Lipase-producing transformant of yarrowialipolytica

Abstract

FIELD: microbiology; biotechnology.SUBSTANCE: transformant of the yeast Y. lipolytica is described, producing lipase from Thermomyces lanuginosus, carrying in the chromosome an optimized synthetic gene with the nucleotide sequence SEQ ID NO: 1, encoding the specified lipase.EFFECT: increase in the level of lipase production.1 cl, 2 dwg, 1 tbl, 2 ex

Description

[0001] The invention relates to microbiology and biotechnology and concerns the production of transformants of the yeast Yarrowia lipolytica capable of producing recombinant lipases from Thermomyces lanuginosus (TLL).

[0002] Lipases possess a number of unique properties, allowing them to be used in various industries: food, agriculture, leather, textile, pulp and paper, and detergent production. Lipases are also widely used in bioenergy and environmental cleanup, particularly in wastewater treatment of oil and other polymer waste and in soil bioremediation.

[0003] Microbial lipases are more versatile due to their low production cost, high stability and greater availability compared to animal and plant-derived lipases [Microbial cell factories, 2020,19,1-42].

[0004] T. lanuginosus lipase, also known as TLL, is a thermostable enzyme whose main advantage is the biocatalysis of enantio- and regioselective specific processes. It has proven itself in the food industry, in the production of biodiesel fuel and fine chemicals [Journal of Molecular Catalysis B: Enzymatic, 2010, 62(3-4), 197-212].

[0005] Recently, Y. lipolytica yeast has been increasingly used as “factories” for the production of heterologous proteins, including lipases. Firstly, a wide range of genetic engineering tools and DNA fragments have been developed that allow them to be modified to express the desired proteins. Secondly, yeast cells contain a complete set of molecular mechanisms for correct protein folding. Thirdly, they are able to maintain functional expression of membrane proteins [Acta Naturae (Russian version), 2020, 12(2(45)), 28-39]. Finally, they carry out cotranslational translocation of newly formed protein in the endoplasmic reticulum. Thus, Y. lipolytica yeast is an efficient platform for protein expression and secretion [J. Fungi, 2021, 7(7), 548; FEMS Yeast Research, 2021, 21(2), 18].

[0006] One of the key ways to increase the production level of target proteins in heterologous systems is codon optimization [Demissie EA, Park SY, Moon JH, Lee DY. Comparative Analysis of Codon Optimization Tools: Advancing toward a Multi-Criteria Framework for Synthetic Gene Design. J Microbiol Biotechnol. 2025 Apr 10; 35: e2411066. doi: 10.4014 / jmb.2411.11066. PMID: 40223268; PMCID: PMC12010093.] - adaptation of the nucleotide sequence of a gene to the codon usage frequencies in the producer organism. The essence of the method is to eliminate potential translation bottlenecks. Due to the degeneracy of the genetic code, different organisms prefer to use certain codons to encode the same amino acid, which directly correlates with the intracellular concentration of the corresponding tRNAs. The presence of codons "rare" for the host in a foreign gene can slow protein synthesis.

[0007] Modern biotechnology provides a comprehensive toolkit for working with Y. lipolytica yeast, including sets of genetic elements (promoters, markers) and advanced genome editing methods (CRISPR), making it an ideal candidate for such tasks. Therefore, an important task is to create a recombinant strain in which heterologous gene expression is enhanced by optimizing its nucleotide sequence based on known codon preferences. Codon frequencies have been identified for cells of many microbial species (http: / / www.kazusa.or.ip / codon / P.html).

[0008] There are known examples of the use of optimized synthetic nucleotide sequences to create producers of heterologous lipases based on the yeast Y. lipolytica.

[0009] Synthetic lipase genes with optimized codon composition were obtained, including Rhizopus oryzae, Lip1 from Y. lipolytica and Candida antarctica lipase B (CalB), adapted for expression in Y. lipolytica and Pichia pastoris. As a result of codon optimization, selection of promoters and secretion signals, a significant increase in the expression level was achieved. In particular, when expressing CalB in Y. lipolytica, the productivity of the strain increased up to 2.8-fold when using an inducible promoter and more than 10-fold when combined with codon optimization and expression enhancement [Appl. Microbiol. Biotechnol., 2015, 99, 219-229; Microb. Cell Fact., 2019,18,167; J. Ind. Microbiol. Biotechnol., 2010, 37, 1057-1065].

[0010] Using modern codon optimization rules—from proven web services (Biotechnol. Annu. Rev. 2007; IDT CodonOpt; GenScript) to deep learning (CodonTransformer, 2025)—it is possible to generate multiple nucleotide variants of a single enzyme. When integrated into the chromosome, their expression and production levels vary significantly. For example, for cellobiohydrolase II (cbh2) from Trichoderma reesei, one of the two optimized variants showed an approximately 2-fold increase in activity compared to the native variant [Microbial Cell Factories, 2012, 11, 61; PMC, 2021].

[0011] Variants of codon optimization of the T. lanuginosus lipase gene for expression in Y. lipolytica were implemented in the work [Int. J. Mol. Sci., 2023,24,719], which made it possible to obtain transformants with a lipase activity level of up to 579 U / mL in culture fluid using optimized promoters and constructs.

[0012] The objective of the claimed invention is to expand the arsenal of recombinant microorganisms producing lipases.

[0013] This objective is achieved by creating a Y. lipolytica yeast transformant expressing T. lanuginosus lipase with a codon-optimized synthetic gene encoding said lipase integrated into the chromosome, the nucleotide sequence of which is presented in the sequence listing under SEQ ID NO: 1. The technical result of the invention is a transformant carrying within the chromosome an optimized synthetic gene encoding said lipase. Experiments have confirmed that use of the optimized gene sequence of SEQ ID NO: 1 significantly increases the level of lipase production compared to a non-optimized gene.

[0014] The production of the claimed transformant comprises synthesizing an optimized synthetic TLL gene encoding T. lanuginosus lipase [UniProt: 059952] and transforming it into Y. lipolytica yeast cells using an expression cassette comprising the optimized gene, a promoter functioning in Y. lipolytica, a signal peptide for secreting the enzyme into the culture medium, a terminator, a marker gene and a site for homologous integration into the chromosome, carried out by any suitable method, for example, the electroporation method [http: / / tools.thermofisher.com / content / sfs / manuals / pich_man.pdf] or a method using polyethylene glycol or protoplasts [http: / / www.thermofisher.com / order / catalog / product / K173001].

[0015] Construction of expression cassettes is carried out by standard methods of molecular biology and genetic engineering [Rybchin V.N. Fundamentals of Genetic Engineering. - SPb. SPbGTU, 1999; Sambrook J., Maniatis T., Fritsch E. Molecular Cloning: A Laboratory Manual. - NY: Cold Spring Harbor Laboratory, 1989] using genetic elements adapted for work in Y. lipolytica yeast. These elements include promoters that actively function in the cells of a given host (for example: pTEF, pHP4D, pXPR2, pEYK1, pGPD, pPOX2 and others [Appl Microbiol Biotechnol, 2014, 98, 5301-5317]), providing high and regulated expression, signal peptides that ensure correct transport of the expressed protein (α-factor of Saccharomyces cerevisiae, XPR2 [Appl Microbiol Biotechnol, 2014, 98, 5301-5317]), as well as transcription terminators that are capable of correctly and accurately completing the synthesis of the desired DNA sequence.

[0016] Genes providing resistance to antibiotics (for example, zeocin, geneticin (G418), blasticidin S), as well as genes complementary to auxotrophic mutations of Y. lipolytica, such as URA3, LEU2, LYS5, MET2 and others, are used as selective markers [Yeast, 2005, 22, 249-270].

[0017] For homologous integration, arms are used - sequences homologous to the YLT1, LEU2, URA3, РОХ2 loci, or other regions of the Y. lipolytica chromosome [Thermo Fisher Scientific, catalog V17520].

[0018] The invention is illustrated by the following figures.

[0019] Fig. 1. Schematic diagram of the linear expression cassette for integration into the Y. lipolytica genome, containing the optimized TLL lipase gene.

[0020] Fig. 2. Schematic diagram of the control expression cassette containing the native TLL lipase gene.

[0021] Example 1. Construction of Y. lipolytica yeast transformants containing an optimized gene encoding lipase from T. lanuginosus.

[0022] A fusion-PCR amplification method with overlapping primers was used to assemble the integrative expression cassette [Gene. 1989 Apr 15;77(1):61-8]. The nucleotide sequence encoding the lipase from T. lanuginosus was optimized in silico to increase the expression level in Y. lipolytica yeast by replacing rare codons with those preferred by the host strain [http: / / www.kazusa.or.jp / codon / cgi-bin / showcodon.cgi?species=4952]. The optimized sequence was synthesized according to the method described in [Journal of Microbiological Methods, 2010, 81(2), 147-152]. The resulting synthetic DNA fragment (SEQ ID NO:1) is integrated into an expression cassette containing the following functional elements (expression cassette 1):

[0023] 1. Target gene TLLsynt: the coding sequence of lipase, fused in frame with the signal peptide of lipase LIP2 and under the regulation of the HP4D promoter.

[0024] 2. XPR2 transcription terminator

[0025] 3. Selectable marker: URA3 gene flanked by 10xP sites.

[0026] 4. Integration site: long terminal repeats of the retrotransposon YLT1 polindromic sequences Zeta 5 (and Zeta 3'

[0027] Next, to obtain recombinant strains, the auxotrophic strain Y. lipolytica W29 (Ura3-) is transformed with the obtained expression cassette.

[0028] The cells are pre-grown in YP agar medium with the addition of glucose (2 wt%) for one day.

[0029] Heat shock is achieved by adding 1 microbiological loop of cells to a reaction mixture consisting of 90 μl 50% PEG, 5 μl 2M DTT, and 5 μl 2M lithium acetate at pH 6. After adding the cells to the reaction medium, 4 μl Salmon sperm DNA is added and incubated for 8 minutes at 99°C. 1000 ng of the DNA cassette is then added. The mixture is vigorously pipetted and incubated in a thermoshaker at 28°C and 900 rpm for 30 min. The cells are then placed in a thermostat at 39°C for 30 min, where heat shock occurs. The cells are then quickly washed with saline and plated on YP agar plates supplemented with glucose (2 wt%).

[0030] The selection of transformants is carried out for 5 days at 30°C on a liquid selective YNB medium with the addition of glucose (2 wt.%).

[0031] The presence of the integrated gene in the chromosome of the resulting transformants is verified using PCR. Using primers TllM-F and TllM-R, the target region is amplified. The appearance of a PCR fragment of 912 bp indicates successful integration of the synthetic gene.

[0032] For control experiments, transformants carrying the native T. lanuginosus lipase gene were generated. The coding region of the native TLL gene was obtained by PCR with the genomic DNA of T. lanuginosus F-1126 as a template and primers TllN-F and TllN-R. This fragment was inserted into expression cassette 2 (Fig. 2), which is similar in structure to cassette 1. Transformation and selection of control strains were carried out according to the above-described method. The presence of the native gene in the genome of control transformants was confirmed by PCR analysis (TllN-F and TllN-R), yielding a product of size (873 bp).

[0033] Example 2. Evaluation of the productivity of Y. lipolytica transformants with an optimized lipase gene from T. lanuginosus

[0034] To evaluate the effectiveness of codon optimization, a comparative study was conducted between the productivity of Y. lipolytica transformants containing the optimized synthetic T. lanuginosus lipase gene (SEQ ID NO:1) and transformants containing the native (wild-type) lipase gene, which served as a control. Ten transformants were randomly selected for each variant and subjected to fermentation.

[0035] The seed culture is grown in 50 ml test tubes containing 10 ml of liquid nutrient medium YP with the addition of glucose (2 wt%) at 30°C for 24 hours on a shaker at 250 rpm.

[0036] The fermentation medium is seeded at a ratio of 1 / 10000. Fermentation is carried out at 30°C for 5 days on a shaker at 250 rpm in 10 ml of a nutrient medium containing 50% YNB, 25% 4 M potassium phosphate buffer, 12.5% ​​40% glucose solution, 10% olive oil emulsion with the addition of Tween 40 as an emulsifier, 2% sterile distilled water and 0.5% antibiotic mixture (ampicillin, tetracycline, chloramphenicol).

[0037]

[0038] Starting on day 3, lipase activity is measured during fermentation. Cells are pelleted by centrifugation, and lipase activity in the resulting supernatant is measured spectrophotometrically using p-nitrophenyl butyrate as a substrate. The results, summarized in Table 1, clearly demonstrate the advantage of genetic modification. The average productivity of transformants with the optimized gene reached 726 U / ml, 41% higher than that of the control group with the native gene, which showed an average result of 432 U / ml.

[0039] Thus, the obtained data confirm that the claimed invention makes it possible to construct Y. lipolytica transformants with significantly increased productivity of lipase from T. lanuginosus.

[0040] --->

[0041] <?xml version="1.0" encoding="UTF-8"?>

[0042] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0043] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0044] <ST26SequenceListing dtdVersion="V1_3" fileName="Transformant yeast

[0045] Yarrowia Lipolytica, producing lipase .xml" softwareName="WIPO

[0046] Sequence" softwareVersion="2.0.0" productionDate="2026-01-27">

[0047] <applicationidentification>

[0048] <ipofficecode>RU< / ipofficecode>

[0049] <applicationnumbertext> 2025137517< / applicationnumbertext>

[0050] <filingdate> 2025-10-06< / filingdate>

[0051] < / applicationidentification>

[0052] <applicantfilereference> 1< / applicantfilereference>

[0053] <earliestpriorityapplicationidentification>

[0054] <ipofficecode> RU< / ipofficecode>

[0055] <applicationnumbertext> 2025137517< / applicationnumbertext>

[0056] <filingdate> 2025-10-06< / filingdate>

[0057] < / earliestpriorityapplicationidentification>

[0058] <applicantname languagecode="ru">National Research

[0059] Kurchatov Institute Center< / applicantname>

[0060] <applicantnamelatin> Kurchatov Institute< / applicantnamelatin>

[0061] <inventorname languagecode="ru">Frolov Sergey

[0062] Valerievich< / inventorname>

[0063] <inventornamelatin> Frolov Sergey Valerievich< / inventornamelatin>

[0064] <inventiontitle languagecode="ru">Yarrowia yeast transformant

[0065] lipolytica producing lipase< / inventiontitle>

[0066] <sequencetotalquantity> 1< / sequencetotalquantity>

[0067] <sequencedata sequenceidnumber="1">

[0068] <insdseq>

[0069] <INSDSeq_length>915< / INSDSeq_length>

[0070] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0071] <INSDSeq_division>PAT< / INSDSeq_division>

[0072] <INSDSeq_feature-table>

[0073] <insdfeature>

[0074] <INSDFeature_key>source< / INSDFeature_key>

[0075] <INSDFeature_location>1..915< / INSDFeature_location>

[0076] <INSDFeature_quals>

[0077] <insdqualifier>

[0078] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0079] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0080] < / insdqualifier>

[0081] <insdqualifier id="q2">

[0082] <INSDQualifier_name>organism< / INSDQualifier_name>

[0083] <INSDQualifier_value>Yarrowia lipolytica< / INSDQualifier_value>

[0084] < / insdqualifier>

[0085] < / INSDFeature_quals>

[0086] < / insdfeature>

[0087] < / INSDSeq_feature-table>

[0088] <INSDSeq_sequence>atgaagctcagcacaatactttttactgcctgtgcgaccctggcagctg

[0089] ccttaccctctccctcgcgtgtcttccaagccagaagacactcgcccatccgccgggaggtcagccagga

[0090] cctgttcaaccagttcaaccttttcgctcagtactccgcagccgcttattgcggcaaaaacaacgacgct

[0091] cctgctgggaccaacattacttgcaccggaaacgcctgccccgaggttgaaaaggccgatgcaaccttcc

[0092] tgtactcgtttgaggactctggagttggagatgtcactggattcctggccctggataacactaacaagct

[0093] gattgtgttgtctttccgaggatccagatctatcgagaactggattggcaatcttaacttcgaccttaag

[0094] gagatcaatgacatttgttcaggatgccgaggtcacgacggctttacaagttcgtggagatcagttgctg

[0095] acaccctccgtcagaaagtggaggatgccgtgcgggaacacccggactaccgagtcgtgttcacgggaca

[0096] ttcgttggggggtgcgctggccaccgtcgccggtgctgatctgagaggtaacggctacgacattgatgtg

[0097] tttagttacggagctccaagggtcggcaatcgagcctttgcggagtttctaacggtccagaccggaggta

[0098] ctctctaccgtatcacccatacaaatgacattgttccccgactgccccctcgagaattcggctattctca

[0099] ctcctccccagagtactggatcaagtccggcactctcgtgcctgtaacgcgaaacgacatcgtcaagatt

[0100] gagggcattgacgccacaggtggcaacaaccaacccaacatccccgatatccctgctcacctgtggtact

[0101] ttggcctcatcggtacctgtctctaa< / INSDSeq_sequence>

[0102] < / insdseq>

[0103] < / sequencedata>

[0104]

[0105] <---

Images