Method for molecular genetic diagnostics of fatty liver disease in common carp (cyprinuscarpio)

Abstract

FIELD: molecular biology.SUBSTANCE: method for diagnosing fatty liver disease in common carp (Cyprinus carpio) by calculating the expression of the FASN gene in relation to the expression of the housekeeping gene β -actin is described.EFFECT: non-invasive, accurate and suitable for mass application method for diagnosing fatty liver disease in common carp.2 cl, 2 tbl, 1 ex

Description

[0001] This invention relates to fish farming, veterinary medicine, and molecular biology. It concerns methods for diagnosing liver diseases in fish, particularly fatty liver disease in common carp (Cyprinus carpio). The development of effective, accurate, and non-invasive methods for the early diagnosis of this disease is of great importance for improving fish farming performance and ensuring food security.

[0002] Fatty liver disease is a pathological condition characterized by excessive accumulation of lipids, primarily triacylglycerols, in hepatocytes, which leads to disruption of the normal architecture of liver tissue and functional failure of the organ. In industrial fish farming, this disease is one of the most common metabolic pathologies, significantly reducing the productivity and viability of cultured fish species [Tocher DR Metabolism and functions of lipids and fatty acids in teleost fish / / Reviews in fisheries science. - 2003. - Vol. 11. - No. 2. - P. 107-184].

[0003] Under conditions of intensive aquaculture, the main etiological factors in the development of fatty liver disease are an imbalance in the composition of feed, especially an excessive content of easily digestible carbohydrates and saturated lipids with a deficiency of essential fatty acids and lipotropic factors [Sargent JR, Tocher DR, Bell JG The lipids / / Fish nutrition. - 2003. - P. 181-257]. High-energy compound feeds with an unbalanced ratio of proteins, fats and carbohydrates stimulate the activation of de novo lipogenesis in the liver of fish, which leads to the accumulation of triglycerides [Hemre GI, Mommsen T. P., Carbohydrates in fish nutrition: effects on growth, glucose metabolism and hepatic enzymes / / Aquaculture nutrition. - 2002. - Vol. 8. - No. 3. - Pp. 175-194]. In addition, a deficiency of methionine, choline, inositol and other lipotropic substances disrupts the synthesis of phospholipids and very low-density lipoproteins (VLDL), which are necessary for the transport of lipids from the liver to peripheral tissues.

[0004] The pathogenetic mechanism of fatty liver disease development in fish involves several interrelated processes at the molecular and cellular levels. Excessive nutrient intake activates key lipogenesis enzymes, such as acetyl-CoA carboxylase and fatty acid synthase, leading to increased fatty acid synthesis [Polakof, S., Panserat, S., Soengas, JL, Moon, TW (2012). Glucose metabolism in fish: a review. Journal of Comparative Physiology B, 182(8), 1015-1045]. At the same time, fatty acid β-oxidation in mitochondria and peroxisomes is impaired due to decreased activity of carnitine palmitoyltransferase I and other oxidative metabolism enzymes. Deficiency of lipotropic factors inhibits the assembly and secretion of VLDL, which prevents the mobilization of triacylglycerols from hepatocytes [Torstensen V. E. et al.Novel production of Atlantic salmon (Salmo salar) protein based on combined replacement of fish meal and fish oil with plant meal and vegetable oil blends / / Aquaculture. - 2008. - Vol. 285. - No. 1-4. - Pp. 193-200]. The developing oxidative stress caused by the peroxidation of accumulated lipids causes damage to cell membranes, mitochondrial dysfunction and activation of apoptosis, which can ultimately lead to an inflammatory response and liver fibrosis.

[0005] A known method for diagnosing fatty liver disease using hyperpolarized 13C-pyruvate as a metabolic marker (KR 10-2022-0163657 A, A61B 5 / 055, A61B 5 / 00, A61B 5 / 0036, A61K 49 / 10, published 12.12.2022). This method is based on the use of 13C magnetic resonance spectroscopy to measure the rate of metabolic conversion of hyperpolarized 13C-pyruvate into its metabolites, mainly 13C-lactate and 13C-alanine, which makes it possible to diagnose non-alcoholic fatty liver disease and evaluate the effectiveness of therapeutic drugs in the early stages of treatment. The technical implementation of the method is carried out by intravenous administration to the subject of study of hyperpolarized 13C-pyruvate, obtained by the method of dynamic nuclear polarization at ultra-low temperature and a magnetic field of 3.35 T using the trityl radical as a paramagnetic agent in a molar ratio of 5:1.The subject is placed in a 9.4 Tesla magnetic resonance imaging (MRI) scanner, with a 20 mm diameter dual frequency radiofrequency coil positioned over the liver area to record spectroscopic signals from the C isotope. 13The physical basis of the method is that injected 13C-pyruvate is metabolized in the liver by specific enzymes, converting it into 13C-lactate via lactate dehydrogenase and into 13C-alanine via alanine aminotransferase. Spectra are recorded every second for 60 seconds after injection, allowing for real-time monitoring of metabolic transformations without exposure to ionizing radiation. Data processing includes automatic signal phasing, baseline subtraction, and frequency correction to obtain valid metabolite spectra. The diagnostic parameters are the calculated ratios of the areas under the signal curves of 13C-alanine to 13C-lactate, 13C-alanine to 13C-pyruvate, and 13C-lactate to 13C-pyruvate.The interpretation of the results is based on a comparison of the measured ratios with the control group, whereby an increase in the 13C-alanine / 13C-lactate ratio compared to the control indicates the presence or high probability of developing fatty liver disease, while a decrease in this indicator after the administration of the therapeutic agent indicates high sensitivity to treatment with drugs that inhibit ATP-citrate lyase.

[0006] However, this method has significant drawbacks that limit its practical application. It requires expensive, specialized dynamic nuclear polarization equipment operating at ultra-low temperatures and a high-field magnetic resonance imaging (MRI), significantly increasing the cost of the study and limiting its availability. The lifetime of the hyperpolarized state of 13C-pyruvate is only approximately 60 seconds, necessitating rapid manipulation and preventing repeat measurements in the event of technical issues. The need for intravenous administration of the drug makes the method invasive and requires qualified personnel to administer the injections.Interpretation of the results depends significantly on the activity of specific liver enzymes, which can change under the influence of many factors not directly related to steatosis, including acute inflammatory processes, medication intake, and individual metabolic characteristics.

[0007] A drawback of this method in the context of fish is its fundamental impossibility of application, as it was developed and validated exclusively in diabetic mouse models without any examples of its use in ichthyofauna. Metabolic pathways for pyruvate conversion in fish have significant species-specific characteristics associated with adaptation to aquatic habitats and thermoregulatory characteristics, making direct extrapolation of reference values ​​for metabolite ratios obtained in mammals impossible. The activity of key pyruvate metabolism enzymes, such as alanine aminotransferase and lactate dehydrogenase, differs significantly in fish from that in mammals and is strongly temperature-dependent, necessitating the development of specific calibration curves for each species under different maintenance conditions.In addition, the etiological factors for the development of fatty hepatosis in fish are fundamentally different from those in humans and are associated primarily with unbalanced feeding with high-carbohydrate feeds, the quality of the aquatic environment, and stocking density, which determines different pathogenetic mechanisms for the accumulation of lipids in hepatocytes.

[0008] The method for studying metabolic markers of liver pathologies in fish by taking blood from the gill vein of aquatic organisms was selected as a prototype [Popova O.S., Ponomarev V.S. Metabolic markers of liver pathologies in fish / O.S. Popova, V.S. Ponomarev / / International Bulletin of Veterinary Medicine. - 2022. - No. 3. - P. 91-95].

[0009] In the context of the application of this method, it is important to note a number of disadvantages, such as its invasiveness, labor-intensive implementation, characterized by the technical complexity of obtaining material, and a high degree of trauma with a significant probability of developing complications for the health of individuals, including death, as well as the impossibility of using this method as a mass screening of fish populations.

[0010] The common carp (Cyprinus carpio) is characterized by unique physiological adaptations that ensure highly efficient lipid metabolism in the liver under fluctuating aquatic temperature conditions. The carp's ability to actively accumulate energy reserves in the form of triglycerides in hepatocytes during periods of intensive feeding and mobilize them during wintering or starvation represents an evolutionarily developed survival mechanism. However, under artificial conditions with constant high-energy feeding, this adaptation can lead to pathological lipid overload in the liver. The morphofunctional features of the carp liver, including high vascularization, significant relative organ mass, and specific hepatocyte organization, facilitate intensive lipogenesis and make this species particularly sensitive to imbalances between lipid intake and utilization.

[0011] The invention solves the problem of developing a method for diagnosing fatty liver disease in common carp that would be non-invasive, accurate and suitable for mass use.

[0012] The technical result consists in a non-invasive, accurate and suitable for mass application method for diagnosing fatty liver disease in common carp.

[0013] The technical result is achieved in that in the method for diagnosing fatty liver disease in common carp (Cyprinus carpio), which includes taking venous blood, according to the invention, total RNA is isolated from the blood taken from the tail vein, complementary DNA is sequentially synthesized, quantitative polymerase chain reaction (PCR) in real time is carried out to determine the level of expression of the fatty acid synthase (FASN) gene, the expression of the FASN gene is calculated in relation to the expression of the housekeeping gene f-actin) according to the indicator

[0014] 2-ΔΔct, where ΔΔCt = ΔCt Kкарп с подозрением на жировую дистрофию печени - ΔСt здоровый карп; ΔCt = Ct ген fasn - Ct ген β-актина , and if the obtained value is 2-ΔΔct ≥ 2.5, the fish is diagnosed with fatty liver disease. Primers SEQ ID NO: 1 and SEQ ID NO: 2 are used to amplify the FASN gene region, primers SEQ ID NO: 3 and SEQ ID NO: 4 are used to amplify the housekeeping gene (β-actin), and SYBR Green is used as the intercalating dye in the PCR.

[0015] The fatty acid synthase gene (FASN) is a key enzyme in lipogenesis that catalyzes the synthesis of long-chain fatty acids from acetyl-coenzyme A and malonyl-coenzyme A, ensuring the process of new lipid formation in the body. Changes in the expression of the FASN gene can serve as a molecular marker of the intensification of lipogenetic processes and, consequently, fatty liver disease [The influence of the probiotic "Bacell-m" on the expression of metabolic genes, hematological and biochemical parameters of blood of common carp (Cyprinus carpio) in hepatopathies / E.V. Semenova, N.A. Strelnikov, E.V. Mikhailov, V.Yu. Sulin / / Scientific notes of the educational institution Vitebsk Order of the Badge of Honor State Academy of Veterinary Medicine. - 2024. - Vol. 60, No. 4. - P. 54-59].

[0016] The proposed method for diagnosing fatty liver disease is based on the analysis of the FASN gene expression level in the blood of fish and allows for minimally invasive diagnostics without the need to slaughter the fish, ensures early detection of the disease at the molecular level before the appearance of clinical signs and allows for mass screening of fish populations in farms and research institutions.

[0017] The diagnostic method for fatty liver disease involves the following steps. A blood sample is collected from the caudal vein of a common carp using a sterile syringe and needle. The volume of blood collected is 0.5-1.0 ml, which does not cause significant harm to the fish and does not affect its vital functions. The procedure is performed under aseptic conditions to prevent sample contamination and reduce the risk of infection. The blood is collected in tubes containing an anticoagulant to prevent clotting and ensure the preservation of cellular components.

[0018] Complementary DNA (cDNA) synthesis is performed by reverse transcription using reverse transcriptase and primers. The reaction is carried out at optimal temperatures for the enzyme, after which the enzyme is inactivated by heat.

[0019] The quantitative real-time polymerase chain reaction (qPCR) involves the use of specific primers for the FASN gene and a reference gene (β-actin). The reaction mixture includes cDNA, specific primers, DNA polymerase, buffer components, and dye. Amplification conditions include cycles of denaturation, primer annealing, and elongation. Product detection is performed in real time.

[0020] The results are analyzed by calculating the relative expression of the FASN gene using the 2 method -ΔΔCtwith normalization relative to the reference gene. Statistical analysis of the data allows us to determine the significance of differences in expression between the study and control groups. A significant decrease in FASN gene expression (more than 2.5 times compared to the control) indicates the presence of fatty liver disease.

[0021] The proposed method has several advantages. It is non-invasive and does not require slaughtering fish, which is important for preserving fish stocks and conducting repeat testing. Its high sensitivity allows for the detection of changes at the molecular level before the onset of clinical symptoms. Specificity is ensured by the use of specific primers and reaction conditions. The method is quick and cost-effective, does not require expensive equipment, and can be performed in a standard molecular biology laboratory. The ability to simultaneously analyze large numbers of samples speeds up the diagnostic process on a farm-wide scale.

[0022] At the Federal State Budgetary Scientific Institution “All-Russian Veterinary Research Institute of Pathology, Pharmacology and Therapy”, studies were conducted to study the expression of metabolic genes in common carp with fatty degeneration.

[0023] Blood samples of 0.5 ml were collected from 2 groups of 12-month-old carp: clinically healthy individuals without signs of liver pathology and aquatic animals with confirmed fatty liver disease.

[0024] Verification of the diagnosis of fatty liver disease was performed through a postmortem examination and histological and histochemical examination of the liver. Histological specimens were prepared using a standard method with hematoxylin and eosin staining. Histochemical examination was performed using a cryostage and specialized lipid staining with Sudan III and scarlet red. The diagnosis of fatty liver disease was established by qualitatively identifying characteristic morphological features in hepatocytes: pronounced cytoplasmic vacuolization with multiple lipid inclusions, peripheral displacement of nuclei, and an increase in hepatocyte size.

[0025] Total RNA was immediately (within 30 minutes) isolated from the collected blood using any available method (if it is not possible to isolate RNA from the blood immediately, the blood should be stored at -20°C for no more than two weeks). Reverse transcription was then performed to obtain cDNA. Real-time PCR was then performed with the obtained cDNA, using primers SEQ ID NO: 1 and SEQ ID NO: 2 to amplify the FASN gene region, and primers SEQ ID NO: 3 and SEQ ID NO: 4 to amplify the housekeeping gene β-actin (Table 1).

[0026]

[0027] SYBR Green was used as the intercalating dye in the PCR. PCR was performed according to the following protocol: primary denaturation at 95°C for 3 minutes; 38 cycles, including denaturation at 95°C for 30 seconds, primer annealing at 58°C for 30 seconds, chain elongation at 72°C for 30 seconds, and signal recording.

[0028] The calculation of FASN gene expression in relation to the expression of the housekeeping gene was performed based on the calculation of the 2-factor -ΔΔCt , where ΔΔCt = ΔCt особь с жировой дистрофией печени - ΔСt здоровая особь ; ΔCt = Ct ген FASN - Ct ген β-актина .

[0029] To make a diagnosis, it is necessary to have cDNA from the blood of healthy carp aged 12 months, which can be obtained earlier and stored for no more than two weeks at -20°C. If, when calculating according to formula 2 -ΔΔCt If a value of ≥2.5 was obtained, then the fish has an 80% probability of having fatty degeneration.

[0030] Example.

[0031] RNA was isolated from the blood of 12-month-old common carp using a commercially available RNA-EKSTRAN kit (Synthol, Russia) according to the included instructions. After RNA isolation, reverse transcription was performed using the MMLV RT kit (Eurogen, Russia) according to the included instructions. Quantitative real-time polymerase chain reaction was performed on a CFX96 Real-Time PCR Detection System (BioRad, USA) using the qPCRmix-HS SYBR+LowROX mixture (Eurogen, Russia) according to the following protocol: primary denaturation at 95°C for 3 minutes; 38 cycles, including denaturation at 95°C for 30 seconds, primer annealing at 58°C for 30 seconds, chain elongation at 72°C for 30 seconds, signal registration. The following were mixed in a test tube: 16 μl of sterile water, 5 μl of qPCRmix-HS SYBR+LowROX (Eurogen, Russia), 1 μl of primer SEQ ID NO: 1 at a concentration of 5 μM, 1 μl of primer SEQ ID NO: 2 at a concentration of 5 μM, 2 μl of the resulting cDNA.cDNA from healthy 12-month-old carp was used as a control.

[0032] PCR results were processed using method 2 -ΔΔCt . ΔCt was calculated using the following formula:

[0033]

[0034] ΔΔCt was calculated as

[0035]

[0036] The results obtained during PCR are shown in Table 2.

[0037]

[0038] ΔΔCt = 3.5-4.8 = -1.3;

[0039] 2 -ΔΔCt = 2 -(-1,3) = 2.5.

[0040] Thus, a 2.5-fold increase in the expression level of the FASN metabolic gene was observed in the group with fatty liver disease compared to the healthy group. These values ​​indicate that fish suspected of having the disease have an 80% probability of having the disease, as the FASN gene expression level was more than 2.5 times higher than in healthy fish.

[0041] --->

[0042] <?xml version="1.0" encoding="UTF-8"?>

[0043] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0044] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0045] <st26sequencelisting dtdversion="V1_3" filename="Код FASN.xml"

[0046] softwarename="WIPO Sequence" softwareversion="2.3.0"

[0047] productiondate="2025-11-23">

[0048] <applicationidentification>

[0049] <ipofficecode>RU< / ipofficecode>

[0050] <applicationnumbertext> 1< / applicationnumbertext>

[0051] <filingdate> 2025-11-10< / filingdate>

[0052] < / applicationidentification>

[0053] <applicantfilereference> 1< / applicantfilereference>

[0054] <earliestpriorityapplicationidentification>

[0055] <ipofficecode> RU< / ipofficecode>

[0056] <applicationnumbertext> 1< / applicationnumbertext>

[0057] <filingdate> 2025-11-10< / filingdate>

[0058] < / earliestpriorityapplicationidentification>

[0059] <applicantname languagecode="ru">

[0060] Federal State Budget Scientific Institute «All-Russian Veterinary Rese

[0061] arch Institute of Pathology,

[0062] Pharmacology and Therapy»< / applicantname>

[0063] <applicantnamelatin>FGBNU

[0064] "VNIVIPFiT"< / applicantnamelatin>

[0065] <inventiontitle languagecode="ru">Method of molecular genetic

[0066] diagnosis of fatty liver disease in common carp (Cyprinus

[0067] Carpio)< / inventiontitle>

[0068] <sequencetotalquantity> 4< / sequencetotalquantity>

[0069] <sequencedata sequenceidnumber="1">

[0070] <insdseq>

[0071] <INSDSeq_length> 20< / INSDSeq_length>

[0072] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0073] <INSDSeq_division> PAT< / INSDSeq_division>

[0074] <INSDSeq_feature-table>

[0075] <insdfeature>

[0076] <INSDFeature_key>source< / INSDFeature_key>

[0077] <INSDFeature_location>1..20< / INSDFeature_location>

[0078] <INSDFeature_quals>

[0079] <insdqualifier>

[0080] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0081] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0082] < / insdqualifier>

[0083] <insdqualifier id="q2">

[0084] <INSDQualifier_name> organism< / INSDQualifier_name>

[0085] <INSDQualifier_value> Cyprinus carpio< / INSDQualifier_value>

[0086] < / insdqualifier>

[0087] < / INSDFeature_quals>

[0088] < / insdfeature>

[0089] < / INSDSeq_feature-table>

[0090] <INSDSeq_sequence> gacaggccgctattgctatt< / INSDSeq_sequence>

[0091] < / insdseq>

[0092] < / sequencedata>

[0093] <sequencedata sequenceidnumber="2">

[0094] <insdseq>

[0095] <INSDSeq_length> 20< / INSDSeq_length>

[0096] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0097] <INSDSeq_division> PAT< / INSDSeq_division>

[0098] <INSDSeq_feature-table>

[0099] <insdfeature>

[0100] <INSDFeature_key>source< / INSDFeature_key>

[0101] <INSDFeature_location>1..20< / INSDFeature_location>

[0102] <INSDFeature_quals>

[0103] <insdqualifier>

[0104] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0105] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0106] < / insdqualifier>

[0107] <insdqualifier id="q4">

[0108] <INSDQualifier_name> organism< / INSDQualifier_name>

[0109] <INSDQualifier_value> Cyprinus carpio< / INSDQualifier_value>

[0110] < / insdqualifier>

[0111] < / INSDFeature_quals>

[0112] < / insdfeature>

[0113] < / INSDSeq_feature-table>

[0114] <INSDSeq_sequence> tgccgtaagctgaggaaatc< / INSDSeq_sequence>

[0115] < / insdseq>

[0116] < / sequencedata>

[0117] <sequencedata sequenceidnumber="3">

[0118] <insdseq>

[0119] <INSDSeq_length> 20< / INSDSeq_length>

[0120] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0121] <INSDSeq_division> PAT< / INSDSeq_division>

[0122] <INSDSeq_feature-table>

[0123] <insdfeature>

[0124] <INSDFeature_key>source< / INSDFeature_key>

[0125] <INSDFeature_location>1..20< / INSDFeature_location>

[0126] <INSDFeature_quals>

[0127] <insdqualifier>

[0128] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0129] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0130] < / insdqualifier>

[0131] <insdqualifier id="q6">

[0132] <INSDQualifier_name> organism< / INSDQualifier_name>

[0133] <INSDQualifier_value> Cyprinus carpio< / INSDQualifier_value>

[0134] < / insdqualifier>

[0135] < / INSDFeature_quals>

[0136] < / insdfeature>

[0137] < / INSDSeq_feature-table>

[0138] <INSDSeq_sequence> caaggccaacagggaaaaga< / INSDSeq_sequence>

[0139] < / insdseq>

[0140] < / sequencedata>

[0141] <sequencedata sequenceidnumber="4">

[0142] <insdseq>

[0143] <INSDSeq_length> 20< / INSDSeq_length>

[0144] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0145] <INSDSeq_division> PAT< / INSDSeq_division>

[0146] <INSDSeq_feature-table>

[0147] <insdfeature>

[0148] <INSDFeature_key>source< / INSDFeature_key>

[0149] <INSDFeature_location>1..20< / INSDFeature_location>

[0150] <INSDFeature_quals>

[0151] <insdqualifier>

[0152] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0153] <INSDQualifier_value>genomic DNA< / INSDQualifier_value>

[0154] < / insdqualifier>

[0155] <insdqualifier id="q8">

[0156] <INSDQualifier_name> organism< / INSDQualifier_name>

[0157] <INSDQualifier_value> Cyprinus carpio< / INSDQualifier_value>

[0158] < / insdqualifier>

[0159] < / INSDFeature_quals>

[0160] < / insdfeature>

[0161] < / INSDSeq_feature-table>

[0162] <INSDSeq_sequence> aggcatacagggacagcaca< / INSDSeq_sequence>

[0163] < / insdseq>

[0164] < / sequencedata>

[0165] < / st26sequencelisting>

[0166] <---

Claims

1. A method for diagnosing fatty liver disease in common carp (Cyprinus carpio), which involves taking venous blood, characterized in that total RNA is isolated from the blood taken from the tail vein, complementary DNA is sequentially synthesized, quantitative polymerase chain reaction (PCR) in real time is carried out to determine the level of expression of the fatty acid synthase gene (FASN), the expression of the FASN gene is calculated in relation to the expression of the housekeeping gene (β-actin) using the index 2 -ΔΔct , where ΔΔCt = ΔCt карп с подозрением на жировую дистрофию печени - ΔСt здоровый карп ; ΔCt = Сt ген FASN - Ct ген β-актина , and in the case of the obtained value 2 -ΔΔct ≥ 2.5 in fish, fatty liver disease is diagnosed.

2. The method according to claim 1, characterized in that the primers SEQ ID NO: 1 and SEQ ID NO: 2 are used to amplify the FASN gene region, the primers SEQ ID NO: 3, SEQ ID NO: 4 are used to amplify the housekeeping gene (β-actin), and SYBR Green is used as the intercalating dye in PCR.

Images