressing CD38 and HLA-DR markers increased to 99.8% and 98.9%, respectively (Fig. 6).These cells can be used to study the cytotoxic activity of NK cells, as well as for adoptive immunotherapy in cancer patients. Sources of information:
[0082] 1. Denman CJ, Senyukov VV, Somanchi SS, Phatarpekar PV, Kopp LM, Johnson JL, Singh H, Hurton L, Maiti SN, Huls MH, Champlin RE, Cooper LJ, Lee DA. Membrane-bound IL-21 promotes sustained ex vivo proliferation of human natural killer cells. PLoS One. 2012; 7(1): e30264.
[0083] 2. AN CO T., LIU E, Rezvani K, Shpoll E J. Universal antigen-presenting cells and their applications. RU2809113C2.
[0084] 3. Abakushina E.V. Method of long-term cultivation and expansion of NK cells with high viability and functional activity. RU No. 2794770.
[0085] 4. Fu Y, Tang R, Zhao X. Engineering cytokines for cancer immunotherapy: a systematic review. Front Immunol. 14:1218082.
[0086] 5. Tyshchuk EB, Mikhailova BA, Seltsov CA, Selkov CA, Sokolov DI Natural killers: origin, phenotype, functions. Medical Immunology. 2021, Vol. 23, No. 6, pp. 1207-1228.
[0087] 6. Fakua Sh.F., Akomea R. Aduña S.E. IL-21 signaling and induction of cytokine expression in human leukemia cells and monocytes. DOI: 10.5772 / intechopen.93004
[0088] 7. Hinrichs CS, Jin BY. Tethered interleukin-15 and interleukin-21. US20230355677A1.
[0089] 8. Ojo EO, Sharma AA, Liu R, Moreton S, Checkley-Luttge MA, Gupta K, et al. Membrane bound IL-21 based NK cell feeder cells drive robust expansion and metabolic activation of NK cells. Sci Rep.2019;9:14916.
[0090] 9. Liu E, Ang SOT, Kerbauy L, Basar R, Kaur I, Kaplan M, et al. GMP-Compliant Universal Antigen Presenting Cells (uAPC) Promote the Metabolic Fitness and Antitumor Activity of Armored Cord Blood CAR-NK Cells. Front Immunol. 2021;12: 626098.
[0091] 10. Rezvani K, Rouce RH. The application of natural killer cell immunotherapy for the treatment of cancer. Front Immunol. 2015;6: 578.
[0092] 11. Fang F, Xiao W, Tian Z. NK cell-based immunotherapy for cancer. Semin Immunol. 2017; 31: 37-54.
[0093] 12. Lindstrom R. NK cells expand and interact with K562-mbl5-41BBL plasma membrane particles, but not with K562-mbl5-41BBL cells. Honors Program Theses. 2016.
[0094] 13. Klingemann H, Boissel L, Toneguzzo F. Natural Killer Cells for Immunotherapy - Advantages of the NK-92 Cell Line over Blood NK Cells. Front Immunol. 2016; 7:91.
[0095] 14. Shimasaki N, Jain A, Campana D. NK cells for cancer immunotherapy. Nat Rev DrugDiscov. 2020; 19: 200-218.
[0096] 15. Wang X, Lee DA, Wang Y, Wang L, Yao Y, Lin Z, Cheng J, Zhu S. Membrane-bound interleukin-21 and CD 137 ligand induce functional human natural killer cells from peripheral blood mononuclear cells through STAT-3 activation. Clin Exp Immunol. 172(1):104-12.
[0097] 16. Zhang C, Kadu S, Xiao Y, Johnson O, Kelly A, O'Connor RS, Lai M, Kong H, Srivatsa S, Tai V, Greenblatt E, Holmes M, Riley JL, June CH, Sheppard NC.
[0098] Sequential Exposure to IL21 and IL15 During Human Natural Killer Cell Expansion Optimizes Yield and Function. Cancer Immunol Res. 2023 Nov 1;11(11): 1524-1537.
[0099] 17. Denman CJ, Senyukov VV, Somanchi SS, Phatarpekar PV, Kopp LM, Johnson JL, et al. Membrane-bound IL-21 promotes sustained ex vivo proliferation of human natural killer cells. PLoS ONE. 2012;7: e30264.
[0100] 18. Imai C, Iwamoto S, Campana D. Genetic modification of primary natural killer cells overcomes inhibitory signals and induces specific killing of leukemic cells. Blood. 2005; 106: 376-383.
[0101] 19. Genetically-modified cell line for nk cell activation and amplification, and use thereof. WO2021251707A1.