Live attenuated pseudorabies virus vaccine for swine containing deletion of UL23 gene

Abstract

FIELD: biotechnology; veterinary medicine.SUBSTANCE: proposed is the use of a modified live pseudorabies virus containing the genome SEQ ID NO: 3 or a nucleic acid sequence that is at least 95 % identical thereto, for producing a vaccine for protecting a pig against one or more symptoms of pseudorabies virus (PRV) caused by an infectious PRV, wherein said modified live pseudorabies virus comprises a deletion of nucleotides 480–846 of the UL23 gene, and said infectious PRV is of genotype II, and wherein said pig is a pregnant sow.EFFECT: administration of the said vaccine does not affect the farrowing rate, abortion rate or survival of the offspring of the said pregnant sows.10 cl, 10 tbl, 7 ex

Description

FIELD OF TECHNICAL INVENTION

[0001] This invention generally relates to the field of vaccines against pseudorabies virus.BACKGROUND OF THE INVENTION

[0002] Pseudorabies virus (PRV) causes a disease that affects many animal species worldwide. PRV infections are variously known as infectious bulbar paralysis, Aujeszky's disease, and pseudorabies. Clinical signs of PRV infection include abortions, high mortality in sows, coughing, sneezing, fever, constipation, depression, seizures, ataxia, circling, and excessive salivation in piglets and adult pigs. Mortality among piglets under one month of age is close to 100%, but among pigs between one and six months of age, it is less than 10%. Pregnant sows may resorb their offspring or give birth to mummified, stillborn, or weakened piglets. In cattle, symptoms include severe pruritus, followed by neurological signs and death. In dogs, symptoms include severe itching, paralysis of the jaw and pharynx, howling, and death. Any infected secondary host typically survives only two to three days.Itching is considered a phantom sensation because the virus is never detected at the site of the itch.

[0003] Infections are known in important domestic animals such as pigs, cattle, dogs, cats, sheep, rats, and mink. The host range is very broad and includes most mammals and, at least experimentally, many bird species (for a detailed list of hosts, see D. P. Gustafson, "Pseudorabies," in Diseases of Swine, 5th ed., A. D. Leman et al., eds., (1981)). However, adult pigs and possibly rats do not die from the disease and therefore act as vectors. However, the disease is fatal to other species.

[0004] Swine populations are particularly susceptible to PRV. Although adult pigs rarely show symptoms or die from the disease, infected piglets become acutely ill, and death typically occurs within 24–48 hours, often without specific clinical signs (T. C. Jones and R. D. Hunt, Veterinary Pathology, 5th ed., Lea & Febiger (1983)).

[0005] PRV is a herpesvirus. The PRV genome is characterized by two unique regions (UL and US), with the US region flanked by internal and terminal repeat sequences (IRS and TRS, respectively). The sequence and gene arrangement of the entire PRV genome are known, and a map of the probable transcript organization has been constructed, well supported by experimental data. Recombination between inverted repeats can lead to the formation of two possible genomic isomers in which the US region has opposite orientations. The functions of 70 different genes have been determined. For a discussion of the general biology of PRV and its mechanism of action, see Pomeranz et al., Microbiol. AndMol. Biol. Reviews 205, Sept., 462–500.

[0006] PRV vaccines are produced using various methods, and vaccination has been practiced in endemic areas of Europe for over 15 years. While vaccination has reduced losses, it has also maintained the virus in the environment. Vaccinated animals exposed to a virulent virus can survive the infection and then shed an even more virulent virus. Thus, vaccinated animals may carry a latent infection that can relapse. (See DP Gustafson's publication, above.)

[0007] Live attenuated and inactivated PRV vaccines are commercially available in the United States and have been approved by the U.S. Department of Agriculture (see C.E. Aronson, ed., Veterinary Pharmaceuticals & Biologicals, (1983)).

[0008] Live attenuated and inactivated PRV vaccines are commercially available in the United States and have been approved by the U.S. Department of Agriculture (see C.E. Aronson, ed., Veterinary Pharmaceuticals & Biologicals, (1983)). However, there remains a need for new PRV vaccines, particularly live attenuated vaccines, that are both safe and effective. SUMMARY OF THE INVENTION

[0009] This application provides a method for protecting a pig from one or more symptoms of a PRV infection caused by an infectious PRV, wherein said method comprises administering to the pig a vaccine comprising a modified live pseudorabies virus comprising the genome of SEQ ID NO: 3 or a nucleic acid sequence that is at least 95% identical thereto, wherein said modified live pseudorabies virus comprises a deletion of nucleotides 480-846 of the UL23 gene, and said infectious PRV is of genotype I or genotype II.

[0010] In certain embodiments, the genome of the modified live pseudorabies virus comprises deletions of the gE gene and the gI gene. In certain embodiments, the US1, US2, and US9 genes are not modified in the genome of said modified live PRV. In the most preferred embodiments, the genome of said modified live PRV has SEQ ID NO: 3.

[0011] In certain embodiments, one dose of said vaccine comprises 10 2 -10 7 TCID 50 Preferably, the vaccine is administered intramuscularly. In some embodiments, the symptoms of PRV infection protected against by the vaccine may be selected from a group including viral shedding, coughing, sneezing, fever, constipation, depression, seizures, ataxia, circling, and excessive salivation.

[0012] In preferred embodiments, at least 80%, or at least 90%, or at least 95%, or 100% of the pigs are protected from symptoms of PRV infection when exposed to said infectious PRV for six months after vaccination with the modified live pseudorabies vaccine described herein.

[0013] In certain embodiments, the vaccinated pig is a piglet that may be at least three weeks old, at least 7 weeks old, or older.

[0014] In other embodiments, the vaccinated pig is a sow. In certain embodiments, the sow is pregnant. In more specific embodiments, the sow is 2-3 months pregnant. In the most preferred embodiments, administration of the live pseudorabies virus vaccine described herein to pregnant sows does not affect the farrowing rate, abortion rate, or survival of the offspring of the pregnant sow. DETAILED DESCRIPTION OF THE INVENTION

[0015] The following definitions and introductory provisions apply in this description

[0016] Terms in the singular include the plural unless the context otherwise indicates. Similarly, the word "or" is intended to include "and" unless the context otherwise indicates. The word "or" means any one element of a specified list and also includes any combination of elements of that list.

[0017] The term "adjuvant" refers to a compound that enhances the effectiveness of a vaccine and can be added to a formulation including an immunizing agent. Adjuvants provide an enhanced immune response even after administration of a single dose of a vaccine. Adjuvants can include, for example, muramyl dipeptides, pyridine, aluminum hydroxide, dimethyldioctadecyl ammonium bromide (DDA), oils, oil-in-water emulsions, saponins, cytokines, and other substances known in the art. Examples of suitable adjuvants are described in U.S. Patent Application Publication No. US 2004 / 0213817 A1. "Adjuvant" refers to a composition that includes or is combined with an adjuvant.

[0018] "Antibodies" refers to polyclonal and monoclonal antibodies, chimeric and single-chain antibodies, and Fab fragments, including products of Fab or other immunoglobulin expression libraries. For antibodies, the term "immunologically specific" refers to antibodies that bind to one or more epitopes of the protein of interest but do not recognize or bind other molecules in a sample containing a mixed population of antigenic biological molecules.

[0019] For the purposes of this document, "attenuated PRV" means a PRV that is capable of infecting and / or replicating in a susceptible host but is nonpathogenic or less pathogenic to the susceptible host. For example, an attenuated virus may not cause observable / detectable clinical manifestations, may cause fewer or less severe clinical manifestations, or may exhibit reduced viral replication efficiency and / or infectivity compared to related field-isolated strains. Clinical manifestations of PRV infection may include, but are not limited to, coughing, sneezing, fever, constipation, depression, seizures, ataxia, circling, and excessive salivation in piglets and adult pigs.

[0020] An "epitope" is an antigenic determinant that is immunologically active in the sense that, upon introduction into the host organism, it can elicit a humoral (B cell) and / or cellular (T cell) immune response. These are specific chemical groups or peptide sequences on a molecule that are antigens. An antibody specifically binds to a specific antigenic epitope on a polypeptide. In an animal organism, most antigens present several or even many antigenic determinants simultaneously. Such a polypeptide can also be classified as an immunogenic polypeptide, and the epitope can be identified as described below.

[0021] For the purposes of the present invention, a nucleotide sequence of a second polynucleotide molecule (RNA or DNA) is "identical" to a nucleotide sequence of a first polynucleotide molecule if the nucleotide sequence of the second polynucleotide molecule encodes the same polyamino acid as the nucleotide sequence of the first polynucleotide molecule, based on the degeneracy of the genetic code, or if it encodes a polyamino acid that is sufficiently similar to the polyamino acid encoded by the nucleotide sequence of the first polynucleotide molecule. Typically, a nucleotide sequence of a second polynucleotide molecule is identical to a nucleotide sequence of a first polynucleotide molecule if it has at least about 85% nucleotide sequence identity with the first polynucleotide molecule according to the BLASTN algorithm (National Center for Biotechnology Information, otherwise known as NCBI, (Bethesda, Md., USA) National Institutes of Health (National Institutes of Health, USA). In a specific example of calculations in accordance with the practice of the present invention, BLASTP 2.2.6 is used [Tatusova TA and TL Madden, "BLAST 2 sequences--a new tool for comparing protein and nucleotide sequences." (1999) FEMS Microbiol Lett. 174:247-250.]. Briefly, two amino acid sequences are aligned to optimize alignment scores using a gap opening penalty of 10, a gap extension penalty of 0.1, and the "blosum62" scoring matrix of Henikoff and Henikoff (Proc. Nat. Acad. Sci. USA 325 89:10915-10919. 1992). Percent identity is calculated as follows: Total number of identical matches X 100 / divided by the length of the longer sequence + the number of gaps introduced into the longer sequence to align the two sequences.

[0022] The term "isolated" is used to indicate that a cell, peptide, or nucleic acid is separated from its natural environment. Isolated peptides and nucleic acids can be essentially pure, i.e., essentially free of other substances with which they may be found in nature.

[0023] The phrase "absent functional proteins" means that the amount and / or activity of the protein encoded by the modified gene is reduced by at least 95% compared to the protein encoded by the unmodified gene. In certain aspects, the amount and / or activity of the protein encoded by the modified gene is reduced by at least 96%, or at least 97%, or at least 98%, or at least 99%, or at least 99.5%, or at least 99.9%. In certain aspects, the amount and / or activity of the protein encoded by the modified gene is completely eliminated.

[0024] "Pharmaceutically acceptable carrier" means any conventional pharmaceutically acceptable carrier, excipient, or excipient used in the art for the manufacture and administration of vaccines. Pharmaceutically acceptable carriers are typically non-toxic, inert, solid or liquid.

[0025] The terms "pig" and "swine" are used interchangeably in this document and refer to any animal that is a member of the family Suidae, such as a pig.

[0026] For the purposes of this document, the term "susceptible" host refers to a cell or animal that can be infected with PEDV. When administered to a susceptible animal, attenuated PEDV can also induce an immunological response against PEDV or its antigen, thereby conferring immunity to PEDV infection.

[0027] The term "vaccine" refers to an antigen preparation used to induce immunity to a disease in order to prevent or mitigate the effects of infection. Vaccines are typically prepared using a combination of an immunologically effective amount of an immunogen and an adjuvant effective in enhancing the vaccinated subject's immune response to the immunogen.

[0028] Vaccine formulations will contain a "therapeutically effective amount" of the active ingredient, i.e., an amount capable of eliciting an immunoprotective response in a subject to whom the composition is administered. For example, in the treatment and prevention of PEDV disease, a "therapeutically effective amount" will preferably be an amount that increases the vaccinated subject's resistance to new infection and / or reduces the clinical severity of the disease. Such protection will be demonstrated by either a reduction or absence of symptoms typically exhibited by a subject infected with PRV, a more rapid onset of recovery, and / or a reduction in the number of viral particles. Vaccines can be administered prior to infection as a prophylactic measure against human papillomavirus. Alternatively, vaccines can be administered after the subject has already recovered from the disease.Vaccines given after PRV exposure may attenuate the disease by inducing a stronger immune response than the natural infection itself.

[0029] The present invention provides an attenuated PRV strain that is safe and effective when used in a vaccine and protects pigs from infection with a virulent PRV strain. In certain aspects, the attenuated PRV strain contains modifications of the thymidine kinase (TK), glycoprotein I (gI), and glycoprotein E (gE) genes compared to the parental field strain.

[0030] Suitable parental strains include, but are not limited to, FS18 (SEQ ID NO: 1); strain JS2012 (SEQ ID NO: 2); strain TJ (GenBank accession number KJ789182); strain HeN1 (GenBank accession number KP098534); strain HLJ8 (GenBank accession number KT824771); strain HN1201 (GenBank accession number KP722022). Other suitable strains are strains that are encoded by a nucleotide sequence that is at least 85% identical (i.e.,at least 86% identical, at least 87% identical, at least 88% identical, at least 89% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, at least 99.2% identical, at least 99.4% identical, at least 99.6% identical, at least 99.8% identical, at least 99.9% identical) to full-length SEQ ID: NO: 1 or SEQ ID NO: 2.

[0031] In certain aspects, the parent strain is at least 85% identical to SEQ ID NO: 1 or 2, as set forth in the preceding paragraph, and at least half (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of the different bases form codons encoding similar amino acids, i.e., conservative amino acid substitutions are made.It is generally recognized that certain such conservative amino acid substitutions do not inactivate the overall function of the protein: for example, with respect to the positively charged amino acids (and vice versa), lysine, arginine, and histidine; with respect to the negatively charged amino acids (and vice versa), aspartic acid and glutamic acid; and with respect to certain groups of neutrally charged amino acids (and in all cases vice versa), (1) alanine and serine, (2) asparagine, glutamine, and histidine, (3) cysteine ​​and serine, (4) glycine and proline, (5) isoleucine, leucine, and valine, (6) methionine, leucine, and isoleucine, (7) phenylalanine, methionine, leucine, and tyrosine, (8) serine and threonine, (9) tryptophan and tyrosine, (10) and, for example, tyrosine, tryptophan, and phenylalanine. Amino acids can be classified based on their physical properties and their contribution to the secondary and tertiary structure of proteins.Thus, a conservative substitution is recognized in the art as the replacement of one amino acid with another amino acid having similar properties, and examples of conservative substitutions can be found in WO 97 / 09433, page 10, published March 13, 1997 (PCT / GB96 / 02197, filed September 6, 1996). Alternatively, conservative amino acids can be grouped as described in Lehninger (Biochemistry, Second Edition; Worth Publishers, Inc. NY:NY (1975), pp. 71-77). Protein sequences can be aligned using Vector NTI Advance 11.5 and CLUSTAL 2.1 multiple sequence alignment. As used herein, a reference to a particular amino acid or nucleotide sequence shall include all silent mutations for the nucleic acid sequence and any and all conservatively modified variants for amino acid sequences.

[0032] The sequences and functions of the gI, gE, and TK proteins of the pseudorabies virus are known. Thymidine kinase is encoded by the UL23 gene and is involved in nucleotide synthesis. Glycoproteins I and E are virion proteins encoded by the US7 and US8 genes, respectively. Pomeranz et al. found that gI and gE are present in a complex with each other. For the purposes of this description, the UL23, US7, and US8 genes may be referred to as the "TK gene," "gI gene," and "gE gene," respectively.

[0033] In certain embodiments, the attenuated PRV strain further comprises modifications of one or more (i.e., one, two, or all three) of the US1, US2, and US9 genes. These genes encode the RSp40 / ICP22, PK, and 28K proteins, respectively. In certain embodiments, at least one of the US2 and US9 genes is unmodified. For example, the virus may comprise unmodified US2, modified US9, and modified or unmodified US1. Alternatively, the virus may comprise unmodified US9, modified US2, and modified or unmodified US1.

[0034] In certain embodiments, in the attenuated PRV strain of the present invention, the US1, US2 and US9 genes are not modified.

[0035] Pomeranz et al. found that US1 encodes the RSp40 / ICP22 protein. This protein's function in PRV is currently unknown, but Pomeranz reports that its homologue in HSV-1 acts as a regulator of gene expression. US2 encodes a protein present in the viral envelope. US9 encodes an envelope protein that is involved in protein sorting in axons and functions as a type II membrane protein with a tail attachment.

[0036] Modifications in the genes encoding the TK, gI, and gE proteins, as well as optional modifications in the US 1, US2, and US9 genes, result in a virus that lacks the functional proteins expressed by these genes.

[0037] For example, in certain aspects, the virus of the present invention lacking a functional gE protein can be produced in various ways. For example, a stop codon can be introduced into the proximal portion of the ORF encoding the gE protein. In various embodiments, the stop codon can be introduced after the N-terminus of 10 amino acids or less, for example, 9, 8, 7, 6, 5, 4, 3, or 2 N-terminal amino acids. In other embodiments, the transcription start site can be altered such that transcription does not begin. In other embodiments, all nucleotides in the ORF encoding the gE protein are deleted.

[0038] The virus of the present invention also lacks a functional gI protein. In certain embodiments, at least nucleotides 269-1101 are deleted from the ORF encoding the gI protein and consisting of 1101 nucleotides. In certain embodiments, the deletion begins upstream of nucleotide 269, for example, at nucleotides 250, 200, 150, 100, 50, or even higher. In certain embodiments, all 1101 nucleotides are deleted. In certain embodiments, a stop codon is introduced at or upstream of position 269, without introducing a frameshift mutation.

[0039] The virus of the present invention also has a modified US23 gene, which encodes a TK protein. The UL23 gene has an ORF that is 963 nucleotides long. In certain aspects, this 963-nucleotide ORF lacks at least one (or at least two, or at least three, or all four) subsequence(s) selected from the sequences defined by nucleotides 526-607, 480-846, 280-723, and 364-615 of this 963-nucleotide ORF. Of course, longer deletions may also be present, for example, a deletion defined by positions 280-846, which will include all four subsequences, or a deletion defined by positions 300-650, which will contain two subsequences, and so on. Alternatively, all 963 nucleotides of the ORF may be deleted.Alternatively, a stop codon can be introduced (without causing a frameshift) at position before 526, or before position 364, or before position 480, or before position 280, and so on. In certain aspects, mutation of the transcription start site is also possible.

[0040] Optional modifications of any of the US1, US2, and US9 genes preferably result in the resulting virus lacking the protein encoded by the modified gene. Suitable mutations include deletions, insertions, substitutions, etc. of genes. As described above, frameshift mutations can result in proteins that have minimal similarity to proteins encoded by unmodified genes. In-frame mutations can include the introduction of stop codons in the proximal portion of the gene (e.g., within the N-terminus of 20, 15, 10, 5, or 3 amino acids) or mutation of the transcription start site such that the corresponding ORF is not transcribed.

[0041] In certain aspects, an attenuated virus of the present invention has a genome that is at least 85% identical to SEQ ID NO: 1 or 2 and has the following modifications: a) at least 90% (at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) of an ORF encoding the gI protein; b) at least 90% (at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) of an ORF encoding the gI protein; encoding the gE protein;c) the ORF encoding the TK protein lacks at least one (i.e., at least two, at least three, or all four) of the subsequences defined by nucleotides at positions 526-607, 480-846, 280-723, and 364-615 of this 963-nucleotide-long ORF.

[0042] In certain other aspects, the modified live virus is encoded by SEQ ID NO: 3 or a sequence that is at least 85% identical thereto, with the proviso that the sequence encoding the virus comprises modifications of the UL23 gene (encoding TK), the US7 gene (encoding gI), the US8 gene (encoding gE). Some modified live viruses according to this aspect of the invention may comprise unmodified US1, US2, and US9 genes. Some other modified live viruses according to this aspect of the invention further comprise optional modifications of the US1, US2, and US9 genes, as described above, for example, modified US2, unmodified US9, and modified or unmodified US1, or modified US9, unmodified US2, and modified or unmodified US1. In another aspect, all three of these genes (US1, US2, US9) are modified.

[0043] Methods for modifying genes so that the resulting virus lacks the functional proteins encoded by these genes are well known. These methods include, but are not limited to, complete or partial deletions, frameshift mutations, nucleotide substitutions, or insertions. For example, the promoter regulating the gene's function or the transcription start site can be altered. Alternatively (or additionally), a mutation resulting in a premature stop codon can be inserted into the coding sequence. Other suitable methods are within the skill of the art.

[0044] The modifications described above can be introduced into the viral genome by various methods, including, but not limited to, site-directed mutagenesis and homologous recombination.

[0045] The first step of this technique involves the creation of a recombinant DNA molecule for recombination with the PrV genomic DNA. Such a recombinant DNA molecule can be obtained from any suitable plasmid, cosmid, or phage, with plasmids being most preferred, and may contain a PrV DNA fragment containing DNA from that portion of the PrV genome as defined above. The DNA sequence of the portion of the PrV genome, as defined above, is preferably flanked by PrV nucleic acid sequences, which should be of an appropriate length, for example, 50-3000 bp, to allow for homologous recombination in vivo with the PrV viral genome.

[0046] The recombinant DNA molecule obtained in this way is suitable for introducing a mutation into the PrV genome.

[0047] Cells, such as porcine kidney cells or Vero cells, can then be transfected with PrV DNA or infected with wild-type PrV in the presence of the recombinant DNA molecule as described above, resulting in recombination between sequences in the recombinant DNA molecule and corresponding sequences in the PrV genome.

[0048] Recombination can also be induced by cotransfecting cells with a nucleic acid sequence containing the mutational sequence flanked by the corresponding PrV flanking sequences without the plasmid sequences. The recombinant viral progeny is then grown in cell culture and can be selected, for example, genotypically or phenotypically. Another possibility is to detect the absence of the polypeptide encoded by the nucleic acid sequence in which the mutation is located. The presence of the polypeptide encoded by the inserted heterologous nucleic acid sequence can be determined in the same way. Recombinant viruses can also be selected for resistance to compounds such as neomycin, gentamicin, or mycophenolic acid.

[0049] The selected recombinant PrV can be cultured on a large scale in cell culture, after which the recombinant PrV containing the material or heterologous polypeptides expressed by the said PrV can be collected.

[0050] As an alternative or additional option to recombinant DNA techniques, cell culture in combination with clonal enrichment and clonal selection can be used to produce the virus of the present invention. For example, clones with deletions in one of the genes, such as gI or gE, can be selected for further propagation, and it is known that mutants with deletions of the natural TK gene can result in defects in viral replication.

[0051] Suitable cell lines include, but are not limited to, the ST porcine testicular cell line, the PK-15 or MRS-2 porcine kidney cell line, the RK rabbit kidney cell line, the Vero African green monkey cell line, the Marc-145 monkey embryonic kidney epithelial cell line, the MDBK bovine kidney cell line, the BT bovine testicular cell line, chick embryo fibroblasts (CEF), and the BHK-21 baby hamster kidney cell line. In a preferred embodiment, the suitable cell line is Vero (ATCC CCL-81).

[0052] An immunologically effective amount of the vaccines of the present invention is administered to a pig in need of protection against a viral infection. The immunologically effective amount or immunogenic amount inoculated into the pig can be easily determined or titrated using routine testing. An effective amount is one that achieves a sufficient immunological response to the vaccine to protect the pig exposed to the PRV virus. Preferably, the pig is protected to such an extent that one or more adverse physiological symptoms or effects of the viral disease are significantly reduced, attenuated, or completely prevented.

[0053] The vaccines of the present invention can be formulated according to generally accepted rules and include animal-acceptable carriers, such as standard buffers, stabilizers, diluents, preservatives and / or solubilizers, and can also be formulated to facilitate sustained release. Diluents include water, physiological saline, dextrose, ethanol, glycerol, and the like. Additives for imparting isotonicity include, among others, sodium chloride, dextrose, mannitol, sorbitol, and lactose. Stabilizers include, among others, albumin. Other suitable carriers and additives for vaccines, including those that are particularly useful in the creation of modified live vaccines, are known or will be obvious to those skilled in the art. See, for example, Remington's Pharmaceutical Science, 18th ed., 1990, Mack Publishing, which is incorporated herein by reference.

[0054] The vaccines of the present invention may be unadjuvanted. Alternatively, the vaccines of the present invention may also include one or more additional immunomodulatory components, such as, for example, an adjuvant or a cytokine, among others. Non-limiting examples of adjuvants that can be used in the vaccine of the present invention include the RIBI adjuvant system (Ribi Inc., Hamilton, Montana), alum, mineral gels such as aluminum hydroxide gel, oil-in-water emulsions, water-in-oil emulsions such as, for example, complete and incomplete Freund's adjuvants, block copolymer (CytRx, Atlanta, Ga.), QS-21 (Cambridge Biotech Inc., Cambridge, Mass.), SAF-M (Chiron, Emeryville, Calif.), AMPHIGEN adjuvant ®, saponin, Quil A or another saponin fraction, monophosphoryl lipid A, ionic polysaccharides and the lipid-amine adjuvant avridine. Non-limiting examples of oil-in-water emulsions suitable for use in the vaccine of the present invention include modified formulations of SEAM62 and SEAM 1 / 2. Modified SEAM62 is an oil-in-water emulsion containing 5% (v / v) squalene (Sigma), 1% (v / v) SPAN detergent ® 85 (ICI Surfactants), 0.7% (v / v) TWEEN* 80 (ICI Surfactants) detergent, 2.5% (v / v) ethanol, 200 μg / ml Quil A, 100 μg / ml cholesterol, and 0.5% (v / v) lecithin. Modified SEAM 1 / 2 is an oil-in-water emulsion containing 5% (v / v) squalene, 1% (v / v) SPAN detergent ®85, 0.7% (v / v) Tween 80 detergent, 2.5% (v / v) ethanol, 100 μg / ml Quil A and 50 μg / ml cholesterol. Other immunomodulatory agents that may be included in the vaccine include, for example, one or more of the following known cytokines: interleukins, interferons or others.

[0055] Additional adjuvant systems allow for the combination of T-helper and B-cell epitopes, resulting in the formation of one or more types of covalent structures linked to T-B epitopes that can be further lipidated, such as those described in WO 2006 / 084319, WO 2004 / 014957 and WO 2004 / 014956.

[0056] In a preferred embodiment, the PEDV ORFI protein, or other PEDV proteins, or fragments thereof, are formulated with 5% AMPHIGEN ® , as described below. Adjuvant components

[0057] The vaccine compositions of the present invention may or may not include adjuvants. In particular, since the modified live vaccines of the present invention are based on an orally infective virus, they can be used without adjuvants, with a sterile carrier. Adjuvants that can be used for oral administration include those based on CT-type immunomodulators (rmLT, CT-B, i.e., recombinant mutant heat-labile toxin of E. coli, subunit B of cholera toxin); or by encapsulation with polymers and alginates, or with mucoadhesives such as chitosan, or by liposomes. A preferred dose of an adjuvanted or unadjuvanted vaccine at the minimum protective dose when releasing the vaccine can provide from about 10 to about 10 6 log 10 TCID 50 virus per dose or higher. "TCID 50" stands for "tissue culture infective dose" and is defined as the virus dilution required to infect 50% of a given batch of inoculated cell cultures. To calculate TCID 50 Various methods can be used, including the Spearman-Karber method, which is used here. For a description of the Spearman-Karber method, see B. W. Mahy & H. O. Kangro, Virology Methods Manual, pp. 25–46 (1996). Adjuvants, if present, can be presented as emulsions, most commonly if non-oral administration is chosen, but they should not reduce the initial titer by more than 0.7 logs (80% reduction).

[0058] In one example, the adjuvant components are a combination of lecithin in light mineral oil, as well as an aluminum hydroxide component. Detailed information on the composition and composition of AMPHIGEN is provided below. ® (as a representative component of lecithin / mineral oil).

[0059] The preferred adjuvant may be provided as a 2 ml dose in a buffered solution additionally containing about 5% (v / v) REHYDRAGEL ® (aluminum hydroxide gel) and 20% AMPHIGEN* at a final concentration of approximately 25% (v / v) AMPHIGEN ® is generally described in U.S. Patent No. 5,084,269 and is defatted lecithin (preferably soybean) dissolved in a light oil, which is then dispersed in an aqueous solution or suspension of antigen as an oil-in-water emulsion. Amphigene was improved in accordance with the protocols of U.S. Patent No. 6,814,971 (see columns 8-9) to produce so-called "20% Amphigene" for use in the final adjuvanted vaccine compositions of the present invention. Thus, an initial mixture of 10% lecithin and 90% carrier oil (DRAKEOL ® , Penreco, Karnes City, PA) was diluted 1:4 with 0.63% phosphate-buffered saline, thus reducing the lecithin and DRAKEOL content ®up to 2% and 18%, respectively (i.e., up to 20% of their initial concentrations). Surfactants Tween 80 and Span 80 were added to the composition, with representative and preferred final amounts being 5.6% (v / v) TWEEN ® 80 and 2.4% (v / v) SPAN ® 80. while SPAN ® originally contained in the original component DRAKEOL ® , and TWEEN ® is initially contained in a buffered saline component, so that mixing the saline component and DRAKEOL ® results in the final desired concentrations of surfactants. Mixing DRAKEOL ® / lecithin and physiological saline solution can be accomplished using the In-Line Slim Emulsifier, model 405, Charles Ross and Son, Hauppauge, NY, USA.

[0060] The vaccine also contains REHYDRAGEL ®LV (aluminum hydroxide content of the starting material is approximately 2%) as an additional adjuvant component (available from Reheis, NJ, USA, and ChemTrade Logistics, USA). When further diluted using 0.63% PBS, the final vaccine formulation contains the following amounts of components per 2 ml dose: 5% (v / v) REHYDRAGEL ® LV; 25% (v / v) "20% Amphigen", i.e. it is additionally diluted 4 times); and 0.01% ((w / v) thimerosal.

[0061] As is known in the art, the order of addition of components can be varied to ensure an equivalent final vaccine composition. For example, an appropriate dilution of the virus in buffer can be prepared. The appropriate amount of REHYDRAGEL stock solution can then be added. ® LV (aluminium hydroxide content approx. 2%), stirring to ensure the desired concentration of REHYDRAGEL ®LV 5% (v / v) in the final product. After preparation, this intermediate starting material is mixed with the appropriate amount of "20% Amphigen" starting material (as generally described above, and already containing the required amounts of Tween 80 and Span 80) to obtain a final product containing 25% (v / v) "20% Amphigen." Finally, the appropriate amount of 10% thimerosal can be added.

[0062] The vaccine compositions of the present invention allow for variations in all ingredients so that the total antigen dose may vary preferably by 100 times (up or down) compared to the antigen dose specified above, and most preferably by 10 times or less (up or down). Similarly, the concentrations of surfactants (whether TWEEN ® or SPAN ®) can be changed by a factor of 10, independently of each other, or can be completely removed, with replacement by appropriate concentrations of similar materials, as is well known in the art.

[0063] REHYDRAGEL Concentrations ® in the final product may vary, firstly, due to the use of equivalent materials available from many other manufacturers (for example, ALHYDROGEL ® , Brenntag; Denmark), or by using additional variations in the REHYDRAGEL product line ® , such as CG, HPA, or HS. Using LV as an example, its final usable concentrations range from 0% to 20%, with 2-12% being more preferred and 4-8% being the most preferred. Similarly, although the final concentration of AMPHIGEN ®(expressed as % of "20% amphigen") is preferably 25%, this amount can vary from 5 to 50%, preferably 20-30% and most preferably is about 24-26%.

[0064] According to the practice of the present invention, the oil used in the adjuvant compositions of the present invention is preferably mineral oil. As used herein, the term "mineral oil" refers to a mixture of liquid hydrocarbons obtained from petrolatum by distillation. This term is synonymous with the terms "liquid paraffin," "liquid petrolatum," and "white mineral oil." This term also includes "light mineral oil," i.e., an oil that is obtained in a similar manner by distillation of petrolatum, but which has a slightly lower specific gravity than white mineral oil. See, for example, Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pa.: Mack Publishing Company, 1990, pp. 788 and 1323). Mineral oil can be obtained from various commercial sources, for example, J. T. Baker (Phillipsburg, Pa.), USB Corporation (Cleveland, Ohio).The preferred mineral oil is light mineral oil, commercially available under the name DRAKEOL. ® .

[0065] The immunogenic and vaccine compositions of the present invention may further comprise pharmaceutically acceptable carriers, excipients and / or stabilizers (see, for example, Remington: The Science and Practice of Pharmacy, 2005, Lippincott Williams), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients or stabilizers are non-toxic to recipients at the dosages and concentrations employed and may include buffers such as phosphate, citrate and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as mercuric ((o-carboxyphenyl)thio)ethyl sodium salt (THIOMERSAL ®), octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol and m-cresol); proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates including glucose, mannose or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes) and / or non-ionic surfactants such as polyethylene glycol (PEG), TWEEN ® or PLURONICS ® .

[0066] The vaccines of the present invention can be formulated for sustained release of the virus, infectious DNA molecule, plasmid, or viral vector of the present invention. Examples of such sustained release formulations include the virus, infectious DNA molecule, plasmid, or viral vector in combination with composites of biocompatible polymers such as, for example, poly(lactic acid), poly(lactic-co-glycolic acid), methylcellulose, hyaluronic acid, collagen, and the like. The structure, selection, and use of degradable polymers in drug delivery vehicles have been discussed in several publications, including A. Domb et al, 1992, Polymers for Advanced Technologies 3: 279-292, which is incorporated herein by reference. Additional guidance on the selection and use of polymers in pharmaceutical formulations can be found in sources known in the art, for example, M. Chasin and R.Langer (eds), 1990, "Biodegradable Polymers as Drug Delivery Systems" in Drugs and the Pharmaceutical Sciences, Vol. 45, M. Dekker, NY, which is also incorporated herein by reference. Alternatively or additionally, the virus, plasmid, or viral vector can be microencapsulated to improve administration and efficacy. Methods for microencapsulating antigens are well known in the art and include those described, for example, in U.S. Patent No. 3,137,631; U.S. Patent No. 3,959,457; U.S. Patent No. 4,205,060; U.S. Patent No. 4,606,940; U.S. Patent No. 4,744,933; U.S. Patent No. 5,132,117; and International Patent Publication WO 95 / 28227, all of which are incorporated herein by reference.

[0067] Liposomes can also be used to provide sustained release of a virus, plasmid, viral protein, or viral vector. Detailed information on how to create and use liposomal formulations can be found in, among other things, U.S. Patent No. 4,016,100; U.S. Patent No. 4,452,747; U.S. Patent No. 4,921,706; U.S. Patent No. 4,927,637; U.S. Patent No. 4,944,948; U.S. Patent No. 5,008,050; and U.S. Patent No. 5,009,956, all of which are incorporated herein by reference.

[0068] The effective amount of any of the vaccines described above can be determined in the usual manner, starting with a low dose of the virus, viral protein plasmid, or viral vector and then increasing the dose while observing the effects. The effective amount can be obtained after a single administration of the vaccine or after multiple administrations. Known factors can be considered when determining the optimal dose for an individual animal. These include the species, size, age, and general condition of the animal, the animal's use of other medications, and so on. The actual dosage should preferably be determined after considering the results of other animal studies.

[0069] One method for determining whether an adequate immune response has been achieved is by determining seroconversion and antibody titers in an animal after vaccination. The timing of vaccination and the number of booster doses (if any) are preferably determined by a physician or veterinarian based on an analysis of all relevant factors, some of which are described above.

[0070] In a preferred example of the present invention for vaccinating pigs, the optimal target age for animals is 1 to 21 days, which in the pre-weaning period may also correspond to other routine vaccinations such as against Mycoplasma Hyopneumoniae or porcine reproductive and respiratory syndrome virus. In addition, the preferred vaccination schedule for breeding sows should include similar doses with an annual revaccination schedule. Dosage

[0071] In a particularly preferred embodiment, a method is described for protecting a pig from one or more symptoms of a PRV infection caused by an infectious PRV, wherein said method comprises administering to the pig a vaccine comprising a modified live pseudorabies virus comprising the genome of SEQ ID NO: 3 or a nucleic acid sequence that is at least 95% identical thereto, wherein said modified live pseudorabies virus comprises a deletion of nucleotides 480-846 of the UL23 gene, and said infectious PRV is of genotype I or genotype II.

[0072] The actual dose volume depends on the vaccine composition and ranges from 0.05 to 5 ml, taking into account the size of the animals. A single dose vaccination is also advisable. The amount of pseudorabies virus in the vaccine ranges from 10 2 TCID 50 up to 10 8 TCID 50 per dose, preferably from 10 2 up to 10 7 TCID 50per dose, or more preferably from 10 3,5 up to 10 5,5 TCID 50 per dose. The route of administration may vary, but intramuscular administration of the vaccine is preferred.

[0073] In various embodiments of the invention, said one or more symptoms are selected from the group consisting of viral shedding, coughing, sneezing, fever, constipation, depression, seizures, ataxia, dizziness, and excessive salivation.

[0074] The modified live pseudorabies virus can provide cross-protection against a wide range of infectious PRV strains, such as PRV strain FS21PF1115, PRV strain AV25 or PRV strain Rong A.

[0075] The preferred clinical indication is treatment, control, and prevention in both breeding sows and gilts prior to farrowing, followed by vaccination of piglets. In a representative example (applicable to both sows and gilts), a single dose of vaccine is used, although, of course, two-dose vaccination schedules can also be used if necessary. In certain embodiments, at least 80% of pigs are protected from PRV symptoms when exposed to said infectious PRV for six months after vaccination with said vaccine containing said modified live pseudorabies virus.

[0076] It should be noted that piglets can be vaccinated from the first day of life. For example, piglets can be vaccinated on Day 1 with or without a booster dose at 3 weeks of age, especially if the parent sow, although vaccinated before breeding, was not vaccinated before farrowing. Piglet vaccination can also be effective if the parent sow has not previously been infected, either naturally or through a controlled infection. Vaccination of piglets whose mother has not previously been exposed to the virus, as well as vaccination before farrowing, can also be effective.

[0077] In other embodiments, the pig is a piglet between three weeks and about seven weeks of age, such as a three-week-old piglet, a four-week-old piglet, a five-week-old piglet, a six-week-old piglet, or a seven-week-old piglet. In older piglets, such as seven-week-old piglets, the vaccine provides 100% protection.

[0078] In other embodiments, the pig is a sow, preferably a pregnant sow. Most preferably, the pregnant sow is between 2 and 3 months pregnant. The vaccine described herein, when administered to pregnant sows, does not affect farrowing rate, abortion rate, or offspring survival in said pregnant sows.

[0079] Boars (usually kept for breeding purposes) should be vaccinated once every 6 months. The dose adjustment is consistent with current practice. It should be noted that the vaccines of the present invention are safe for use in pregnant animals (all trimesters) and neonatal pigs. The vaccines of the present invention are attenuated to a safety level (i.e., no mortality, only transient mild clinical signs or signs typical of neonatal pigs) that is acceptable for even the most sensitive animals, including neonatal pigs. Of course, from the perspective of protecting swine herds from both PRV epidemics and persistent low-level PRV infections, sustainable sow vaccination programs are of paramount importance.It should be noted that sows or young breeding pigs (before first parity) immunized with PRV MLV vaccine will passively transfer immunity to piglets, including PRV-specific IgA, which will protect piglets from PRV-associated morbidity and mortality. Furthermore, sows immunized with PRV MLV vaccine generally have reduced and / or prolonged fecal PRV shedding, or are protected from it. Sows immunized with PRV MLV vaccine are also protected from clinical signs of PRV, including, but not limited to, mortality, reproductive, neurological, and respiratory manifestations of PRV. PRV MLV also helps stop or control the PEDV transmission cycle.

[0080] It should also be noted that animals vaccinated with the vaccines of the present invention are also immediately safe for human consumption, without any significant delay before slaughter, such as within 21 days or less.

[0081] In therapeutic use, the vaccine is administered in an effective amount immediately after the signs of an actual infection are detected. The composition is considered "pharmacologically acceptable" if its administration is tolerated by the recipient. Such a composition is said to be administered in a "therapeutically or prophylactically effective amount" if the administered amount is physiologically significant.

[0082] At least one vaccine or immunogenic composition of the present invention can be administered by any means that achieve the intended purpose using the pharmaceutical composition described herein. For example, the route of administration of such a composition can be parenteral, oral, oronasal, intranasal, intratracheal, topical, subcutaneous, intramuscular, transdermal, intradermal, intraperitoneal, intraocular and intravenous. In one embodiment, the composition is administered intramuscularly.Parenteral administration can be by bolus injection or by gradual perfusion over time. Any suitable device can be used to administer the compositions, including syringes, droppers, needleless injection devices, patches, and the like. The route and device chosen will depend on the composition of the adjuvant, antigen, and host, and this is well known to those skilled in the art. Oral or subcutaneous administration is preferred. Oral administration can be direct, with water or feed (solid or liquid). When administered in liquid form, the vaccine can be lyophilized and reconstituted, or provided as a paste for direct addition to feed (mixing or topping), or otherwise added to water or liquid feed.

[0083] The following examples are intended to illustrate the above invention and should not be construed as narrowing its scope. One skilled in the art will readily appreciate that the examples suggest many other ways of practicing the invention. It should be understood that numerous changes and modifications are possible without departing from the scope of the invention. EXAMPLE 1

[0084] Piglets that tested negative for both PRV antigen and antibodies were divided into groups of 7 piglets per group. Piglets were fed commercial feed and had free access to water.

[0085] Strain M1707 (containing SEQ ID NO: 3, in which nucleotides 480-846 of the UL23 gene encoding TK were deleted) was prepared using MEM, gelatin, NZ-amine, glutamine, sucrose, dextran 40, lactose, sorbitol, and penicillin-streptomycin.

[0086] The second group of pigs was vaccinated with the Bartha K61 strain. The third group was vaccinated with DMEM. Vaccination was administered by intramuscular injection into the neck. The inoculation volume for all treatment groups was 1 ml per piglet. After inoculation, clinical observations were conducted daily, including rectal temperature measurements.

[0087] The data showed that the M1707 strain in the F35 laboratory formulation is safe for piglets aged 3-4 weeks (7 piglets were treated) and also for piglets of the target age of 7 weeks (14 piglets were treated) with an index of >10 6. 5 TCID 50 / treatment of pigs with three different batches of laboratory preparations. All pigs, including control ones, had normal body temperatures and no clinical signs were detected over a 14-day observation period. EXAMPLE 2

[0088] Piglets that tested negative for both PRV antigen and antibodies were divided into groups of 7 piglets per group. Piglets were fed commercial feed and had free access to water.

[0089] Three batches (Batch A, Batch B, and Batch C) of PRV strain M1707 were prepared. The virus composition included MEM, gelatin, NZ amine, glutamine, sucrose, dextran 40, lactose, sorbitol, and penicillin-streptomycin.

[0090] Pigs in groups T01-T03 received the composition of one of the batches in the amount of 10 5 0 TCID 50per dose on day 0, administered intramuscularly. T04 pigs were inoculated with the commercial Bartha K61 vaccine; T05 pigs were inoculated with the commercial C vaccine; and T06 pigs were inoculated with DMEM. After inoculation, the rectal temperature of the pigs was measured daily. Observation of clinical symptoms showed that all pigs had normal body temperature, good appetite, normal mental status, no respiratory and gastrointestinal symptoms, and no neurological signs during the 21-day observation period. The three vaccinated groups and the control group were infected intranasally with the FS21PF1115 strain, 2 ml (10 50 TCID 50 ) on day 21.

[0091] The protective effect was determined by the severity (or absence) of symptoms. The results showed that all pigs in groups T01 / T02 / T03 / T05 were protected, while one pig in group T04 developed the disease. In the control group (T06), 0 of 5 pigs were protected, and all of them developed the disease.

[0092] On day 0, pigs T01-T03 received the composition of one of the batches in the amount of 10 5,0 TCID 50 per dose, which was administered intramuscularly. Pigs T04~T05 were injected with 2 ml per dose intramuscularly. The control group T06 received only DMEM medium. After inoculation, the rectal temperature of the pigs was measured daily. Observation of clinical symptoms showed that all pigs had normal body temperature, good appetite, normal mental state, no respiratory and gastrointestinal symptoms, and no neurological signs during the 21-day observation period. All groups were infected intranasally with the FS21PF1115 strain, 2 ml (10 5,0 TCID 50 ) on day 21.

[0093] The protective effect was determined by the severity (or absence) of symptoms. In the three groups immunized with the M1 707 strain, 15 of 15 pigs were protected. In the group immunized with the Bartha K61 strain, 4 of 5 pigs were protected. In the group immunized with the C strain, 4 of 5 pigs were protected. In the control group, none of the five pigs were protected. EXAMPLE 3

[0094] Piglets that tested negative for both PRV antigen and antibodies were divided into 4 groups of 5 piglets each. The piglets were fed commercial feed and had free access to water.

[0095] PRV strain 1707 was formulated using MEM, gelatin, NZ amine, glutamine, sucrose, dextran 40, lactose, sorbitol, and penicillin-streptomycin. Each vaccinated pig received 10 5,0 TCID 50antigen per dose. The control group received DMEM medium. The formulations were administered by intramuscular injection. The three vaccinated groups and the control group were infected intranasally with the FS21PF1115 strain, 2 ml (10 6.0 TSID 50 ) six months after vaccination.

[0096] Duration of immunity was determined by the severity (or absence) of symptoms. Results showed that in the three vaccination / challenge groups, 15 out of 15 pigs were protected, and no cases of disease were recorded. In the control group, 0 out of 5 pigs were protected, and 5 developed disease. EXAMPLE 4

[0097] Sows (negative for PRV antigen and antibodies) at 2-3 months of pregnancy were divided into 2 groups, 5 sows in each group. The sows were provided with commercial feed and drinking water.

[0098] Sows in Group 1 were inoculated with a mixture prepared from the M1707 strain (including SEQ ID NO: 3, with nucleotides 480-846 of the UL23 gene encoding TK deleted) together with MEM, gelatin, NZ-amine, glutamine, sucrose, dextran 40, lactose, sorbitol, and penicillin-streptomycin. Pigs in Group 2 received DMEM medium. The inoculation method was intramuscular injection into the neck.

[0099] After inoculation, the rectal temperature of the experimental sows was measured and recorded regularly every day, and a series of parameters including appetite, mental state, respiratory status and other specific clinical signs caused by the pseudorabies virus were clinically observed for 14 days. Before the expected date of parturition, it was important to observe the sows for reproductive disorders such as abortion, stillbirth and mummification. When the sows gave birth, the presence of weak, stillborn, mummified piglets and their number were recorded, and the farrowing status and survival rate of piglets were also recorded for two weeks after parturition.

[00100] The results showed that after immunization, all the pigs had normal body temperature, good appetite, normal mental state, no respiratory, gastrointestinal or neurological signs during the 14-day observation period.No abortions were observed.

[00101] On the day of farrowing, the number of litters, healthy litters, weak litters, aborted fetuses, and stillborns was counted, and the percentage of healthy litters was calculated. The average percentage of healthy litters in the immunization group (group T01) was 86.0%. The average health indicator in the control group (group T02) was 91.9%. Statistical analysis of the results showed that there was no significant difference in farrowing rates between immunized and control sows. EXAMPLE 5

[00102] Piglets (negative for PRV antigen and antibodies) were divided into 5 groups of 5 piglets each. The piglets were provided with commercial feed and drinking water. Pigs in groups 1-4 were inoculated with a mixture prepared from the M1707 strain (including SEQ ID NO: 3, and with nucleotides 480-846 of the UL23 gene encoding TK deleted) with MEM, gelatin, NZ-amine, glutamine, sucrose, dextran 40, lactose, sorbitol, and penicillin-streptomycin. Pigs in group 5 received DMEM medium. The inoculation method was intramuscular injection into the neck.

[00103] On day 0, groups T01-T04 received an intramuscular injection of 1 ml at a dose of 10 5.0 TCID 50 , 10 4 . 0 TCID 50 , 10 3 0 TCID 50 and 10 2.0 TCID 50, respectively. The control group T05 was inoculated with DMEM medium only. After inoculation, the rectal temperature of the pigs was measured daily. Clinical observations showed that during the 21-day observation period, all pigs had normal body temperature, good appetite, normal mental state, no respiratory, gastrointestinal, or neurological symptoms. On day 21, 2 ml (containing 10 5.0 TCID 50 ) of the virulent PRV strain FS21PF1115. The results showed that in the T01 / T02 / T03 / T04 groups, more than 4 / 5 pigs were protected. In the control group, 0 out of 5 pigs were protected, and all of them had confirmed disease. EXAMPLE 6

[00104] Piglets (negative for PRV antigen and antibodies) were divided into 2 groups of 5 piglets each. The piglets were provided with commercial feed and drinking water. Pigs in Group 1 were inoculated with a mixture prepared from the M1707 strain (including SEQ ID NO: 3, and with nucleotides 480-846 of the UL23 gene encoding TK deleted) together with MEM, gelatin, NZ-amine, glutamine, sucrose, dextran 40, lactose, sorbitol, and penicillin-streptomycin. Pigs in Group 2 received DMEM medium. The inoculation method was intramuscular injection into the neck.

[00105] On day 0, group T01 received an intramuscular injection of 1 ml at a dose of 10 5,0 TCID 50 The control group T02 was inoculated with DMEM medium only. On day 21 after inoculation, 2 ml (containing 10 7.0 TCID 50) of the classical virulent PRV strain (Rong A strain). The results showed that in the T01 group, 5 out of 5 piglets were protected. In the control group, 0 out of 5 piglets were not protected, and all of them became ill.

[00106] These data indicate that the modified live PRV strain M1707 is capable of providing broad cross-protection. EXAMPLE 7

[00107] Sheep that tested negative for PRV antigen and antibodies were divided into 2 groups, 5 sheep in each group. The sheep were provided with commercial feed and drinking water. Sheep in Group 1 were inoculated with a mixture prepared from the M1707 strain (including SEQ ID NO: 3, and with nucleotides 480-846 of the UL23 gene encoding TK deleted) together with MEM, gelatin, NZ-amine, glutamine, sucrose, dextran 40, lactose, sorbitol and penicillin-streptomycin. Sheep in Group 2 were inoculated with DMEM medium. The inoculation method was intramuscular injection into the neck.

[00108] On day 0, group T01 received an intramuscular injection of 1 ml at a dose of 10 6 0 TCID 50 The control group T02 was inoculated with DMEM medium only. After inoculation, the rectal temperature of the sheep was measured and recorded regularly every day, and a number of parameters, including appetite, mental state, respiratory status, and specific clinical symptoms caused by the pseudorabies virus, were clinically observed for 14 days. The results showed that after immunization, all sheep had normal body temperature, good appetite, normal mental status, no respiratory or gastrointestinal symptoms, and no neurological symptoms during the 14-day observation period. <?xml version="1.0" encoding="UTF-8"?><!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing1.3 / / EN" "ST26SequenceListing_V1_3.dtd"> <st26sequencelisting dtdversion="V1_3" filename="IIC222414.xml" softwarename="WIPO Sequence" softwareversion="2.0.0" productiondate="2023-10-07"> <applicantfilereference>IIC222414< / applicantfilereference> <applicantname languagecode="en"> Zoetis Services LLC< / applicantname> <applicantnamelatin> Zoetis Services LLC< / applicantnamelatin> <inventiontitle languagecode="en"> Live attenuated vaccine against pseudorabies virus for pigs containing a deletion of genaUL23< / inventiontitle> <sequencetotalquantity> 9< / sequencetotalquantity> <sequencedata sequenceidnumber="1"> <insdseq><INSDSeq_length>138127< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..138127< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> genomic DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q1"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> Pseudorabies virus< / INSDQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="2"> <insdseq><INSDSeq_length>145312< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..145312< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> genomic DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q16"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> Pseudorabies virus< / INSDQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="3"> <insdseq><INSDSeq_length>138015< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..138015< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> genomic DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q3"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> Pseudorabies virus< / INSDQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="4"> <insdseq><INSDSeq_length>15< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..15< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q4"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> fragment of US-1 gene of Pseudorabiesvirus< / INSDQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..15< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q5"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>ctcctcttcctcgtc< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="5"> <insdseq><INSDSeq_length>126< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..126< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q6"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>Fragment of US-1 gene sequence ofPseudorabies virus< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..126< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q7"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> cgaggaaggaaggaaggaagacgggacgaggagga< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="6"> <insdseq><INSDSeq_length>366< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..366< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q8"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>fragment of TK gene sequence ofPseudorabies virus< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..366< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q9"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>gcggcgcctgcgcgcccgcgcgcgcgccggggagcacgtggacgcgcgcctgctcacggccctgcgcaacgtctacgccatgctggtcaacacgtcgcgctacctgagctcggggcgccgctggcgcgacgactgggggcgcgcgccgcgcttcgaccagaccgtgcgcgactgcctcgcgctcaacgagctctgccgcccgcgcgacgaccccgagctccaggacaccctcttcggcgcgtacaaggcgcccgagctctgcgaccggcgcgggcgcccgctcgaggtgcacgcgtgggcgatggacgcgctcgtggccaagctgctgccgctgcgcgtctccaccgtcgacctggggccctcgcc< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="7"> <insdseq><INSDSeq_length>80< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..80< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q10"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>Fragment of TK gene of Pseudorabiesvirus< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..80< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q11"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>cgcctgctcacggccctgcgcaacgtctacgccatgctggtcaacacgtcgcgctacctgagctcggggcgccgctggcg< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="8"> <insdseq><INSDSeq_length>444< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..444< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q12"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>Fragment of TK gene of Pseudorabiesvirus< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..444< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q13"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>gggcccgcggtcgagggcccgcccgagatgacggtcgtctttgaccgccacccggtggccgcgacggtgtgcttcccgctggcgcgcttcatcgtcggggacatcagcgcggcggccttcgtgggcctggcggccacgctgcccggggagccccccggcggcaacctggtggtggcctcgctggacccggacgagcacctgcggcgcctgcgcgcccgcgcgcgcgccggggagcacgtggacgcgcgcctgctcacggccctgcgcaacgtctacgccatgctggtcaacacgtcgcgctacctgagctcggggcgccgctggcgcgacgactgggggcgcgcgccgcgcttcgaccagaccgtgcgcgactgcctcgcgctcaacgagctctgccgcccgcgcgacgaccccgagctccaggacaccctcttcggcgcgtac< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="9"> <insdseq><INSDSeq_length>252< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..252< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q14"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>Fragment of TK gene of Pseudorabiesvirus< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..252< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q15">< INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value >< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>cgcttcatcgtcggggacatcagcgcggcggccttcgtgggcctggcggccacgctgcccggggagccccccggcggcaacctggtggtggcctcgctggacccggacgagcacctgcggcgcctgcgcgcccgcgcgcgcgccggggagcacgtggacgcgcgcctgctcacggccctgcgcaacgtctacgccatgctggtcaacacgtcgcgctacctgagctcggggcgccgctggcgcgacgactgg< / INSDSeq_sequence>< / insdseq> < / sequencedata> < / st26sequencelisting> <---

Claims

1. The use of a modified live pseudorabies virus comprising the genome of SEQ ID NO: 3 or a nucleic acid sequence that is at least 95% identical thereto, for the production of a vaccine for protecting a pig against one or more symptoms of pseudorabies virus (PRV) caused by an infectious PRV, wherein said modified live pseudorabies virus comprises a deletion of nucleotides 480-846 of the UL23 gene, and said infectious PRV is of genotype II, and wherein said pig is a pregnant sow, wherein administration of said vaccine does not affect the farrowing rate, abortion rate or survival of the offspring of said pregnant sows.

2. The use according to paragraph 1, characterized in that the genome of the modified live pseudorabies virus contains deletions of the gE gene and the gI gene.

3. The use according to paragraph 1, characterized in that in the genome of said modified live PRV the genes US1, US2 and US9 are not modified.

4. Use according to any of paragraphs 1-3, characterized in that one dose of the said vaccine contains 10 2 -10 7 TCID 50 .

5. The use according to claim 1, characterized in that said one or more symptoms of PRV are selected from the group consisting of virus shedding, coughing, sneezing, fever, constipation, depression, convulsions, ataxia, dizziness and excessive salivation.

6. Use according to paragraph 5, characterized in that the said vaccine is administered intramuscularly.

7. The use according to claim 1, characterized in that said infectious PRV is the PRV strain FS21PF1115 or the PRV strain AV25.

8. The use according to paragraph 7, characterized in that the said infectious PRV is the PRV strain FS21PF1115 in an amount of 10 5,0 TCID 50 or 10 6,0 TCID 50 or PRV strain AV25 in the amount of 10 7,0 TCID 50 .

9. The use according to claim 1, characterized in that at least 80% of the pigs are protected from the symptoms of PRV when exposed to said infectious PRV for six months after vaccination with said vaccine containing said modified live pseudorabies virus.

10. Use according to paragraph 1 or 9, characterized in that the said sow is 2-3 months pregnant.

Images