MOLECULAR MARKER CAPS2043 FOR SELECTION OF PROANTHOCYANIDIN-FREE BARLEY HYBRIDS OBTAINED FROM MUTANT OF ant27 GENE - ant27.2043

Abstract

FIELD: agriculture; biotechnology.SUBSTANCE: invention can be used in the genetics and breeding of barley. A molecular marker CAPS2043 was proposed for the selection of barley hybrids obtained on the basis of a mutant of the Ant27 gene – ant27.2043, which does not accumulate proanthocyanidins in grain. The marker consists of oligonucleotide primers and the restriction endonuclease BstV1I, which cleaves the 294 bp PCR product of the non-mutant allele of the Ant27 gene obtained using these primers into two fragments with sticky ends of 259 / 263 bp and 35 / 31 bp, and does not cleave the mutant allele of the Ant27 gene.EFFECT: use of the proposed molecular marker makes it possible to distinguish and select plants homozygous for the mutant allele of the Ant27 gene that do not accumulate proanthocyanidins in grain.1 cl, 4 dwg, 2 ex

Description

[0001] The invention relates to agriculture and biotechnology and can be used to select barley hybrids that do not accumulate proanthocyanidins (PA) in grain.

[0002] PAs are polymeric flavonoid compounds of plants. In barley (Hordeum vulgare L.), these compounds accumulate in the seed coat of the grain, where they participate in maintaining the state of seed dormancy and protecting them from unfavorable environmental conditions. In addition, they affect the quality of barley grain and determine its intended use. It is known that barley PAs are capable of binding proline-rich storage proteins of the grain, leading to persistent colloidal turbidity of beer made from such grain [Von Wettstein D. From analysis of mutants to genetic engineering / / Annual Review of Plant Biology. 2007. V. 58. P. 1-19].

[0003] To prevent colloidal haze in beer production, chemical stabilizers are used, aimed at one or both haze components - the protein and polyphenol fractions [Erdal K. Proanthocyanidin-free barley-malting and brewing / / Journal of the Institute of Brewing. 1986. V. 92. № 3. P. 220-224]. Proteases are most often used to reduce the protein content, and selective absorbents such as polyvinylpyrrolidone are used to remove PA [Siebert KJ, Lynn PY Comparison of polyphenol interactions with polyvinylpolypyrrolidone and haze-active protein / / Journal of the American Society of Brewing Chemists. 1998. V. 56. № 1. P. 24-31]. However, these methods are not specific enough and can affect the quality of beer, for example, foaming, in which proteins are involved [MacGregor AW Malting and brewing science: challenges and opportunities / / Journal of the Institute of Brewing. 1996. V. 102. No. 2. P. 97-102].

[0004] An alternative solution to the problem of colloidal haze is to use barley varieties whose biochemical properties of grain contribute to the natural prevention of haze without the use of chemical stabilizers. The creation of such varieties is possible through selection for reduced protein content, or PA. The first approach is the traditional direction of breeding brewing varieties [Emebiri LC, Moody DB, Black C., van Ginkel M., Hernandez E. Improvements in malting barley grain yield by manipulation of genes influencing grain protein content / / Euphytica. 2007. V. 156. P. 185-194]. The second, less common, was proposed in the 70s and became possible due to the existence of barley mutants with impaired synthesis of flavonoid compounds [Von Wettstein D. From analysis of mutants to genetic engineering / / Annual Review of Plant Biology. 2007. V. 58. P. 1-19].

[0005] By using proanthocyanidin-free mutants as donors of recessive alleles of genes controlling PA synthesis, it was possible to create high-yielding brewing varieties, the beer from which was characterized by increased colloidal stability [Molobekova CA, Totsky IV, Trubacheeva NV, Shoeva O.Yu. Breeding for the absence of proanthocyanidins in grain of barley (Hordeum vulgare L.): molecular-genetic and technological aspects / / Vavilovskii Zhurnal Genetiki i Selektsii = Vavilov J Genet Breed. 2025. V. 29. No. 8. P. 1361-1368]. These varieties were developed using a classical breeding approach, including crossing proanthocyanidin-free mutants with a promising variety / line containing PA in grain, followed by selection of hybrid plants whose grain does not accumulate PA. The main difficulty in selecting hybrid plants whose grain does not contain PA is that the presence of these compounds in the grain can only be assessed after it has ripened.For this purpose, qualitative tests for PA are carried out using p-dimethylaminocinnamaldehyde, vanillin solutions or alkali [Kohyama N., Chono M., Nakagawa H., Matsuo Y., Ono H., Matsunaka H. Flavonoid compounds related to seed coat color of wheat / / Bioscience, Biotechnology, and Biochemistry. 2017. V. 81, No. 11. P. 2112-2118].

[0006] The use of molecular markers developed for target genes controlling traits of interest allows for the selection of desired genotypes from hybrid populations already at the seedling stage, which can significantly reduce time, labor costs, and improve selection accuracy. Identifying target genes and developing molecular markers based on their nucleotide sequences is a pressing issue in plant breeding.

[0007] Until now, the only gene for which mutant alleles have been subject to molecular marker development was the Ant28 gene, mapped to the long arm of chromosome 3H in barley [Himi E., Yamashita Y., Haruyama N., Yanagisawa T., Maekawa M., Taketa S. Ant28 gene for proanthocyanidin synthesis encoding the R2R3 MYB domain protein (Hvmyb10) highly affects grain dormancy in barley / / Euphytica. 2012. V. 188. P. 141-151].

[0008] The closest to the claimed molecular marker - prototype, is the CAPS-marker (Cleaved Amplified Polymorphic Sequences), developed to identify alleles of the Ant28 gene in mutants ant28.2131 and ant28.2132, which do not accumulate PA in grain [Patent RU2809369]. This marker consists of a set of oligonucleotide primers: forward Ant28_F: 5'-TTGTGTGCAGGGCTGAATAG-3' and reverse Ant28_R: 5'-GAAACTCCAACGGAAGGGTTAG-3', the amplification product of which is 414 bp long. The ApaLI endonuclease restriction site is reached, at which the resulting PCR product of the non-mutated sample is cleaved into two fragments of 141 and 273 bp in length, while the PCR product of the mutant sample remains undigested.

[0009] A disadvantage of the known CAPS marker is its limited functionality, due to the fact that this marker can only be used to analyze barley hybrids obtained as a result of crossing barley varieties / lines that accumulate PA in grain and proanthocyanidin-free mutants ant28.2131 or ant28.2132.

[0010] The objective of the proposed invention is to develop a molecular marker that allows for the rapid and efficient selection of barley hybrids that do not accumulate PA in grain, obtained on the basis of another proanthocyanidin-free mutant - ant27.2043, carrying a single nucleotide substitution C / T in the coding region of the Ant27 gene at position 720, counted from the translation initiation point.

[0011] The stated objective is achieved by developing a molecular marker for the nucleotide substitution identified in the coding region of the Ant27 gene, consisting of two oligonucleotide primers and a specific restriction endonuclease that cleaves the PCR product of the non-mutant allele of the Ant27 gene obtained using these primers, while the PCR product of the mutant allele of this gene remains undigested. Namely, the molecular marker CAPS2043 for the selection of barley hybrids obtained on the basis of the Ant27-ant27.2043 gene mutant that does not accumulate PA in grain, consisting of oligonucleotide primers having the nucleotide sequences SEQ ID NO 1: 5'-AGTAGTCTCCTGTGACCAGAT-3' and SEQ ID NO 2: 5'-ACTTCTGTACTTGCCGATGAC-3', and the restriction endonuclease BstV1 I, which cleaves the 294 bp long PCR product of the non-mutant allele of the Ant27 gene obtained using these primers into two fragments with sticky ends of 259 / 263 bp and 35 / 31 bp in length, and does not cleave the mutant allele of the Ant27 gene.The presence of unsplit fragments indicates the presence in the genome of the analyzed hybrids of a mutant allele of the Ant27 gene in a homozygous state, characteristic of samples that do not accumulate proanthocyanidins in grain.

[0012] The technical result consists in expanding the functional capabilities of the prototype, reducing labor costs, increasing the accuracy and speed of selection of barley hybrids that do not contain PA in the grain.

[0013] To accomplish this goal, oligonucleotide primers and a specific restriction endonuclease were selected. The site for this enzyme is present in the wild-type Ant27 allele and is absent from the mutant allele due to a mutation. For this purpose, the Ant27 gene was sequenced in the ant27.2043 mutant and its parental cultivar, Arena. The resulting nucleotide sequences were analyzed using dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / ) to identify polymorphic restriction sites between the compared samples.

[0014] As shown in Fig. 1, the nucleotide sequence of the Ant27 gene of the Arena cultivar contains a BstV1 I restriction endonuclease site (GCAGC(N)8↑ / CGTCG(N)12↓), which is absent in the ant27.2043 mutant. The forward CAPS2043F: 5'-AGTAGTCTCCTGTGACCAGAT-3' and reverse CAPS2043R: 5'-ACTTCTGTACTTGCCGATGAC-3' primers were selected, the 294 bp long amplification product of which contains the identified polymorphic site of the BstV1 I restriction endonuclease; no other recognition sites for this endonuclease were found in the resulting PCR product. When cleaving the 294 bp long PCR fragment, The non-mutant allele of the Arena variety produces two fragments with sticky ends of 35 / 31 bp and 259 / 263 bp in length, whereas the mutant allele ant27.2043 lacks a restriction site due to a nucleotide substitution and the 294 bp fragment remains undigested.

[0015] The nucleotide sequences of the developed molecular marker are presented in the sequence listing.

[0016] Figure 2 shows the results of electrophoretic analysis of PCR products obtained using the developed pair of primers on the DNA of the mutant ant27.2043, its parent variety Arena, domestic barley varieties Vorsinsky 2 (marked as Vors2 in Figure 2), Tanai, and first-generation hybrids F1 Vorsinsky 2 xant27.2043 (marked as F1B2x2043 in Figure 2) and Tanai xant27.2043 (marked as F1Tx2043 in Figure 2).

[0017] As can be seen in Fig. 2, before treatment with the restriction endonuclease BstV1 I, the length of the PCR products of all samples was 294 bp. After treatment with the indicated restriction endonuclease, the PCR products obtained for the Arena, Vorsinsky 2, and Tanai varieties, which accumulate PA in grain, decreased and amounted to 259 / 263 bp, which indicates the cleavage of the obtained PCR products by the restriction endonuclease into two fragments of 259 / 263 bp and 35 / 31 bp, the latter of which is not visualized in agarose gel. The PCR product of the mutant allele ant27.2043 remained unchanged. In heterozygous hybrids F1 Vorsinsky 2 xant27.2043 and Tanai xant27.2043, after restriction, both PCR fragments, cleaved and undigested, are detected.

[0018] The selection of proanthocyanidin-free barley hybrids using the proposed molecular marker is carried out as follows. By crossing barley varieties characterized by the presence of PA in their grain with a donor of the mutant allele of the Ant27 gene (the ant27.2043 mutant), and then propagating the harvested grains, second-generation F2 hybrid barley plants are obtained. DNA is then extracted from young leaves of the parental varieties and the second-generation F2 hybrids. For this purpose, 2-3 leaf pieces measuring 0.5 x 2 cm are placed in a 1.5 ml test tube. Add 200 μl of fresh extraction buffer (100 mM Tris-HCl, pH 7.5-8.0, 500 mM NaCl, 50 mM EDTA, 1.25% SDS, 0.38% Na2S2O5) heated to 60°C. The leaves are thoroughly crushed in a homogenizer, add 500 μl of extraction buffer, mix and incubate in a water bath at 60°C for 30-40 min.Next, 700 μl of a chloroform-isoamyl alcohol mixture (24:1) are added and, after mixing, the mixture is centrifuged for 25 min at 10,000-12,000 rpm at room temperature. 1.4 ml of 96% cold ethanol is added to the collected upper fraction (approximately 500 μl), gently mixed, and centrifuged at 10,000-12,000 rpm. The precipitate is washed with 70% ethanol at least three times, dried, and dissolved in 20-25 μl of bidistilled sterile water. The quality and quantity of the isolated DNA is assessed by analytical electrophoresis. The DNA concentration is standardized by dilution in sterile bidistilled water to 100 μg / μl.

[0019] 5 μl of the diluted DNA is used as a template in PCR, which is carried out in a 20 μl reaction mixture containing 1 x AS buffer (Biospecifica, Novosibirsk) without MgCl2 (65 mM Tris-HCl, 16 mM (NH4)2SO4, 0.5% Tween 20), 1.8 mM MgCl2, 0.2 mM of each deoxynucleoside triphosphate (Bioron, Germany), 1 unit of active Taq DNA polymerase (Biospecifica, Novosibirsk), 1 μM of forward and reverse primers. Amplification is carried out under the following conditions: 2 min at 94°C; 45 cycles: 1 min at 94°C, 1 min at 62°C, 2 min at 72°C; 5 min at 72°C. Two units of BstV1 I restriction endonuclease and 2 µl of a compatible SE buffer G (SibEnzyme, Novosibirsk) are added to 10 µl of the resulting PCR mixture. The resulting mixture is incubated in a thermocycler at 55°C for 1 hour, followed by enzyme inactivation at 80°C for 20 minutes. The restriction results are analyzed by electrophoresis in a 2% agarose gel.The presence of cleaved fragments indicates the presence of the nucleotide "C" at position 720, characteristic of the non-mutant allele of the Ant27 gene detected in barley accessions accumulating PA in grain. The retention of the original PCR product indicates the presence of the nucleotide "T" at this position, characteristic of the mutant allele of the Ant27 gene present in the ant27.2043 mutant, which does not accumulate PA in grain. The presence of both cleaved and uncleaved fragments after treatment of the PCR mixture with a restriction endonuclease indicates the presence of alleles in a heterozygous state.

[0020] The invention is illustrated by the following examples.

[0021] Example 1.

[0022] The developed molecular marker to the ant27.2043 allele was used to select barley hybrids that do not accumulate PAs in grain, obtained after crossing the Vorsinsky 2 variety, characterized by the presence of PAs in grain, with the ant27.2043 mutant, the grain of which does not contain these compounds. The Vorsinsky 2 variety and the ant27.2043 mutant (cat. number NGB13710) were obtained from the collections of GenAgro (https: / / ckp.icgen.ru / plants / , Novosibirsk, Russia) and Nordgen (https: / / www.nordgen.org / en / , Alnarp, Sweden), respectively. The second-generation F2 hybrid seeds obtained after crossing, as well as the seeds of the parental forms, were planted in a bath of a hydroponic greenhouse of the Center for Collective Use of Plant Reproduction, Institute of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences (Novosibirsk, Russia). DNA was isolated from young leaves and then genotyped using the developed molecular marker. Results of electrophoretic analysis of PCR products obtained from DNA of the Vorsinsky 2 variety, mutant ant27.2043, a hybrid plant of the F1 generation obtained as a result of crossing the parental forms, and 30 hybrids of the F2 generation after treatment with the restriction endonuclease BstV1 I in a 2% agarose gel, as well as the results of testing the grains collected from the hybrid plants for the presence of PA are presented in Fig. 3.

[0023] As can be seen in Fig. 3, the length of the PCR product of the ant27.2043 mutant after treatment with restriction endonuclease remained 294 bp, which indicates the presence of the nucleotide “T” at position 720 of the Ant27 gene, characteristic of the mutant allele, while the PCR product of the Vorsinsky 2 variety (marked as B2 in Fig. 3) was 269 / 263 bp, which indicates cleavage of the original PCR product with restriction endonuclease, which recognizes the site with the nucleotide “C” at position 720 of the Ant27 gene, characteristic of the dominant allele. Among the hybrids, four accessions homozygous for the recessive allele of the Ant27 gene (4, 14, 19, 29), ten accessions homozygous for the dominant allele of the Ant27 gene (2, 3, 7, 11, 13, 23, 25, 27, 28, 30), and sixteen heterozygous accessions (1, 5, 6, 8-10, 12, 15-18, 20-22, 24, 26) were identified. Grain collected from the parental accessions and the analyzed hybrids was tested using a qualitative reaction to PA.For this purpose, five grains per plant were soaked for 8 hours in a 1N NaOH solution with 0.01% Tween20. As a result, the grain containing PA acquired a brown color, while the grain without PA remained yellow. The grains of all hybrids carrying dominant alleles of the Ant27 gene in the homozygous or heterozygous state acquired a brown color after treatment with sodium hydroxide. Such samples are marked in Fig. 3 as "PA+" (containing PA). Samples with the recessive allele of the Ant27 gene in the homozygous state had a yellow color after soaking in sodium hydroxide, indicating the absence of PA in the grain of these samples, which are marked in Fig. 3 as "PA-" (do not contain PA). Among the analyzed plants, four plants were selected, numbers 4, 14, 19, 29, characterized by the presence of a recessive allele of the Ant27 gene in a homozygous state, the absence of PA in the grain of which was confirmed using alkali testing.These samples were selected for further breeding of barley varieties that do not accumulate PA in grain.

[0024] Example 2.

[0025] The selection of barley hybrids whose grain does not accumulate PA, using the molecular marker CAPS2043 developed for the ant27.2043 allele, was carried out similarly to Example 1, except that the Tanai variety (GenAgro, https: / / ckp.icgen.ru / plants / , Novosibirsk, Russia) was used as one of the parental samples. Fig. 4 shows the results of electrophoretic analysis of the PCR products obtained on the DNA of the ant27.2043 mutant, the Tanai variety (marked as T in Fig. 4), an F1 hybrid obtained by crossing the parental forms, and 26 F2 hybrids after treatment with the restriction endonuclease BstV1 I in 2% agarose gel.

[0026] Among the hybrids, five samples were found to be homozygous for the recessive allele of the Ant27 gene (5, 10, 15, 16, 18), eight samples were homozygous for the dominant allele of the Ant27 gene (3, 8, 9, 13, 19, 20, 24, 25), and thirteen heterozygous samples (1, 2, 4, 6, 7, 11, 12, 14, 17, 21-23, 26).

[0027] Testing of grains collected from genotyped hybrids for the presence of PA in a 1N NaOH solution with 0.01% Tween 20 showed that all hybrids carrying dominant alleles of the Ant27 gene in a homozygous or heterozygous state contain PA in the grain; such samples are marked in Fig. 4 as "PA+". Samples with a recessive allele of the Ant27 gene in a homozygous state do not contain PA in the grain; such samples are marked in Fig. 4 as "PA-".

[0028] Accessories 5, 10, 15, 16, 18, the grain of which does not contain PA, were selected for further breeding of barley varieties that do not accumulate PA in grain.

[0029] Thus, the developed molecular marker CAPS2043 can be used to select barley hybrids that do not accumulate PA in grain, obtained by crossing PA-containing barley varieties / lines with the donor of the mutant allele of the Ant27 gene, the mutant ant27.2043, whose grain does not accumulate PA.

[0030] The use of the proposed molecular marker will expand the functionality of the prototype, reduce labor costs, and increase the accuracy and speed of selection of barley hybrids that do not contain PA in the grain.

[0031] --->

[0032] Sequence list.

[0033] <?xml version="1.0" encoding="UTF-8"?>

[0034] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0035] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0036] <st26sequencelisting originalfreetextlanguagecode="ru"

[0037] dtdversion="V1_3" filename="CAPS2043.xml" softwarename="WIPO

[0038] Sequence" softwareversion="2.3.0" productiondate="2026-01-20">

[0039] <applicationidentification>

[0040] <ipofficecode>RU< / ipofficecode>

[0041] <applicationnumbertext> 1< / applicationnumbertext>

[0042] <filingdate> 2026-01-19< / filingdate>

[0043] < / applicationidentification>

[0044] <earliestpriorityapplicationidentification>

[0045] <ipofficecode> RU< / ipofficecode>

[0046] <applicationnumbertext> 1< / applicationnumbertext>

[0047] <filingdate> 2026-01-19< / filingdate>

[0048] < / earliestpriorityapplicationidentification>

[0049] <applicantname languagecode="ru">Federal State

[0050] Budgetary scientific institution Federal Research Center

[0051] "Institute of Cytology and Genetics of the Siberian Branch of the Russian

[0052] Academy of Sciences" (ICG SB RAS)< / applicantname>

[0053] <applicantnamelatin>Institute of Cytology and Genetics, Siberian

[0054] Branch of Russian Academy of Sciences< / applicantnamelatin>

[0055] <inventiontitle languagecode="ru">Molecular marker CAPS2043 for

[0056] Selection of proanthocyanidin-free barley hybrids obtained on the basis of

[0057] ant27 gene mutant – ant27.2043< / inventiontitle>

[0058] <sequencetotalquantity> 2< / sequencetotalquantity>

[0059] <sequencedata sequenceidnumber="1">

[0060] <insdseq>

[0061] <INSDSeq_length> 21< / INSDSeq_length>

[0062] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0063] <INSDSeq_division> PAT< / INSDSeq_division>

[0064] <INSDSeq_feature-table>

[0065] <insdfeature>

[0066] <INSDFeature_key>source< / INSDFeature_key>

[0067] <INSDFeature_location>1..21< / INSDFeature_location>

[0068] <INSDFeature_quals>

[0069] <insdqualifier>

[0070] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0071] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0072] < / insdqualifier>

[0073] <insdqualifier id="q2">

[0074] <INSDQualifier_name> organism< / INSDQualifier_name>

[0075] <INSDQualifier_value> Barley< / INSDQualifier_value>

[0076] < / insdqualifier>

[0077] < / INSDFeature_quals>

[0078] < / insdfeature>

[0079] < / INSDSeq_feature-table>

[0080] <INSDSeq_sequence> holdtctcctgtgaccagat< / INSDSeq_sequence>

[0081] < / insdseq>

[0082] < / sequencedata>

[0083] <sequencedata sequenceidnumber="2">

[0084] <insdseq>

[0085] <INSDSeq_length>21< / INSDSeq_length>

[0086] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0087] <INSDSeq_division>PAT< / INSDSeq_division>

[0088] <INSDSeq_feature-table>

[0089] <insdfeature>

[0090] <INSDFeature_key>source< / INSDFeature_key>

[0091] <INSDFeature_location>1..21< / INSDFeature_location>

[0092] <INSDFeature_quals>

[0093] <insdqualifier>

[0094] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0095] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0096] < / insdqualifier>

[0097] <insdqualifier id="q4">

[0098] <INSDQualifier_name> organism< / INSDQualifier_name>

[0099] <INSDQualifier_value> Barley< / INSDQualifier_value>

[0100] < / insdqualifier>

[0101] < / INSDFeature_quals>

[0102] < / insdfeature>

[0103] < / INSDSeq_feature-table>

[0104] <INSDSeq_sequence>acttctgtacttgccgatgac< / INSDSeq_sequence>

[0105] < / insdseq>

[0106] < / sequencedata>

[0107] < / st26sequencelisting>

[0108] <---

Images