NK cells with chimeric antigen receptor (CAR) and their applications

Abstract

FIELD: biotechnology; genetic engineering; medicine.SUBSTANCE: plasmid and methods for genetically engineering NK cells using adeno-associated virus (AAV) to deliver the CRISPR / Cas9 system are disclosed. In some aspects, the present document discloses a method for using such engineered NK cells to treat cancer diseases.EFFECT: new methods and vectors for engineering NK cells.33 cl, 22 dwg, 6 tbl, 1 ex

Description

[0001] I. CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] 1. This application claims the benefit of U.S. Provisional Application No. 63 / 105,722, filed October 26, 2020, which is expressly incorporated herein by reference in its entirety.

[0003] II. LEVEL OF TECHNOLOGY

[0004] 2. Human peripheral blood natural killer (NK) cells exhibit intense antitumor activity and have been successfully used in several clinical trials. Modifying NK cells with a chimeric antigen receptor (CAR) can improve their targeting and increase specificity. However, genetic modification of NK cells has been challenging due to their high expression of innate viral nucleic acid detection mechanisms. New methods and vectors for engineering NK cells are needed.

[0005] III. BRIEF DESCRIPTION OF THE INVENTION

[0006] 3. Methods and compositions related to electroporation of NK cells for delivery of a CRISPR / CAS9 gene editing system into a cell (e.g., an NK cell) are disclosed.

[0007] 4. In one aspect, disclosed herein are plasmids for use with clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated 9 (Cas9) integration systems, wherein the plasmid comprises, in order, a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (such as, e.g., a CAR comprising an scFv targeted to a target cell receptor (e.g., CD33), a transmembrane domain (e.g., an NKG2D transmembrane domain, a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, and / or a CD3ζ transmembrane domain), a costimulatory domain (e.g., a 2B4 domain, a CD28 costimulatory domain, a 4-1BB costimulatory domain, or any combination of a 2B4 domain, a CD28 costimulatory domain, and / or costimulatory domain 4-1BB) and the CD3ζ signaling domain) and a right homology arm; wherein the left and right homology arms are 1000 bp or less in length (e.g., 30 bp in length, 300 bp in length,in length, 600 p.o. in length).

[0008] 5. Also disclosed herein are plasmids for use with the CRISPR / Cas9 integration systems of any preceding aspect, wherein the left homology arm and the right homology arm are of the same length or different lengths. In some aspects, the homology arms specifically hybridize to the adeno-associated virus 1 (AAVS1) integration site on human chromosome 19.

[0009] 6. In some embodiments, the present document discloses plasmids for use with the CRISPR / Cas9 integration systems of any preceding aspect, wherein the plasmid further comprises a promoter derived from a murine leukemia virus (MND).

[0010] 7. Also disclosed herein are adeno-associated viral (AAV) vectors (such as, for example, an AAV vector comprising the AAV6 serotype) comprising a plasmid according to any preceding aspect. In some aspects, the AAV plasmids further comprise a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide. In some embodiments, the vector further comprises a plasmid encoding crRNA, tracer RNA (trcrRNA), and Cas endonuclease. The AAV vector may be single-stranded AAV (ssAAV) or self-complementary AAV (scAAV).

[0011] 8. In one aspect, the document discloses modified cells (such as, for example, NK cells and NK-T cells) comprising an AAV plasmid or vector according to any previous aspect.

[0012] 9. Also disclosed herein are methods for treating, reducing, decreasing, inhibiting, ameliorating and / or preventing cancer and / or metastasis (such as, for example, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL) and / or myelodysplastic syndrome (MDS)) in a subject, comprising administering to the subject with cancer a modified cell according to any of the preceding aspects.

[0013] 10. In one aspect, the document discloses methods for generating a chimeric antigen receptor (CAR) natural killer (NK) cell or a CAR NK-T cell, comprising a) obtaining a ribonucleoprotein (RNP) complex comprising a CRISPR / Cas class 2 (Cas9) endonuclease in complex with an appropriate CRISPR / Cas guide RNA, and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is flanked by homology arms; and wherein the length of the homology arms is 1000 bp.or less; and b) introducing a transgene and an RNP complex into an NK cell or NK-T cell; wherein the transgene (such as, for example, a chimeric antigen receptor for a tumor antigen) is introduced into the NK cell or NK-T cell by infection with an adeno-associated virus (AAV); wherein the RNP complex hybridizes to a target sequence in the genomic DNA of the NK cell or NK-T cell, and DNA repair enzymes of the NK cell or NK-T cell integrate the transgene into the host genome (e.g., by homologous repair) at the target sequence, thereby creating a CAR-NK cell or CAR-NK-T cell. In some aspects, the RNP complex can be introduced into the cell by electroporation. In some aspects, the RNP complex can be introduced into the cell via viral delivery in the same or a different AAV (i.e., superinfection).

[0014] 11. In one aspect, disclosed herein are methods for genetically modifying a cell (T cells, B cells, macrophages, NK cells, NK-T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and / or muscle cells, including but not limited to primary or expanded cells), comprising a) providing a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) in complex with a corresponding CRISPR / Cas guide RNA, and an AAV vector comprising a plasmid comprising a chimeric antigen receptor (CAR) polypeptide; wherein the polynucleotide sequence is flanked by homology arms; and wherein the homology arm is 1000 bp in length.or less; and b) introducing the polynucleotide sequence and the RNP complex into the cell; wherein the polynucleotide sequence is introduced into the cell by infecting the cell with AAV; wherein the RNP complex hybridizes to a target sequence in the genomic DNA of the cell, and DNA repair enzymes of the cell insert the transgene into the host genome at the target sequence in the genomic DNA of the cell, thereby creating a modified cell.

[0015] 12. In some embodiments, disclosed herein are methods for genetically modifying a cell of any preceding aspect, wherein the cell (e.g., an NK cell or NK T cell) is infected with an AAV disclosed herein at a multiplicity of infection (MOI) of about 5 to 500 thousand.

[0016] 13. The document also discloses methods for genetically modifying a cell according to any of the preceding aspects, wherein the primary cells are incubated for about 4 to 10 days in the presence of IL-2 and / or irradiated plasma membrane feeder particles or exosomal cells prior to infection and / or electroporation. In some embodiments, the document discloses methods for genetically modifying a cell according to any of the preceding aspects, further comprising expanding the primary cells for about 4 to 10 days in the presence of irradiated feeder cells, plasma membrane particles or exosomes prior to infection, wherein the irradiated feeder cells, plasma membrane particles or exosomes express membrane-associated 4-1BBL, membrane-associated IL-21 or membrane-associated IL-15 or any combination thereof.The document also discloses methods for genetically modifying a cell according to any of the preceding aspects, further comprising propagating the modified cell using irradiated feeder cells, plasma membrane particles or exosomes after infection, wherein the irradiated feeder cells, plasma membrane particles or exosomes express membrane-associated 4-1BBL, membrane-associated IL-21 or membrane-associated IL-15 or any combination thereof.

[0017] 14. In some aspects, disclosed herein is a method for treating, reducing, decreasing, inhibiting, ameliorating, and / or preventing cancer and / or metastasis (such as, for example, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), and / or myelodysplastic syndrome (MDS)) in a subject, comprising administering to the subject a therapeutically effective amount of natural killer (NK) cells, wherein the NK cell comprises a plasmid for use with clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated 9 (Cas9) integration systems, wherein the plasmid comprises, in order, a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (such as, for example, CD33 targeting the CAR), and a right homology arm; in this case, the length of the left and right arms of the homology is 1000 bp or less (for example, 600 bp).

[0018] 15. In some aspects, disclosed herein is a plasmid for use with clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated 9 (Cas9) integration systems, wherein the plasmid comprises a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide; wherein the polynucleotide sequence is adjacent to one protospacer adjacent motif (PAM) and one crispr RNA (crRNA) encoding sequence, or is flanked by two PAMs and crRNA encoding sequences. In some aspects, the disclosed plasmid can be used in any of the methods of treating, attenuating, reducing, inhibiting, ameliorating, and / or preventing cancer and / or metastasis according to any preceding aspect; methods of creating a CAR NK cell and / or a CAR NK T cell according to any preceding aspect; and / or genetic modification of a cell according to any preceding aspect.

[0019] IV. BRIEF DESCRIPTION OF GRAPHIC MATERIALS

[0020] 16. The accompanying drawings, which are incorporated into and constitute a part of this description, illustrate several embodiments and, together with this description, illustrate the disclosed compositions and methods.

[0021] 17. Figures 1A-1E show efficient CRISPR targeting of AAVS1 in mblL-21-expanded human primary NK cells. Figure 1A shows a schematic of the steps involved in ex vivo NK cell isolation and expansion using mblL21-K562. Figure 1B shows the relative expression levels of HR-related genes (Figure 1C) and NHEJ-related genes in different NK cells, ***P<0.001 for all comparisons. Figure 1D shows ATAC-seq data showing that AAVS1 has equal chromatin accessibility between freshly isolated (naive) and mblL-21-expanded NK cells (n=2). Figure Figure 1E shows the efficiency of Cas9 / RNP-mediated targeting of AAVS1 in NK cells. The sequences in Figure 1E include: SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58,

[0022] 18. Figs. 2A-2C show the mCherry-encoding DNA constructs for insertion into AAVS1 via HR and CRISPaint. In Fig. 2A, the left panel shows that Cas9 / RNP introduces a DSB into AAVS1, the DNA encoding the gene of interest can be integrated into NK cells via HR with an optimal Has length; the right panel shows the schematic design of constructs for integrating mCherry-encoding DNA with an HA of 30 to 1000 bp for the Cas9 targeting site in AAVS1 and cloned into the backbone of ssAAV6 and / or scAAV6. In Fig. 2B, the upper panel shows the schematic design of how CRISPaint gene insertion works via the homology-independent DNA repair pathway; the lower panel shows the schematic design of a construct for inserting mCherry-encoding DNA via CRISPaint and cloned into scAAV. In Fig. Figure 2C shows a schematic workflow for Cas9 / RNP electroporation and day 7 transduction of mblL21-expanded, IL2-stimulated NK cells transduced with AAV6 for gene delivery.

[0023] 19. Figures 3A–3C show that targeting AAVS1 in expanded CD3-negative CD56-positive NK cells does not alter normal cell function. Figure 3A shows a representative flow cytometry analysis showing the purity of CD3-negative CD56-positive NK cells isolated from buffy coats of healthy donors. Figure 3B shows a schematic of the workflow for electroporating Cas9 / RNP into 7-day-expanded primary human NK cells to target AAVS1. Figure 3C shows a cytotoxicity assay of AAVS1KO NK cells, which does not show any suppression of their antitumor activity against AML cell lines.

[0024] 20. Figures 4A-4C show that combinations of AAV6 and Cas9 / RNP lead to efficient generation of mCherry-expressing NK cells. Figure 4A shows representative flow cytometry of primary human NK cells expressing mCherry 2 days after CRISPR electroporation and AAV6 transduction (MOI=3 (105). Figure 4B shows the efficiency of Cas9 / RNP- and AAV6-mediated mCherry expression in primary human NK cells by HR and CRISPaint (n=3). Figure 4C shows stable mCherry expression in NK cells after enrichment and expansion with mbll21 K562.

[0025] 21. Fig. 5 shows a typical flow cytometric analysis of mCherry expression levels in freshly isolated NK cells electroporated with Cas9 / RNP and transduced with AAV6.

[0026] 22. Figures 6A-6F show the successful generation of CD33CAR-expressing NK cells using a combination of Cas9 / RNP and AAV6. Figures 6A and 6B are schematic representations of the anti-CD33 CAR constructs (Gen2 and Gen4v2) with an HA for the AAVS1 targeting site and cloned into ssAAV. Figure 6C shows a representative flow cytometry analysis showing CD33CAR expression on NK cells 7 days after Cas9 / RNP electroporation and AAV6 transduction (MOI=3×105). Figure 6D shows that the MFI of CD33CAR expression for Gen2 was significantly higher than that of Gen4v2, **P=0.0014. Figure Figure 6E shows the expression level of CD33CAR on NK cells at seven and fourteen days post-transduction, and electroporation showed no significant decrease (n=3). Figure 6F shows that the fold expansion of CD33CAR-expressing NK cells on feeder cells over 14 days, starting from 3×10 5 cells (n=3) was similar to wild-type NK cells.

[0027] 23. Figs. 7A-7B show a representative flow cytometry analysis of the expression level of CD33CAR-Gen2 in 14-day-old NK cells before freezing and after thawing, which showed no decrease. Fig. 7A also shows that freezing and thawing did not affect the enhanced cytotoxic effect of CD33CAR-Gen2 NK cells against Kasumi-1.

[0028] 24. Figs. 8A-8I show that CD33CAR NK cells have enhanced anti-AML activity. CD33CAR NK cells degranulated significantly more than wild-type NK cells when co-cultured with Kasumi-1, **adjusted P-value=0.004. Figs. 8A and 8B HL60, *adjusted P-value=0.01. Fig. 8B shows that CD33CAR expression on NK cells also enhances the anti-tumor activity of NK cells against Kasumi-1, as demonstrated in a representative cytotoxicity assay performed at different effector:target ratios and in three donors, ****adjusted P-value<0.0001. Fig. Figure 8C shows that this enhanced cytotoxic activity was observed against HL-60 only in CD33CAR-Gen2 NK cells (Figs. 8E and 8F), *adjusted P value = 0.01. CD33CAR-Gen2 and Gen4v2 significantly killed primary AML-10 cells, ****adjusted P value < 0.0001 (Figs. 8G and 8H).Improved killing was not observed for K562, **adjusted P=0.001.

[0029] 25. Figs. 9A-9D show that the integration of the transgene into the AAVS1 locus was confirmed by PCR and TLA. Fig. 9A shows the scheme of PCR primers designed inside and outside the CD33CAR encoding DNA and integrated into AAVS1. Fig. 9B shows that amplicons were amplified and visualized on 1% agar gel only in NK cells with successful insertion of the CD33CAR gene into the AAVS1 locus (condition 1 and 2). Gene insertion in primary human NK cells was also observed when primers designed outside the transgenes were used to amplify the AAVS1 locus in wild-type, mCherry, or CD33CAR cells (condition 3, primers: Forward - 1200 bp (2) Reverse - 1200 bp (1)). Figure 9C shows the coverage of TLA sequences across the human genome using the designed primers to detect CD33CAR-Gen2 integration in cells at day 14. Figure 9D shows that chromosomes are indicated on the ordinate axis and chromosome position is indicated on the abscissa axis.The identified integration site is circled in red.

[0030] 26. Fig. 10A-10B show a representative flow cytometry analysis (Fig. 10A) of the expression level of CD33CAR-Gen2 in NK cells transduced with 10,000-300,000 MOI of ssAAV6 encoding CD33CAR-Gen2, which showed successful CAR expression on NK cells isolated from three healthy donors (Fig. 10B).

[0031] 27. Fig. 11 shows the expression level of CD33 in various cancer cells.

[0032] 28. Fig. 12 shows a representative analysis of Calcein-AM release by NK cells against K562.

[0033] 29. Fig. 13A-13B show a representative flow cytometry analysis of the expression level of CD33CAR 7 days (Fig. 13A) and 14 days (Fig. 13B) after electroporation and transduction of AAV6 in human NK cells.

[0034] 30. Figure 14 shows the NGS sequencing coverage (gray) across the entire vector. Black arrows indicate primer positions. Blue arrows indicate the positions of identified vector genomic breakpoint sequences (described below). The vector map is shown at the bottom. The y-axis is limited to 100x. High coverage is observed across the entire region between ITR sites, vector sequence: 12-4255. Low / no coverage is observed across the vector: 0-11 and 4256-6864, indicating that the scaffold did not integrate across most of this sample; potentially, a small subset of the sample may also contain the scaffold. Additionally, coverage is observed within the ITRs, indicating that in addition to integration across homology arms, ITR-based integrations also occurred in the sample. Sequence and structural variants were called within the covered regions.

[0035] 31. Figure 15 shows the TLA sequence coverage (in gray) over the vector integration locus, human chr19:54550476–55682266. The blue arrow indicates the position of the breakpoint sequences. The y-axis is delimited by 20x and 100x, respectively. The coverage profile in this figure shows that no genomic rearrangements occurred in the region of the integration site. From these data, it is concluded that the vector integrated into the human chromosome chr19:55115754–55115767, as expected. According to RefSeq, this is intron 1 of PPP1R12C. Other integration sites were observed between chr19:55115155–55116371. According to RefSeq, this is also in intron 1 of PPP1R12C.

[0036] 32. Fig. 16 shows the design of the pAAV AAVS1(600 bp HA) MND-CD33CAR(gen2) (CoOp) construct. The sequence of the construct is SEQ ID NO: 22.

[0037] 33. Fig. 17 shows the design of the pAAV AAVS1 (600 bp HA) MND-CD33CAR(gen4v2) (CoOp) construct. The sequence of the construct is SEQ ID NO: 23.

[0038] 34. Figure 18 shows the kinetic assessment of the cytotoxicity of unmodified (wild-type) and CD33-CAR-expressing expanded NK cells towards K562. The assay was performed using xCelligence to monitor target viability at 15-minute intervals using two E:T ratios. The % cell lysis was calculated relative to control wells without NK cells. Although K562 is very sensitive to expanded wild-type NK cells, and serial killing is evident (>50% lysis at an E:T ratio of 0.5:1), K562 also expresses CD33, so the CD33 CAR provides a more rapid onset of killing at both E:T ratios and increased overall killing at the lower E:T ratio.

[0039] 35. Figure 19 shows the kinetic assessment of cytotoxicity against Kasumi. The assay was performed as in the previous figure. Unlike K562, Kasumi is highly resistant to expanded wild-type NK cells, but the addition of the NK cell-targeting CD33 CAR provides a more rapid onset of high-grade lysis with faster kinetics and increased overall lysis at both E:T ratios.

[0040] 36. Fig. 20 shows that co-culture of AML cells with WT-NK or CD33 CAR-NK cells induces AML cell death, as shown in the SPADE plots (colored for pRb expression indicating viable cycling cells), green arrows indicate live AML cells, and red arrows indicate dead / dying AML cells. CD33 CAR-NK cells exhibit enhanced killing of AML cells, and surviving AML cells have reduced surface expression of CD33 and increased expression of CD38, suggesting that the combination of CD33 CAR and anti-CD38 antibody may be synergistic. A patient-derived AML cell line was used as a target in this assay.

[0041] 37. Fig. 21 shows the design of the mCherry PAMgRNA construct. The sequence of the construct is SEQ ID NO: 51.

[0042] 38. Fig. 22 shows the design of the PAMgPAMg mCherry construct. The sequence of the construct is SEQ ID NO: 50.

[0043] V. DETAILED DESCRIPTION OF THE ESSENCE OF THE INVENTION

[0044] 39. Before disclosing and describing the compounds, compositions, articles, devices, and / or methods of the present invention, it should be understood that they are not limited to particular synthetic methods or particular recombinant biotechnology methods, unless otherwise indicated, or to particular reagents, unless otherwise indicated, since these may, of course, vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0045] A. Definitions

[0046] 40. When used in the description and appended claims, the singular forms "a" and "the" include plural references unless the context clearly indicates otherwise. Thus, for example, a reference to a pharmaceutical carrier includes mixtures of two or more such carriers, etc.

[0047] 41. Ranges may be expressed herein as from "about" one specific value and / or to "about" another specific value. When such a range is expressed, another embodiment includes from one specific value and / or to another specific value. Similarly, when values ​​are expressed as approximate values ​​using the preceding word "about," it should be understood that the specific value forms another embodiment. It will also be understood that the endpoints of each range are significant both in relation to the other endpoint and independently of the other endpoint. It should also be understood that multiple values ​​are disclosed herein, and that each value is also disclosed herein as "about" that specific value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed.It is also understood that when a value is disclosed that is "less than or equal to" a value, "greater than or equal to" a value, the possible ranges between the values ​​are also disclosed, as would be understood by one of ordinary skill in the art. For example, if the value "10" is disclosed, "less than or equal to 10" is also disclosed, as well as "greater than or equal to 10." It should also be understood that throughout this application, data is presented in various formats and that this data represents endpoints, startpoints, and ranges for any combination of data points. For example, if a specific data point of "10" and a specific data point of "15" are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15, as well as between 10 and 15, are disclosed. It should also be understood that each unit between two specific units is also disclosed. For example, if the values ​​10 and 15 are disclosed, the values ​​11, 12, 13, and 14 are also disclosed.

[0048] 42. "Administration" to a subject includes any route of administration or delivery of an agent to the subject. Administration may be by any suitable route, including oral, topical, intravenous, subcutaneous, transdermal, intramuscular, intra-articular, parenteral, intra-arterial, intradermal, intraventricular, intracranial, intraperitoneal, intralesional, intranasal, rectal, vaginal, by inhalation, via an implanted reservoir, parenteral (e.g., subcutaneous, intravenous, intramuscular, intra-articular, intrasynovial, intrasternal, intrathecal, intraperitoneal, intrahepatic, intralesional, and intracranial injection or infusion techniques), etc.As used herein, the terms "concomitant administration," "administration in combination," "simultaneous administration," or "administration simultaneously" mean that the compounds are administered at the same time or substantially immediately after one another. In the latter case, the two compounds are administered at a sufficiently close time that the observed results are indistinguishable from the results achieved by administering the compounds at the same time. "Systemic administration" refers to the administration or delivery of a drug to a subject via a route that delivers the drug to large areas of the subject's body (e.g., more than 50% of the body), such as through the circulatory or lymphatic systems.In contrast, local administration refers to the administration or delivery of a drug to a subject via a route in which the drug is administered or delivered to a site or region immediately adjacent to the site of administration, and the drug is not administered systemically in a therapeutically significant amount. For example, locally administered drugs are readily detectable in the immediate vicinity of the administration site but are not detectable, or detectable in negligible amounts, in distal parts of the subject's body. Administration includes self-administration and administration by another person.

[0049] 43. Biocompatible generally refers to a material and any of its metabolites or degradation products that are generally non-toxic to the recipient and do not cause significant adverse effects in the subject.

[0050] 44. A "control" is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative."

[0051] 45. "Complementary" or "substantially complementary" refers to hybridization or base pairing or duplex formation between nucleotides or nucleic acids, such as between the two strands of a double-stranded DNA molecule or between an oligonucleotide primer and the primer-binding site on a single-stranded nucleic acid. Complementary nucleotides are typically A and T / U or C and G. Two single-stranded RNA or DNA molecules are said to be substantially complementary when the nucleotides of one strand, optimally aligned and juxtaposed, and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the nucleotides of the other strand, typically at least about 90% to 95%, and more preferably about 98% to 100%. Alternatively, substantial complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions with its complement.In general, selective hybridization will occur when there is at least about 65% complementarity over a region of at least 14 to 25 nucleotides, at least about 75% complementarity, or at least about 90% complementarity. See Kanehisa (1984) Nucl. Acids Res. 12:203.

[0052] 46. As used herein, the term "comprising" and its variations are used synonymously with the term "including" and its variations and are open-ended, non-limiting terms. Although the terms "comprising" and "including" have been used herein to describe various embodiments, the terms "consisting essentially of" and "consisting of" may be used instead of "comprising" and "including" to provide more specific embodiments and are also disclosed.

[0053] 47. "Composition" refers to any agent that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, such as treatment of a disorder or other undesirable physiological condition, and prophylactic effects, such as prevention of a disorder or other undesirable physiological condition. The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of the beneficial agents specifically mentioned herein, including, but not limited to, vectors, polynucleotides, cells, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like.When the term "composition" is used or when a particular composition is specifically identified, it should be understood that this term includes the composition as such, as well as a pharmaceutically acceptable, pharmacologically active vector, polynucleotide, salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0054] 48. A DNA sequence that "encodes" a specific RNA is a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide can encode RNA (mRNA), which is translated into protein (and therefore both DNA and mRNA encode protein), or a DNA polynucleotide can encode RNA that is not translated into protein (e.g., tRNA, rRNA, microRNA (miRNA), non-coding RNA (ncRNA), guide RNA, etc.).

[0055] 49. An expression vector refers to a vector containing a recombinant polynucleotide containing expression control sequences operably linked to the nucleotide sequence to be expressed. The expression vector contains a sufficient number of cis-acting elements for expression; other expression elements may be supplied by the host cell or in an in vitro expression system. Expression vectors include all known in the art, such as cosmids, plasmids (e.g., unmodified or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses), which contain a recombinant polynucleotide.

[0056] 50. "Fragments," whether linked to other sequences or not, may include insertions, deletions, substitutions, or other selected modifications of specific regions or specific amino acid residues, provided that the fragment's activity is not significantly altered or impaired compared to the unmodified peptide or protein. These modifications may impart some additional property, such as the removal or addition of amino acids capable of disulfide bonding, increase its biodurability, alter secretory characteristics, etc. In any case, the fragment must have a bioactive property, such as regulation of target gene transcription.

[0057] 51. The term "gene" or "gene sequence" refers to a coding sequence or a control sequence, or fragments thereof. A gene may include any combination of a coding sequence and a control sequence, or fragments thereof. Thus, a "gene" as referred to herein may be an entire native gene or a portion thereof. A polynucleotide sequence referred to herein may be used interchangeably with the term "gene" or may include any coding sequence, non-coding sequence, or control sequence, fragments thereof, and combinations thereof. The term "gene" or "gene sequence" includes, for example, control sequences located upstream of the coding sequence (e.g., a ribosome binding site).

[0058] 52. The terms "identical" or percentage "identity" in the context of two or more nucleic acid sequences or polypeptide sequences refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity in the specified region when compared and aligned for the maximum match in the comparison window or in the specified region) when measured using the BLAST or BLAST 2.0 sequence comparison algorithms with the default parameters described below, or by manual alignment and visual inspection (see, for example, the NCBI website or the like).Such sequences are then referred to as "substantially identical." This definition also applies to or can be applied to the complement of the test sequence. The definition also includes sequences with deletions and / or additions, as well as sequences with substitutions. As described below, preferred algorithms can account for omissions and the like. Preferably, the identity exists over a region that is at least about 10 amino acids or 20 nucleotides long, or, more preferably, over a region that is 10-50 amino acids or 20-50 nucleotides long. As used herein, the percentage (%) of nucleotide sequence identity is defined as the percentage of amino acids in the candidate sequence that are identical to nucleotides in the reference sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percentage of sequence identity.Alignment for the purpose of determining percent sequence identity can be achieved by various methods known to those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2, or Megalign (DNASTAR). Appropriate parameters for measuring alignment, including any algorithms necessary to achieve maximum alignment over the entire length of the compared sequences, can be determined by known methods.

[0059] 53. For sequence comparisons, one sequence typically serves as the reference sequence to which the test sequences are compared. When using a sequence comparison algorithm, the test and reference sequences are input into the computer, subsequence coordinates are assigned if necessary, and the sequence algorithm program parameters are defined. The default program parameters can be used, or alternative parameters can be specified. The sequence comparison algorithm then calculates the percent sequence identity of the test sequences relative to the reference sequence based on the program parameters.

[0060] 54. One example of an algorithm suitable for determining percent sequence identity and sequence similarity is the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1977) Nuc. Acids Res. 25:3389–3402 and Altschul et al. (1990) J. Mol. Biol. 215:403–410, respectively. Software for performing BLAST analysis is publicly available through the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ). This algorithm involves first identifying high-scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive threshold score T when matched with a word of the same length in the database sequence. T is called the neighbor word evaluation threshold (Altschul et al. (1990) J. Mol. Biol. 215:403–410).These initial neighboring word matches serve as the seed for initiating a search to find longer HSPs containing them. Word matches are expanded in both directions along each sequence as far as the cumulative alignment score can be increased. Cumulative scores are calculated using the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatched residues; always <0) for nucleotide sequences. For amino acid sequences, a scoring matrix is ​​used to calculate a cumulative score. Expansion of word matches in each direction stops when: the cumulative alignment score falls by X from the maximum achieved value; the cumulative score becomes zero or lower due to the accumulation of one or more negative-scoring residue alignments; or the end of any sequence is reached.The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses by default a wordlength (W) of 11, an expectation (E) of 10, M = 5, N = -4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses by default a wordlength of 3 and an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915) an alignment (B) of 50, an expectation (E) of 10, M = 5, N = -4, and a comparison of both strands.

[0061] 55. The BLAST algorithm also performs statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873–5787). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which indicates the probability that a match between two nucleotide or amino acid sequences would occur by chance. For example, a nucleic acid is considered similar to a reference sequence if the smallest sum probability when comparing the test nucleic acid with the reference nucleic acid is less than about 0.2, more preferably less than about 0.01.

[0062] 56. The term "natural," "unmodified," or "wild-type," when used herein with respect to a nucleic acid, polypeptide, cell, or organism, refers to a nucleic acid, polypeptide, cell, or organism that occurs in nature. For example, a polypeptide or polynucleotide sequence present in an organism (including viruses), which can be isolated from a source in nature and which has not been intentionally modified by humans in a laboratory, is referred to as wild-type (and occurs in nature).

[0063] 57. "Increase" may refer to any change that results in a greater degree of a symptom, disease, constituent, condition, or activity. An increase may be any individual, median, or average increase in a condition, symptom, activity, constituent by a statistically significant amount. Thus, an increase may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% increase, as long as the increase is statistically significant.

[0064] 58. "Reduction" may refer to any change that results in a lesser degree of a symptom, disease, composition, condition, or activity. A substance is also said to result in a decrease in the genetic output of a gene when the genetic output of the gene product with the substance is less than the genetic output of the gene product without the substance. Also, for example, a decrease may represent a change in the symptoms of a disorder such that the symptoms become less pronounced than previously observed. A decrease may represent any individual, median, or average decrease in a condition, symptom, activity, or composition by a statistically significant amount. Thus, the reduction can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% reduction if the reduction is statistically significant.

[0065] The term "nucleic acid" as used herein refers to a polymer composed of nucleotides, such as deoxyribonucleotides (DNA) or ribonucleotides (RNA). The terms "ribonucleic acid" and "RNA" as used herein refer to a polymer composed of ribonucleotides. The terms "deoxyribonucleic acid" and "DNA" as used herein refer to a polymer composed of deoxyribonucleotides.

[0066] 59. "Optional" or "optional" means that the phenomenon or circumstance described below may or may not occur, and that the description includes cases in which the stated phenomenon or circumstance occurs and cases in which it does not occur.

[0067] 60. As used herein, "operably linked" may mean that regulatory sequences suitable for the expression of coding nucleic acid sequences are positioned within the nucleic acid molecule at appropriate positions relative to the coding sequence to cause expression of the coding sequence. The same definition is sometimes applied to the arrangement of coding sequences and / or transcriptional control elements (e.g., promoters, enhancers, and termination elements) and / or selectable markers in an expression vector. The term "operably linked" may also refer to the arrangement of polypeptide segments within a single polypeptide chain, wherein the individual polypeptide segments may be, but are not limited to, a protein, fragments thereof, binding peptides, and / or signal peptides.The term operably linked may refer to the direct fusion of different individual polypeptides within individual polypeptides or fragments thereof, when there are no intervening amino acids between the different segments, as well as when the individual polypeptides are linked to each other via one or more intervening amino acids.

[0068] 61. "Primers" are a subset of probes that are capable of supporting a specific type of enzymatic processing and that can hybridize with the target nucleic acid so that enzymatic processing can occur. A primer can be derived from any combination of nucleotides or nucleotide derivatives or analogs available in the art that do not interfere with enzymatic processing.

[0069] 62. "Probes" are molecules capable of interacting with a target nucleic acid, typically in a sequence-specific manner, such as through hybridization. Nucleic acid hybridization is well known in the art and is discussed herein. Typically, a probe can be prepared from any combination of nucleotides or nucleotide derivatives or analogs available in the art.

[0070] 63. A "protein coding sequence," or a sequence that encodes a specific protein or polypeptide, is a nucleic acid sequence that is transcribed into mRNA (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are defined by a start codon at the 5' end (N-terminus) and a nonsense translation-terminating codon at the 3' end (C-terminus). The coding sequence may include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic nucleic acids. A transcription termination sequence is typically located at the 3' end of the coding sequence.

[0071] 64. The term "polynucleotide" refers to a single-stranded or double-stranded polymer composed of nucleotide monomers.

[0072] 65. The term "polypeptide" refers to a compound consisting of a single chain of D- or L-amino acids or a mixture of D- and L-amino acids linked by peptide bonds.

[0073] 66. As used herein, the term "promoter" is defined as a DNA sequence recognized by the cellular or introduced cellular machinery that is necessary for the initiation of specific transcription of a polynucleotide sequence.

[0074] 67. As used herein, the term "promoter / regulatory sequence" means a nucleic acid sequence that is necessary for the expression of a gene product operably linked to the promoter / regulatory sequence. In some cases, this sequence may be the primary promoter sequence, while in other cases, this sequence may also include an enhancer sequence and other regulatory elements necessary for the expression of the gene product. A promoter / regulatory sequence may, for example, be one that expresses the gene product in a tissue-specific manner.

[0075] 68. A "pharmaceutically acceptable" component may refer to a component that is not biologically or otherwise undesirable, i.e., the component can be included in the pharmaceutical formulation of the invention and administered to a subject as described herein without causing significant undesirable biological effects or without interacting in an undesirable manner with any of the other components of the formulation in which it is contained. When used with respect to administration to humans, this term generally means that the component meets the required toxicological and manufacturing testing standards or that it is included in the Inactive Ingredients Guide prepared by the U.S. Food and Drug Administration.

[0076] 69. "Pharmaceutically acceptable carrier" (sometimes referred to as a "carrier") means a carrier or excipient that can be used in the preparation of a pharmaceutical or therapeutic composition that is generally safe and non-toxic, and includes a carrier acceptable for veterinary and / or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" may include, but are not limited to, phosphate-buffered saline, water, emulsions (such as an oil / water or water / oil emulsion), and / or various types of wetting agents. As used herein, the term "carrier" includes, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and preparations, as described further herein.

[0077] 70. "Pharmacologically active" (or simply "active"), as in the case of a "pharmacologically active" derivative or analogue, may refer to a derivative or analogue (e.g., salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) having the same type of pharmacological activity as the parent compound and approximately equivalent in degree.

[0078] 71. An "effective amount" of an agent refers to an amount of the agent sufficient to provide the desired effect. The amount of agent that is "effective" will vary from subject to subject depending on many factors, such as the age and general condition of the subject, the specific agent or agents, and the like. Therefore, it is not always possible to quantify an "effective amount." However, a suitable "effective amount" in any given case can be determined by one of skill in the art through routine experimentation. Also, as used herein and unless otherwise specifically indicated, an "effective amount" of an agent may also refer to an amount encompassing both therapeutically effective amounts and prophylactically effective amounts.The effective amount of the agent required to achieve a therapeutic effect may vary depending on factors such as the subject's age, gender, and weight. Dosing regimens can be adjusted to ensure an optimal therapeutic response. For example, several divided doses can be administered daily, or the dose can be proportionally reduced depending on the severity of the therapeutic situation.

[0079] 72. "Therapeutic agent" refers to any composition that exhibits a beneficial biological effect. Beneficial biological effects include both therapeutic effects, such as treating a disorder or other undesirable physiological condition, and prophylactic effects, such as preventing a disorder or other undesirable physiological condition (e.g., cancer). The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of the beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like.When the term "therapeutic agent" is used or when a specific agent is specifically mentioned, it should be understood that this term includes the agent itself, as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.

[0080] 73. A "therapeutically effective amount" or "therapeutically effective dose" of a composition (e.g., a composition containing an agent) refers to an amount effective to achieve the desired therapeutic result. In some embodiments, the desired therapeutic result is cancer control. In some embodiments, the desired therapeutic result is metastasis control. In some embodiments, the desired therapeutic result is tumor reduction. In some embodiments, the desired therapeutic result is prevention and / or treatment of recurrence. Therapeutically effective amounts of a given therapeutic agent will typically vary depending on factors such as the type and severity of the disease or disorder being treated, as well as the age, sex, and body weight of the subject.The term can also refer to the amount of a therapeutic agent or the rate of delivery of a therapeutic agent (e.g., amount over time) effective to achieve a desired therapeutic effect, such as pain relief. The precise desired therapeutic effect will vary depending on the condition being treated, the subject's tolerance, the agent being administered and / or the formulation of the agent (e.g., the potency of the therapeutic agent, the concentration of the agent in the formulation, etc.), and a number of other factors well known to those skilled in the art. In some cases, the desired biological or medical response is achieved after administering multiple doses of the composition to the subject over several days, weeks, or years.

[0081] 74. As used herein, a "transgene" refers to exogenous genetic material (e.g., one or more polynucleotides) that has been or can be artificially introduced into a cell. The term may be used to refer to a recombinant polynucleotide encoding any of the polypeptides disclosed herein that are the subject of the present invention. The term "recombinant" refers to a sequence (e.g., a polynucleotide or polypeptide sequence) that is not found in the cell into which the sequence is artificially introduced, or that is linked to another polynucleotide in a location that is not found in the cell into which the sequence is artificially introduced. It is understood that "artificial" refers to a non-natural occurrence in a host cell and includes manipulation by a person, a device, exogenous factors (e.g., enzymes, viruses, etc.).), other manipulations not found in nature, or combinations thereof. A transgene may contain a gene operably linked to a promoter (e.g., an open reading frame), although it is not limited to this. When a transgene is artificially introduced into a cell, the transgene may integrate into the host cell's chromosome, exist extrachromosomally, or exist in any combination of the two.

[0082] 75. Throughout this application, various publications are referenced. The disclosures of these publications in their entirety are incorporated by reference into this application for a more complete description of the state of the art to which it pertains. The disclosed references are also individually and specifically incorporated herein by reference for the material contained therein that is discussed in the sentence to which the reference refers.

[0083] B. Plasmids and methods of genetic modification of cells

[0084] 76. Genetic modification of NK cells using viral or non-viral vectors has been challenging due to robust recognition mechanisms for foreign DNA and RNA, which can limit the efficiency of gene delivery methods in NK cells. To overcome this limitation, a novel method was developed to electroporate Cas9 / ribonucleoprotein (Cas9 / RNP) complexes directly into primary human NK cells. This method introduces a double-strand break (DSB) into the NK cell genome, resulting in successful gene knockout and enhanced antitumor activity. Following this initial success in gene silencing, further development of the gene insertion method continued. Once Cas9 introduces a DSB, two independent and innate DNA repair mechanisms can be used to repair the break: homologous recombination (HR) or non-homologous end joining (NHEJ).Given a DNA template encoding the gene of interest, the exogenous gene can be integrated into the Cas9-targeted site using any of these repair mechanisms.

[0085] 77. Accordingly, disclosed herein are plasmids for use with clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated 9 (Cas9) integration systems, wherein the plasmid comprises, in order, a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (such as, for example, a CAR comprising an scFv targeted to a target cell receptor (e.g., CD33), a transmembrane domain (e.g., an NKG2D transmembrane domain, a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, or a CD3ζ transmembrane domain), a costimulatory domain (e.g., a 2B4 domain, a CD28 costimulatory domain, a 4-1BB costimulatory domain, or any combination of a 2B4 domain, a CD28 costimulatory domain, and / or a costimulatory domain). 4-1 BB) and the CD3ζ signaling domain) and the right homology arm; the left and right homology arms are 1000 bp or less in length (e.g., about 30 bp in length)., about 300 bp long or about 600 bp long).

[0086] 78. In general, a CRISPR system or CRISPR integration system collectively refers to transcripts and other elements involved in the expression or control of the activity of CRISPR-related Cas genes. In some embodiments, one or more elements of a CRISPR system are derived from a Type I, Type II, or Type III CRISPR system. CRISPR systems are known in the art. See, for example, U.S. Patent No. 8,697,359, incorporated herein by reference in its entirety.

[0087] 79. Endonuclease / RNP complexes (e.g., Cas9 / RNP) consist of three components: a recombinant endonuclease protein (e.g., Cas9 endonuclease) in complex with CRISPR loci. The endonuclease complexed with CRISPR loci may be referred to as CRISPR / Cas guide RNA. CRISPR loci contain a synthetic single guide RNA (gRNA), consisting of RNA that can hybridize to a target sequence to form a complex with complementary repetitive RNA (crRNA) and trans-complementary repetitive RNA (tracrRNA). Accordingly, the CRISPR / Cas guide RNA hybridizes to a target sequence in the cell's genomic DNA. In some cases, class 2 CRISPR / Cas endonuclease is type II CRISPR / Cas endonuclease. In some cases, the class 2 CRISPR / Cas endonuclease is a Cas9 polypeptide and the corresponding CRISPR / Cas guide RNA is a Cas9 guide RNA.These Cas9 / RNPs are capable of cleaving genomic targets with greater efficiency than foreign DNA-dependent approaches due to their delivery as functional complexes. Furthermore, rapid clearance of Cas9 / RNPs from cells may reduce off-target effects, such as apoptosis induction.

[0088] 80. To obtain the RNP complex, crRNA and tracrRNA can be mixed in a 1:1, 2:1, or 1:2 ratio at concentrations between about 50 μM and about 500 μM (e.g., 50 μM, 60 μM, 70 μM, 80 μM, 90 μM, 100 μM, 125 μM, 150 μM, 175 μM, 200 μM, 225 μM, 250 μM, 275 μM, 300 μM, 325 μM, 350 μM, 375 μM, 400 μM, 425 μM, 450 μM, 475 μM or 500 μM), preferably between 100 μM and about 300 μM, most preferably between 200 μM at 95°C for about 5 min to form a crRNA:tracrRNA complex (i.e., guide RNA). The crRNA:tracrRNA complex can then be mixed with between about 20 μM and about 50 μM (e.g., 21 μM, 22 μM, 23 μM, 24 μM, 25 μM, 26 μM, 27 μM, 28 μM, 29 μM, 30 μM, 31 μM, 32 μM, 33 μM, 34 μM, 35 μM, 36 μM, 37 μM, 38 μM, 39 μM, 40 μM, 41 μM, 42 μM, 43 μM, 44 μM, 45 μM, 46 μM, 47 μM, 48 μM, 49 μM, or 50 μM) final dilution of Cas endonuclease (such as Cas9).

[0089] 81. After binding to a target sequence in a target cell, CRISPR loci can modify the genome by introducing an insertion or deletion of one or more base pairs into the target DNA, by inserting a heterologous DNA fragment (e.g., a donor polynucleotide), by deleting a fragment of endogenous DNA, by inversion or translocation of a fragment of endogenous DNA, or a combination thereof. Thus, the disclosed methods can be used to create knockouts or knockins in combination with DNA for homologous recombination. This paper demonstrates that transduction via adeno-associated virus (AAV) Cas9 / RNPs is a relatively efficient method that overcomes previous limitations of genetic modification in cells (such as, for example, T cells, B cells, macrophages, NK cells, NK-T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells and / or muscle cells).

[0090] 82. Recently, the CRISPR / Cas9 system has been shown to facilitate high-level precision genome editing using adeno-associated virus (AAV) vectors, which serve as the donor DNA template during homologous recombination (HR). However, previous use of AAVs has been limited because their immune function makes NK cells and NK-T cells resistant to viral and bacterial vectors and to the induction of NK cell / NK-T cell apoptosis by these vectors. Thus, prior to the present methods, CRISPR / Cas modification of NK cells or NK-T cells has been unsuccessful. Furthermore, the maximum packaging capacity of AAVs of ~4.5 kb limits the donor size, which includes homology arms. There are recommendations that any transcript longer than 100 bp should be removed. and any transgene must have homology arms of at least 800 bp for each arm, with many systems using asymmetric arms of 800 bp and 1000 bp, for a total of 1800 bp.Thus, the AAV vector cannot deliver a transgene larger than ~2.5 kb. In one aspect, this document discloses CRISPR / CAS9 AAV nucleotide delivery systems comprising a donor construct plasmid with homology arms between 30 bp. and 1000 p.p., including, but not limited to, 30 p.p., 50 p.p., 100 p.p., 110 p.p., 120 p.p., 130 p.p., 140 p.p., 150 p.p., 160 p.p., 170 p.p., 180 p.p., 190 p.p., 200 p.p., 210 p.p., 220 p.p., 230 p.p., 240 p.p., 250 p.p., 260 p.p., 270 p.p., 280 p.p., 290 p.p., 300 p.p., 310 p.p., 320 p.o., 330 p.o., 340 p.o., 350 p.o., 360 p.o., 370 p.o., 380 p.o., 390 p.o., 400 p.o., 410 p.o., 420 p.o., 430 p.o., 440 p.o., 450 p.o., 460 p.o., 470 p.o., 480 p.o., 490 p.o., 500 p.o., 510 p.o., 520 p.o., 530 p.o., 540 p.o., 550 p.o., 560 p.o., 570 p.o., 580 p.o., 590 p.o., 600 p.o., 610 p.o., 620 p.o., 630 p.o., 640 p.o., 650 p.o., 660 p.o., 670 p.o., 680 p.o., 690 p.o., 700 p.o., 710 p.o., 720 p.o., 730 p.o., 740 p.o., 750 p.o., 760 p.o., 770 p.o., 780 p.o., 790 p.o., 800 p.o., 810 p.o., 820 p.o., 830 p.o., 840 p.o., 850 p.o., 860 p.o., 870 p.o., 880 p.o., 890 p.o., 900 p.o., 910 p.o., 920 p.o., 930 p.o., 940 p.o., 950 p.o., 960 p.o., 970 p.o., 980 p.o., 990 p.o. or 1000 p.o. For example, the homology arms may be symmetrical 30 bp homology arms, symmetrical 300 bp homology arms, symmetrical 500 bp homology arms, symmetrical 600 bp homology arms, symmetrical 800 bp homology arms, symmetrical 1000 bp homology arms, or asymmetrical 800 bp homology arms that include an 800 bp left homology arm (LHA) and a 1000 bp right homology arm (RHA) for homologous recombination (HR) or no homology arms at all for non-homologous end joining using homology-independent targeted integration (HITI) plasmids.In some examples, plasmids with or without homology arms are those disclosed in International Publication No. WO 2020 / 198675, which is incorporated herein by reference in its entirety. In some embodiments, the plasmids comprise a clinically approved splice acceptor (SA) (SEQ ID NO: 10) and a clinically approved polyadenylation terminator (PA) (such as, for example, the BGH polyA terminator SEQ ID NO: 11). It is understood and contemplated herein that the homology arms may be symmetrical (the same length on each side) or asymmetrical (different lengths on each side) to accommodate transgenes of different lengths. Therefore, the homology arm length may be any combination of the left homology arm (LHA) length and the right homology arm (RHA) length, including, but not limited to, a 30 bp LHA (SEQ ID NO: 2) and a 30 bp RHA (SEQ ID NO: 1), a 30 bp LHA and a 100 bp RHA, a 30 bp LHA and a 300 bp RHA.(SEQ ID NO: 3), 30 bp LHA and 500 bp RHA (SEQ ID NO: 5), 30 bp LHA and 800 bp RHA (SEQ ID NO: 7), 30 bp LHA and 1000 bp RHA, 100 bp LHA and 30 bp RHA, 100 bp LHA and 100 bp RHA, 100 bp LHA and 300 bp RHA, 100 bp LHA and 500 bp RHA, 100 bp LHA and 800 bp RHA, 100 bp LHA and 1000 bp RHA, 300 bp LHA (SEQ ID NO: 4) and 30 bp RHA, 300 bp LHA and 100 bp RHA, 300 bp LHA and 300 bp RHA, 300 bp LHA and 500 bp RHA, 300 bp LHA and 800 bp RHA, 300 bp LHA and 1000 bp RHA, 500 bp LHA (SEQ ID NO: 6) and 30 bp RHA, 500 bp LHA and 100 bp RHA, 500 bp LHA and 300 bp RHA, 500 bp LHA and 500 bp RHA, 500 bp LHA and 800 bp RHA, 500 bp LHA and 1000 bp RHA, 800 bp LHA (SEQ ID NO: 8) and 30 bp RHA, 800 bp LHA and 100 bp RHA, 800 bp LHA and 300 bp RHA, 800 bp LHA and 500 bp RHA, 800 bp LHA and 800 bp RHA., 800 bp LHA and 1000 bp RHA, 1000 bp LHA and 30 bp RHA, 1000 bp LHA and 100 bp RHA, 1000 bp LHA and 300 bp RHA, 1000 bp LHA and 500 bp RHA, 1000 bp LHA and 800 bp RHA, and 1000 bp LHAH3 and 1000 bp RHAH3.

[0091] 83. Several methods exist for producing DNA templates, including viral and non-viral methods. In non-viral approaches, single- or double-stranded DNA templates are typically electroporated along with Cas9 / RNP, but this has lower efficiency compared to viral transduction. Adeno-associated viruses (AAVs), including AAV6, have been safely used in clinical trials for viral gene delivery and can be used as vectors for susceptible primary immune cells, including T cells.

[0092] 84. Transcripts delivered by AAV vectors can be packaged as linear single-stranded (ss) DNA of approximately 4.7 kb (ssAAV) or as linear self-complementary (sc) DNA (scAAV). The advantage of the scAAV vector is that it contains a mutated inverted terminal repeat (ITR), which is essential for replication and helps bypass the rate-limiting steps of second-strand generation compared to single-stranded DNA vectors. Due to limited packaging capacity, scAAV HAs of 30 bp, 300 bp, 500 bp, and 800-1000 bp have been developed. for the right and left side of the Cas9 targeting site to find the most optimal HA length and provide a possible HA length to be selected by researchers based on the size of the transgenes (e.g., as shown in Fig. 2A).Furthermore, due to packaging capacity limitations compared to ssAAV, scAAV may not be suitable for larger transgenes, such as a chimeric antigen receptor (CAR) targeting CD33. Therefore, based on transgene size, both ssAAV and scAAV have been developed and tested, providing a wide range of gene insertion options for primary NK cells and / or NK T cells.

[0093] 85. Recombination efficiency was shown to increase with increasing HA length. Therefore, the maximum possible length of the left and right homology arms (HA) for both mCherry (e.g., 800-1000 bp HA) and CD33 CAR-NK (e.g., 600 bp HA) was used for the ssAAV backbone. Since generating homology arms is a labor-intensive procedure and requires numerous optimizations, the CRISPaint approach, a homology-independent method for inserting or marking genes, was also investigated. In this method, the same Cas9 targeting site, including the crRNA-coding sequence and the PAM sequence (also referred to as PAMd herein, e.g., SEQ ID NO: 9), is contained in the DNA template encoding the gene of interest. Upon introduction of the Cas9 complex, both the template and genomic DNA are cut simultaneously.As a result, the CRISPaint template is presented as a linearized double-stranded DNA that can be integrated using the non-homologous repair mechanism (e.g., as shown in Fig. 2B). In some examples, the CRISPaint DNA template appears as shown in Fig. 21 and Fig. 22. Accordingly, in one aspect, the present document discloses plasmids for delivering a donor transgene into a cell and integrating said transgene (e.g., a CAR) into the cell in combination with CRISPR / Cas9. Thus, the present document discloses plasmids for use with the CRISPR / Cas9 integration systems of any preceding aspect, wherein the left homology arm and the right homology arm are of the same length or different lengths.

[0094] 86. In some aspects, the homology arms specifically hybridize to the adeno-associated virus 1 (AAVS1) integration site of human chromosome 19. In some embodiments, the LHA is 600 bp in length. In some embodiments, the LHA comprises a sequence that is at least about 70% (such as at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 31 or a fragment thereof. In some embodiments, the RHA is 600 bp in length. In some embodiments, the RHA comprises a sequence that is at least about 70% (such as at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 32 or a fragment thereof.

[0095] 87. The plasmid described herein comprises a polynucleotide sequence encoding a chimeric antigen receptor CAR polypeptide. As used herein, the term "chimeric antigen receptor" or "CAR" refers to a chimeric receptor that targets a cancer antigen and serves to transfer a cell expressing the receptor to a cancer cell expressing the target antigen. Typically, a CAR comprises a molecule that recognizes peptides derived from a tumor antigen presented by major histocompatibility molecules (MHC) or an antibody or fragment thereof (such as, for example, Fab', scFv, Fv) expressed on the surface of a CAR cell targeting a cancer antigen. The receptor is fused to a signaling domain (such as, for example, the _CD3 domain for T cells and the NKG2C domain, -NKp44 or CD3 for NK cells or NK T cells) via a linker. Target tumor antigens are proteins produced by tumor cells that induce an immune response, specifically B-cell, NK-cell, NK-T-cell, and T-cell-mediated immune responses. The choice of antigen-binding domain will depend on the specific type of cancer being treated. Tumor antigens are well known in the art and include, for example, glioma-associated antigen, carcinoembryonic antigen (CEA), EGFRvIII, IL-IIRa, IL-13Ra, EGFR, FAP, B7H3, Kit, CA LX, CS-1, MUC1, BCMA, bcr-abl, HER2, β-human chorionic gonadotropin, alpha-fetoprotein (AFP), ALK, CD19, CD123, cyclin B1, lectin-reactive AFP, Fos-related antigen 1, ADRB3, thyroglobulin, EphA2, RAGE-1, RU1, RU2, SSX2, AKAP-4, LCK, OY-TES1, PAX5, SART3, CLL-1, fucosyl GM1, GloboH, MN-CA IX, EPCAM, EVT6-AML, TGS5, human telomerase reverse transcriptase, plisialic acid, PLAC1, RU1, RU2 (AS),intestinal carboxylesterase, lewisY, sLe, LY6K, mut hsp70-2, M-CSF, MYCN, RhoC, TRP-2, CYPIBI, BORIS, prostasis, prostate-specific antigen (PSA), PAX3, PAP, NY-ESO-1, LAGE-la, LMP2, NCAM, p53, mutant p53, mutant Ras, gplOO, prostein, OR51E2, PANX3, PSMA, PSCA, Her2 / neu, hTERT, HMWMAA, HAVCR1, VEGFR2, PDGFR-beta, survivin and telomerase, legumain, HPV E6, E7, sperm protein 17, SSEA-4, tyrosinase, TARP, WT1, prostate tumor antigen-1 (PTA-1), ML-IAP, MAGE, MAGE-A1, MAD-CT-1, MAD-CT-2, MelanA / MART 1, XAGE1, ELF2M, ERG (TMPRSS2 ETS fusion gene), NA17, neutrophil elastase, sarcoma translocation breakpoints, NY-BR-1, ephnnB2, CD20, CD22, CD24, CD30, CD33, CD38, CD44v6, CD97, CD171, CD179a, androgen receptor, FAP, insulin growth factor (IGF)-I, IGFII, IGF-I receptor, GD2, o-acetyl-CO2, GD3, GM3, GPRC5D, GPR20, CXORF61, folate receptor (FRa), folate receptor beta, ROR1, Flt3, TAG72, TN Ag, Tie 2, TEM1, TEM7R, CLDN6, TSHR,UPK2 and mesothelin. Non-limiting examples of tumor antigens include the following: differentiation antigens such as tyrosinase, TRP-1, TRP-2, and tumor-specific multilineage antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, pi 5; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor suppressor genes such as p53, Ras, HER-2 / neu; unique tumor antigens arising from chromosomal translocations; such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR; and viral antigens such as Epstein-Barr virus EBVA antigens and human papillomavirus (HPV) E6 and E7 antigens. Other major protein antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, IL13Ra2, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, beta-catenin, CDK4, Mum-1, p 15, p 16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, beta-HCG, BCA225, BTAA, CA 125, CA 15-3 / CA 27.29 / BCAA, CA 195,CA 242, CA-50, CAM43, CD68 / P1, CO-029, FGF-5, G250, Ga733 / EpCAM, HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NYAG1 , 6 , RCAS TA-90 / Mas-2-binding protein / cyclophilic C-associated protein, TAAL6, TAG72, TLP, TPS, GPC3, MUC16, LMP1, EBMA-1, BARF-1, CS1, CD319, HER1 and L1, MCAMTH.6, IL

[0096] 88. The CAR polypeptide may also comprise a transmembrane domain (such as, for example, an NKG2D transmembrane domain, a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, and / or a CD3ζ transmembrane domain) and a costimulatory domain (such as, for example, a 2B4 domain, a CD28 costimulatory domain, a 4-1BB costimulatory domain, or any combination of a 2B4 domain, a CD28 costimulatory domain, and / or a 4-1BB costimulatory domain). For example, in some embodiments, a CAR polypeptide comprises an IgG4 hinge domain, a CD4 transmembrane domain, a CD28 costimulatory domain, a CD3-zeta polypeptide, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell, including, but not limited to, a cancer cell expressing a target antigen (e.g., CD33).In some embodiments, a CAR polypeptide comprises an IgG4 hinge domain, an NKG2D transmembrane domain, a 2B4 domain, a CD3-zeta polypeptide, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell, including, but not limited to, a cancer cell expressing a target antigen (e.g., CD33). In some embodiments, the CAR polypeptides are those shown in Fig. 6B. In some embodiments, a polynucleotide encoding a CAR polypeptide described herein comprises a sequence that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 22, SEQ ID NO: 23, or a fragment thereof. In some examples, the construction of a plasmid containing a polynucleotide encoding a CAR is shown in Fig. 16 and Fig. 17.

[0097] 89. In some embodiments, a polynucleotide encoding an scFV described herein comprises a sequence that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 18 or a fragment thereof.

[0098] 90. In some embodiments, a polynucleotide encoding an IgG4 hinge described herein comprises a sequence that is at least about 70% (such as at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 19 or a fragment thereof.

[0099] 91. In some embodiments, a polynucleotide encoding a CD28 costimulatory domain described herein comprises a sequence that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 20 or a fragment thereof.

[0100] 92. In some embodiments, a polynucleotide encoding CD3-zeta described herein comprises a sequence that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 21, SEQ ID NO: 28, or a fragment thereof.

[0101] 93. In some embodiments, a polynucleotide encoding the NKG2D transmembrane domain described herein comprises a sequence that is at least about 70% (such as at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 24 or a fragment thereof.

[0102] 94. In some embodiments, a polynucleotide encoding a 2B4 domain described herein comprises a sequence that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 26 or a fragment thereof.

[0103] 95. In some embodiments, a polynucleotide encoding an anti-CD33 scFV described herein comprises a sequence that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 29 or a fragment thereof.

[0104] 96. In some embodiments, the MND promoter described herein comprises a sequence that is at least about 70% (such as at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 30 or a fragment thereof.

[0105] 97. In some embodiments, the expression vector described herein comprises one or more linker sequences, wherein the linker sequence comprises a sequence that is at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 95%, 97%, or 99%) identical to SEQ ID NO: 25 or a fragment thereof.

[0106] 98. Accordingly, in some embodiments, a plasmid disclosed herein comprises a polynucleotide sequence encoding a CAR polypeptide, wherein the CAR polypeptide comprises a transmembrane domain (e.g., an NKG2D transmembrane domain, a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, or a CD3ζ transmembrane domain), a costimulatory domain (e.g., a 2B4 domain, a CD28 costimulatory domain, a 4-1BB costimulatory domain, or any combination of a 2B4 domain, a CD28 costimulatory domain, and / or a 4-1BB costimulatory domain), CD3-zeta, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell (e.g., a cancer cell expressing CD33). In some embodiments, the CAR polypeptide specifically binds to CD33.

[0107] 99. Also disclosed herein are plasmids that can be integrated into the genome of transduced cells using HITI, CRISPaint, or other non-homologous end joining (NHEJ). Thus, they have the advantage of integrating with higher efficiency. In some examples, the plasmids for NHEJ are those disclosed in International Publication No. WO 2020 / 198675, which is incorporated herein by reference in its entirety. In order to facilitate the identification of a cleavage site for removing the transgene for integration, the plasmids contain one or more PAMd sequences (i.e., a protospacer adjacent motif (PAM) and a crRNA (i.e., gRNA) encoding sequence) (SEQ ID NO: 9) to target the integration of donor transgenes.In some examples of NHEJ DNA templates (e.g., CRISPaint DNA templates), a single (RAMd) or double (PAMg RAMd) Cas9 targeting sequence is inserted around the transgene (e.g., a polynucleotide encoding a CAR, such as the CD33 CAR disclosed herein), but within the ITR. Consequently, Cas9 can simultaneously cleave gDNA and the CRISPaint DNA template, enabling integration into the genomic DSB.

[0108] 100. Accordingly, in some aspects, the present document discloses a plasmid for use with clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated 9 (Cas9) integration systems, wherein the plasmid comprises a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide; wherein the polynucleotide sequence is adjacent to one protospacer adjacent motif (PAM) and one polynucleotide sequence encoding crispr RNA (crRNA), or is flanked by two PAMs and two polynucleotide sequences encoding crRNA.In some aspects, the document discloses a plasmid for use with clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated 9 (Cas9) integration systems, wherein the plasmid comprises, in order, one protospacer adjacent motif (PAM) sequence and one polynucleotide sequence encoding a crRNA, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, and one PAM sequence and one polynucleotide sequence encoding a crRNA. In some examples, the plasmid is shown in Figs. 2B, 21, and 22.

[0109] 101. Furthermore, despite the advantages of using single-stranded (SS) plasmids for inserting larger transgenes, SS plasmids may require more time to fold and act as double-stranded DNA inside cells before integration, which enhances DNA recognition and cytotoxicity in some cells (such as T cells, B cells, macrophages, NK cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and / or muscle cells). This issue is addressed here by using self-complementary (SC) (double-stranded) constructs to reduce the time of cell exposure to exogenous DNA.

[0110] 102. It is understood and suggested herein that crispr RNA (crRNA) is used to direct Cas9 nuclease activity to the target site and to cleave the donor plasmid to allow recombination of the donor transgene into the host DNA. In some cases, crRNA is combined with tracrRNA to form a guide RNA (gRNA). The described plasmids utilize the AAV integration site, protein phosphatase 1 intron 1, regulatory subunit 12C (PPP1R12C) gene on human chromosome 19, called AAVS1, as the target site for transgene integration. This locus represents a "safe harbor gene" and ensures stable, long-term transgene expression in many cell types. Because PPP1R12C disruption is not associated with any known disease, the AAVS1 locus is often considered a safe haven for transgene targeting. Because the AAVS1 site is used as a target site, CRSPR RNA (crRNA) must target this DNA.In this document, the disclosed guide RNA comprises GGGGCCACTAGGGACAGGAT (SEQ ID NO: 17) or any sense or antisense contiguous 10-nucleotide fragment thereof. Accordingly, in some examples, the PAM+ crRNA encoding sequence comprises SEQ ID NO: 9. Although AAVS1 is used herein for illustrative purposes, it is understood and contemplated herein that other "safe harbor genes" may be used with equivalent results and may be substituted for AAVS1 if more appropriate given the particular type of cells or transgene being transfected. Examples of other safe harbor genes include, but are not limited to, C-C chemokine receptor type 5 (CCR5), the ROSA26 locus, and TRAC.

[0111] 103. In one example, the plasmid described herein further comprises a promoter derived from murine leukemia virus (MND).

[0112] 104. As noted above, the use of AAV as a vector for delivery of the described CRISPR / Cas9 plasmid and any donor transgene is limited to a maximum size of ~4.5 kb. It is understood and suggested herein that one way to increase the permissible transgene size is to create additional space by replacing the commonly used Streptococcus pyogenes Cas9 (SpCas9) with synthetic Cas9 or Cas9 from another bacterial source. Cas9 substitution can also be used to increase targeting specificity, thereby requiring the use of less gRNA. For example, Cas9 can be obtained from Staphylococcus aureus (SaCas9), Acidaminococcus sp. (AsCpf1), Lachnospiracase bacteria (LbCpf1), Neisseria meningitidis (NmCas9), Streptococcus thermophilus (StCas9), Campylobacter jejuni (CjCas9), enhanced SpCas9 (eSpCas9), SpCas9-HF1, Fokl-Fused dCas9, enriched Cas9 (xCas9) and / or catalytically dead Cas9 (dCas9).

[0113] 105. It is understood and suggested herein that the use of a particular Cas9 may alter the PAM sequence that the Cas9 endonuclease (or alternative) uses to screen targets. As used herein, suitable PAM sequences include NGG (SpCas9 PAM), NNGRRT (SaCas9 PAM), NNNNGATT (NmCAs9 PAM), NNNNRYAC (CjCas9 PAM), NNAGAAW (St), TTTV (LbCpf1 PAM and AsCpf1 PAM); TYCV (LbCpf1 PAM variant and AsCpf1 PAM variant); where N can be any nucleotide; V=A, C, or G; Y=C or T; W=A or T; and R=A or G.

[0114] 106. In one aspect, the document discloses methods for genetically modifying a cell, comprising obtaining a ribonucleoprotein (RNP) complex containing a class 2 CRISPR / Cas endonuclease (Cas9) in a complex with a corresponding CRISPR / Cas guide RNA (gRNA) specific for a target DNA sequence in a cell and a plasmid containing a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is flanked by homology arms; and b) introducing the transgene and the RNP complex into the cell; wherein the transgene is introduced into the cell by infecting the target cell with an adeno-associated virus (AAV); wherein the RNP complex hybridizes to the target sequence in the genomic DNA of the cell. In one aspect, the method may further comprise introducing the RNP complex into the cell via electroporation (e.g., by modifying an NK cell or NK T cell).In one aspect, the method may further comprise superinfecting the target cell with a second AAV virus containing the RNP complex. In one aspect, when the transgene is sufficiently small, the same AAV virus may contain both the transgene and the RNP complex. In additional aspects, the transgene and RNP complex may be encoded on the same plasmid.

[0115] 107. In one aspect, disclosed herein are methods for genetically modifying a cell (e.g., an NK cell or NK T cell), comprising a) providing a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) in complex with an appropriate CRISPR / Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is adjacent to one PAM and a crRNA or flanked by two PAMs and two crRNA encoding sequences; and b) introducing the transgene and the RNP complex into the cell; wherein the transgene is introduced into the cell by infecting the target cell with AAV; In this case, the ribonucleoprotein (RNP) complex hybridizes to a target sequence in the cell's genomic DNA, and the cell's DNA repair enzymes insert the transgene into the host genome at the target sequence (e.g., by non-homologous end joining), thereby creating a modified cell.In one aspect, the method may further comprise introducing the RNP complex into a cell via electroporation (e.g., by modifying an NK cell or NK T cell). In one aspect, the method may further comprise superinfecting the target cell with a second AAV virus containing the RNP complex. In one aspect, when the transgene is sufficiently small, the same AAV may contain both the transgene and the RNP complex. In another aspect, the transgene and the RNP complex may be encoded on the same plasmid.

[0116] 108. In some examples, the AAV described herein can be used as a vector to deliver the disclosed prime editing plasmid and any donor transgene (e.g., a polynucleotide encoding a CAR) described herein. Prime editing is a search-and-replace genome editing technology that mediates targeted insertions, deletions, base-to-base conversions, and combinations thereof in human cells without requiring DSBs or donor DNA templates. Prime editing can utilize a fusion protein that includes a Cas9 endonuclease with a catalytic disruption, an engineered reverse transcriptase enzyme, an RNA programmable nickase, and / or a prime editing guide RNA (pegRNA) to copy genetic information directly from an extension on the pegRNA to a target genomic locus. Methods for designing and using prime editing are known in the art. See, for example, Anzalone, AV, Randolph, RV, Davis, JR et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149–157 (2019), incorporated herein by reference in its entirety.

[0117] 109. It is understood and contemplated herein that the disclosed methods can be used with any cell type, including T cells, B cells, macrophages, NK cells, NK-T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells and / or muscle cells, as well as any other cell type. Human NK cells are a particularly good target for the disclosed plasmids and methods of using them. NK cells are a subset of peripheral blood lymphocytes defined by the expression of CD56 or CD16 and the absence of a T cell receptor (CD3). NK cells detect and kill target cells that lack major histocompatibility complex (MHC) class I molecules. Receptors that activate NK cells include, among others, the natural cytotoxicity receptors (NKp30, NKp44, and NKp46) and the lectin-like receptors NKG2D and DNAM-1.Their ligands are expressed on stressed, transformed, or infected cells, but not on normal cells, rendering normal cells resistant to killing by NK cells. NK cell activation is negatively regulated by inhibitory receptors such as killer immunoglobulin (Ig)-like receptors (KIRs), NKG2A / CD94, TGFD, and leukocyte Ig-like receptor-1 (LIR-1). In one aspect, the target cells may be primary NK cells from a donor source, such as, for example, an allogeneic donor source for adoptive transfer therapy or an autologous donor source (i.e., the final recipient of the modified cells), an NK cell line (including, but not limited to, NK RPMI8866; HFWT, K562, and EBV-LCL), or a source of expanded NK cells derived from a primary NK cell source or NK cell line.

[0118] 110. Prior to transduction of cells (such as, for example, T cells, B cells, macrophages, NK cells, NK-T cells, fibroblasts, osteoblasts, hepatocytes, neuronal cells, epithelial cells, and / or muscle cells), the cell may be incubated in a medium suitable for cell expansion. It is understood and assumed herein that culture conditions may include the addition of cytokines, antibodies, and / or feeder cells. Thus, in one aspect, disclosed herein are methods for genetically modifying a cell (such as, for example, a T cell, a B cell, a macrophage, an NK cell, an NK-T cell, a fibroblast, an osteoblast, a hepatocyte, a nerve cell, an epithelial cell, and / or a muscle cell), further comprising incubating the cells for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to transducing the cells in a medium that supports cell proliferation; wherein the medium further comprises cytokines, antibodies, and / or feeder cells.For example, the medium may comprise IL-2, IL-12, IL-15, IL-18, and / or IL-21. In one aspect, the medium may also comprise an anti-CD3 antibody. In one aspect, the feeder cells may be purified from feeder cells that stimulate cells. For example, NK cell-stimulating feeder cells for use in the claimed invention disclosed herein may be either irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs), or non-irradiated autologous PBMCs; RPMI8866; HFWT, K562; K562 cells transfected with membrane-bound IL-15 and 41BBL, or IL-21, or any combination thereof; or EBV-LCL. In some aspects, feeder cells are provided in combination with a solution of IL-21, IL-15, and / or 41BBL. Feeder cells can be seeded into the cell culture at a ratio of 1:2, 1:1, or 2:1. It is understood and suggested herein that the culture period can range from 1 to 14 days post-AAV infection (i.e.,1,2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 days), preferably from 3 to 7 days, most preferably from 4 to 6 days.

[0119] 111. It is understood and contemplated herein that the incubation conditions for primary cells and expanded cells (including, but not limited to, primary and expanded T cells, NK cells, NK-T cells, or B cells) may be different. In one aspect, culturing primary NK cells or NK-T cells prior to AAV infection includes medium and cytokines (such as, for example, IL-2, IL-12, IL-15, IL-18, and / or IL-21) and / or an anti-CD3 antibody for less than 5 days (e.g., 1, 2, 3, or 4 days). For expanded NK cells, culturing can occur in the presence of NK feeder cells (e.g., at a 1:1 ratio) in addition to or instead of cytokines (such as IL-2, IL-12, IL-15, IL-18, and / or IL-21) and / or in addition to or instead of anti-CD3 antibody. Expanded NK cells can be cultured 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 days prior to transduction.Thus, in one aspect, disclosed herein are methods for genetically modifying a cell (e.g., a T cell, a B cell, a macrophage, an NK cell, an NK-T cell, a fibroblast, a neuron, an osteoblast, a hepatocyte, an epithelial cell, and / or a muscle cell) comprising incubating primary cells for 4 days in the presence of IL-2 prior to infection with an AAV vector and / or electroporation (when an RNP complex is administered by electroporation) or incubating expanded cells in the presence of irradiated feeder cells for 4, 5, 6, or 7 days prior to infection with AAV and / or electroporation when an RNP complex is administered by electroporation.

[0120] 112. After transduction (e.g., by AAV infection or electroporation) of a cell (e.g., a T cell, B cell, macrophage, NK cell, NK T cell, fibroblast, osteoblast, hepatocyte, nerve cell, epithelial cell, and / or muscle cell), the newly modified cell can be expanded in a medium containing feeder cells that stimulate the modified cells (such as, for example, a T cell, B cell, macrophage, NK cell, NK T cell, fibroblast, osteoblast, hepatocyte, nerve cell, epithelial cell, and / or muscle cell). In this way, the modified cells retain viability and proliferative potential because they are able to expand after AAV infection and / or electroporation (when the RNP complex is administered by electroporation) using irradiated feeder cells.For example, NK cell stimulating feeder cells for use in the claimed invention disclosed herein can be either irradiated autologous or allogeneic peripheral blood mononuclear cells (PBMCs), or non-irradiated autologous PBMCs; RPMI8866; HFWT, K562; K562 cells transfected with membrane-bound IL-15 and 41BBL, or IL-21, or any combination thereof; or EBV-LCL. In some aspects, the NK feeder cells are presented in combination with a solution of IL-21, IL-15 and / or 41BBL. The feeder cells can be seeded into the NK cell culture at a ratio of 1:2, 1:1, or 2:1. It is understood and suggested herein that the culture period may be from 1 to 14 days after infection and / or electroporation (i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 days), preferably from 3 to 7 days, most preferably from 4 to 6 days.In some aspects, the culture medium for modified NK cells may further comprise cytokines, such as, for example, IL-2, IL-12, IL-15, IL-18 and / or IL-21.

[0121] 113. In one aspect, it is understood and contemplated herein that one purpose of the disclosed methods for genetically modifying a cell is to obtain a modified cell. Accordingly, modified T cells, B cells, macrophages, NK cells, NK-T cells, fibroblasts, osteoblasts, hepatocytes, neural cells, epithelial cells, and / or muscle cells obtained by the disclosed methods are disclosed herein. Thus, in one aspect, modified NK cells and / or NK-T cells (including, but not limited to, CAR-NK cells and / or CAR-NK-T cells) comprising any of the plasmids or vectors disclosed herein are disclosed herein.For example, disclosed herein are anti-CD33 CAR NK cells and anti-CD33 CAR NK T cells (including, but not limited to, anti-CD33 CAR NK cells and / or anti-CD33 NK T cells, wherein the anti-CD33 CAR comprises an scFv targeting CD33, a transmembrane domain (such as, for example, an NKG2D transmembrane domain, a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, and / or a CD3ζ transmembrane domain) and a costimulatory domain (such as, for example, a 2B4 domain, a CD28 costimulatory domain, a 4-1BB costimulatory domain, or any combination of a 2B4 domain, a CD28 costimulatory domain, and / or a 4-1BB costimulatory domain).

[0122] 114. In one aspect, disclosed herein are methods for generating a chimeric antigen receptor (CAR) natural killer (NK) cell, comprising a) providing a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) in complex with an appropriate CRISPR / Cas guide RNA and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is adjacent to one PAM and crRNA or flanked by two PAMs and crRNA; and b) introducing the transgene and the RNP complex into a cell; wherein the transgene is introduced into the cell by infecting a target cell with an adeno-associated virus (AAV); In this case, the ribonucleoprotein (RNP) complex hybridizes to a target sequence in the cell's genomic DNA, and the cell's DNA repair enzymes insert the transgene into the host genome at the target sequence (e.g., by non-homologous end joining), thereby creating a modified cell.In one aspect, the method may further comprise introducing the RNP complex into a cell via electroporation (e.g., by modifying an NK cell or NK T cell). In one aspect, the method may further comprise superinfecting the target cell with a second AAV virus containing the RNP complex. In one aspect, when the transgene is sufficiently small, the same AAV may contain both the transgene and the RNP complex. In another aspect, the transgene and the RNP complex may be encoded on the same plasmid.

[0123] 115. In one aspect, disclosed herein is a method for genetically modifying a cell, comprising a) obtaining a ribonucleoprotein (RNP) complex comprising a CRISPR / Cas class 2 (Cas9) endonuclease in complex with an appropriate CRISPR / Cas guide RNA, and an AAV vector comprising a plasmid comprising a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide; wherein the polynucleotide sequence is flanked by homology arms; and wherein the homology arms are 800 bp or less in length; and b) introducing the polynucleotide sequence and the RNP complex into a cell; wherein the polynucleotide sequence is introduced into the cell by infecting the cell with AAV; In this case, the RNP complex hybridizes with a target sequence in the cell's genomic DNA, and the cell's DNA repair enzymes insert the transgene into the host genome at the target sequence in the cell's genomic DNA, thereby creating a modified cell.In some embodiments, the cell is an NK cell.

[0124] 116. In one aspect, the modified cells (e.g., NK cells) used in the disclosed immunotherapy methods and created by the disclosed modification methods may be primary cells from a donor source (such as, for example, an allogeneic donor source for adoptive transfer therapy or an autologous donor (i.e., the final recipient of the modified cells)), a cell line (including, but not limited to, the NK cell lines NK RPMI8866; HFWT, K562, and EBV-LCL), or from an expanded cell source derived from a primary cell source or cell line. Since primary cells may be used, it is understood and contemplated herein that the disclosed cell modifications may occur ex vivo or in vitro.

[0125] 117. The cells used herein can be primary cells or expanded cells. Primary cells can be incubated for approximately 4 to 10 days in the presence of IL-2 prior to infection with AAV vectors. In one example, primary cells are expanded for approximately 4 to 10 days in the presence of irradiated feeder cells, plasma membrane particles, or exosomes prior to infection. In some embodiments, the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-associated 4-1BBL, membrane-associated IL-21, or membrane-associated -15, or any combination thereof.

[0126] 118. After transduction of cells (e.g., NK cells), the modified cells can be expanded and stimulated before administering the modified (i.e., engineered) cells to a subject. For example, disclosed herein are methods for adoptively transferring immune cells to a subject in need thereof, in which an immune cell (e.g., a natural killer (NK) cell) is expanded using irradiated feeder cells, plasma membrane particles (PM), or exosomes (EX) that express membrane-bound IL-21 (mblL-21) (PM particles and EX exosomes expressing mblL-21 are referred to herein as PM21 particles and EX21 exosomes, respectively) before administration to the subject. In some aspects, the expansion may further include irradiated feeder cells, plasma membrane particles (PM), or exosomes expressing membrane-associated IL-15 (mblL-15) and / or membrane-associated 4-1BBL (mb4-1BBL).In some aspects, it is understood and contemplated herein that stimulation and expansion of modified (i.e., engineered) cells may occur in vivo following or concurrent with the administration of the modified cells to a subject. Accordingly, disclosed herein are methods of immunotherapy in which cells (e.g., NK cells) are expanded in a subject following the transfer of the cells to the subject by administering IL-21 or PM particles with mblL-21, exosomes with mblL-21, and / or irradiated feeder cells expressing mblL-21. In some aspects, expansion further comprises administering IL-15 and / or 4-1BBL or PM particles, exosomes, and / or irradiated feeder cells that express membrane-bound IL-15 and / or 4-1BBL.

[0127] 119. In some embodiments of the invention, the method disclosed herein comprises infecting an NK cell with an MOI of AAV in the range of about 1 to about 1000 thousand MOI (e.g., about 5 to 500 thousand MOI) of AAV. For example, the method disclosed herein comprises infecting an NK cell with at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, or 500 MOI of AAV.

[0128] 1. Hybridization / selective hybridization

[0129] 120. The term hybridization generally refers to a sequence-directed interaction between at least two nucleic acid molecules, such as a primer or probe, and a genome. A sequence-directed interaction refers to an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide-specific manner. For example, G interacting with C or A interacting with T are sequence-directed interactions. Typically, sequence-directed interactions occur at the Watson-Crick surface or the Hoogsteen surface of a nucleotide. Hybridization of two nucleic acids is influenced by a number of conditions and parameters known to those skilled in the art. For example, salt concentration, pH, and reaction temperature influence whether two nucleic acid molecules will hybridize.

[0130] 121. The parameters of selective hybridization between two nucleic acid molecules are well known to those skilled in the art. For example, in some embodiments, the selective hybridization conditions may be defined as stringent hybridization conditions. For example, the stringency of hybridization is controlled by both the temperature and the salt concentration in one or both of the hybridization and washing steps. For example, hybridization conditions for achieving selective hybridization may include hybridization in a high ionic strength solution (6X SSC or 6X SSPE) at a temperature of about 12-25°C below the Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners), followed by washing at a combination of temperature and salt concentration that is selected such that the washing temperature is about 5°C to 20°C below the Tm.Temperature and salt conditions are easily determined empirically in preliminary experiments in which reference DNA samples immobilized on filters are hybridized with the labeled nucleic acid of interest and then washed under conditions of varying stringency. Hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridizations. Conditions can be used as described above to achieve stringency, or as known in the art. Preferred stringent hybridization conditions for DNA:DNA hybridization may be approximately 68°C (in aqueous solution) in 6X SSC or 6X SSPE, followed by a wash at 68°C. Hybridization and wash stringency can be reduced, if desired, as the desired degree of complementarity decreases and, further, depending on the GC or A-T content of any region in which variability is sought.Likewise, the stringency of hybridization and washing may, if desired, be increased accordingly as the desired homology increases, and further depending on the GC or A-T content in any region in which high homology is desired, all as is known in the art.

[0131] 122. Another way to determine selective hybridization is to look at the amount (percentage) of one of the nucleic acids associated with the other nucleic acid. For example, in some embodiments of the invention, the selective hybridization conditions will be such that at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the limiting nucleic acid is associated with the non-limiting nucleic acid. Typically, the non-limiting primer is present in, for example, 10-, 100-, or 1000-fold excess. This type of assay can be performed under conditions where both the limiting and non-limiting primers are, for example, 10-, 100-, or 1000-fold lower than their k d , or when only one of the nucleic acid molecules is 10 times, or 100 times, or 1000 times, or when one or both nucleic acid molecules exceed their k d .

[0132] 123 Another way to determine selective hybridization is to look at the percentage of primer that has undergone enzymatic digestion under conditions that require hybridization to achieve the desired enzymatic digestion. For example, in some embodiments, the selective hybridization conditions will be such that at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer is enzymatically processed under conditions that facilitate the enzymatic processing, for example, if the enzymatic processing is DNA extension, then the selective hybridization conditions will be such that at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of primer molecules are elongated.Preferred conditions also include conditions suggested by the manufacturer or indicated in the art as suitable for the enzyme performing the treatment.

[0133] 124. As with homology, it is understood that there are numerous methods disclosed herein for determining the level of hybridization between two nucleic acid molecules. It is understood that these methods and conditions may provide different percentages of hybridization between the two nucleic acid molecules, but unless otherwise specified, adherence to the parameters of any one of the methods will suffice. For example, if 80% hybridization is required, and as long as hybridization occurs within the required parameters in any of these methods, it is considered disclosed in this document.

[0134] 125. It is understood that those skilled in the art understand that if a composition or method satisfies any of these criteria for determining hybridization, either in combination or individually, then it is a composition or method disclosed herein.

[0135] 2. Nucleic acids

[0136] 126. This document discloses a variety of nucleic acid-based molecules. The disclosed nucleic acids consist, for example, of nucleotides, nucleotide analogs, or nucleotide substitutes. Non-limiting examples of these and other molecules are discussed herein. It is understood that, for example, when a vector is expressed in a cell, the expressed mRNA will typically consist of A, C, G, and U. It is also understood that if, for example, an antisense molecule is introduced into a cell or cellular environment via, for example, exogenous delivery, it is advantageous for the antisense molecule to consist of nucleotide analogs that reduce the degradation of the antisense molecule in the cellular environment.

[0137] a) Nucleotides and related molecules

[0138] 127. A nucleotide is a molecule that contains a base moiety, a sugar moiety, and a phosphate moiety. Nucleotides can be linked to each other through their phosphate and sugar moieties, forming an internucleoside linkage. The base moiety of a nucleotide can be adenine-9-yl (A), cytosin-1-yl (C), guanine-9-yl (G), uracil-1-yl (U), and thymin-1-yl (T). The sugar moiety of a nucleotide is ribose or deoxyribose. The phosphate moiety of a nucleotide is pentavalent phosphate. A non-limiting example of a nucleotide can be 3'-AMP (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate). There are many variations of these types of molecules available in the art and available herein.

[0139] 128. A nucleotide analog is a nucleotide containing some type of modification of the base, sugar, or phosphate moiety. Nucleotide modifications are well known in the art and may include, for example, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, and 2-aminoadenine, as well as modifications of the sugar or phosphate moieties. There are many variations of these types of molecules available in the art and disclosed herein.

[0140] 129. Nucleotide substitutes are molecules that have similar functional properties to nucleotides but lack a phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes are molecules that recognize nucleic acids using the Watson-Crick or Hoogsteen moiety, but which are linked to each other via a moiety other than the phosphate moiety. Nucleotide substitutes are capable of conforming to a double-helix structure when interacting with the corresponding target nucleic acid. Numerous variations of these types of molecules exist in the art and are described herein.

[0141] 130. Other types of molecules (conjugates) can also be linked to nucleotides or nucleotide analogs to enhance, for example, cellular uptake. Conjugates can be chemically linked to the nucleotide or nucleotide analogs. Such conjugates include, but are not limited to, lipid moieties such as a cholesterol moiety. (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556). There are many variations of these types of molecules available in the art and available herein.

[0142] 131. A Watson-Crick interaction is at least one interaction with the Watson-Crick surface of a nucleotide, nucleotide analog, or nucleotide surrogate. The Watson-Crick surface of a nucleotide, nucleotide analog, or nucleotide surrogate includes the C2, N1, and C6 positions of a purine-based nucleotide, nucleotide analog, or nucleotide surrogate and the C2, N3, and C4 positions of a pyrimidine-based nucleotide, nucleotide analog, or nucleotide surrogate.

[0143] 132. The Hoogsteen interaction is an interaction occurring at the Hoogsteen surface of a nucleotide or nucleotide analog that opens into the major groove of duplex DNA. The Hoogsteen surface includes the N7 position and reactive groups (NH2 or O) at the C6 position of purine nucleotides.

[0144] b) Sequences

[0145] 133. There are numerous sequences associated with protein molecules involved in the signaling pathways disclosed herein, such as CD33, 4-1BB, NKG2D, or 2B4, all of which are encoded by nucleic acids or are nucleic acids. The sequences of human analogs of these genes, as well as other analogs and alleles of these genes, as well as splice variants and other types of variants, are available in various protein and gene databases, including Genbank. Those skilled in the art understand how to resolve discrepancies and differences in sequences and adapt compositions and methods related to a particular sequence to other related sequences. Primers and / or probes can be designed for any given sequence taking into account the information disclosed herein and known in the art.

[0146] c) Primers and probes

[0147] 134. Disclosed are compositions comprising primers and probes that are capable of interacting with the disclosed nucleic acids, such as CD33, as disclosed herein. In some embodiments of the invention, the primers are used to support DNA amplification reactions. Typically, the primers are capable of being extended in a sequence-specific manner. Sequence-specific extension of a primer includes any methods in which the sequence and / or composition of the nucleic acid molecule to which the primer is hybridized or otherwise linked directs or influences the composition or sequence of the product obtained by extending the primer. Thus, sequence-specific extension of a primer includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription.Methods and conditions that amplify the primer in a sequence-specific manner are preferred. In some embodiments of the invention, the primers are used for DNA amplification reactions such as PCR or direct sequencing. It is understood that in some embodiments of the invention, the primers can also be extended using non-enzymatic methods, whereby, for example, the nucleotides or oligonucleotides used for primer extension are modified such that they will chemically react to extend the primer in a sequence-specific manner. Typically, the disclosed primers hybridize to the disclosed nucleic acids or nucleic acid region, or they hybridize to the complement of the nucleic acids or the complement of the nucleic acid region.

[0148] 135. Primers or probes for interacting with nucleic acids in certain embodiments of the invention can be of any size that supports the desired enzymatic treatment with the primer, such as DNA amplification or simple hybridization of the probe or primer. A typical primer or probe should be at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides in length.

[0149] 136. In other embodiments, the primer or probe may be less than or equal to 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides in length.

[0150] 137. CD33 gene primers are typically used to generate an amplified DNA product containing a portion of the CD33 gene or the entire gene. Typically, the product size will be such that it can be accurately determined to within 3, 2, or 1 nucleotide.

[0151] 138. In some embodiments, the product is at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500 or 4000 nucleotides in length.

[0152] 139. In other embodiments, the product is less than or equal to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500 or 4000 nucleotides in length.

[0153] Z. Delivery of compositions to cells

[0154] 140. A number of compositions and methods exist that can be used to deliver nucleic acids into cells either in vitro or in vivo. These methods and compositions can be generally divided into two classes: viral-based delivery systems and non-viral-based delivery systems. For example, nucleic acids can be delivered using a number of direct delivery systems, such as electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or by transferring genetic material in cells or carriers such as cationic liposomes. Suitable means for transfection, including viral vectors, chemical transfectants, or physicomechanical methods such as electroporation and direct DNA diffusion, are described, for example, by Wolff, J. A., et al., Science, 247, 1465-1468, (1990); and Wolff, J. A. Nature, 352, 815-818, (1991).Such methods are well known in the art and are readily adapted for use with the compositions and methods described herein. In some cases, the methods will be modified to work with larger DNA molecules. Furthermore, these methods can be used to target specific diseases and cell populations using the targeting properties of the carrier.

[0155] a) Nucleic acid-based delivery systems

[0156] 141. Transfer vectors can be any nucleotide construct used to deliver genes into cells (e.g., a plasmid), or as part of a general gene delivery strategy, such as as part of a recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)). In some examples, the plasmid described herein can be a DNA template or nucleotide construct containing the polynucleotide sequences described herein.

[0157] 142. Plasmid or viral vectors as used herein are vehicles that transfer exposed nucleic acids into a cell without cleavage and include a promoter that provides for the expression of a gene in the cells into which it is delivered. Viral vectors include, for example, adenovirus, adeno-associated virus, herpes virus, vaccinia virus, poliovirus, AIDS virus, neuronal trophic virus, Sindbis virus, and other RNA viruses, including those viruses with the HIV backbone. Also preferred are any viral families that possess the properties of these viruses, making them suitable for use as vectors. Retroviruses include Maloney murine leukemia virus, MMLV, and retroviruses that exhibit the desired properties of MMLV as a vector. Retroviral vectors are capable of carrying a larger genetic payload, i.e.A transgene or marker gene is carried by adenovirus vectors more easily than by other viral vectors, making them widely used. However, they are less applicable to non-proliferating cells. Adenovirus vectors are relatively stable, easy to handle, have high titers, can be delivered by aerosol, and can transfect non-dividing cells. Smallpox virus vectors are large and have multiple gene insertion sites. They are thermostable and can be stored at room temperature. A preferred embodiment is a viral vector engineered to suppress the host immune response elicited by viral antigens. Preferred vectors of this type will carry regions encoding interleukin 8 or 10.

[0158] 143. Viral vectors can have higher translocation capacities (the ability to introduce genes) than chemical or physical methods of introducing genes into cells. Typically, viral vectors contain nonstructural early genes, structural late genes, an RNA polymerase III transcript, inverted terminal repeats required for replication and encapsidation, and promoters to control transcription and replication of the viral genome. When engineered as vectors, viruses typically have one or more early genes deleted, and a gene or gene / promoter cassette is inserted into the viral genome in place of the deleted viral DNA. Constructs of this type can carry up to 8 kb of foreign genetic material. The necessary functions of the deleted early genes are usually provided by cell lines engineered to express the gene products of the early genes in trans.

[0159] (1) Adeno-associated viral vectors

[0160] 144. Another type of viral vector is based on the adeno-associated virus (AAV). This defective parvovirus is the preferred vector because it can infect many cell types and is nonpathogenic to humans. AAV-type vectors can transport 4 to 5 kb, and wild-type AAVs are known to stably integrate into chromosome 19 (e.g., at AAV integration site 1 (AAVS1)). Vectors that contain this site-specific integration feature are preferred. The AAVs used can be derived from any AAV serotype, including but not limited to AAC1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, and recombinant (rAAV), such as, for example, AAV-Rh74, and / or synthetic AAV (such as, for example, AAV-DJ, Anc80). AAV serotypes can be selected based on cell or tissue tropism. AAV-based vectors for use in the disclosed compositions and methods can be single-chain (SS) or self-complementary (SC).

[0161] 145. In another type of AAV virus, the AAV contains a pair of inverted terminal repeats (ITRs) flanking at least one cassette containing a promoter that directs cell-specific expression, operably linked to a heterologous gene. Heterologous in this context refers to any nucleotide sequence or gene that is not native to the AAV or B19 parvovirus.

[0162] 146. Typically, the coding regions of AAV and B19 are deleted, resulting in a safe, non-cytotoxic vector. AAV ITRs or their modifications confer infectivity and site-specific integration, but not cytotoxicity, and the promoter directs cell-specific expression.

[0163] 147. Thus, the disclosed vectors provide DNA molecules that are capable of integrating into the mammalian chromosome without significant toxicity.

[0164] 148. Integrated genes in viruses and retroviruses typically contain promoters and / or enhancers that facilitate control of expression of the desired gene product. A promoter is typically a DNA sequence or sequences that function when in a relatively fixed position relative to the transcription start site. The promoter contains core elements necessary for the basic interaction of RNA polymerase and transcription factors and may contain upstream and response elements.

[0165] 149. It should be understood, and is assumed in this document, that the packaging capacity of AAV is limited. One way to overcome the loading capacity of the AAV vector is to use two vectors, with the transgene divided between two plasmids and a 3' splice donor and 5' splice acceptor used to join the two transgene regions into a single full-length transgene. Alternatively, two transgenes can be produced with significant overlap, and homologous recombination will result in the joining of the two segments into a full-length transcript.

[0166] 4. Expression systems

[0167] 150. Nucleic acids delivered into cells typically contain expression control systems. For example, inserted genes in viral and retroviral systems typically contain promoters and / or enhancers that facilitate control of expression of the desired gene product. A promoter is typically a DNA sequence or sequences that function when in a relatively fixed position relative to the transcription start site. A promoter contains core elements necessary for the basic interaction of RNA polymerase and transcription factors and may contain upstream and response elements.

[0168] a) Viral promoters and enhancers

[0169] 151. Preferred promoters controlling transcription from vectors in mammalian host cells can be obtained from various sources, for example, from the genomes of viruses such as polyoma, simian virus 40 (SV40), adenovirus, retroviruses, hepatitis B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, for example, the beta-actin promoter. The early and late promoters of SV40 virus are conveniently obtained as a restriction fragment of SV40, which also contains the origin of replication of SV40 virus (Fiers et al., Nature, 273: 113 (1978)). The immediate-early promoter of human cytomegalovirus is conveniently obtained as a restriction fragment of HindIII E (Greenway, PJ et al., Gene 18: 355-360 (1982)). Of course, promoters from the host cell or related species may also be applicable herein.

[0170] 152. An enhancer generally refers to a DNA sequence that functions at any fixed distance from the transcription start site and can be either 5((Laimins, L. et al., Proc. Natl. Acad. Sci. 78: 993 (1981)) or 3((Lusky, ML, et al., Mol. Cell Bio. 3: 1108 (1983)) relative to the transcription unit. Additionally, enhancers can be located within an intron (Banerji, JL et al., Cell 33: 729 (1983)) as well as within the coding sequence itself (Osborne, TF, et al., Mol. Cell Bio. 4: 1293 (1984)). They are typically 10 to 300 bp in length and function in cis. Enhancers enhance transcription from nearby promoters. Enhancers also often contain response elements that mediate transcriptional regulation. Promoters can also contain response elements that mediate transcriptional regulation. Enhancers often determine the regulation of gene expression.Although many enhancer sequences are currently known from mammalian genes (globin, elastase, albumin, β-fetoprotein, and insulin), enhancers from eukaryotic viruses are typically used for general expression. Preferred examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma virus enhancer on the late side of the replication origin, and adenovirus enhancers.

[0171] 153. The promoter and / or enhancer can be specifically activated either by light or by specific chemical events that trigger their function. These systems can be regulated using reagents such as tetracycline and dexamethasone. There are also ways to enhance viral vector gene expression by exposure to radiation, such as gamma irradiation, or alkylating chemotherapeutic drugs.

[0172] 154. In certain embodiments, the promoter and / or enhancer region may act as a constitutive promoter and / or enhancer to maximize expression of the region of the transcription unit to be transcribed. In certain constructs, the promoter and / or enhancer region is active in all eukaryotic cell types, even if it is expressed only in a specific cell type at a specific time. A preferred promoter of this type is the CMV promoter (650 bases). Other preferred promoters include the SV40 promoter, the cytomegalovirus promoter (full-length promoter), and the LTR of a retroviral vector.

[0173] 155. It was shown that all specific regulatory elements can be cloned and used to construct expression vectors that are selectively expressed in specific cell types, such as melanoma cells. The glial fibrillary acidic protein (GFAP) promoter was used for selective gene expression in cells of glial origin.

[0174] 156. Expression vectors for use in eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells) may also contain sequences required for transcription termination, which can influence mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of mRNA encoding the tissue factor protein. The 3'-untranslated regions also include transcription termination sites. Preferably, the transcription unit also contains a polyadenylation region. One advantage of this region is that it increases the likelihood that the transcribed unit will be processed and transported similarly to mRNA. The identification and use of polyadenylation signals in expression constructs is well known. Preferably, homologous polyadenylation signals are used in transgene constructs.In some transcription units, the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of approximately 400 bases. It is also preferred that the transcribed units contain other standard sequences, either alone or in combination with the above sequences, that improve expression or construct stability.

[0175] b) Markers

[0176] 157. Viral vectors may include a nucleic acid sequence encoding a marker product. This marker product is used to determine whether a gene has been delivered to a cell and whether it is expressed after delivery. Preferred marker genes are the E. coli lacZ gene, which encodes β-galactosidase, and green fluorescent protein.

[0177] 158. In some embodiments, the marker may be a selectable marker. Examples of suitable selectable markers for mammalian cells include dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hygromycin, and puromycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive under selective pressure. There are two widely used distinct categories of selection schemes. The first category is based on cellular metabolism and the use of a mutant cell line that is unable to grow independently of supplemented medium. Two examples are CHO DHFR cells and mouse LTK cells. These cells are unable to grow without the addition of nutrients such as thymidine or hypoxanthine.Because these cells lack certain genes required for the complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in the supplemented medium. An alternative to supplementing the medium is to introduce the intact DHFR or TK gene into cells lacking the corresponding genes, which alters their growth requirements. Individual cells that are not transformed with the DHFR or TK gene will not survive in the unsupplemented medium.

[0178] 159. The second category is dominant selection, which refers to a selection scheme used for any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest the growth of the host cell. Those cells that have the new gene will express the drug resistance protein and survive the selection. Examples of such dominant selection include the drugs neomycin (Southern P. and Berg, P., J. Molec. Appl. Genet. 1: 327 (1982)), mycophenolic acid (Mulligan, RC and Berg, P. Science 209: 1422 (1980)) or hygromycin (Sugden, B. et al., Mol. Cell. Biol. 5: 410-413 (1985)). Three examples use bacterial genes under eukaryotic control to confer resistance to the respective drug G418 or neomycin (geneticin), xgpt (mycophenolic acid), or hygromycin, respectively.Others include the neomycin analogue G418 and puramycin.

[0179] 5. Peptides

[0180] a) Protein variants

[0181] 160. Protein variants and derivatives are well known to those skilled in the art and may include modifications of the amino acid sequence. For example, amino acid sequence modifications typically fall into one or more of three classes: substitution, insertional, or deletional variants. Insertions include fusions at the amino and / or carboxyl termini, as well as intrasequence insertions of one or more amino acid residues. Insertions are typically smaller in size than fusions at the amino or carboxyl termini, for example, on the order of one to four residues. Immunogenic fusion protein derivatives, such as those described in the examples, are produced by fusing a polypeptide large enough to confer immunogenicity to the target sequence, by in vitro cross-linking, or by recombinant cell culture transformed with DNA encoding the fusion.Deletions are characterized by the removal of one or more amino acid residues from a protein sequence. Typically, no more than about 2 to 6 residues are deleted at any one site in the protein molecule. These variants are typically produced by site-directed mutagenesis of nucleotides in the protein-encoding DNA, thereby producing DNA encoding the variant, and then expressing the DNA in recombinant cell culture. Methods for producing substitution mutations at predetermined sites in DNA of known sequence are well known, such as M13 primer mutagenesis and PCR mutagenesis. Amino acid substitutions typically consist of single residues but can occur simultaneously at several different sites; insertions will typically be on the order of about 1 to 10 amino acid residues; and deletions will range from about 1 to 30 residues. Deletions or insertions are preferably made in adjacent pairs, i.e., a deletion of 2 residues or an insertion of 2 residues.Substitutions, deletions, insertions, or any combination thereof can be combined to produce the final construct. Mutations should not place the sequence out of frame and, preferably, should not create complementary regions that could contribute to mRNA secondary structure. Substitution variants are those in which at least one residue has been deleted and another residue inserted in its place. Such substitutions are typically made according to the following Tables 5 and 6 and are called conservative substitutions.

[0182]

[0183]

[0184] 161. Substantial changes in function or immunological identity are achieved by selecting substitutions that are less conservative than the substitutions in Table 6, i.e., by selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the region of the substitution, such as a sheet or helix conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.Substitutions that are generally expected to cause the greatest changes in protein properties are those in which (a) a hydrophilic residue, such as seryl or threonyl, is replaced by or with a hydrophobic residue, such as leucyl, isoleucyl, phenylalanyl, valyl, or alanyl; (b) a cysteine ​​or proline is replaced by or with any other residue; (c) a residue having an electropositive side chain, such as lysyl, arginyl, or histidyl, is replaced by or with an electronegative residue, such as glutamyl or aspartyl; or (d) a residue having a bulky side chain, such as phenylalanine, is replaced by or with a residue having no side chain, such as glycine, in this case (e) by increasing the number of sites for sulfation and / or glycosylation.

[0185] 162. For example, the substitution of one amino acid residue for another, biologically and / or chemically similar, is known to those skilled in the art as a conservative substitution. For example, a conservative substitution can be the substitution of one hydrophobic residue for another or one polar residue for another. These substitutions include combinations such as, for example, Gly, Ala; Val, Ile, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr. Such conservatively substituted variations of each explicitly described sequence are included in the mosaic polypeptides provided herein.

[0186] 163. Substitution or deletion mutagenesis can be used to insert sites for N-glycosylation (Asn-X-Thr / Ser) or O-glycosylation (Ser or Thr). Deletions of cysteine ​​or other labile residues may also be desirable. Deletions or substitutions of potential proteolytic sites, such as Arg, are accomplished, for example, by deleting one of the basic residues or replacing one with a glutaminyl or histidyl residue.

[0187] 164. Some post-translational derivatizations result from the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are often post-translationally deamidated to the corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of the hydroxyl groups of seryl or threonyl residues, methylation of the o-amino groups of the side chains of lysine, arginine, and histidine (T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco pp 79–86

[1983] ), acetylation of the N-terminal amine, and, in some cases, amidation of the C-terminal carboxyl.

[0188] 165. It is understood that one way to define variants and derivatives of the proteins disclosed herein is to define variants and derivatives in terms of homology / identity to specific known sequences. In particular, variants of these and other proteins described herein are disclosed that are at least 70%, or 75%, or 80%, or 85%, or 90%, or 95% homologous to the claimed sequence. Those skilled in the art readily understand how to determine the homology of two proteins. For example, homology can be calculated after aligning two sequences so that homology is at the highest level.

[0189] 166. Another method of calculating homology can be performed using published algorithms. Optimal alignment of sequences for comparison can be performed using the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), the similarity search method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85: 2444 (1988), computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics software package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.

[0190] 167. The same types of homology can be obtained for nucleic acids, for example, using the algorithms disclosed in Zuker, M. Science 244:48–52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706–7710, 1989, Jaeger et al. Methods Enzymol. 183:281–306, 1989.

[0191] 168. It is understood that the description of conservative mutations and homology can be combined together in any combination, such as embodiments that are at least 70% homologous to a particular sequence, wherein the variants are conservative mutations.

[0192] 169. Since various proteins and protein sequences are discussed in this document, it is understood that nucleic acids that can encode these protein sequences are also disclosed. This may include all degenerate sequences related to a particular protein sequence, i.e., all nucleic acids having a sequence that encodes one particular protein sequence, as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the protein sequences. Thus, although each specific nucleic acid sequence cannot be described in this document, it should be understood that each sequence is in fact disclosed and described herein by means of the described protein sequence.It is also understood that, although no amino acid sequence indicates which specific DNA sequence encodes that protein in an organism, when specific variants of the described protein are disclosed herein, a known nucleic acid sequence that encodes that protein is also known, disclosed, and described herein.

[0193] 170. It is understood that there are many amino acid and peptide analogs that can be included in the disclosed compositions. For example, there are many D-amino acids or amino acids whose functional substituents differ from the amino acids shown in Table 5 and Table 6. Opposite stereoisomers of naturally occurring peptides, as well as stereoisomers of peptide analogs, are disclosed. These amino acids can be readily incorporated into polypeptide chains by populating tRNA molecules with the selected amino acid and constructing genetic constructs that use, for example, amber codons to insert the amino acid analog into the peptide chain in a site-specific manner.

[0194] 171. Molecules resembling peptides but not linked by a natural peptide bond can be obtained. For example, bonds for amino acids or amino acid analogs may include CH2NH--, --CH2S--, -CH2-CH2--, -CH=CH-(cis and trans), -COCH2--, -CH(OH)CH2-, and -CHH2SO- (These and others can be found in Spatola, AF in Chemistry and Biochemistry of Amino Acids, Peptides, and Proteins, B. Weinstein, eds., Marcel Dekker, New York, p. 267 (1983); Spatola, AF, Vega Data (March 1983), Vol. 1, Issue 3, Peptide Backbone Modifications (general review); Morley, Trends Pharm Sci (1980) pp. 463-468; Hudson, D. et al., Int J Pept Prot Res 14:177-185 (1979) (-CH2NH-, CH2CH2--); Spatola et al. Life Sci 38:1243–1249 (1986) (-CH H2-S); Hann J. Chem. Soc Perkin Trans. I 307-314 (1982) (-CH-CH-, cis and trans); Almquist et a IJ Med. Chem. 23:1392-1398 (1980) (-COCH2-); Jennings-White et al. Tetrahedron Lett 23:2533 (1982) (-COCH2-); Szelke et al.European Application EP 45665 CA (1982): 97:39405 (1982) (-CH(OH)CH2-); Holladay et al. Tetrahedron. Lett 24:4401-4404 (1983) (-C(OH)CH2--); and Hruby Life Sci 31:189-199 (1982) (--CH2--S--); each of which is incorporated herein by reference. A particularly preferred non-peptide bond is -CH2NH--. It is understood that peptide analogs may have more than one atom between the bond atoms, such as b-alanine, g-aminobutyric acid, and the like.

[0195] 172. Amino acid analogues and peptide analogues often have improved or desirable properties, such as more cost-effective production, higher chemical stability, improved pharmacological properties (half-life, absorption, activity, efficacy, etc.), altered specificity (e.g., broad spectrum of biological activity), reduced antigenicity, and others.

[0196] 173. D-amino acids can be used to create more stable peptides because D-amino acids are not recognized by peptidases and the like. Systematic replacement of one or more amino acids of the consensus sequence with a D-amino acid of the same type (e.g., D-lysine instead of L-lysine) can be used to produce more stable peptides. Cysteine ​​residues can be used for cyclization, or linking two or more peptides together. This can be useful for constraining peptides in specific conformations.

[0197] 6. Pharmaceutical carriers / Delivery of pharmaceuticals

[0198] 174. As described above, the compositions can also be administered in vivo in a pharmaceutically acceptable carrier. By "pharmaceutically acceptable" is meant a material that is not biologically or otherwise undesirable, i.e., the material can be administered to a subject along with the nucleic acid or vector without causing any undesirable biological effects or harmful interactions with any of the other components of the pharmaceutical composition in which it is contained. The carrier, of course, should be selected to minimize any degradation of the active ingredient and minimize any adverse side effects in the subject, as is well known to those skilled in the art.

[0199] 175. The compositions can be administered orally, parenterally (e.g., intravenously), intramuscularly, intraperitoneally, transdermally, extracorporeally, topically, and the like, including topical intranasal administration or administration via an inhaler. The term "topical intranasal administration" as used herein means delivery of the compositions to the nasal cavity and nasal passages through one or both nostrils and may include delivery via a spray or dropper mechanism or by aerosolization of nucleic acid or vector. Administration of the compositions via an inhaler can be accomplished through the nasal cavity or oral cavity using a spray or dropper mechanism. Delivery can also be accomplished directly to any area of ​​the respiratory system (e.g., the lungs) via intubation.The exact amount of composition required will vary from subject to subject, depending on the species, age, weight, and general health of the subject, the severity of the allergic disorder being treated, the specific nucleic acid or vector used, the route of administration, and the like. Therefore, it is impossible to specify a precise amount for each composition. However, the appropriate amount can be determined by one skilled in the art using only routine experimentation, taking into account the teachings of this document.

[0200] 176. Parenteral administration of the composition, if used, is typically characterized by injection. Injectable preparations can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for reconstitution of the suspension in liquid prior to injection, or as emulsions. A recently revised approach to parenteral administration involves the use of slow-release or extended-release systems so that a constant dose is maintained. See, for example, U.S. Patent No. 3,610,795, which is incorporated herein by reference.

[0201] 177. Materials may be in solution or suspension (e.g., as microparticles, liposomes, or cells). They can be targeted to a specific cell type via antibodies, receptors, or receptor ligands. The following references are examples of the application of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, KD, Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconjugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol, 42:2062-2065, (1991)).Carriers such as "steles" and other antibody-conjugated liposomes (including a lipid-mediated drug targeting colon carcinoma), receptor-mediated DNA targeting via cell-specific ligands, lymphocyte-directed tumor targeting, and highly specific therapeutic retroviral targeting of mouse glioma cells in vivo. The following references are examples of the application of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)). In general, receptors are involved in endocytosis pathways, either constitutive or ligand-induced.These receptors are clustered in clathrin-coated pits, enter the cell through clathrin-coated vesicles, pass through an acidified endosome where the receptors are sorted, and then either return to the cell surface, accumulate intracellularly, or are degraded in lysosomes. Internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, ligand dissociation and degradation, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, ligand type, ligand valence, and ligand concentration. The molecular and cellular mechanisms of receptor-mediated endocytosis are reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399–409 (1991)).

[0202] 7. Method for Treating Cancer 178. The plasmids, vectors, and modified NK cells and NK T cells described herein can be used to treat, inhibit, reduce, attenuate, alleviate, and / or prevent any disease in which uncontrolled cellular proliferation occurs, such as cancer. Cancer immunotherapy has been improved in recent years; genetically modified chimeric antigen receptor (CAR) T cells are an excellent example of engineered immune cells successfully used in cancer immunotherapy. These cells have recently been approved by the FDA for the treatment of CD19+ B cell malignancies, but so far, success has been limited to diseases bearing multiple target antigens, and targeting such limited antigen repertoires is prone to failure due to immune escape.Furthermore, CAR-T cells have focused on using autologous T cells due to the risk of graft-versus-host disease (GvHD) caused by allogeneic T cells. In contrast, NK cells are capable of killing tumor targets in an antigen-independent manner and do not cause GvHD, making them good candidates for cancer immunotherapy. It is understood and suggested herein that the disclosed plasmids and methods can be used to generate, for example, CAR-NK T cells and CAR-NK cells for cancer targeting.

[0203] 179. Thus, disclosed herein are methods for treating, reducing, decreasing, inhibiting, ameliorating, and / or preventing cancer and / or metastasis (such as, for example, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), and / or myelodysplastic syndrome (MDS)) in a subject, comprising administering to the subject with cancer any modified cells (e.g., modified NK cells and NK-T cells) disclosed herein.For example, disclosed herein are methods for treating, reducing, decreasing, inhibiting, ameliorating, and / or preventing cancer and / or metastasis (such as, for example, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic myeloid leukemia (CML), hairy cell leukemia (HCL), and / or myelodysplastic syndrome (MDS)) in a subject, comprising administering to the subject a therapeutically effective amount of natural killer (NK) cells or NK T cells, wherein the NK cells or NK T cells comprise a plasmid for use with clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-acco^npoBaHHbix 9 (Cas9) integration systems, wherein the plasmid comprises, in order of the left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide (such such as CD33 targeting CAR) and a right homology arm; the length of the left and right homology arms is 1000 bp or less (e.g., 600 bp).O.).

[0204] 180. "Inhibit," "inhibiting," and "inhibition" mean a reduction in an activity, response, condition, disease, or other biological parameter. This may include, without limitation, complete elimination of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease compared to the native or control level. Thus, the reduction may be 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any intermediate value compared to native or control levels.

[0205] 181. By "reduce," or other forms of the word such as "effect of reduction" or "reduction," is meant a decrease in a phenomenon or characteristic (e.g., tumor growth). It should be understood that this usually refers to some standard or expected value; in other words, it is relative, but it is not always necessary to refer to a standard or relative value. For example, "reduces tumor growth" means a decrease in the rate of tumor growth compared to a standard or control.

[0206] 182. By "prevent," or other forms of this word, such as "implementing a prevention" or "prevention," is meant the stopping of a specific phenomenon or characteristic, stabilizing or delaying the development or progression of a specific phenomenon or characteristic, or minimizing the likelihood that a specific phenomenon or characteristic will occur. The term "prevent" does not require comparison with control, since it is generally more absolute than, for example, "mitigate." As used herein, something can be mitigated but not prevented, but something that is mitigated can also be prevented. Similarly, something could be prevented but not mitigated, but what was prevented could also be mitigated. It should be understood that if "mitigate" or "prevent" is used, unless specifically stated otherwise, the use of the other word is also expressly disclosed.

[0207] 183. The term "treatment" refers to the medical management of a patient with the goal of curing, alleviating, stabilizing, or preventing a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment specifically aimed at ameliorating the disease, pathological condition, or disorder, and also includes causal therapy, that is, treatment aimed at eliminating the cause of an associated disease, pathological condition, or disorder.In addition, the term includes palliative treatment, that is, treatment aimed at relieving symptoms rather than curing a disease, condition, or disorder; prophylactic treatment, that is, treatment aimed at minimizing or partially or completely suppressing the progression of an associated disease, condition, or disorder; and maintenance treatment, that is, treatment used in addition to other specific therapy aimed at reducing the symptoms of an associated disease, condition, or disorder.

[0208] 184. The term "subject" refers to any individual who is the target of administration or treatment. The subject may be a vertebrate, such as a mammal. In one aspect, the subject may be a human, a non-human primate, a bovine, a horse, a pig, a dog, or a cat. The subject may also be a guinea pig, a rat, a hamster, a rabbit, a mouse, or a mole. Thus, the subject may be a human patient or an animal patient. The term "patient" refers to a subject under treatment by a clinician, such as a physician.

[0209] 185. As noted above, the plasmids, vectors, and modified NK cells and NK-T cells disclosed herein can be used to treat, inhibit, reduce, attenuate, alleviate, and / or prevent cancer. A representative, but non-limiting list of cancers that the disclosed compositions can be used to treat includes: lymphoma, B-cell lymphoma, T-cell lymphoma, mycosis fungoides, Hodgkin's disease, acute lymphocytic leukemia (ALL), hairy cell leukemia (HCL), myelodysplastic syndromes (MDS), myeloid leukemia (including, but not limited to, acute myeloid leukemia (AML) and chronic myeloid leukemia (CML)), bladder cancer, brain cancer, nervous system cancer, head and neck cancer, squamous cell cancer of the head and neck, lung cancer such as small cell lung cancer and non-small cell lung cancer, neuroblastoma / glioblastoma, ovarian cancer, skin cancer, liver cancer, melanoma, squamous cell cancer of the mouth, throat,larynx and lung cancer, cervical cancer, cervical carcinoma, breast cancer and epithelial cancer, kidney cancer, genitourinary cancer, lung cancer, esophageal cancer, head and neck cancer, colon cancer, hematopoietic cancer; testicular cancer; colon cancer, rectal cancer, prostate cancer or pancreatic cancer.,

[0210] 186. As noted herein, the disclosed modified NK cells are ideally suited for use in immunotherapy, such as adoptively transferring the modified (i.e., engineered NK cells to a subject in need thereof). Thus, in one aspect, disclosed herein are methods for adoptively transferring engineered NK cells to a subject in need thereof, said method comprising a) obtaining NK cells to be modified; b) obtaining a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease (Cas9) in complex with an appropriate CRISPR / Cas guide RNA, and an AAV vector comprising a plasmid comprising a transgene (such as, for example, a chimeric antigen receptor for a tumor antigen); wherein the transgene is flanked by homology arms; and the homology arms are less than 1000 bp.; and c) introducing the transgene and the RNP complex into an NK cell; wherein the transgene is introduced into the cell by infecting the NK cell with an adeno-associated virus (AAV); wherein the RNP complex hybridizes to a target sequence in the genomic DNA of the NK cell, and DNA repair enzymes of the NK cell integrate the transgene into the host genome (e.g., by homologous repair) into the target sequence in the genomic DNA of the target cell, thereby creating an engineered NK cell; and d) transferring the engineered NK cell to a subject. In one aspect, the transgene can be contained on the same plasmid as the Cas9 endonuclease or encoded on a second plasmid in the same or a different AAV vector. In one aspect, the target cell can be transduced with the RNP complex by electroporation prior to or concurrent with infection of the cell with an AAV containing the transgene.

[0211] 187. In one aspect, the modified cells (e.g., NK cells) used in the disclosed immunotherapy methods may be primary cells from a donor source (such as, for example, an allogeneic donor source for adoptive transfer therapy or an autologous donor source (i.e., the final recipient of the modified cells)), a cell line (including, but not limited to, the NK cell lines NK RPMI8866; HFWT, K562, and EBV-LCL), or from an expanded cell source derived from a primary cell source or cell line. Since primary cells may be used, it is understood and contemplated herein that the disclosed cell modifications may occur ex vivo or in vitro.

[0212] 188. Also disclosed in this document is a plasmid comprising, in order, a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, and a right homology arm; wherein each of the left and right homology arms has a length of 1000 bp or less.

[0213] 189. In another aspect, this document discloses a plasmid, AAV vector, or modified cell as disclosed herein for use as a medicament. This document also discloses the use of a plasmid, AA vector / or modified cell as disclosed herein for the production of a medicament.

[0214] 190. Also disclosed herein is a plasmid, AAV vector, or modified cell as disclosed herein for use in the treatment of cancer. Also disclosed herein is the use of a plasmid, AAV vector, or modified cell as disclosed herein for the production of a medicament for the treatment of cancer.

[0215] 191. Also disclosed in this document is a CAR-NK cell created using the method for creating a natural killer (NK) cell or an NK-T cell with a chimeric antigen receptor (CAR), as disclosed in this document, for use in the treatment of cancer. This document also discloses the use of a CAR-NK cell created using the method for creating a natural killer (NK) cell or an NK-T cell with a chimeric antigen receptor (CAR), as disclosed in this document, for the production of a medicament for the treatment of cancer.

[0216] VI. Examples

[0217] 192. The following examples are presented to provide those skilled in the art with a complete disclosure and description of how the compounds, compositions, articles, devices, and / or methods claimed herein are prepared and evaluated, and are intended to be illustrative only and are not intended to limit the present invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amount, temperature, etc.), however, some errors and deviations should be taken into account. Unless otherwise indicated, parts are parts by weight, temperatures are in °C or equal to ambient temperature, and pressure is equal to or close to atmospheric pressure.

[0218] 1. Example 1: Highly efficient site-directed gene insertion into primary human natural killer cells using homologous recombination and CRISPaint delivered by AAV6

[0219] 193. Using the approaches described in this paper, highly potent and stable transgene-modified primary human NK cells, including two CAR-NK cells that showed enhanced anti-AML activity, were successfully generated.

[0220] a) Methods

[0221] (1) Purification and expansion of human NK cells.

[0222] 194. NK cells were purified as described previously. Briefly, NK cells were isolated from PBMCs collected from healthy individuals using RosetteSep™ human NK cell enrichment cocktail (Fig. 1A). Purified NK cells were phenotyped by flow cytometry as >90% CD3-negative / CD56-positive population (Fig. 3A). These cells were stimulated with irradiated K562 feeder cells expressing 4-1BBL and membrane-bound IL-21 (FC21) at a 2:1 ratio (feeder cells:NK) on the day of purification (Fig. 1A). Stimulated cells were cultured for 7 days in AIM-V / ICSR serum-free expansion medium containing 50 IU / ml IL-2.

[0223] (2) ATAC-seq analysis.

[0224] 195. Freshly isolated (naive), FC15-, and FC21-expanded NK cells were cryopreserved in aliquots of 100,000 viable cells / vial before processing for ATAC-seq. ATAC-seq was performed as described previously. DNA libraries were sequenced using an lllumina HiSeq 2500 with 50 bp paired-end reads.

[0225] (3) Electroporation of Cas9 / RNP to target AAVS1 in NK cells.

[0226] 196. AAVS1 was targeted with a single gRNA (crRNA: 5'GGGGCCACTAGGGACAGGAT) (SEQ ID NO: 17) by electroporating Cas9 / RNP into NK cells expanded for seven days as described previously. Briefly, 3 x 10e expanded NK cells were collected and washed twice with 13 ml PBS, followed by centrifugation for 5 min at 400 g and PBS aspiration. The cell pellet was resuspended in 20 μl of P3 Primary Cell 4D-Nucleofector solution. 5 μl of pre-complexed Cas9 / RNP (CRISPR-Cas9 ALT-R® crRNA, CRISPR-Cas9 ALT-R® tracrRNA, and Cas9 ALT-R® SpHiFi V3 nuclease) (Integrated DNA Technologies, Inc., Coralville, IA) targeting AAVS1 and 1 μl of 100 μM electroporation enhancer (Cas9 ALT-R® Electroporation Enhancer) were added to the cell suspension. A total volume of 26 μl of the CRISPR reaction mixture was transferred to a 16-well 4D-Nucleofector™ strip and electroporated using the EN-138 program (Fig. 3B).After electroporation, the cells were transferred to 2 ml of medium containing 50 IU of IL-2 in a 12-well plate and incubated at 37°C and 5% CO2. Two days after electroporation, the cells were stimulated with 2 × 10. 6 feeder cells and added 8 ml of fresh medium supplemented with 50 IU to the cell suspension and stored in a T25 flask.

[0227] (4) ICE mutation detection assay.

[0228] 197. To measure the degree of insertions-deletions in AAVS1KO NK cells, PCR was used to amplify the Cas9 / RNP targeting site using the forward and reverse primers mentioned in Table 1. The amplicons were sequenced by Sanger sequencing, and the results were analyzed by ICE.

[0229] (5) RNA-seq sample preparation and sequencing.

[0230] 198. Total RNA was purified from naive resting, expanded resting, naive IL-21-stimulated, and FC21-expanded NK cells for seven days using the Total RNA Purification Plus Kit (Norgen Biotek, Ontario, Canada). The resulting total RNA was quantified on a Nanodrop ND-1000 spectrophotometer, verified for purity and integrity on a Bioanalyzer-2100 (Agilent Technologies Inc., Santa Clara, CA), and submitted to the Genomics Core at Nationwide Children's Hospital for sequencing. Libraries were prepared using the TruSeq RNA Sample Prep Kit (Illumina Inc.) according to the manufacturer's recommended protocols. Library quality was determined by Agilent 4200 Tapestation using the High Sensitivity D1000 ScreenTape Assay kit and quantified by KAPA qPCR (KAPA BioSystems).Using the Illumina HiSeq4000 platform, approximately 60-80 million paired-end reads of 150 bp sequences were generated per library.

[0231] 199. Sequencing reads from each sample were aligned to the NCBI Homo sapiens reference assembly GRCh38.p9 using the STAR aligner version 2.5.2b with splicing support. Feature coverage counts were calculated with HTSeq using the GFF file supplied with the NCBI assembly. Default parameters for feature type, exon and feature ID, and gene ID from GFF were used to identify features for RNA-Seq analysis. Quality control checks for sample preparation and alignment were performed using custom Perl scripts that count read types using the STAR mapping quality metric and the number of reads corresponding to each feature class defined in the feature table supplied with the NCBI assembly.

[0232] (6) AAV6 production.

[0233] 200. Transgenes cloned into ssAAV or scAAV plasmids were packaged into AAV6 capsids as described previously.

[0234] (7) Combining Cas9 / RNP and AAV6 to generate mCherry-CAR NK cells.

[0235] 201. Change of medium and resuspension in the amount of 5 × 10 5 cells per ml was performed on day 6 of NK cell expansion, one day before experimental manipulations. NK cells were then electroporated with Cas9 / RNP targeting AAVS1 on day 7, as described above. Thirty minutes after electroporation, 3×10 5 living cells and resuspended at a concentration of 1 × 10 6 cells per ml in medium containing 50 IU IL2 (Novartis) in a 24-well plate in a total volume of 300 µl. For each transduction condition with ssAAV6 or scAAV6 to deliver HR or CRISPaint DNA encoding mCherry or CD33CAR, we transduced 3 × 10 5cells were electroporated at an MOI of 300,000 (MOI 10,000-500,000 if necessary). Negative controls included NK cells that were not electroporated, were electroporated with Cas9 / RNP but not transduced with AAV, or were transduced with 300,000 MOI AAV6 without Cas9 / RNP electroporation. The day after electroporation and transduction, we added 300 μl of fresh medium containing 50 IU IL2 to each well without changing the old medium. Cells were maintained in culture for 48 hours after electroporation and then restimulated with 2 × 10 6The cells were cultured with feeder cells and maintained in a total volume of 2 ml of medium containing 50 IU in a 12-well plate without replacing the old medium. After 48 hours, 8 ml of fresh medium supplemented with IL2 was added to the cells; a total volume of 10 ml was stored in a T25 flask. On the 7th day after transduction, the cells were re-stimulated with feeder cells at a 1:1 ratio and grown for another week, with fresh medium added every 2 days.

[0236] (8) Flow cytometry for CAR-NK cell detection.

[0237] 202. 7 days and 14 days after electroporation 5 × 10 5NK cells were washed twice with staining buffer containing 2% FBS in PBS. Then, 2.5 μg of recombinant human siglec-3 / CD33 Fc chimeric protein (CF; R&D systems #1137-SL-050) were added to the cell suspension in a total volume of 80 μl and incubated for 30 min at 4°C. The cells were washed twice with staining buffer before staining with 2 μl of Alexa Fluor® 647 affinipure goat anti-human IgG specific for the Fey fragment (Jackson ImmunoResearch #109-605-098) at a ratio of 1:100 in 200 μl of staining buffer and stored at 4°C for 30 min. After staining, cells were washed twice with staining buffer and then analyzed on MacsQuant flow cytometers. Flow cytometry data were analyzed using FlowJo software (FlowJo, LLC).

[0238] (9) Cytotoxicity assay.

[0239] 203. Cytotoxicity assays were performed for 3-4 h as described previously using the calcein-acetoxymethyl release assay. Cytotoxicity was assessed against Kasumi-1, HL60, or AML10 cells at different target:effector ratios, as shown in Fig. 8.

[0240] (10) CD107a staining.

[0241] 204. NK cells and cancer cells were co-cultured at a 10:1 ratio, and 20 µl of mouse anti-human CD107a PE antibody (BD Pharmingen™, #555801) were added to a total volume of 220 µl in a 96-well plate. The plate was incubated at 37°C for 90 minutes. The cells were then washed once with staining buffer and collected for analysis on MacsQuant flow cytometers.

[0242] (11) PCR-based detection of transgene integration.

[0243] 205. Input-output PCR was performed using two pairs of primers (Figs. 9A and 9B and Table 2) designed inside or outside the CD33CAR constructs. We also added a primer set to amplify 1200 bp of the right and left flanking regions of the Cas9 targeting region and the transgene integration site (Fig. 9C). PCR was performed using the Platinum™ Taq DNA Polymerase High Fidelity Kit (Thermofisher #11304011).

[0244] 206. TLA. For genome-wide mapping of CD33CAR-Gen2 integration, we used TLA technology (Cergentis BV). For more information, see Fig. 9C.

[0245] b) Results

[0246] (1) NK cell expansion using FC21 provides optimal conditions for gene insertion.

[0247] 207. Enzymatic reactions regulate CRISPaint and HR. CRISPaint is a LIG4-dependent process, while other proteins such as BRCA1 and BRCA2 regulate HR. Therefore, the expression levels of these genes were analyzed in freshly isolated NK cells or seven days after stimulation with feeder cells expressing membrane-bound IL-21 (FC21) (n=4) to assess which repair pathway was more efficient in this cell type and at what stage of expansion (Fig. 1A, Figs. 3A and 3B). RNA-seq analysis revealed that NK cells expanded for seven days have higher expression of BRCA1 and BRCA2 compared to naive NK cells. Furthermore, there is no downregulation of LIG4 in these cells; However, the level of LIG1, which is a DNA repair enzyme, was significantly higher in the expanded cells (Fig.1B and 1C), providing optimal conditions for the insertion of a gene targeting either HR or NHEJ via CRISPaint in NK cells expanded for 7 days.

[0248] (2) Successful targeting of genomic safe harbor for gene insertion.

[0249] 208. Genomic safe harbors (GSHs) are regions in the genome that can be modified without altering the normal function of the host cell and allow adequate transgene expression. Adeno-associated virus site 1 (AAVS1), which is one of the GSHs and an exemplary locus in the phosphatase 1 regulatory subunit 1C (PPP1R12C) gene, was chosen for gene insertion into NK cells. This locus has been successfully used for targeted gene insertion into several cell types. First, AAVS1 chromatin accessibility in naive and expanded NK cells (n=2) was assessed using ATAC-seq analysis, and it showed no decrease in chromatin accessibility in FC21-expanded NK cells compared with naive NK cells (Fig. 1D). AAVS1 was then targeted using gRNA alone via electroporation of Cas9 / RNP into NK cells expanded for seven days.After 48 hours, NK cell DNA was isolated to detect insertion-deletion deletions (IDDs) in CRISPR-edited NK cells using Inference of CRISPR Edits (ICE) to analyze insertion-deletion frequencies. ICE results showed that up to 85% of CRISPR-edited NK cells had at least one IDD in the AAVS1 Cas9 targeting site (Figure 1E). To ensure that genomic modifications at this locus did not affect the ability of NK cells to target cancer cells, the cytotoxicity of AAVS1KO NK cells was assessed against Kasumi-1, an acute myeloid leukemia (AML) cancer cell line. Using the Calcein AM assay, no differences were observed between wild-type and CRISPR-modified NK cells in their killing ability (Fig. 3C).

[0250] (3) Successful generation of mCherry-expressing primary human NK cells using a combination of single-chain AAV6 and Cas9 / RNP.

[0251] 209. For HDR-mediated gene insertion, DNA encoding mCherry with an HA of 800 bp for the right and 1000 bp for the left site flanking the Cas9 target site region in the AAVS1 locus was cloned into a single-stranded AAV plasmid backbone and packaged into the AAV6 viral capsid. Constructs were designed to have a splice acceptor downstream of the transgene to improve mCherry gene transcription (Fig. 2A). As described in the methods, NK cells were electroporated with Cas9 / RNP targeting AAVS1, and 30 minutes later, the cells were transduced with AAV6 at an MOI of 300,000 or an MOI of 500,000 (Fig. 2C). This resulted in 17% (300,000 MOI) and 19% (500,000 MOI) mCherry-positive NK cells, assessed 48 hours after electroporation using flow cytometry. These cells were further expanded for one week using FC21 and enriched for mCherry-positive cells using FACS sorting.This resulted in an enrichment of the mCherry-positive NK cell population (77% of mCherry-positive NK cells transduced with 300,000 MOI and 86% for NK cells transduced with 500,000 MOI ssAAV6). These cells were restimulated with feeder cells and expanded for an additional 30 days, with no decrease in mCherry expression observed (Figs. 4A, 4B, and 4C).

[0252] (4) Improved gene insertion by using self-complementary AAV6 and Cas9 / RNP.

[0253] 210. As described previously, scAAV vectors can become double-stranded in a shorter time than ssAAV after entering host cells. This may improve the efficiency of gene insertion into NK cells. To test this, scAAV6 and its combination with Cas9 / RNP were used to improve the gene insertion result in the ssAAV6 method. Due to the limitation of the transgene packaging size in scAAV, several HA lengths were designed to provide a wide range of possibilities for cloning transgenes of different sizes into the scAAV backbones. Therefore, DNA encoding mCherry with 30 bp, 300 bp, 500 bp, and 1000 bp for the right HA and 30 bp, 300 bp, 500 bp, and 800 bp for the right HA. for the left HA (Fig. 2A), was cloned into the scAAV backbone and packaged into the AAV6 capsid. The same steps described previously were then performed for the ssAAV section for electroporation and transduction of 7-day-expanded NK cells.This approach significantly increased the efficiency of generating mCherry-expressing NK cells, with positive percentages reported as follows: 30 bp (19-20%), 300 bp (80-85%), 500 bp (75-85%), and 800 bp (80-89%) (Figures 4A and 4B). These cells could be further expanded using feeder cells for over 3 weeks, and no decrease in the percentage of mCherry-expressing NK cells exhibiting stable exogenous gene expression was observed. Although these vectors cannot be used to generate CAR NK cells due to size limitations in scAAV, mCherry can be considered a proof of concept for generating NK cells capable of producing highly potent and stable exogenous proteins. When the same approach of Cas9 / RNP electroporation and AAV6 transduction was used in freshly isolated NK cells, the percentage of mCherry expression was quite low (1.13% for ss800bp AAV6 and 2.9% for sc300bp AAV6, Fig. 5).Based on these observations, FC21-expanded NK cells were used.

[0254] (5) CRISPaint can be used to insert genes into NK cells.

[0255] 211. To overcome the complexity of HA optimization observed during HDR-targeted gene insertion, a homology-independent gene insertion approach called CRISPaint was tested. For CRISPaint DNA templates, dual AAVS1 (PAMgPAMg) sequences targeting Cas9 were incorporated around the mCherry transgene but within the scAAV ITR and packaged into AAV6 (Fig. 2B). The methods used for NK cell electroporation and transduction were also applied here to insert HR-targeted genes. Two days after electroporation and transduction and before expansion, flow cytometry was performed to assess mCherry expression in NK cells. Cells electroporated and transduced with 300,000 MOI scAAV6 delivering CRISPaint PAMgPAMg were found to be up to 6% mCherry positive.These cells could be further sorted and enriched for up to 77% mCherry-expressing NK cells and expanded using FC21 for 30 days, and no decrease in the percentage of mCherry-positive NK cells was observed (Figures 4B and 4C). Although the efficiency of gene integration using CRISPaint was lower compared to HR-directed gene insertion, this method remains desirable because it allows researchers to integrate genes of interest into a user-defined locus without the need to create homology arms.

[0256] (6) Successful production of primary human CD33 CAR NK cells.

[0257] 212. To generate CD33 targeting NK cell CARs, two constructs (Gen2 and Gen4v2) were developed. The CARs used in this invention contain the same scFv derived from an anti-CD33 monoclonal antibody followed by CD4 and CD28 as costimulatory domains, along with CD3z for Gen2 and NKG2D, 2B4 followed by CD3z for Gen4v2 (Figs. 6A and 6B). To improve the expression level of CAR, which is higher than that of mCherry, a murine leukemia virus-derived (MND) promoter, which is a highly and constitutively active promoter in the hematopoietic system upstream of the CAR start codon, was included instead of using a splice acceptor. Then, the DNA encoding CD33CAR was cloned using a 600 bp HA. for the AAVS1 targeting site into the ssAAV backbone and packaged them into the AAV6 capsid.Seven days after electroporation and transduction, CAR expression on NK cells was analyzed by flow cytometry, and up to 78% of CD33CAR-expressing NK cells were detected as positive (on average, 59.3% for Gen2 and 60% for Gen4v2 on day 14 post-transduction). A higher mean fluorescence intensity (MFI) of CD33CAR-Gen2 expressed on NK cells was observed compared to Gen4v2 (Figs. 6C and 6D). Cells were then expanded and grown on feeder cells for another week (day 14), and between days 7 and 14, CAR-NK cells showed no significant decrease in CAR expression (Fig. 6E). Gene manipulation also did not significantly affect the expansion of CAR-expressing cells compared to wild-type cells (Fig. 6F). The freezing and thawing process also had no negative effect on CAR expression and enhanced CAR NK cell cytotoxicity (Figures 7A and 7B).Next, PCR confirmed the integration of transgene-encoding DNA at the DNA level (Figures 9A and 9B). Furthermore, targeted locus amplification (TLA) technology was used for genome-wide mapping of CD33CAR-Gen2 integration with a sensitivity of greater than 5% for random integration detection, demonstrating that the vector correctly integrated at the target site on chromosome 19 in a subset of the sample. There was no indication of a large number of off-target integration sites. One sequence variant and four structural variants were detected in the sample, indicating that a mistargeting event occurred in at least a subset of the sample. Additionally, random integrations into chr19 were also detected in a subset of the sample (Figure 9C). It was also shown that reducing the virus concentration to 10,000 MOI could also be used to produce CD33CAR-Gen2-expressing NK cells (Fig. 10A and 10B).

[0258] (7) Primary human CAR-NK cells have enhanced antitumor activity.

[0259] 213. To examine the cytotoxic effect of primary human CD33CAR-NK cells on CD33-expressing AML cells, a Calcein AM-based cytotoxicity assay was performed. Two different CD33-expressing AML cell lines, named Kasumi-1 and HL60 (Fig. 11), were used and co-cultured with NK cells isolated from peripheral blood collected from three different healthy individuals. NK cells with CD33CAR-gen2 and CD33CAR-gen4v2 showed significantly higher expression of CD107a, a marker of NK cell degranulation, when co-cultured with Kasumi-1 or HL60 compared to wild-type or AAVS1K0-expressing NK cells. This also resulted in significantly higher specific lysis of Kasumi-1 by CD33CAR-NK cells. A higher killing capacity of CD33CAR-Gen2 towards HL60 was also observed (Figs. 8A-8F).The specificity of enhanced tumor killing by CD33CAR NK cells for CD33-expressing cancer cells was demonstrated by performing a cytotoxicity assay against chronic myelogenous leukemia (CML) K562, and no improvement in NK cell killing capacity was observed (Fig. 8I and Fig. 12). Importantly, significantly higher antitumor activity of CD33CAR NK cells was observed against AML-10, a primary human AML obtained from a relapsed patient (Figs. 8G and 8H, Fig. 12). Overall, CD33CAR-Gen2 NK cells showed superior cytotoxicity compared to CD33CAR-Gen4v2 NK cells.

[0260] c) Discussion

[0261] 214. Gene modification in primary human NK cells has always been a challenging task; herein, we report successful, highly efficient site-directed gene integration into primary human NK cells using a combination of Cas9 / RNP electroporation and single-stranded or self-complementary AAV6 gene delivery via HR and homology-independent gene insertion (CRISPaint). This invention shows for the first time how the expression level of genes regulating the HR and NHEJ pathways is altered in human NK cells when expanded with FC21 and provides optimal conditions for site-directed gene insertion. We also demonstrated that AAVS1 can accommodate and express exogenous genes at a highly efficient level, as previously shown in T cells and NK cells. Furthermore, it was shown that the HA range from 30 to 1000 bp. can be used to insert the gene into the AAVS1 locus in NK cells, but the shortest optimal length is 300 bp.when used in scAAV6. This helps researchers select the optimal HA based on the size of their exogenous DNA for introduction into NK cells. CRISPaint gene insertion can be used to label endogenous genes and study protein biology in NK cells.

[0262] 215. Using a combination of Cas9 / RNP gene delivery and AAV6, two different primary human CD33CAR-NK cells with enhanced anti-AML activity were generated. These results also demonstrated that the gene-modified NK cells can be subsequently expanded using FC21, enabling the production of large quantities of gene-modified NK cells for cancer immunotherapy. Overall, the method demonstrated in this invention can be used for multiple applications in immunology, cancer immunotherapy, and the study of NK cell biology.

[0263]

[0264]

[0265]

[0266]

[0267] TLA was performed with 2 independent primer sets specific for the vector sequence (Table 3).

[0268] 219. Sequence variants. The detected sequence variants are presented in Table 4. The frequency of this variant may indicate a change in the vector used.

[0269]

[0270] 221. Identification of structural variants

[0271] 222. Four vector-vector breakpoints were found. All fusions were located on the annotated homology arm. Due to the heterogeneous nature of the sample, these fusions are expected to be present only in a subset of the sample. It should be noted that three of the four fusions show 9-12 bp homology, which may indicate a technical error.

[0272] 223. Vector: 149 (head) fused with Vector: 4116 (tail) with 9 homologous bases

[0273]

[0274] 225. Vector: 149 (head) fused with Vector: 4113 (tail) with 12 homologous bases

[0275]

[0276] 227. Vector: 155 (head) fused with Vector: 4163 (tail) with 9 homologous bases

[0277]

[0278] 229. Vector: 158 (head) fused with Vector: 4121 (tail) with 4 homologous bases

[0279]

[0280] B. REFERENCES

[0281] Buenrostro, J.D., Giresi, P.G., Zaba, L.C., Chang, H.Y. & Greenleaf, W.J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat Methods 10, 1213-1218 (2013). de Vree, P.J. et al. Targeted sequencing by proximity ligation for comprehensive variant detection and local haplotyping. NatBiotechnol 32, 1019-1025 (2014). Dutour, A. et al. In Vitro and In Vivo Antitumor Effect of Anti-CD33 Chimeric Receptor-Expressing EBV-CTL against CD33 Acute Myeloid Leukemia. Adv Hematol 2012, 683065 (2012).

[0282] Foust, K.D. et al. Therapeutic AAV9-mediated suppression of mutant SOD1 slows disease progression and extends survival in models of inherited ALS. Mol Ther 21, 2148-2159 (2013).

[0283] He, X. et al. Knock-in of large reporter genes in human cells via CRISPR / Cas9-induced homology-dependent and independent DNA repair. Nucleic Acids Res 44, e85 (2016). Hsiau, T. et al. Inference of CRISPR Edits from Sanger Trace Data. bioRxiv, 251082 (2018).

[0284] Li, K., Wang, G., Andersen, Т., Zhou, P. & Pu, W.T. Optimization of genome engineering approaches with the CRISPR / Cas9 system. PLoS One 9, e105779 (2014). Li, Y., Hermanson, D.L., Moriarity, B.S. & Kaufman, D.S. Human iPSC-Derived Natural Killer Cells Engineered with Chimeric Antigen Receptors Enhance Anti-tumor Activity. Cell Stem Cell 23, 181-192 e185 (2018).

[0285] Liu, J., Zhou, G., Zhang, L. & Zhao, Q. Building Potent Chimeric Antigen Receptor T

[0286] Cells With CRISPR Genome Editing. Front Immunol 10, 456 (2019).

[0287] MacLeod, D.T. et al. Integration of a CD19 CAR into the TCR Alpha Chain Locus Streamlines Production of Allogeneic Gene-Edited CAR T Cells. Mol Ther 25, 949-961 (2017).

[0288] Mali, P. et al. RNA-guided human genome engineering via Cas9. Science 339, 823-826 (2013).

[0289] McCarty, D.M. Self-complementary AAV vectors; advances and applications. Mol Ther 16, 1648-1656 (2008).

[0290] Mendell, J.R. et al. Single-Dose Gene-Replacement Therapy for Spinal Muscular Atrophy. NEngl J Med 377, 1713-1722 (2017).

[0291] Moseman, J.E., Foltz, J.A., Sorathia, K., Heipertz, E.L. & Lee, D.A. Evaluation of serum-free media formulations in feeder cell-stimulated expansion of natural killer cells. Cytotherapy (2020).

[0292] Naeimi Kararoudi, M. et al. CD38 deletion of human primary NK cells eliminates daratumumab-induced fratricide and boosts their effector activity. Blood (2020). Naeimi Kararoudi, M. et al. Generation of Knock-out Primary and Expanded Human NK Cells Using Cas9 Ribonucleoproteins. J Vis Exp (2018). Oceguera-Yanez, F. et al. Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Methods 101, 43-55 (2016).

[0293] Pomeroy, E.J. et al. A Genetically Engineered Primary Human Natural Killer Cell Platform for Cancer Immunotherapy. Mol Ther28, 52-63 (2020). Ran, F.A. et al. Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8, 2281-2308 (2013).

[0294] Schmid-Burgk, J.L., Honing, K., Ebert, T.S. & Hornung, V. CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun 7, 12338 (2016).

[0295] Somanchi, S.S., Senyukov, V.V., Denman, C.J. & Lee, D.A. Expansion, purification, and functional assessment of human peripheral blood NK cells. J Vis Exp (2011). Song, F. & Stieger, K. Optimizing the DNA Donor Template for Homology-Directed Repair of Double-Strand Breaks. Mol Ther Nucleic Acids 7, 53-60 (2017). Suzuki, K. et al. In vivo genome editing via CRISPR / Cas9 mediated homology-independenttargeted integration. NaturebAQ, 144-149 (2016).

[0296] С. ПОСЛЕДОВАТЕЛЬНОСТИ

[0297]

[0298]

[0299]

[0300]

[0301]

[0302]

[0303]

[0304]

[0305]

[0306] The sequence of ITR1 corresponds to nucleic acid positions 1-141 of SEQ ID NO: 22;

[0307] MND-CD33CAR-gen2 construct corresponds to nucleic acid positions 156-4118 of SEQ ID NO: 22;

[0308] The 600 bp left arm of AAVS1 homology corresponds to nucleic acid positions 156-759 of SEQ ID NO: 22;

[0309] MND promoter corresponds to nucleic acid positions 783-1322 of SEQ ID NO: 22;

[0310] CD33 CAR gen2 encoding sequence corresponds to nucleic acid positions 1329-3362 of SEQ ID NO: 22;

[0311] scFV-CD33 encoding sequence corresponds to nucleic acid positions 1329-2128 of SEQ ID NO: 22;

[0312] CD4 IgG hinge encoding sequence corresponding to nucleic acid positions 2130-2816 of SEQ ID NO: 22;

[0313] CD28 encoding sequence corresponds to nucleic acid positions 2814-3023 of SEQ ID NO: 22;

[0314] CD3zeta encoding sequence corresponds to nucleic acid positions 3024-3362 of SEQ ID NO: 22;

[0315] BGHPA corresponds to nucleic acid positions 3372-3518 of SEQ ID NO: 22;

[0316] poly BGH corresponds to nucleic acid positions 3378-3489 of SEQ ID NO: 22;

[0317] The 600 bp right arm of AAVS1 homology corresponds to nucleic acid positions 3519-4118 of SEQ ID NO: 22;

[0318] The ITR2 sequence corresponds to nucleic acid positions 4127-4267 of SEQ ID NO: 22.

[0319]

[0320]

[0321]

[0322]

[0323] The ITR1 sequence corresponds to nucleic acid positions 1-141 of SEQ ID NO: 23; the MND-CD33CAR-gen2 construct corresponds to nucleic acid positions 156-4415 of SEQ ID NO: 23; the left 600 bp arm of AAVS1 homology corresponds to nucleic acid positions 156-759 of SEQ ID NO: 23; MND promoter corresponds to nucleic acid positions 783-1322 of SEQ ID NO: 23;

[0324] the encoding sequence of CD33 CAR gen2 corresponds to nucleic acid positions 1329-3659 of SEQ ID NO: 23; the encoding sequence of scFV-CD33 corresponds to nucleic acid positions 1329-2129 of SEQ ID NO: 23; the encoding sequence of CD4 IgG hinge corresponds to nucleic acid positions 2130-2816 of SEQ ID NO: 23; the encoding sequence of NKG2D TM corresponds to nucleic acid positions 2817-2909 of SEQ ID NO: 23; the encoding sequence of 2B4 corresponds to nucleic acid positions 2934-3293 of SEQ ID NO: 23; the CD3zeta encoding sequence corresponds to nucleic acid positions 3318-3659; BGHPA corresponds to nucleic acid positions 3669-3815 of SEQ ID NO: 23; poly BGH corresponds to nucleic acid positions 3675-3786 of SEQ ID NO: 23;

[0325] The 600 bp right arm of AAVS1 homology corresponds to nucleic acid positions 3816-4415 of SEQ ID NO: 23; the ITR2 sequence corresponds to nucleic acid positions 4424-4564 of SEQ ID NO: 23.

[0326]

[0327]

[0328]

[0329] SEQ ID NO: 33, gRNA sequence targeting AAVS1

[0330] GGGGCCACTAGGGACAGGAT

[0331] SEQ ID No.: 34. TTCTCCTGTGGATTCGGGTCAC

[0332] SEQ ID No.: 35. CTCTCTGGCTCCATCGTAAGCA

[0333] SEQ ID No.: 36. TCCTGGGCAAACAGCATAA

[0334] SEQ ID No.: 37. GAGCTGCAGAAGGACAAGAT

[0335] SEQ ID No.: 38. CTCTGTGTCATCTGGATGTCTG

[0336] SEQ ID No.: 39. CTTTGAGCTCTACTGGCTTCTG

[0337] SEQ ID No: 40. TCCTGGGCAAACAGCATAA

[0338] SEQ ID No.: 41. CTTTGAGCTCTACTGGCTTCTG

[0339] SEQ ID No.: 42. GCGAGTGAAGACGGCATG

[0340]

[0341]

[0342] The first PAM sequence corresponds to nucleic acid positions 1-3 of SEQ ID NO: 50; the first crRNA encoding sequence corresponds to nucleic acid positions 4-23 of SEQ ID NO: 50; the splice acceptor sequence corresponds to nucleic acid positions 47-85 of SEQ ID NO: 50; the mCherry codon (optimized) corresponds to nucleic acid positions 86-793 of SEQ ID NO: 50; the BGHpA sequence corresponds to nucleic acid positions 803-949 of SEQ ID NO: 50; the second PAM sequence corresponds to nucleic acid positions 950-952 of SEQ ID NO: 50; the second crRNA encoding sequence corresponds to nucleic acid positions 953-972 of SEQ ID No: 50.

[0343]

[0344]

[0345] The PAM sequence corresponds to positions 1-3 of nucleic acid SEQ ID NO: 51;

[0346] crRNA encoding sequence corresponding to positions 4-23 of nucleic acid of SEQ ID NO: 51;

[0347] splice acceptor corresponds to nucleic acid positions 47-85 of SEQ ID NO: 51;

[0348] mCherry codon (optimized) corresponds to nucleic acid positions 86-793 of SEQ ID NO: 51;

[0349] The BGHpA sequence corresponds to nucleic acid positions 803-949 of SEQ ID NO: 51.

[0350]

[0351]

[0352] --->

[0353] SEQUENCE LISTING

[0354] <110> RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL

[0355] <120> NK CELLS WITH CHIMERIC ANTIGEN RECEPTOR (CAR) AND THEIR APPLICATIONS

[0356] <130> 10935-017WO1

[0357] <160> 58

[0358] <170> PatentIn version 3.5

[0359] <210> 1

[0360] <211> 30

[0361] <212> DNA

[0362] <213> Artificial sequence

[0363] <220>

[0364] <223> Synthetic sequence

[0365] <400> 1

[0366] gattggtgac agaaaagccc catccttagg 30

[0367] <210> 2

[0368] <211> 30

[0369] <212> DNA

[0370] <213> Artificial sequence

[0371] <220>

[0372] <223> Synthetic sequence

[0373] <400> 2

[0374] ttatctgtcc cctccacccc acagtggggc 30

[0375] <210> 3

[0376] <211> 300

[0377] <212> DNA

[0378] <213> Artificial sequence

[0379] <220>

[0380] <223> Synthetic sequence

[0381] <400> 3

[0382] gattggtgac agaaaagccc catccttagg cctcctcctt cctagtctcc tgatattggg 60

[0383] tctaaccccc acctcctgtt aggcagattc cttatctggt gacacacccc catttcctgg 120

[0384] agccatctct ctccttgcca gaacctctaa ggtttgctta cgatggagcc agagaggatc 180

[0385] ctgggaggga gagcttggca gggggtggga gggaaggggg ggatgcgtga cctgcccggt 240

[0386] tctcagtggc caccctgcgc taccctctc cagaacctga gctgctctga cgcggctgtc 300

[0387] <210> 4

[0388] <211> 300

[0389] <212> DNA

[0390] <213> Artificial sequence

[0391] <220>

[0392] <223> Synthetic sequence

[0393] <400> 4

[0394] gttctcctgt ggattcgggt cacctctcac tcctttcatt tgggcagctc ccctaccccc 60

[0395] cttaccctc tagtctgtgc tagctcttc agccccctgt catggcatct tccaggggtc 120

[0396] cgagagctca gctagtcttc ttcctccaac ccgggccct atgtccactt caggacagca 180

[0397] tgtttgctgc ctccagggat cctgtgtccc cgagctggga ccaccttata ttcccagggc 240

[0398] cggttaatgt ggctctggtt ctgggtactt ttatctgtcc cctccacccc acagtggggc 300

[0399] <210> 5

[0400] <211> 500

[0401] <212> DNA

[0402] <213> Artificial sequence

[0403] <220>

[0404] <223> Synthetic sequence

[0405] <400> 5

[0406] gattggtgac agaaaagccc catccttagg cctcctcctt ctagtctcc tgatattggg 60

[0407] tctaaccccc acctcctgtt aggcagattc cttatctggt gacacacccc catttcctgg 120

[0408] agccatctct ctccttgcca gaacctctaa ggtttgctta cgatggagcc agagaggatc 180

[0409] ctgggaggga gagcttggca gggggtggga gggaaggggg ggatgcgtga cctgcccggt 240

[0410] tctcagtggc caccctgcgc taccctctc cagaacctga gctgctctga cgcggctgtc 300

[0411] tggtgcgttt cactgatcct ggtgctgcag cttccttaca cttcccaaga ggagaagcag 360

[0412] tttggaaaaa caaaatcaga ataagttggt cctgagttct aactttggct cttcaccttt 420

[0413] ctagtcccca atttatattg ttcctccgtg cgtcagtttt acctgtgaga taaggccagt 480

[0414] agccagcccc gtcctggcag 500

[0415] <210> 6

[0416] <211> 500

[0417] <212> ДНК

[0418] <213> Искусственная последовательность

[0419] <220>

[0420] <223> Синтетическая последовательность

[0421] <400> 6

[0422] tcccttttcc ttctccttct ggggcctgtg ccatctctcg tttcttagga tggccttctc 60

[0423] cgacggatgt ctcccttgcg tcccgcctcc ccttcttgta ggcctgcatc atcaccgttt 120

[0424] ttctggacaa ccccaaagta ccccgtctcc ctggctttag ccacctctcc atcctcttgc 180

[0425] tttctttgcc tggacacccc gttctcctgt ggattcgggt cacctctcac tcctttcatt 240

[0426] tgggcagctc ccctaccccc cttacctctc tagtctgtgc tagctcttcc agccccctgt 300

[0427] catggcatct tccaggggtc cgagagctca gctagtcttc ttcctccaac ccgggcccct 360

[0428] atgtccactt caggacagca tgtttgctgc ctccagggat cctgtgtccc cgagctggga 420

[0429] ccaccttata ttcccagggc cggttaatgt ggctctggtt ctgggtactt ttatctgtcc 480

[0430] cctccacccc acagtggggc 500

[0431] <210> 7

[0432] <211> 1000

[0433] <212> DNA

[0434] <213> Artificial sequence

[0435] <220>

[0436] <223> Synthetic sequence

[0437] <400> 7

[0438] gattggtgac agaaaagccc catccttagg cctcctcctt ctagtctcc tgatattggg 60

[0439] tctaaccccc acctcctgtt aggcagattc cttatctggt gacacacccc catttcctgg 120

[0440] agccatctct ctccttgcca gaacctctaa ggtttgctta cgatggagcc agagaggatc 180

[0441] ctgggaggga gagcttggca gggggtggga gggaaggggg ggatgcgtga cctgcccggt 240

[0442] tctcagtggc caccctgcgc taccctctc cagaacctga gctgctctga cgcggctgtc 300

[0443] tggtgcgttt cactgatcct ggtgctgcag cttccttaca cttcccaaga ggagaagcag 360

[0444] tttggaaaaa caaaatcaga ataagttggt cctgagttct aactttggct cttcaccttt 420

[0445] ctagtcccca atttatattg ttcctccgtg cgtcagtttt acctgtgaga taaggccagt

[0446] agccagcccc gtcctggcag ggctgtggtg aggagggggg tgtccgtgtg gaaaactccc 540

[0447] tttgtgagaa tggtgcgtcc taggtgttca ccaggtcgtg gccgcctcta ctccctttct

[0448] ctttctccat ccttctttcc ttaagagtc cccagtgcta tctgggacat attcctccgc

[0449] ccagagcagg gtccccgcttc cctaaggccc tgctctgggc ttctgggttt gagtccttgg 720.

[0450] caagcccagg agaggcgctc aggcttccct gtccccttc ctcgtccacc atctcatgcc 780.

[0451] cctggctctc ctgccccttc cctacagggg ttcctggctc tgctcttcag actgagcccc840

[0452] gttcccctgc atccccgttc ccctgcatcc cccttcccct gcatcccccca gaggccccag900

[0453] gccacctact tggcctggac cccacgagag gccaccccag ccctgtctac caggctgcct 960

[0454] tttgggtgga ttctcctcca actgtggggt gactgcttgg

[0455] <210> 8

[0456] <211> 804

[0457] <212> ДНК

[0458] <213> Thanks for reading

[0459] <220>

[0460] <223> Thanks for reading

[0461] <400> 8

[0462] tgctttctct gacctgcatt ctctcccctg ggcctgtgcc gctttctgtc tgcagcttgt

[0463] ggcctgggtc acctctacgg ctggcccaga tccttccctg ccgcctcctt caggttccgt

[0464] cttcctccac tccctcttcc ccttgctctc tgctgtgttg ctgcccaagg atgctctttc

[0465] cggagcactt ccttctcggc gctgcaccac gtgatgtcct ctgagcggat cctccccgtg 240

[0466] tctgggtcct ctccgggcat ctctcctccc tcacccaacc ccatgccgtc ttcactcgct 300

[0467] gggttccctt ttccttctcc ttctggggcc tgtgccatct ctcgtttctt aggatggcct360

[0468] tctccgacgg atgtctccct tgcgtcccgc ctccccttct tgtaggcctg catcatcacc420

[0469] gtttttctgg acaaccccaa agtaccccgt ctccctggct ttagccacct ctccatcctc

[0470] ttgctttctt tgcctggaca ccccgttctc ctgtggattc gggtcacctc tcactccttt540

[0471] catttgggca gctcccctac cccccttacc tctctagtct gtgctagctc ttccagcccc 600

[0472] ctgtcatggc atcttccagg ggtccgagag ctcagctagt cttcttcctc caacccgggc 660

[0473] ccctatgtcc acttcaggac agcatgtttg ctgcctccag ggatcctgtg tccccgagct 720

[0474] gggaccacct tatattccca gggccggtta atgtggctct ggttctgggt acttttatct 780

[0475] gtcccctcca ccccacagtg gggc 804

[0476] <210> 9

[0477] <211> 23

[0478] <212> DNA

[0479] <213> Artificial sequence

[0480] <220>

[0481] <223> Synthetic sequence

[0482] <400> 9

[0483] ccaatcctgt ccctagtggc ccc 23

[0484] <210> 10

[0485] <211> 39

[0486] <212> DNA

[0487] <213> Artificial sequence

[0488] <220>

[0489] <223> Synthetic sequence

[0490] <400> 10

[0491] atcgatcgca ggcgcaatct tcgcatttct tttttccag 39

[0492] <210> 11

[0493] <211> 147

[0494] <212> DNA

[0495] <213> Artificial sequence

[0496] <220>

[0497] <223> Synthetic sequence

[0498] <400> 11

[0499] cctcgactgt gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct 60

[0500] tgaccctgga aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc 120

[0501] attgtctgag taggtgtcat tctattc 147

[0502] <210> 12

[0503] <211> 708

[0504] <212> DNA

[0505] <213> Artificial sequence

[0506] <220>

[0507] <223> Synthetic sequence

[0508] <400> 12

[0509] gtgagcaagg gcgaggagga taacatggcc atcatcaagg agttcatgcg cttcaaggtg 60

[0510] cacatggagg gctccgtgaa cggccacgag ttcgagatcg agggcgaggg cgagggccgc 120

[0511] ccctacgagg gcacccagac cgccaagctg aaggtgacca agggtggccc cctgcccttc 180

[0512] gcctgggaca tcctgtcccc tcagttcatg tacggctcca aggcctacgt gaagcacccc 240

[0513] gccgacatcc ccgactactt gaagctgtcc ttccccgagg gcttcaagtg ggagcgcgtg 300

[0514] atgaacttcg aggacggcgg cgtggtgacc gtgacccagg actcctccct gcaggacggc 360

[0515] gagttcatct acaaggtgaa gctgcgcggc accaacttcc cctccgacgg ccccgtaatg 420

[0516] cagaagaaga ccatgggctg ggaggcctcc tccgagcgga tgtaccccga ggacggcgcc 480

[0517] ctgaagggcg agatcaagca gaggctgaag ctgaaggacg gcggccacta cgacgctgag 540

[0518] gtcaagacca cctacaaggc caagaagccc gtgcagctgc ccggcgccta caacgtcaac 600

[0519] atcaagttgg acatcacctc ccacaacgag gactacacca tcgtggaaca gtacgaacgc 660

[0520] gccgagggcc gccactccac cggcggcatg gacgagctgt acaagtaa 708

[0521] <210> 13

[0522] <211> 986

[0523] <212> ДНК

[0524] <213> Искусственная последовательность

[0525] <220>

[0526] <223> Искусственная последовательность

[0527] <400> 13

[0528] ttatctgtcc cctccacccc acagtggggc cactagggac agcgatcggg tacatcgatc 60

[0529] gcaggcgcaa tcttcgcatt tcttttttcc aggtgagcaa gggcgaggag gataacatgg 120

[0530] ccatcatcaa ggagttcatg cgcttcaagg tgcacatgga gggctccgtg aacggccacg 180

[0531] agttcgagat cgagggcgag ggcgagggcc gcccctacga gggcacccag accgccaagc 240

[0532] tgaaggtgac caagggtggc cccctgccct tcgcctggga catcctgtcc cctcagttca 300

[0533] tgtacggctc caaggcctac gtgaagcacc ccgccgacat ccccgactac ttgaagctgt 360

[0534] ccttccccga gggcttcaag tgggagcgcg tgatgaactt cgaggacggc ggcgtggtga 420

[0535] ccgtgaccca ggactcctcc ctgcaggacg gcgagttcat ctacaaggtg aagctgcgcg 480

[0536] gcaccaactt cccctccgac ggccccgtaa tgcagaagaa gaccatgggc tgggaggcct 540

[0537] cctccgagcg gatgtacccc gaggacggcg ccctgaaggg cgagatcaag cagaggctga 600

[0538] agctgaagga cggcggccac tacgacgctg aggtcaagac cacctacaag gccaagaagc 660

[0539] ccgtgcagct gcccggcgcc tacaacgtca acatcaagtt ggacatcacc tcccacaacg 720

[0540] aggactacac catcgtggaa cagtacgaac gcgccgaggg ccgccactcc accggcggca 780

[0541] tggacgagct gtacaagtaa cgcggccgcc ctcgactgtg ccttctagtt gccagccatc 840

[0542] tgttgtttgc ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct 900

[0543] ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattcgatt 960

[0544] ggtgacagaa aagccccatc cttagg 986

[0545] <210> 14

[0546] <211> 1526

[0547] <212> ДНК

[0548] <213> Искусственная последовательность

[0549] <220>

[0550] <223> Синтетическая последовательность

[0551] <400> 14

[0552] gttctcctgt ggattcgggt cacctctcac tcctttcatt tgggcagctc ccctaccccc 60

[0553] cttacctctc tagtctgtgc tagctcttcc agccccctgt catggcatct tccaggggtc 120

[0554] cgagagctca gctagtcttc ttcctccaac ccgggcccct atgtccactt caggacagca 180

[0555] tgtttgctgc ctccagggat cctgtgtccc cgagctggga ccaccttata ttcccagggc 240

[0556] cggttaatgt ggctctggtt ctgggtactt ttatctgtcc cctccacccc acagtggggc 300

[0557] cactagggac agcgatcggg tacatcgatc gcaggcgcaa tcttcgcatt tcttttttcc 360

[0558] aggtgagcaa gggcgaggag gataacatgg ccatcatcaa ggagttcatg cgcttcaagg 420

[0559] tgcacatgga gggctccgtg aacggccacg agttcgagat cgagggcgag ggcgagggcc 480

[0560] gcccctacga gggcacccag accgccaagc tgaaggtgac caagggtggc cccctgccct 540

[0561] tcgcctggga catcctgtcc cctcagttca tgtacggctc caaggcctac gtgaagcacc 600

[0562] ccgccgacat ccccgactac ttgaagctgt ccttccccga gggcttcaag tgggagcgcg 660

[0563] tgatgaactt cgaggacggc ggcgtggtga ccgtgaccca ggactcctcc ctgcaggacg 720

[0564] gcgagttcat ctacaaggtg aagctgcgcg gcaccaactt cccctccgac ggccccgtaa 780

[0565] tgcagaagaa gaccatgggc tgggaggcct cctccgagcg gatgtacccc gaggacggcg 840

[0566] ccctgaaggg cgagatcaag cagaggctga agctgaagga cggcggccac tacgacgctg 900

[0567] aggtcaagac cacctacaag gccaagaagc ccgtgcagct gcccggcgcc tacaacgtca 960

[0568] acatcaagtt ggacatcacc tcccacaacg aggactacac catcgtggaa cagtacgaac 1020

[0569] gcgccgaggg ccgccactcc accggcggca tggacgagct gtacaagtaa cgcggccgcc 1080

[0570] ctcgactgtg ccttctagtt gccagccatc tgttgtttgc ccctcccccg tgccttcctt 1140

[0571] gaccctggaa ggtgccactc ccactgtcct ttcctaataa aatgaggaaa ttgcatcgca 1200

[0572] ttgtctgagt aggtgtcatt ctattcgatt ggtgacagaa aagccccatc cttaggcctc 1260

[0573] ctccttccta gtctcctgat attgggtcta acccccacct cctgttaggc agattcctta 1320

[0574] tctggtgaca cacccccatt tcctggagcc atctctctcc ttgccagaac ctctaaggtt 1380

[0575] tgcttacgat ggagccagag aggatcctgg gagggagagc ttggcagggg gtgggaggga 1440

[0576] agggggggat gcgtgacctg cccggttctc agtggccacc ctgcgctacc ctctcccaga 1500

[0577] acctgagctg ctctgacgcg gctgtc 1526

[0578] <210> 15

[0579] <211> 1926

[0580] <212> DNA

[0581] <213> Artificial sequence

[0582] <220>

[0583] <223> Synthetic sequence

[0584] <400> 15

[0585] tcccttttcc ttctccttct ggggcctgtg ccatctctcg tttcttagga tggccttctc 60

[0586] cgacggatgt ctcccttgcg tcccgcctcc ccttcttgta ggcctgcatc atcaccgttt 120

[0587] ttctggacaa ccccaaagta ccccgtctcc ctggctttag ccacctctcc atcctcttgc 180

[0588] tttctttgcc tggacacccc gttctcctgt ggattcgggt cacctctcac tcctttcatt 240

[0589] tgggcagctc ccctaccccc cttacctctc tagtctgtgc tagctcttcc agccccctgt 300

[0590] catggcatct tccaggggtc cgagagctca gctagtcttc ttcctccaac ccgggcccct 360

[0591] atgtccactt caggacagca tgtttgctgc ctccagggat cctgtgtccc cgagctggga 420

[0592] ccaccttata ttcccagggc cggttaatgt ggctctggtt ctgggtactt ttatctgtcc 480

[0593] cctccacccc acagtggggc cactagggac agcgatcggg tacatcgatc gcaggcgcaa 540

[0594] tcttcgcatt tcttttttcc aggtgagcaa gggcgaggag gataacatgg ccatcatcaa 600

[0595] ggagttcatg cgcttcaagg tgcacatgga gggctccgtg aacggccacg agttcgagat 660

[0596] cgagggcgag ggcgagggcc gcccctacga gggcacccag accgccaagc tgaaggtgac 720

[0597] caagggtggc cccctgccct tcgcctggga catcctgtcc cctcagttca tgtacggctc 780

[0598] caaggcctac gtgaagcacc ccgccgacat ccccgactac ttgaagctgt ccttccccga 840

[0599] gggcttcaag tgggagcgcg tgatgaactt cgaggacggc ggcgtggtga ccgtgaccca 900

[0600] ggactcctcc ctgcaggacg gcgagttcat ctacaaggtg aagctgcgcg gcaccaactt 960

[0601] cccctccgac ggccccgtaa tgcagaagaa gaccatgggc tgggaggcct cctccgagcg 1020

[0602] gatgtacccc gaggacggcg ccctgaaggg cgagatcaag cagaggctga agctgaagga 1080

[0603] cggcggccac tacgacgctg aggtcaagac cacctacaag gccaagaagc ccgtgcagct 1140

[0604] gcccggcgcc tacaacgtca acatcaagtt ggacatcacc tcccacaacg aggactacac 1200

[0605] catcgtggaa cagtacgaac gcgccgaggg ccgccactcc accggcggca tggacgagct 1260

[0606] gtacaagtaa cgcggccgcc ctcgactgtg ccttctagtt gccagccatc tgttgtttgc 1320

[0607] ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct ttcctaataa 1380

[0608] aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattcgatt ggtgacagaa 1440

[0609] aagccccatc cttaggcctc ctccttccta gtctcctgat attgggtcta acccccacct 1500

[0610] cctgttaggc agattcctta tctggtgaca cacccccatt tcctggagcc atctctctcc 1560

[0611] ttgccagaac ctctaaggtt tgcttacgat ggagccagag aggatcctgg gagggagagc 1620

[0612] ttggcagggg gtgggaggga agggggggat gcgtgacctg cccggttctc agtggccacc 1680

[0613] ctgcgctacc ctctcccaga acctgagctg ctctgacgcg gctgtctggt gcgtttcact 1740

[0614] gatcctggtg ctgcagcttc cttacacttc ccaagaggag aagcagtttg gaaaaacaaa 1800

[0615] atcagaataa gttggtcctg agttctaact ttggctcttc acctttctag tccccaattt 1860

[0616] atattgttcc tccgtgcgtc agttttacct gtgagataag gccagtagcc agccccgtcc 1920

[0617] tggcag 1926

[0618] <210> 16

[0619] <211> 2730

[0620] <212> DNA

[0621] <213> Artificial sequence

[0622] <220>

[0623] <223> Synthetic sequence

[0624] <400> 16

[0625] tgctttctct gacctgcatt ctctcccctg ggcctgtgcc gctttctgtc tgcagcttgt 60

[0626] ggcctgggtc acctctacgg ctggcccaga tccttccctg ccgcctcctt caggttccgt 120

[0627] cttcctccac tccctcttc cttgctctc tgctgtgttg ctgcccaagg atgctctttc 180

[0628] cggagcactt cttctcggc gctgcaccac gtgatgtcct ctgagcggat cctccccgtg 240

[0629] tctgggtcct ctccgggcat ctctcctccc tcacccaacc ccatgccgtc ttcactcgct 300

[0630] gggttccct ttccttctcc ttctggggcc tgtgccatct ctcgtttctt agatggcct 360

[0631] tctccgacgg atgtctccct tgcgtcccgc ctccccttct tgtaggcctg catcatcacc 420

[0632] gtttttctgg acaaccccaa agtaccccgt ctccctggct ttagccacct ctccatcctc 480

[0633] ttgctttctt tgcctggaca ccccgttctc ctgtggattc gggtcacctc tcactccttt 540

[0634] catttgggca gctcccctac cccccttacc tctctagtct gtgctagctc ttccagcccc 600

[0635] ctgtcatggc atcttccagg ggtccgagag ctcagctagt cttcttcctc caacccgggc 660

[0636] ccctatgtcc acttcaggac agcatgtttg ctgcctccag ggatcctgtg tccccgagct 720

[0637] gggaccacct tatattccca gggccggtta atgtggctct ggttctgggt acttttatct 780

[0638] gtcccctcca ccccacagtg gggccactag ggacagcgat cgggtacatc gatcgcaggc 840

[0639] gcaatcttcg catttctttt ttccaggtga gcaagggcga ggaggataac atggccatca 900

[0640] tcaaggagtt catgcgcttc aaggtgcaca tggagggctc cgtgaacggc cacgagttcg 960

[0641] agatcgaggg cgagggcgag ggccgcccct acgagggcac ccagaccgcc aagctgaagg 1020

[0642] tgaccaaggg tggccccctg cccttcgcct gggacatcct gtcccctcag ttcatgtacg 1080

[0643] gctccaaggc ctacgtgaag caccccgccg acatccccga ctacttgaag ctgtccttcc 1140

[0644] ccgagggctt caagtgggag cgcgtgatga acttcgagga cggcggcgtg gtgaccgtga 1200

[0645] cccaggactc ctccctgcag gacggcgagt tcatctacaa ggtgaagctg cgcggcacca 1260

[0646] acttcccctc cgacggcccc gtaatgcaga agaagaccat gggctgggag gcctcctccg 1320

[0647] agcggatgta ccccgaggac ggcgccctga agggcgagat caagcagagg ctgaagctga 1380

[0648] aggacggcgg ccactacgac gctgaggtca agaccaccta caaggccaag aagcccgtgc 1440

[0649] agctgcccgg cgcctacaac gtcaacatca agttggacat cacctcccac aacgaggact 1500

[0650] acaccatcgt ggaacagtac gaacgcgccg agggccgcca ctccaccggc ggcatggacg 1560

[0651] agctgtacaa gtaacgcggc cgccctcgac tgtgccttct agttgccagc catctgttgt 1620

[0652] ttgcccctcc cccgtgcctt ccttgaccct ggaaggtgcc actcccactg tcctttccta 1680

[0653] aataatgag gaaattgcat cgcattgtct gagtaggtgt cattctattc gattggtgac

[0654] agaaaagccc catccttagg cctcctcctt cctagtctcc tgatattggg tctaaccccc

[0655] acctcctgtt cttatctggt gacacacccc catttcctgg agccatctct

[0656] ctccttgcca gaacctctaa ggtttgctta cgatggagcc agagaggatc ctggggaggga

[0657] gagcttggca gggggtggga gggagggggg ggatgcgtga cctgcccggt tctcagtggc

[0658] caccctgcgc taccctctcc cagaacctga gctgctctga cgcggctgtc tggtgcgttt

[0659] cactgatcct ggtgctgcag cttccttaca cttcccaaga ggagaagcag tttggaaaaa

[0660] caaaatcaga ataagttggt cctgagttct aactttggct cttcaccttt ctagtcccca

[0661] atttatattg ttcctccgtg cgtcagtttt acctgtgaga taaggccagt agccagcccc 2220

[0662] gtcctggcag ggctgtggtg aggagggggg tgtccgtgtg gaaaactccc tttgtgagaa

[0663] tggtgcgtcc taggtgttca ccaggtcgtg gccgcctcta ctccctttct ctttctccat

[0664] ccttctttcc ttaaagagtc cccagtgcta tctgggacat attcctccgc ccagagcagg 2400

[0665] gtcccgcttc cttaaggccc tgctctgggc ttctgggttt gagtccttgg caagcccagg 2460

[0666] agaggcgctc aggcttccct gtccccttc ctcgtccacc atctcatgcc cctggctctc 2520

[0667] ctgccccttc cctacagggg ttcctggctc tgctcttcag actgagcccc gttcccctgc 2580

[0668] atccccgtc ccctgcatcc cccttcccct gcatccccca gaggccccag gccacctact 2640

[0669] tggcctggac cccacgagag gccaccccag ccctgtctac caggctgcct tttgggtgga 2700

[0670] ttctcctcca actgtggggt gactgcttgg 2730

[0671] <210> 17

[0672] <211> 20

[0673] <212> DNA

[0674] <213> Artificial sequence

[0675] <220>

[0676] <223> The synthetic sequence

[0677] <400> 17

[0678] ggggccacta gggacaggat 20

[0679] <210> 18

[0680] <211> 800

[0681] <212> DNA

[0682] <213> Artificial sequence

[0683] <220>

[0684] <223> Synthetic sequence

[0685] <400> 18

[0686] atgctgctgc tggtgacctc tctgctgctg tgcgagctgc cacacccagc cttcctgctg 60

[0687] atcccagaca tccagatgac acagagcccc agctccctga gcgcctccgt gggcgacaga 120

[0688] gtgaccatca catgtagggc ctctgagagc gtggataact atggcatcag cttcatgaat 180

[0689] tggtttcagc agaagcctgg cggcgcccca aagctgctga tctacgcagc cagcatgcag 240

[0690] ggctccggcg tgccctctcg gttctccggc tctggcagcg gcaccgactt caccctgaca 300

[0691] atctctagcc tgcagccaga cgatttcgcc acatactatt gccagcagag caaggaggtg 360

[0692] cctggacct ttggccaggg cacaaaggtg gagatcaagg gctccacctc tggcagcggc 420

[0693] aagcctggca gcggagaggg ctccacaaag ggacaggtgc agctggtgca gtccggagcc 480

[0694] gaggtgaaga agccaggctc ctctgtgaag gtgtcttgta aggccagcgg ctataccttc 540

[0695] acagactaca acatgcactg ggtgcgccag gcaccaggac agggcctgga gtggatcggc 600

[0696] tacatctatc cttacaacgg cggcaccggc tataatcaga agtttaagtc caaggccacc 660

[0697] atcacagccg atgagtctac caatacagcc tacatggagc tgagcagcct gcggtccgag 720

[0698] gacacagccg tgtactattg cgcccggggc agacccgcta tggactattg gggccagggc 780

[0699] accctggtga cagtgtctag 800

[0700] <210> 19

[0701] <211> 687

[0702] <212> DNA

[0703] <213> Artificial sequence

[0704] <220>

[0705] <223> Synthetic sequence

[0706] <400> 19

[0707] gagagcaagt acggaccacc ttgcccacca tgtcctgcac cagagttcct gggaggacct 60

[0708] tccgtgttcc tgtttcctcc aaagccaaag gacaccctga tgatcagccg gaccccagag 120

[0709] gtgacatgcg tggtggtgga cgtgagccag gaggaccccg aggtgcagtt caactggtac 180

[0710] gtggatggcg tggaggtgca caatgccaag accaagccaa gagaggagca gtttaactcc 240

[0711] acctataggg tggtgtctgt gctgacagtg ctgcaccagg actggctgaa cggcaaggag 300

[0712] tacaagtgca aggtgtccaa tagaggcctg ccttcctcta tcgagaagac catctctaag 360

[0713] gcaaagggac agccaaggga gccacaggtg tatacactgc cccctagcca ggaggagatg 420

[0714] accaagaacc aggtgtccct gacatgtctg gtgaagggct tttacccttc tgacatcgcc 480

[0715] gtggagtggg agagcaatgg ccagccagag aacaattata agaccacacc acccgtgctg 540

[0716] gactctgatg gcagcttctt tctgtacagc cgcctgaccg tggataagtc ccggtggcag 600

[0717] gagggcaacg tgttctcctg ctctgtgatg cacgaggccc tgcacaatca ctacacacag 660

[0718] aagagcctgt ccctgtctct gggcaag 687

[0719] <210> 20

[0720] <211> 207

[0721] <212> DNA

[0722] <213> Artificial sequence

[0723] <220>

[0724] <223> Synthetic sequence

[0725] <400> 20

[0726] atgttttggg tgctggtggt ggtgggaggc gtgctggcct gttattccct gctggtgacc 60

[0727] gtggccttca tcatcttttg ggtgcgctcc aagcggagcc ggggcggaca ctctgactac 120

[0728] atgaacatga ccccacggag acccggacct acaaggaagc actatcagcc ctacgcccct 180

[0729] ccacgggact tcgcagcata tcgcagc 207

[0730] <210> 21

[0731] <211> 339

[0732] <212> ДНК

[0733] <213> Искусственная последовательность

[0734] <220>

[0735] <223> Синтетическая последовательность

[0736] <400> 21

[0737] cgggtgaagt ttagcagatc cgccgatgca ccagcatatc agcagggaca gaatcagctg 60

[0738] tacaacgagc tgaatctggg caggcgcgag gagtacgacg tgctggataa gaggcggggc 120

[0739] cgggaccccg agatgggagg caagcccagg cgcaagaacc ctcaggaggg cctgtataat 180

[0740] gagctgcaga aggacaagat ggccgaggcc tacagcgaga tcggcatgaa gggagagcgg 240

[0741] agaaggggca agggacacga tggcctgtat cagggcctgt ccaccgccac aaaggacacc 300

[0742] tacgatgcac tgcacatgca ggccctgcca cctcggtga 339

[0743] <210> 22

[0744] <211> 6864

[0745] <212> ДНК

[0746] <213> Искусственная последовательность

[0747] <220>

[0748] <223> Синтетическая последовательность

[0749] <400> 22

[0750] cctgcaggca gctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag cccgggcgtc 60

[0751] gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

[0752] actccatcac taggggttcc tgcggccggc gcgccgctgc accacgtgat gtcctctgag 180

[0753] cggatcctcc ccgtgtctgg gtcctctccg ggcatctctc ctccctcacc caaccccatg 240

[0754] ccgtcttcac tcgctgggtt cccttttcct tctccttctg gggcctgtgc catctctcgt 300

[0755] ttcttaggat ggccttctcc gacggatgtc tcccttgcgt cccgcctccc cttcttgtag 360

[0756] gcctgcatca tcaccgtttt tctggacaac cccaaagtac cccgtctccc tggctttagc 420

[0757] cacctctcca tcctcttgct ttctttgcct ggacaccccg ttctcctgtg gattcgggtc 480

[0758] acctctcact cctttcattt gggcagctcc cctacccccc ttacctctct agtctgtgct540

[0759] agctcttcca gccccctgtc atggcatctt ccaggggtcc gagagctcag ctagtcttct

[0760] tcctccaacc cgggccccta tgtccacttc aggacagcat gtttgctgcc tccagggatc

[0761] ctgtgtcccc gagctgggac caccttatat tcccagggcc ggttaatgtg gctctggttc

[0762] tgggtacttt tatctgtccc ctccacccca cagtggggcc actagggaca gcgatcgggt

[0763] acatcgatca cgagactagc ctcgagaagc ttgatatcga attccacggg gttggacgcg

[0764] tcttaattaa ggatccaagg tcaggaacag agaaacagga gaatgggc caaacaggat

[0765] atctgtggta agcagttcct gccccggctc agggccaaga acagttgga around

[0766] tgggccaaac aggatatctg tggtaagcag ttcctgcccc ggctcagggc caagacaga

[0767] tggtccccag atgcggtccc gccctcagca gtttctagag aaccatcaga tgtttccagg

[0768] gtgccccaag gacctgaat gaccctgtgc cttatttga ctaaccaatc agttcgcttc

[0769] tcgcttctgt tcgcgcgctt ctgctccccg agctctatat aagcagagct cgtttagtga

[0770] accgtcagat cgcctggaga cgccatccac gctgttttga cctccataga agacaccgac 1260

[0771] tctagaggat cgatcccccg ggctgcagga attcaagcga gaagacaagg gcagaaagca

[0772] ccgccaccat gctgctgctg gtgacctctc tgctgctgtg cgagctgcca cacccagcct 1380

[0773] tcctgctgat cccagacatc cagatgacac agagccccag ctccctgagc gcctccgtgg

[0774] gcgacagagt gaccatcaca tgtagggcct ctgagagcgt ggataactat ggcatcagct

[0775] tcatgaattg gtttcagcag aagcctggcg gcgccccaaa gctgctgatc tacgcagcca

[0776] gcatgcaggg ctccggcgtg ccctctcggt tctccggctc tggcagcggc accgacttca

[0777] ccctgacaat ctctagcctg cagccagacg atttcgccac attackattgc cagcagagca

[0778] aggaggtgcc ctggaccttt ggccagggca caaaggtgga gatcaagggc tccacctctg

[0779] gcagcggcaa gcctggcagc ggagagggct ccacaaaggg acaggtgcag ctggtgcagt

[0780] ccggagccga ggtgaagaag ccaggctcct ctgtgaaggt gtcttgtaag gccagcggct 1860

[0781] ataccttcac agactacaac atgcactggg tgcgccaggc accaggacag ggcctggagt 1920

[0782] ggatcggcta catctatcct tacaacggcg gcaccggcta taatcagaag tttaagtcca 1980

[0783] aggccaccat cacagccgat gagtctacca atacagccta catggagctg agcagcctgc 2040

[0784] ggtccgagga cacagccgtg tactattgcg cccggggcag acccgctatg gactattggg 2100

[0785] gccagggcac cctggtgaca gtgtctagcg agagcaagta cggaccacct tgcccaccat 2160

[0786] gtcctgcacc agagttcctg ggaggacctt ccgtgttcct gttcctcca aagccaaagg 2220

[0787] acaccctgat gatcagccgg accccagagg tgacatgcgt ggtggtggac gtgagccagg 2280

[0788] aggaccccga ggtgcagttc aactggtacg tggatggcgt ggaggtgcac aatgccaaga 2340

[0789] ccaagccaag agaggagcag tttaactcca cctatagggt ggtgtctgtg ctgacagtgc 2400

[0790] tgcaccagga ctggctgaac ggcaaggagt acaagtgcaa ggtgtccaat aagggcctgc 2460

[0791] cttcctctat cgagaagacc atctctaagg caaagggaca gccaagggag ccacaggtgt 2520

[0792] atacactgcc ccctagccag gaggagatga ccaagaacca ggtgtccctg acatgtctgg 2580

[0793] tgaagggctt ttacccttct gacatcgccg tggagtggga gagcaatggc cagccagaga 2640

[0794] acaattataa gaccacacca cccgtgctgg actctgatgg cagcttcttt ctgtacagcc 2700

[0795] gcctgaccgt ggataagtcc cggtggcagg agggcaacgt gttctcctgc tctgtgatgc 2760

[0796] acgaggccct gcacaatcac tacacacaga agagcctgtc cctgtctctg ggcaagatgt 2820

[0797] tttgggtgct ggtggtggtg ggaggcgtgc tggcctgtta ttccctgctg gtgaccgtgg 2880

[0798] ccttcatcat cttttgggtg cgctccaagc ggagccgggg cggacactct gactacatga 2940

[0799] acatgacccc acggagaccc ggacctacaa ggaagcacta tcagccctac gcccctccac 3000

[0800] gggacttcgc agcatatcgc agccgggtga agtttagcag atccgccgat gcaccagcat 3060

[0801] atcagcaggg acagaatcag ctgtacaacg agctgaatct gggcaggcgc gaggagtacg 3120

[0802] acgtgctgga taagaggcgg ggccgggacc ccgagatggg aggcaagccc aggcgcaaga 3180

[0803] accctcagga gggcctgtat aatgagctgc agaaggacaa gatggccgag gcctacagcg 3240

[0804] agatcggcat gaagggagag cggagaaggg gcaagggaca cgatggcctg tatcagggcc 3300

[0805] tgtccaccgc cacaaaggac acctacgatg cactgcacat gcaggccctg ccacctcggt 3360

[0806] gaaagtaacg ccctcgactg tgccttctag ttgccagcca tctgttgttt gcccctcccc 3420

[0807] cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat aaaatgagga 3480

[0808] aattgcatcg cattgtctga gtaggtgtca ttctattcga ttggtgacag aaaagcccca 3540

[0809] tccttaggcc tcctccttcc tagtctcctg atattgggtc taacccccac ctcctgttag 3600

[0810] gcagattcct tatctggtga cacaccccca tttcctggag ccatctctct ccttgccaga 3660

[0811] acctctaagg tttgcttacg atggagccag agaggatcct gggagggaga gcttggcagg 3720

[0812] gggtgggagg gaaggggggg atgcgtgacc tgcccggttc tcagtggcca ccctgcgcta 3780

[0813] ccctctccca gaacctgagc tgctctgacg cggctgtctg gtgcgtttca ctgatcctgg 3840

[0814] tgctgcagct tccttacact tcccaagagg agaagcagtt tggaaaaaca aaatcagaat 3900

[0815] aagttggtcc tgagttctaa ctttggctct tcacctttct agtccccaat ttatattgtt 3960

[0816] cctccgtgcg tcagttttac ctgtgagata aggccagtag ccagccccgt cctggcaggg 4020

[0817] ctgtggtgag gaggggggtg tccgtgtgga aaactccctt tgtgagaatg gtgcgtccta 4080

[0818] ggtgttcacc aggtcgtggc cgcctctact ccctttctgc ggccgcagga acccctagtg 4140

[0819] atggagttgg ccactccctc tctgcgcgct cgctcgctca ctgaggccgg gcgaccaaag 4200

[0820] gtcgcccgac gcccgggctt tgcccgggcg gcctcagtga gcgagcgagc gcgcagctgc 4260

[0821] ctgcaggggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 4320

[0822] atacgtcaaa gcaaccatag tacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg 4380

[0823] tggttacgcg cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt 4440

[0824] tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 4500

[0825] tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 4560

[0826] gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 4620

[0827] agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct 4680

[0828] cgggctattc ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg 4740

[0829] agctgattta acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaattttat 4800

[0830] ggtgcactct cagtacaatc tgctctgatg ccgcatagtt aagccagccc cgacacccgc 4860

[0831] caacacccgc tgacgcgccc tgacgggctt gtctgctccc ggcatccgct tacagacaag 4920

[0832] ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc accgtcatca ccgaaacgcg 4980

[0833] cgagacgaaa gggcctcgtg atacgcctat ttttataggt taatgtcatg ataataatgg 5040

[0834] tttcttagac gtcaggtggc acttttcggg gaaatgtgcg cggaacccct atttgtttat 5100 0835 0836

[0837] tttttgcggc attttgcctt cctgtttttg ctcacccaga aacgctggtg aaagtaaaag 5280

[0838] atgctgaaga tcagttgggt gcacgagtgg gttacatcga actggatctc aacagcggta 5340

[0839] agatccttga gagttttcgc cccgaagaac gttttccaat gatgagcact tttaaagttc 5400

[0840] tgctatgtgg cgcggtatta tcccgtattg acgccgggca agagcaactc ggtcgccgca 5460

[0841] tacactattc tcagaatgac ttggttgagt actcaccagt cacaagaaag catcttacgg 5520

[0842] atggcatgac agtaagagaa ttatgcagtg ctgccataac catgagtgat aacactgcgg 5580 0843

[0844] tggggatca tgtaactcgc cttgatcgtt gggaaccgga gctgaatgaa gccataccaa 5700

[0845] acgacgagcg tgacaccacg atgcctgtag caatggcaac aacgttgcgc aaactattaa 5760

[0846] ctggcgaact acttactcta gcttcccggc aacaattaat agactggatg gaggcggata 5820

[0847] aagttgcagg accacttctg cgctcggccc ttccggctgg ctggtttatt gctgataaat 5880

[0848] ctggagccgg tgagcgtggg tctcgcggta tcattgcagc actggggcca gatggtaagc 5940

[0849] cctcccgtat cgtagttatc tacacgacgg ggagtcaggc aactatggat gaacgaaata 6000

[0850] gacagatcgc tgagataggt gcctcactga ttaagcattg gtaactgtca gaccaagttt 6060

[0851] actcatatat actttagatt gatttaaaac ttcattttta atttaaaagg atctaggtga 6120

[0852] agatcctttt tgataatctc atgaccaaaa tcccttaacg tgagttttcg ttccactgag 6180

[0853] cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 6240

[0854] tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 6300

[0855] agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 6360

[0856] tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 6420

[0857] acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 6480

[0858] ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 6540

[0859] gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 6600

[0860] gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 6660

[0861] gcggcagggt cggaacagga gagcgcacga gggagcttc agggggaaac gcctggtatc 6720

[0862] tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 6780

[0863] caggggggcg gagcctatgg aaaaacgcca gcaacgcggc cttttacgg ttcctggcct 6840

[0864] tttgctggcc tttgctcac atgt 6864

[0865] <210> 23

[0866] <211> 7161

[0867] <212> DNA

[0868] <213> Artificial sequence

[0869] <220>

[0870] <223> Synthetic sequence

[0871] <400> 23

[0872] cctgcaggca gctgcgcgct cgctcgctca ctgaggcgc ccgggcaaag cccgggcgtc 60

[0873] gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag ggagtggcca 120

[0874] actccatcac taggggttcc tgcggccggc gcgccgctgc accacgtgat gtcctctgag 180

[0875] cggatcctcc ccgtgtctgg gtcctctccg ggcatctctc ctccctcacc caaccccatg 240

[0876] ccgtcttcac tcgctgggtt cccttttcct tctccttctg gggcctgtgc catctctcgt 300

[0877] ttcttaggat ggccttctcc gacggatgtc tcccttgcgt cccgcctccc cttcttgtag 360

[0878] gcctgcatca tcaccgtttt tctggacaac cccaaagtac cccgtctccc tggctttagc 420

[0879] cacctctcca tcctcttgct ttctttgcct ggacaccccg ttctcctgtg gattcgggtc 480

[0880] acctctcact cctttcattt gggcagctcc cctacccccc ttacctctct agtctgtgct 540

[0881] agctcttcca gccccctgtc atggcatctt ccaggggtcc gagagctcag ctagtcttct 600

[0882] tcctccaacc cgggccccta tgtccacttc aggacagcat gtttgctgcc tccagggatc 660

[0883] ctgtgtcccc gagctgggac caccttatat tcccagggcc ggttaatgtg gctctggttc 720

[0884] tgggtacttt tatctgtccc ctccacccca cagtggggcc actagggaca gcgatcgggt

[0885] acatcgatca cgagactagc ctcgagaagc ttgatatcga attccacggg gttggacgcg

[0886] tcttaattaa ggatccaagg tcaggaacag agaaacagga gaatgggc caaacaggat

[0887] atctgtggta agcagttcct gccccggctc agggccaaga acagttgga around

[0888] tgggccaaac aggatatctg tggtaagcag ttcctgcccc ggctcagggc caagacaga

[0889] tggtccccag atgcggtccc gccctcagca gtttctagag aaccatcaga tgtttccagg

[0890] gtgccccaag gacctgaat gaccctgtgc cttatttga ctaaccaatc agttcgcttc

[0891] tcgcttctgt tcgcgcgctt ctgctccccg agctctatat aagcagagct cgtttagtga

[0892] accgtcagat cgcctggaga cgccatccac gctgttttga cctccataga agacaccgac

[0893] tctagaggat cgatcccccg ggctgcagga attcaagcga gaagacaagg gcagaaagca

[0894] ccgccaccat gctgctgctg gtgacctccc tgctgctgtg cgagctgcca caccctgcct 1380

[0895] ttctgctgat cccagacatc cagatgacac agagccccag ctccctgtct gccagcgtgg

[0896] gcgacagagt gaccatcaca tgtagggcct ccgagtctgt ggataactat ggcatcagct

[0897] ttatgaattg gttccagcag aagccaggag gcgcccctaa gctgctgatc tacgcagcct

[0898] ccatgcaggg ctctggcgtg cccagccgct ttagcggctc cggctctggc accgatttca

[0899] ccctgacaat ctctagcctg cagccagacg attttgccac atactattgc cagcagtcca

[0900] aggaggtgcc ctggaccttc ggccagggca caaaggtgga gatcaagggc agcacctccg

[0901] gctctggcaa gcctggctcc ggagagggct ctacaaaggg acaggtgcag ctggtgcaga

[0902] gcggagccga ggtgaagaag ccaggctcct ctgtgaaggt gagctgtaag gcctccggct

[0903] atacctttac agctacaac atgcactggg tgagacaggc accaggacag ggcctggagt

[0904] gatcggcta catctatcct tacaacggcg gcaccggcta taatcagaag ttcaagagca

[0905] aggccaccat cacagccgat cagtccacca attackcagccta catggagctg agcagcctga

[0906] ggagcgagga cacagccgtg tactattgcg ccagaggcag gcctgctatg gactattggg 2100

[0907] gccagggcac cctggtgaca gtgtctagcg agtccaagta cggaccacct tgcccaccat 2160

[0908] gtccagcacc agagtttctg ggaggaccta gcgtgtttct gttccctcca aagccaaagg 2220

[0909] acaccctgat gatcagcaga acccccgagg tgacatgcgt ggtggtggac gtgtcccagg 2280

[0910] aggaccccga ggtgcagttt aactggtacg tggatggcgt ggaggtgcac aatgccaaga 2340

[0911] ccaagcctag agaggagcag ttcaactcca cctatagggt ggtgtctgtg ctgacagtgc 2400

[0912] tgcaccagga ctggctgaac ggcaaggagt acaagtgcaa ggtgtctaat aagggcctgc 2460

[0913] catcctctat cgagaagacc atcagcaagg ccaagggcca gcctagggag ccacaggtgt 2520

[0914] atacactgcc cccttcccag gaggagatga ccaagaacca ggtgtctctg acatgtctgg 2580

[0915] tgaagggctt ctacccatcc gacatcgccg tggagtggga gtctaatggc cagcccgaga 2640

[0916] acaattataa gaccacacca cccgtgctgg actctgatgg cagcttcttt ctgtactctc 2700

[0917] gcctgaccgt ggataagagc cggtggcagg agggcaacgt gtttagctgc tccgtgatgc 2760

[0918] acgaggccct gcacaatcac tacacacaga agtctctgag cctgtccctg ggcaagagca 2820

[0919] acctgttcgt ggcctcctgg atcgccgtga tgatcatctt tcgcatcggc atggccgtgg 2880

[0920] ccatcttctg ctgtttcttt ttcccatccg gaggctctgg aggaggctcc ggctggcgga 2940

[0921] gaaagcggaa ggagaagcag agcgagacct cccctaagga gtttctgaca atctatgagg 3000

[0922] acgtgaagga tctgaagacc aggcgcaatc acgagcagga gcagaccttc ccaggaggag 3060

[0923] gctctacaat ctacagcatg atccagtccc agagcagcgc cccaaccagc caggagccag 3120

[0924] cctatacact gtactctctg atccagccta gccggaagtc tggcagccgc aagcggaacc 3180

[0925] actccccatc tttcaattct accatctatg aagtgatcgg caagagccag cctaaggccc 3240

[0926] agaacccagc cagactgtcc aggaaggagc tggagaattt tgacgtgtac tctggaggca 3300

[0927] gcggaggagg ctctggccgc gtgaagttca gccggtccgc cgatgcccca gcctataagc 3360

[0928] agggccagaa ccagctgtac aacgagctga atctgggccg gagagaggag tacgacgtgc

[0929] tggataagag gcggggccgg gaccccgaga tgggaggcaa gccccggaga aagaaccctc

[0930] aggagggcct gtataatgag ctgcagaagg acaagatggc cgaggcctac tccgagatcg

[0931] gcatgaaggg agagaggcgc cggggcaagg cctgtatcag ggcctgagca

[0932] ccgccacaaa ggacacctac gatgccctgc acatgcaggc cctgcctcca cggtgatgaa

[0933] agtaacgccc tcgactgtgc cttctagttg ccagccatct gttgtttgcc cctcccccgt 3720.

[0934] gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataa atgaggaaat

[0935] tgcatcgcat tgtctgagta ggtgtcattc tattcgattg gtgacagaaa agccccatcc

[0936] ttaggcctcc tccttcctag tctcctgata ttgggtctaa cccccacctc ctgttaggca

[0937] gattccttat ctggtgacac acccccattt cctggagcca tctctctcct tgccagaacc 3960

[0938] tctaaggttt gcttacgatg gagccagaga ggatcctggg agggagagct tggcaggggg

[0939] tgggagggaa gggggggatg cgtgacctgc ccggttctca gtggccaccc tgcgctaccc 4080

[0940] tctcccagaa cctgagctgc tctgacgcgg ctgtctggtg cgtttcactg atcctggtgc 4140

[0941] tgcagcttcc ttacacttcc caagaggaga agcagtttgg aaaaacaaaa tcagaataag 4200

[0942] ttggtcctga gttctaactt tggctcttca cctttctagt ccccaattta tattgttcct 4260

[0943] ccgtgcgtca gttttacctg tgagataagg ccagtagcca gccccgtcct ggcagggctg 4320

[0944] tggtgaggag gggggtgtcc gtgtggaaaa ctccctttgt gagaatggtg cgtcctaggt 4380

[0945] gttcaccagg tcgtggccgc ctctactccc tttctgcggc cgcaggaacc cctagtgatg 4440

[0946] gagttggcca ctccctctct gcgcgctcgc tcgctcactg aggccgggcg accaaaggtc 4500

[0947] gcccgacgcc cgggctttgc ccgggcggcc tcagtgagcg agcgagcgcg cagctgcctg 4560

[0948] caggggcgcc tgatgcggta ttttctcctt acgcatctgt gcggtatttc acaccgcata 4620

[0949] cgtcaaagca accatagtac gcgccctgta gcggcgcatt aagcgcggcg ggtgtggtgg 4680

[0950] ttacgcgcag cgtgaccgct acacttgcca gcgccctagc gcccgctcct ttcgctttct 4740

[0951] tcccttcctt tctcgccacg ttcgccggct ttccccgtca agctctaaat cgggggctcc 4800

[0952] ctttagggtt ccgatttagt gctttacggc acctcgaccc caaaaaactt gatttgggtg 4860

[0953] atggttcacg tagtgggcca tcgccctgat agacggtttt tcgccctttg acgttggagt 4920

[0954] ccacgttctt taatagtgga ctcttgttcc aaactggaac aacactcaac cctatctcgg 4980

[0955] gctattcttt tgatttataa gggattttgc cgatttcggc ctattggtta aaaaatgagc 5040

[0956] tgatttaaca aaaatttaac gcgaatttta acaaaatatt aacgtttaca attttatggt 5100

[0957] gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 5160

[0958] cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 5220

[0959] tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 5280

[0960] gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 5340

[0961] cttagacgtc aggtggcact tttcgggggaa atgtgcgcgg aacccctatt tgtttatttt 5400

[0962] tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 5460

[0963] aatattgaaa aaagaagagt atgagtattc aacatttccg tgtcgccctt attcccttt 5520

[0964] ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 5580

[0965] ctgaagatca gttgggttca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 5640

[0966] tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 5700

[0967] tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 5760

[0968] actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 5820

[0969] gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 5880

[0970] acttacttct gcaacgatc ggaggaccga aggagctaac cgcttttttg caacacatgg 5940

[0971] gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 6000

[0972] acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 6060

[0973] gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 6120

[0974] ttgcaggacc acttctgcgc tcggcccttc cggctggctg gttattgct gataaatctg 6180

[0975] gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 6240

[0976] cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaatagac 6300

[0977] agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 6360

[0978] catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 6420

[0979] tccttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 6480

[0980] cagaccccgt agaaaagatc aaaggatctt cttgagatcc ttttttctg cgcgtaatct 6540

[0981] gctgcttgca aaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 6600

[0982] taccaactct tttccgaag gtaactggct tcagcagagc gcagatacca aatactgtcc 6660

[0983] ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 6720

[0984] tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 6780

[0985] ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 6840

[0986] cgtgcacaca gcccagcttg gagcgaacga cttacaccga actgagatac ctacagcgtg 6900

[0987] agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 6960

[0988] gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 7020

[0989] atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 7080

[0990] gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 7140

[0991] gctggccttt tgctcacatg t 7161

[0992] <210> 24

[0993] <211> 93

[0994] <212> DNA

[0995] <213> Artificial sequence

[0996] <220>

[0997] <223> Synthetic sequence

[0998] <400> 24

[0999] agcaacctgt tcgtggcctc ctggatcgcc gtgatgatca tctttcgcat cggcatggcc 60

[1000] gtggccatct tctgctgttt ctttttccca tcc 93

[1001] <210> 25

[1002] <211> 24

[1003] <212> DNA

[1004] <213> Artificial sequence

[1005] <220>

[1006] <223> Synthetic sequence

[1007] <400> 25

[1008] ggaggctctg gaggaggctc cggc 24

[1009] <210> 26

[1010] <211> 360

[1011] <212> DNA

[1012] <213> Artificial sequence

[1013] <220>

[1014] <223> Synthetic sequence

[1015] <400> 26

[1016] tggcggagaa agcggaagga gaagcagagc gagacctccc ctaaggagtt tctgacaatc 60

[1017] tatgaggacg tgaaggatct gaagaccagg cgcaatcacg agcaggagca gaccttccca 120

[1018] ggaggaggct ctacaatcta cagcatgatc cagtcccaga gcagcgcccc aaccagccag 180

[1019] gagccagcct atacactgta ctctctgatc cagcctagcc ggaagtctgg cagccgcaag 240

[1020] cggaaccact ccccatcttt caattctacc atctatgaag tgatcggcaa gagccagcct 300

[1021] aaggcccaga acccagccag actgtccagg aaggagctgg agaattttga cgtgtactct 360

[1022] <210> 27

[1023] <211> 24

[1024] <212> DNA

[1025] <213> Artificial sequence

[1026] <220>

[1027] <223> Synthetic sequence

[1028] <400> 27

[1029] ggaggcagcg gaggaggctc tggc 24

[1030] <210> 28

[1031] <211> 342

[1032] <212> DNA

[1033] <213> Artificial sequence

[1034] <220>

[1035] <223> Synthetic sequence

[1036] <400> 28

[1037] cgcgtgaagt tcagccggtc cgccgatgcc ccagcctata agcagggcca gaaccagctg 60

[1038] tacaacgagc tgaatctggg ccggagagag gagtacgacg tgctggataa gaggcggggc 120

[1039] cgggaccccg agatgggagg caagccccgg agaaagaacc ctcaggaggg cctgtataat 180

[1040] gagctgcaga aggacaagat ggccgaggcc tactccgaga tcggcatgaa gggagagagg 240

[1041] cgccggggca agggacacga tggcctgtat cagggcctga gcaccgccac aaaggacacc 300

[1042] tacgatgcc tgcacatgca ggccctgcct ccacggtgat ga 342

[1043] <210> 29

[1044] <211> 801

[1045] <212> DNA

[1046] <213> Artificial sequence

[1047] <220>

[1048] <223> Synthetic sequence

[1049] <400> 29

[1050] atgctgctgc tggtgacctc cctgctgctg tgcgagctgc cacaccctgc cttctgctg 60

[1051] atcccagaca tccagatgac acagagcccc agctccctgt ctgccagcgt gggcgacaga 120

[1052] gtgaccatca catgtagggc ctccgagtct gtggataact atggcatcag ctttatgaat 180

[1053] tggttccagc agaagccagg aggcgcccct aagctgctga tctacgcagc ctccatgcag 240

[1054] ggctctggcg tgcccagccg ctttagcggc tccggctctg gcaccgattt caccctgaca 300

[1055] atctctagcc tgcagccaga cgattttgcc acatactatt gccagcagtc caaggaggtg 360

[1056] cctggacct tcggccaggg cacaaaggtg gagatcaagg gcagcacctc cggctctggc 420

[1057] aagcctggct ccggagaggg ctctacaaag ggacaggtgc agctggtgca gagcggagcc 480

[1058] gaggtgaaga agccaggctc ctctgtgaag gtgagctgta aggcctccgg ctataccttt 540

[1059] acagactaca acatgcactg ggtgagacag gcaccaggac agggcctgga gtggatcggc 600

[1060] tacatctatc cttacaacgg cggcaccggc tataatcaga agttcaagag caaggccacc 660

[1061] atcacagccg atgagtccac caatacagcc tacatggagc tgagcagcct gaggagcgag 720

[1062] gacacagccg tgtactattg cgccagaggc aggcctgcta tggactattg gggccagggc 780

[1063] accctggtga cagtgtctag c 801

[1064] <210> 30

[1065] <211> 540

[1066] <212> DNA

[1067] <213> Artificial sequence

[1068] <220>

[1069] <223> The synthetic sequence

[1070] <400> 30

[1071] atcgatcacg agactagcct cgagaagctt gatatcgaat tccacggggt tggacgcgtc 60

[1072] ttaattaagg atccaaggtc aggaacagag aaacaggaga atatgggcca aacaggatat 120

[1073] ctgtggtaag cagttcctgc cccggctcag ggccaagaac agttggaaca gcagaatatg 180

[1074] ggccaaacag gatatctgtg gtaagcagtt cctgccccgg ctcagggcca agaacagatg 240

[1075] gtccccagat gcggtcccgc cctcagcagt ttctagagaa ccatcagatg tttccagggt 300

[1076] gccccaagga cctgaaatga ccctgtgcct tatttgaact aaccaatcag ttcgcttctc 360

[1077] gcttctgttc gcgcgcttct gctccccgag cctatataa gcagagctcg tttagtgaac 420

[1078] cgtcagatcg cctggagacg ccatccacgc tgttttgacc tccatagaag acaccgactc 480

[1079] tagaggatcg atcccccggg ctgcaggaat tcaagcgaga agacaagggc agaaagcacc 540

[1080] <210> 31

[1081] <211> 604

[1082] <212> DNA

[1083] <213> Artificial sequence

[1084] <220>

[1085] <223> Synthetic sequence

[1086] <400> 31

[1087] gctgcaccac gtgatgtcct ctgagcggat cctccccgtg tctgggtcct ctccgggcat 60

[1088] ctctctccc tcacccaacc ccatgccgtc ttcactcgct gggttccct ttccttctcc 120

[1089] ttctggggcc tgtgccatct ctcgtttctt agatggcct tctccgacgg atgtctccct 180

[1090] tgcgtcccgc ctccccttct tgtaggcctg catcatcacc gttttctgg acaaccccaa 240

[1091] agtaccccgt ctccctggct ttagccacct ctccatcctc ttgctttctt tgcctggaca 300

[1092] ccccgttctc ctgtggattc gggtcacctc tcactccttt catttgggca gctcccctac 360

[1093] ccccttacc tctctagtct gtgctagctc ttccagcccc ctgtcatggc atcttccagg 420

[1094] ggtccgagag ctcagctagt cttcttcctc caacccgggc ccctatgtcc acttcaggac 480

[1095] agcatgtttg ctgcctccag ggatcctgtg tccccgagct gggaccacct tatattccca 540

[1096] gggccggtta atgtggctct ggttctgggt acttttatct gtcccctcca ccccacagtg 600

[1097] gggc 604

[1098] <210> 32

[1099] <211> 600

[1100] <212> DNA

[1101] <213> Artificial sequence

[1102] <220>

[1103] <223> Synthetic sequence

[1104] <400> 32

[1105] gattggtgac agaaaagccc catccttagg cctcctcctt ctagtctcc tgatattggg 60

[1106] tctaaccccc acctcctgtt aggcagattc cttatctggt gacacacccc catttcctgg 120

[1107] agccatctct ctccttgcca gaacctctaa ggtttgctta cgatggagcc agagaggatc 180

[1108] ctgggaggga gagcttggca gggggtggga gggaaggggg ggatgcgtga cctgcccggt 240

[1109] tctcagtggc caccctgcgc taccctctc cagaacctga gctgctctga cgcggctgtc 300

[1110] tggtgcgttt cactgatcct ggtgctgcag cttccttaca cttcccaaga ggagaagcag 360

[1111] tttggaaaaa caaaatcaga ataagttggt cctgagttct aactttggct cttcaccttt 420

[1112] ctagtcccca atttatattg ttcctccgtg cgtcagtttt acctgtgaga taaggccagt 480

[1113] agccagcccc gtcctggcag ggctgtggtg aggagggggg tgtccgtgtg gaaaactccc 540

[1114] tttgtgagaa tggtgcgtcc taggtgttca ccaggtcgtg gccgcctcta ctccctttct 600

[1115] <210> 33

[1116] <211> 20

[1117] <212> DNA

[1118] <213> Artificial sequence

[1119] <220>

[1120] <223> Synthetic sequence

[1121] <400> 33

[1122] ggggccacta gggacaggat 20

[1123] <210> 34

[1124] <211> 22

[1125] <212> DNA

[1126] <213> Artificial sequence

[1127] <220>

[1128] <223> Synthetic sequence

[1129] <400> 34

[1130] ttctcctgtg gattcgggtc ac 22

[1131] <210> 35

[1132] <211> 22

[1133] <212> DNA

[1134] <213> Artificial sequence

[1135] <220>

[1136] <223> Synthetic sequence

[1137] <400> 35

[1138] ctctctggct ccatcgtaag ca 22

[1139] <210> 36

[1140] <211> 19

[1141] <212> DNA

[1142] <213> Artificial sequence

[1143] <220>

[1144] <223> Synthetic sequence

[1145] <400> 36

[1146] tcctgggcaa acagcataa 19

[1147] <210> 37

[1148] <211> 20

[1149] <212> DNA

[1150] <213> Artificial sequence

[1151] <220>

[1152] <223> Synthetic sequence

[1153] <400> 37

[1154] gagctgcaga aggacaagat 20

[1155] <210> 38

[1156] <211> 22

[1157] <212> DNA

[1158] <213> Artificial sequence

[1159] <220>

[1160] <223> Synthetic sequence

[1161] <400> 38

[1162] ctctgtgtca tctggatgtc tg 22

[1163] <210> 39

[1164] <211> 22

[1165] <212> DNA

[1166] <213> Artificial sequence

[1167] <220>

[1168] <223> Synthetic sequence

[1169] <400> 39

[1170] ctttgagctc tactggcttc tg 22

[1171] <210> 40

[1172] <211> 19

[1173] <212> DNA

[1174] <213> Artificial sequence

[1175] <220>

[1176] <223> Synthetic sequence

[1177] <400> 40

[1178] tcctgggcaa acagcataa 19

[1179] <210> 41

[1180] <211> 22

[1181] <212> DNA

[1182] <213> Artificial sequence

[1183] <220>

[1184] <223> Synthetic sequence

[1185] <400> 41

[1186] ctttgagctc tactggcttc tg 22

[1187] <210> 42

[1188] <211> 18

[1189] <212> DNA

[1190] <213> Artificial sequence

[1191] <220>

[1192] <223> Synthetic sequence

[1193] <400> 42

[1194] gcgagtgaag acggcatg 18

[1195] <210> 43

[1196] <211> 20

[1197] <212> DNA

[1198] <213> Artificial sequence

[1199] <220>

[1200] <223> Synthetic sequence

[1201] <400> 43

[1202] gtctgtgcta gctcttccag 20

[1203] <210> 44

[1204] <211> 19

[1205] <212> DNA

[1206] <213> Artificial sequence

[1207] <220>

[1208] <223> Synthetic sequence

[1209] <400> 44

[1210] gcgatgtcag aagggtaaa 19

[1211] <210> 45

[1212] <211> 20

[1213] <212> DNA

[1214] <213> Artificial sequence

[1215] <220>

[1216] <223> Synthetic sequence

[1217] <400> 45

[1218] ggcggacact ctgactacat 20

[1219] <210> 46

[1220] <211> 235

[1221] <212> DNA

[1222] <213> Artificial sequence

[1223] <220>

[1224] <223> Synthetic sequence

[1225] <400> 46

[1226] ggcatggggt tgggtgaggg aggagagatg cccggagagg acccagacac ggggaggatc 60

[1227] cgctcagagg acatcacgtg gtgcagcggc gcgccggccg cagaaaggga gtagaggcgg 120

[1228] ccacgacctg gtgaacacct aggacgcacc attctcacaa agggagtttt ccacacggac 180

[1229] acccccctcc tcaccacagc cctgccagga cggggctggc tactggcctt atctc 235

[1230] <210> 47

[1231] <211> 243

[1232] <212> DNA

[1233] <213> Artificial sequence

[1234] <220>

[1235] <223> Synthetic sequence

[1236] <400> 47

[1237] gcgagtgaag acggcatggg gttgggtgag ggaggagaga tgcccggaga ggacccagac 60

[1238] acggggagga tccgctcaga ggacatcacg tggtgcagcg gcgcgcggc cgcaggaagg 120

[1239] gagtagaggc ggccacgacc tggtgaacac ctaggacgca ccattctcac aaagggagtt 180

[1240] ttccacacgg acacccccct cctcaccaca gccctgccag gacggggctg gctactggcc 240

[1241] at 243

[1242] <210> 48

[1243] <211> 229

[1244] <212> DNA

[1245] <213> Artificial sequence

[1246] <220>

[1247] <223> Synthetic sequence

[1248] <400> 48

[1249] gcgagtgaag acggcatggg gttgggtgag ggaggaga tgcccggaga ggacccagac 60

[1250] acggggagga tccgctcaga ggacatcacg tggtgcagcg gcgcgcagag agggagtggc 120

[1251] caactccatc actaggggtt cctgcggccg cagaaaggga gtagaggcgg ccacgacctg 180

[1252] gtgaacacct aggacgcacc attctcacaa aggagtttt ccacacgga 229

[1253] <210> 49

[1254] <211> 234

[1255] <212> DNA

[1256] <213> Artificial sequence

[1257] <220>

[1258] <223> Synthetic sequence

[1259] <400> 49

[1260] gcgagtgaag acggcatggg gttgggtgag ggaggagaga tgcccggaga ggacccagac 60

[1261] acggggagga tccgctcaga ggacatcacg tggtgcagcg gccgcagaaa gggagtagag 120

[1262] gcggccacga cctggtgaac acctaggacg caccattctc acaaagggag ttttccacac 180

[1263] ggacaccccc ctcctcacca cagccctgcc aggacggggc tggctactgg cctt 234

[1264] <210> 50

[1265] <211> 972

[1266] <212> DNA

[1267] <213> Artificial sequence

[1268] <220>

[1269] <223> Synthetic sequence

[1270] <400> 50

[1271] ccaatcctgt ccctagtggc cccactagg gacagcgatc gggtacatcg atcgcaggcg 60

[1272] caatcttcgc atttcttttt tccaggtgag caagggcgag gaggataaca tggccatcat 120

[1273] caaggagttc atgcgcttca aggtgcacat ggagggctcc gtgaacggcc acgagttcga 180

[1274] gatcgagggc gagggcgagg gccgcccta cgagggcacc cagaccgcca agctgaaggt 240

[1275] gaccaagggt ggccccctgc ccttcgcctg ggacatcctg tcccctcagt tcatgtacgg 300

[1276] ctccaaggcc tacgtgaagc accccgccga catccccgac tacttgaagc tgtccttccc 360

[1277] cgagggcttc aagtgggagc gcgtgatgaa cttcgaggac ggcggcgtgg tgaccgtgac 420

[1278] ccaggactcc tccctgcagg acggcgagtt catctacaag gtgaagctgc gcggcaccaa 480

[1279] cttcccctcc gacggccccg taatgcagaa gaagaccatg ggctgggagg cctcctccga 540

[1280] gcggatgtac cccgaggacg gcgccctgaa gggcgagatc aagcagaggc tgaagctgaa 600

[1281] ggacggcggc cactacgacg ctgaggtcaa gaccacctac aaggccaaga agcccgtgca 660

[1282] gctgcccggc gcctacaacg tcaacatcaa gttggacatc acctcccaca acgaggacta 720

[1283] caccatcgtg gaacagtacg aacgcgccga gggccgccac tccaccggcg gcatggacga 780

[1284] gctgtacaag taacgcggcc gccctcgact gtgccttcta gttgccagcc atctgttgtt 840

[1285] tgccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa 900

[1286] taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattcc caatcctgtc 960

[1287] cctagtggcc cc 972

[1288] <210> 51

[1289] <211> 949

[1290] <212> DNA

[1291] <213> Artificial sequence

[1292] <220>

[1293] <223> Synthetic sequence

[1294] <400> 51

[1295] ccaatcctgt ccctagtggc ccccactagg gacagcgatc gggtacatcg atcgcaggcg 60

[1296] caatcttcgc atttcttttt tccaggtgag caagggcgag gaggataaca tggccatcat 120

[1297] caaggagttc atgcgcttca aggtgcacat ggagggctcc gtgaacggcc acgagttcga 180

[1298] gatcgagggc gagggcgagg gccgcccta cgagggcacc cagaccgcca agctgaaggt 240

[1299] gaccaagggt ggccccctgc ccttcgcctg ggacatcctg tcccctcagt tcatgtacgg 300

[1300] ctccaaggcc tacgtgaagc accccgccga catccccgac tacttgaagc tgtccttccc 360

[1301] cgagggcttc aagtgggagc gcgtgatgaa cttcgaggac ggcggcgtgg tgaccgtgac 420

[1302] ccaggactcc tccctgcagg acggcgagtt catctacaag gtgaagctgc gcggcaccaa 480

[1303] cttcccctcc gacggccccg taatgcagaa gaagaccatg ggctgggagg cctcctccga 540

[1304] gcggatgtac cccgaggacg gcgccctgaa gggcgagatc aagcagaggc tgaagctgaa 600

[1305] ggacggcggc cactacgacg ctgaggtcaa gaccacctac aaggccaaga agcccgtgca 660

[1306] gctgcccggc gcctacaacg tcaacatcaa gttggacatc acctcccaca acgaggacta 720

[1307] caccatcgtg gaacagtacg aacgcgccga gggccgccac tccaccggcg gcatggacga 780

[1308] gctgtacaag taacgcggcc gccctcgact gtgccttcta gttgccagcc atctgttgtt 840

[1309] tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa 900

[1310] taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattc 949

[1311] <210> 52

[1312] <211> 65

[1313] <212> DNA

[1314] <213> Artificial sequence

[1315] <220>

[1316] <223> Synthetic sequence

[1317] <400> 52

[1318] cccctccacc ccacagtggg gccactaggg acaggattgg tgacagaaaa gccccatcct 60

[1319] taggc 65

[1320] <210> 53

[1321] <211> 34

[1322] <212> DNA

[1323] <213> Artificial sequence

[1324] <220>

[1325] <223> Synthetic sequence

[1326] <400> 53

[1327] cccctccacc ccacagtggg gccactaggg acag 34

[1328] <210> 54

[1329] <211> 30

[1330] <212> DNA

[1331] <213> Artificial sequence

[1332] <220>

[1333] <223> Synthetic sequence

[1334] <400> 54

[1335] attggtgaca gaaaagcccc atccttaggc 30

[1336] <210> 55

[1337] <211> 31

[1338] <212> DNA

[1339] <213> Artificial sequence

[1340] <220>

[1341] <223> Synthetic sequence

[1342] <400> 55

[1343] cccctccacc cccacagtggg gccactaggg a 31

[1344] <210> 56

[1345] <211> 14

[1346] <212> DNA

[1347] <213> Artificial sequence

[1348] <220>

[1349] <223> Synthetic sequence

[1350] <400> 56

[1351] cccctccacc ccac 14

[1352] <210> 57

[1353] <211> 25

[1354] <212> DNA

[1355] <213> Artificial sequence

[1356] <220>

[1357] <223> Synthetic sequence

[1358] <400> 57

[1359] cccctccacc cccacagtggg gccac 25

[1360] <210> 58

[1361] <211> 31

[1362] <212> DNA

[1363] <213> Artificial sequence

[1364] <220>

[1365] <223> Synthetic sequence

[1366] <400> 58

[1367] gattggtgac agaaaagccc catccttagg c 31

[1368] <---

Claims

1. A plasmid for use in genetically modifying a natural killer (NK) cell or an NK T cell, wherein said plasmid is used with clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated 9 (Cas9) integration systems, and wherein the plasmid comprises, in order, a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide, and a right homology arm; wherein the left and right homology arms each have a length of from 30 bp to 1000 bp.

2. The plasmid of claim 1, wherein the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3ζ signaling domain, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell, wherein said transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3ζ transmembrane domain, or an NKG2D transmembrane domain, and wherein said costimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 costimulatory domain, a 4-1BB costimulatory domain, or any combination thereof.

3. The plasmid according to claim 2, characterized in that the receptor contains CD33.

4. The plasmid according to claim 3, characterized in that the scFV, specifically binding to CD33, contains a sequence that is at least 90% identical to SEQ ID No: 29 or a fragment thereof.

5. A plasmid according to any one of claims 1-4, characterized in that the homology arms specifically hybridize with the integration site 1 of the adeno-associated virus (AAVS1) of human chromosome 19.

6. An adeno-associated virus (AAV) vector for use in transducing a natural killer (NK) cell or NK T cell with a polynucleotide sequence encoding a CAR polypeptide, wherein said AAV vector comprises a plasmid according to any one of claims 1-5.

7. The AAV vector according to claim 6, characterized in that the serotype of the AAV vector includes AAV6.

8. The AAV vector of claim 7, further comprising a plasmid encoding crRNA, tracer RNA (trcrRNA) and CAS endonuclease.

9. An AAV vector according to any one of paragraphs 6-8, characterized in that it is a single-stranded AAV vector (ssAAV).

10. An AAV vector according to any one of paragraphs 6-8, characterized in that it is a self-complementary AAV vector (scAAV).

11. The AAV vector according to any one of claims 6-10, characterized in that it contains a sequence that is at least 90% identical to SEQ ID No: 22, or SEQ ID No: 23, or a fragment thereof.

12. A modified cell for increasing antitumor activity relative to a control cell, comprising a plasmid according to any one of claims 1-5 or an AAV vector according to any one of claims 6-11, wherein said modified cell is a natural killer (NK) cell or an NK T cell.

13. The modified cell of claim 12, wherein the NK cell or NK T cell has been expanded in the presence of irradiated feeder cells, plasma membrane particles or exosomes expressing membrane-associated IL-21, membrane-associated 4-1BBL and / or membrane-associated IL-15 or any combination thereof.

14. A method of treating cancer in a subject, comprising administering to the subject with cancer a modified NK cell or a modified NK T cell, wherein said modified NK cell or modified NK T cell comprises a plasmid that has, in order, a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide for a tumor antigen, and a right homology arm; wherein the left and right homology arms each have a length of from 30 bp to 1000 bp.

15. A method for genetically modifying a natural killer (NK) cell or NK T cell, comprising (a) providing a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease in complex with an appropriate CRISPR / Cas guide RNA and an adeno-associated virus (AAV) vector comprising a plasmid comprising a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide; wherein the polynucleotide sequence is flanked by homology arms; and wherein each homology arm has a length of from 30 bp to 1000 bp; and b) introducing into an NK cell or NK T cell a polynucleotide sequence encoding a CAR polypeptide and an RNP complex; wherein the polynucleotide sequence encoding a CAR polypeptide is introduced into the NK cell or NK T cell by infecting the cell with an AAV vector; wherein the RNP complex hybridizes with a target sequence in the genomic DNA of the NK cell or NK T cells, and DNA repair enzymes of the cell insert the polynucleotide sequence encoding the CAR polypeptide into the host genome at the target sequence in the genomic DNA of the NK cell or NK T cell, thereby creating a modified NK cell or a modified NK T cell.

16. The method of claim 15, wherein the NK cell or NK T cell is a primary cell or an expanded cell, wherein the primary cell is incubated for about 4 to 10 days in the presence of IL-2 prior to infection; or wherein the primary cell is expanded for about 4 to 10 days in the presence of irradiated feeder cells, plasma membrane particles, or exosomes prior to infection; wherein the irradiated feeder cells, plasma membrane particles, or exosomes express membrane-associated 4-1BBL, membrane-associated IL-21, or membrane-associated IL-15, or any combination thereof.

17. The method according to claim 15 or 16, characterized in that the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3ζ signaling domain, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell, wherein said transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3ζ transmembrane domain, or an NKG2D transmembrane domain, and wherein said costimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 costimulatory domain, a 4-1BB costimulatory domain, or any combination thereof.

18. The method according to claim 17, characterized in that the receptor contains CD33.

19. The method according to any one of claims 15-18, characterized in that the homology arms specifically hybridize with the integration site 1 of the adeno-associated virus (AAVS1) of human chromosome 19. 20 A method for generating a chimeric antigen receptor (CAR)-enhanced natural killer (NK) cell or a CAR-enhanced NK T cell, comprising (a) providing a ribonucleoprotein (RNP) complex comprising a class 2 CRISPR / Cas endonuclease in complex with an appropriate CRISPR / Cas guide RNA and an adeno-associated virus (AAV) vector comprising a plasmid comprising a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide; wherein the polynucleotide sequence is flanked by homology arms; and wherein each homology arm has a length of from 30 bp to 1000 bp; and b) introducing a polynucleotide sequence encoding a CAR polypeptide and an RNP complex into an NK cell or NK T cell; wherein the polynucleotide sequence encoding the CAR polypeptide is introduced into the NK cell or NK T cell by infecting the NK cell or NK T cell with an AAV vector; wherein the RNP complex hybridizes to a target sequence in the genomic DNA of the NK cell or NK T cell, and DNA repair enzymes of the NK cell or NK T cell insert the polynucleotide sequence encoding the CAR polypeptide into the host genome at target sequences within the genomic DNA of the cell, thereby creating a CAR-NK cell or CAR-NK T cell.

21. The method of claim 20, wherein the NK cells or NK T cells are primary or expanded NK cells or NK T cells, wherein said primary NK cells or NK T cells are incubated for about 4 to 10 days in the presence of IL-2 prior to infection, or expanded for about 4 to 10 days in the presence of irradiated feeder cells, plasma membrane particles, or exosomes prior to infection; and wherein said irradiated feeder cells, plasma membrane particles, or exosomes express membrane-associated 4-1BBL, membrane-associated IL-21, or membrane-associated IL-15, or any combination thereof.

22. The method of claim 20 or 21, further comprising expanding the CAR-NK cell or CAR-NK T cell using IL-2 or irradiated feeder cells, plasma membrane particles or exosomes after infection, wherein the irradiated feeder cells, plasma membrane particles or exosomes express membrane-associated 4-1BBL, membrane-associated IL-21 or membrane-associated IL-15 or any combination thereof.

23. The method according to any one of paragraphs 20-22, characterized in that the NK cell or NK T cell is infected with from about 5 to 500 thousand MOI of the AAV vector.

24. The method according to any one of claims 20-23, characterized in that the RNP complex is introduced into the NK cell or NK T cell by electroporation or by transfection; and wherein the RNP complex is encoded by the same or a different AAV vector, different from the one containing the polynucleotide sequence.

25. The method according to any one of claims 20-24, characterized in that the CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3ζ signaling domain, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell, wherein said transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3ζ transmembrane domain, or an NKG2D transmembrane domain; and / or wherein said costimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 costimulatory domain, a 4-1BB costimulatory domain, or any combination thereof.

26. The method according to claim 25, characterized in that the receptor comprises CD33, and wherein the scFV that specifically binds to CD33 comprises a sequence that is at least 90% identical to SEQ ID No: 29 or a fragment thereof.

27. The method according to any one of claims 20-26, characterized in that the homology arms specifically hybridize with the integration site 1 of the adeno-associated virus (AAVS1) of human chromosome 19.

28. The method according to any one of paragraphs 20-27, characterized in that the serotype of the AAV vector comprises AAV6.

29. The method according to any one of paragraphs 20-28, characterized in that the vector is a single-stranded AAV vector (ssAAV) or a self-complementary AAV vector (scAAV).

30. The method according to any one of paragraphs 20-29, characterized in that the vector contains a sequence that is at least 90% identical to SEQ ID No.: 22 or SEQ ID No.: 23 or its fragment.

31. A method of treating cancer in a subject, comprising administering to the subject a therapeutically effective amount of a natural killer (NK) cell or NK T cell, wherein the NK cell or NK T cell comprises a plasmid for use with clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated 9 (Cas9) integration systems, wherein the plasmid comprises, in order, a left homology arm, a polynucleotide sequence encoding a chimeric antigen receptor (CAR) polypeptide for a tumor antigen, and a right homology arm; wherein the left and right homology arms have a length of from 30 bp to 1000 bp., wherein said CAR polypeptide comprises a transmembrane domain, a costimulatory domain, a CD3ζ signaling domain, and a single-chain variable fragment (scFV) that specifically binds to a receptor on a target cell; wherein said transmembrane domain of the CAR polypeptide comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3ζ transmembrane domain, or an NKG2D transmembrane domain; wherein said costimulatory domain of the CAR polypeptide comprises a 2B4 domain, a CD28 costimulatory domain, a 4-1BB costimulatory domain, or any combination thereof; and wherein the receptor comprises CD33.

32. The method according to claim 31, characterized in that the scFV that specifically binds to CD33 contains a sequence that is at least 90% identical to SEQ ID No: 29 or a fragment thereof.

33. The method according to claim 31 or 32, characterized in that the homology arms specifically hybridize with the integration site 1 of the adeno-associated virus (AAVS1) of human chromosome 19.

Images