Compositions and methods for screening agents targeting tau protein 4r

Abstract

FIELD: biotechnology; molecular biology.SUBSTANCE: methods for assessing the activity of a reagent targeting tau protein, including in vivo, are proposed.EFFECT: proposed methods allow measurements of specific tau protein isoforms to accurately test the specificity of reagents that should reduce only tau protein 4R and not affect tau protein 3R, compared with reagents that should reduce both tau proteins.14 cl, 15 dwg, 2 ex

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Patent Application No. 63 / 309,055, filed February 11, 2022, which is incorporated herein by reference in its entirety for all purposes.LINK TO SEQUENCE LISTING FILED AS XML FILE VIA EFS-WEB

[0002] The sequence listing recorded in the file 057766-59020l.xml has a size of 123 kilobytes, was created on February 3, 2023, and is incorporated herein by reference.BACKGROUND

[0003] Human Tep MART encodes six different tau isoforms: 2N4R, 1N4R, 0N4R, 2N3R, 1N3R, and 0N3R. The distinction between transcripts containing 4R (with four repeats) and 3R (with three repeats) tau is determined by the inclusion (4R) or exclusion (3R) of exon 10. In humans, 3R and 4R tau are usually expressed in equal proportions. In some tauopathies, such as Alzheimer's disease, experimental data from postmortem studies of brain tissue indicate that insoluble tau aggregates consist of both 3R and 4R tau. In rarer tauopathies, such as progressive supranuclear palsy (PSP) and corticobasal degeneration (CBD), 4R tau proteins represent aggregation-prone forms of tau. The underlying mechanisms for the formation of these differentiated aggregate types in these diseases are unknown.

[0004] One of the major challenges to date is the development of assays for measuring mRNA of different tau isoforms. For example, the tau "R / repeat" domain complicates the design of TaqMan primer-probe pairs to measure 3R tau. This lack of assays for measuring specific tau isoforms makes it difficult to accurately test the specificity of reagents (e.g., siRNA) that should reduce only 4R tau and not affect 3R tau, compared to reagents (e.g., siRNA) that should reduce both tau proteins. SUMMARY OF THE INVENTION

[0005] Tau reporter compositions, tau reporter cells, and tau reporter animals are provided, which comprise a tau protein isoform with four repeats (4R) linked to a first reporter protein and a tau protein isoform with three repeats (3R) linked to a second reporter protein that is different from the first reporter protein. Methods for producing such tau reporter cells and tau reporter animals and using such tau reporter cells and tau reporter animals to evaluate the activity of reagents targeting tau protein are provided.

[0006] In one aspect, a cell is provided that comprises a four-repeat (4R) tau protein isoform linked to a first reporter protein and a three-repeat (3R) tau protein isoform linked to a second reporter protein that is different from the first reporter protein. In some such cells, the cell comprises a first fusion protein comprising a 4R tau protein isoform fused to a first reporter protein and a second fusion protein comprising a 3R tau protein isoform fused to a second reporter protein. In some such cells, the cell comprises a first nucleic acid encoding the first fusion protein and a second nucleic acid encoding the second fusion protein, wherein the cell expresses the first fusion protein and the second fusion protein.

[0007] In some such cells, the cell comprises a first nucleic acid comprising a coding sequence for the 4R tau protein isoform and a coding sequence for a first reporter protein, and a second nucleic acid comprising a coding sequence for the 3R tau protein isoform and a coding sequence for a second reporter protein, wherein the cell expresses the 4R tau protein isoform, the 3R tau protein isoform, the first reporter protein, and the second reporter protein. In some such cells, the coding sequence for the 4R tau protein isoform and the coding sequence for the first reporter protein are separated by a coding sequence for the first 2A peptide, and the coding sequence for the 3R tau protein isoform and the coding sequence for the second reporter protein are separated by a coding sequence for the second 2A peptide.In some such cells, the first 2A peptide is the first P2A peptide, and the second 2A peptide is the second P2A peptide.

[0008] In some such cells, the first nucleic acid and the second nucleic acid are integrated into the genome of the cell. In some such cells, the cell contains a viral vector containing the first nucleic acid and the second nucleic acid. In some such cells, the viral vector is a lentiviral vector or an adeno-associated virus (AAV) vector. In some such cells, the cell contains a first viral vector containing the first nucleic acid and a second viral vector containing the second nucleic acid. In some such cells, the first viral vector and the second viral vector are lentiviral vectors or adeno-associated virus (AAV) vectors.

[0009] In some of these cells, the first reporter protein is the first fluorescent reporter protein, and the second reporter protein is the second fluorescent reporter protein. In some of these cells, the first reporter protein is eYFP, and the second reporter protein is mCherry. In some of these cells, the 4R tau isoform and the 3R tau isoform are human.

[0010] In some such cells, the 4R tau isoform is the 2N4R tau isoform. In some such cells, the 3R tau isoform is the 2N3R tau isoform. In some such cells, the 4R tau isoform is the 2N4R tau isoform, and the 3R tau isoform is the 2N3R tau isoform. In some such cells, the 4R tau isoform comprises the sequence presented in SEQ ID NO: 13, and the 3R tau isoform comprises the sequence presented in SEQ ID NO: 14.

[0011] In some such cells, the 4R tau isoform is the 1N4R tau isoform. In some such cells, the 3R tau isoform is the 1N3R tau isoform. In some such cells, the 4R tau isoform is the 1N4R tau isoform, and the 3R tau isoform is the 1N3R tau isoform. In some such cells, the 4R tau isoform comprises the sequence presented in SEQ ID NO: 23, 27, 31, or 47, and the 3R tau isoform comprises the sequence presented in SEQ ID NO: 24, 28, 32, or 49.

[0012] In some of these cells, the cell is a mammalian cell. In some of these cells, the cell is a human cell. In some of these cells, the cell is an immortalized cell. In some of these cells, the cell is a HEK293 cell.

[0013] In another aspect, populations of cells are provided comprising a plurality of any of the above cells.

[0014] In another aspect, a non-human animal is provided comprising a four-repeat (4R) tau protein isoform linked to a first reporter protein and a three-repeat (3R) tau protein isoform linked to a second reporter protein that is different from the first reporter protein. In the case of some such non-human animals, the non-human animal comprises a first fusion protein comprising a 4R tau protein isoform fused to a first reporter protein and a second fusion protein comprising a 3R tau protein isoform fused to a second reporter protein. In the case of some such non-human animals, the non-human animal comprises a first nucleic acid encoding a first fusion protein and a second nucleic acid encoding a second fusion protein, wherein the non-human animal expresses the first fusion protein and the second fusion protein.

[0015] In the case of some such non-human animals, the non-human animal comprises a first nucleic acid comprising a coding sequence for a 4R tau protein isoform and a coding sequence for a first reporter protein, and a second nucleic acid comprising a coding sequence for a 3R tau protein isoform and a coding sequence for a second reporter protein, wherein the non-human animal expresses a 4R tau protein isoform, a 3R tau protein isoform, a first reporter protein and a second reporter protein.In some such non-human animals, the sequence for the 4R tau isoform and the coding sequence for the first reporter protein are separated by the coding sequence for the first 2A peptide, and the coding sequence for the 3R tau isoform and the coding sequence for the second reporter protein are separated by the coding sequence for the second 2A peptide. In some such non-human animals, the first 2A peptide is the first P2A peptide, and the second 2A peptide is the second P2A peptide.

[0016] In the case of some such non-human animals, the first nucleic acid and the second nucleic acid are integrated into the genome of the non-human animal. In the case of some such non-human animals, the non-human animal comprises a viral vector comprising the first nucleic acid and the second nucleic acid. In the case of some such non-human animals, the viral vector is a lentiviral vector or an adeno-associated virus (AAV) vector. In the case of some such non-human animals, the non-human animal comprises a first viral vector comprising a first nucleic acid and a second viral vector comprising a second nucleic acid. In the case of some such non-human animals, the first viral vector and the second viral vector are lentiviral vectors or adeno-associated virus (AAV) vectors.

[0017] For some such non-human animals, the first reporter protein is the first fluorescent reporter protein, and the second reporter protein is the second fluorescent reporter protein. For some such non-human animals, the first reporter protein is eYFP, and the second reporter protein is mCherry.

[0018] In the case of some such non-human animals, the tau protein 4R isoform and the tau protein 3R isoform are human, optionally each of the tau protein 4R isoform and the tau protein 3R isoform comprises an R5L mutation, an L237V mutation, or a G243V mutation, or optionally each of the tau protein 4R isoform and the tau protein 3R isoform comprises an N279K mutation, an L284R mutation, or an S285R mutation.

[0019] In the case of some such non-human animals, the 4R tau isoform is the 2N4R tau isoform. In the case of some such non-human animals, the 3R tau isoform is the 2N3R tau isoform. In the case of some such non-human animals, the 4R tau isoform is the 2N4R tau isoform, and the 3R tau isoform is the 2N3R tau isoform. In the case of some such non-human animals, the 4R tau isoform comprises the sequence presented in SEQ ID NO: 13, and the 3R tau isoform comprises the sequence presented in SEQ ID NO: 14.

[0020] In some such non-human animals, the 4R tau isoform is the 1N4R tau isoform. In some such non-human animals, the 3R tau isoform is the 1N3R tau isoform. In some such non-human animals, the 4R tau isoform is the 1N4R tau isoform, and the 3R tau isoform is the 1N3R tau isoform. For some such non-human animals, the 4R tau isoform comprises the sequence shown in SEQ ID NO: 23, 27, 31, or 47, and the 3R tau isoform comprises the sequence shown in SEQ ID NO: 24, 28, 32, or 49.

[0021] For certain such non-human animals, the non-human animal is a mammal. For certain such non-human animals, the non-human animal is a rodent. For certain such non-human animals, the non-human animal is a mouse. For certain such non-human animals, the non-human animal is a rat.

[0022] In some such non-human animals, the 4R tau isoform, the first reporter protein, the 3R tau isoform, and the second reporter protein are expressed in neurons of the central nervous system of the non-human animal. In some such non-human animals, the non-human animal contains filamentous inclusions of tau protein.

[0023] In another aspect, methods for assessing the activity of a tau protein-targeting reagent are provided. Some such methods include: (a) introducing a tau protein-targeting reagent into any of the above-mentioned cells; and (b) assessing the activity of the tau protein-targeting reagent in the cell. In some such methods, the activity of the tau protein-targeting reagent is assessed compared to a control cell into which the tau protein-targeting reagent is not introduced, or is assessed compared to a state before the tau protein-targeting reagent is introduced.

[0024] In some such methods, the evaluation includes measuring one or more of the expression of 4R tau protein messenger RNA, the expression of a first reporter protein messenger RNA, and the expression of a second reporter protein messenger RNA.In some such methods, the assay comprises measuring the expression of the 4R tau protein isoform messenger RNA and the expression of the second reporter protein messenger RNA, wherein a greater relative decrease in the expression of the 4R tau protein isoform messenger RNA compared to the expression of the second reporter protein messenger RNA after introducing the tau protein targeting reagent into the cell indicates that the tau protein targeting reagent is a 4R-preferential tau protein targeting reagent, wherein optionally a decrease in the expression of the 4R tau protein isoform messenger RNA by at least 70% and a decrease in the expression of the second reporter protein messenger RNA by no more than 30% after introducing the tau protein targeting reagent into the cell indicates that the tau protein targeting reagent is a 4R-preferential tau protein targeting reagent.In some such methods, the evaluation comprises measuring the expression of the messenger RNA of the first reporter protein and the expression of the messenger RNA of the second reporter protein, wherein a greater relative decrease in the expression of the messenger RNA of the first reporter protein compared to the expression of the messenger RNA of the second reporter protein after introducing the tau protein-targeting reagent into the cell indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent, wherein optionally a decrease in the expression of the messenger RNA of the first reporter protein by at least 70% and a decrease in the expression of the messenger RNA of the second reporter protein by no more than 30% after introducing the tau protein-targeting reagent into the cell indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent.

[0025] In some such methods, the evaluation includes measuring one or more of the expression of a first reporter protein and the expression of a second reporter protein. In some such methods, the evaluation includes measuring the expression of the first reporter protein and the expression of a second reporter protein, wherein a greater relative decrease in the expression of the first reporter protein compared to the expression of the second reporter protein after introducing the tau protein-targeting reagent into the cell indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent, while optionally a decrease in the expression of the first reporter protein by at least 70% and a decrease in the expression of the second reporter protein by no more than 30% after introducing the tau protein-targeting reagent into the cell indicates that the tau protein-targeting reagent is a 411-preferential tau protein-targeting reagent.

[0026] In some such methods, the first reporter protein is a first fluorescent reporter protein, and the second reporter protein is a second fluorescent reporter protein, and the evaluation in step (b) includes immunofluorescence staining or flow cytometry. In some such methods, the evaluation in step (b) includes evaluation of tau protein hyperphosphorylation or tau protein aggregation.

[0027] In some such methods, the tau protein-targeting reagent is an RNAi agent or an antisense oligonucleotide. In some such methods, the tau protein-targeting reagent is an intrabody. In some such methods, the tau protein-targeting reagent is a nuclease agent. In some such methods, the nuclease agent comprises a Cas protein and a guide RNA designed to target a target sequence of the guide RNA within the tau protein-coding sequence.

[0028] In another aspect, methods are provided for assessing the activity of a tau protein-targeting reagent in vivo. Some such methods comprise: (a) administering a tau protein-targeting reagent to any of the above-mentioned non-human animals; and (b) assessing the activity of the tau protein-targeting reagent in a non-human animal. In some such methods, the activity of the tau protein-targeting reagent is assessed compared to a control non-human animal that is not administered the tau protein-targeting reagent, or assessed compared to a state before administration of the tau protein-targeting reagent.

[0029] In some such methods, the evaluation includes measuring one or more of the expression of 4R tau protein messenger RNA, the expression of a first reporter protein messenger RNA, and the expression of a second reporter protein messenger RNA.In some such methods, the evaluation comprises measuring the expression of 4R tau isoform messenger RNA and the expression of a second reporter protein messenger RNA, wherein a greater relative decrease in the expression of 4R tau isoform messenger RNA compared to the expression of the second reporter protein messenger RNA after administration of a tau protein-targeting reagent to a non-human animal indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent, wherein optionally a decrease in the expression of 4R tau isoform messenger RNA by at least 70% and a decrease in the expression of the second reporter protein messenger RNA by no more than 30% after administration of a tau protein-targeting reagent to a non-human animal indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent.In some such methods, the evaluation comprises measuring the expression of messenger RNA of a first reporter protein and the expression of messenger RNA of a second reporter protein, wherein a greater relative decrease in the expression of messenger RNA of the first reporter protein compared to the expression of messenger RNA of the second reporter protein after administration of the tau protein-targeting reagent to a non-human animal indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent, wherein optionally a decrease in the expression of messenger RNA of the first reporter protein by at least 70% and a decrease in the expression of messenger RNA of the second reporter protein by no more than 30% after administration of the tau protein-targeting reagent to a non-human animal indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent.

[0030] In some such methods, the evaluation includes measuring one or more of the expression of a first reporter protein and the expression of a second reporter protein.In some such methods, the evaluation comprises measuring the expression of a first reporter protein and the expression of a second reporter protein, wherein a greater relative decrease in the expression of the first reporter protein compared to the expression of the second reporter protein after administration of the tau protein-targeting reagent to a non-human animal indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent, wherein optionally a decrease in the expression of the first reporter protein by at least 70% and a decrease in the expression of the second reporter protein by no more than 30% after administration of the tau protein-targeting reagent to a non-human animal indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent.

[0031] In some such methods, the first reporter protein is a first fluorescent reporter protein, and the second reporter protein is a second fluorescent reporter protein, and the evaluation in step (b) includes immunofluorescence staining or flow cytometry. In some such methods, the evaluation in step (b) includes evaluation of tau protein hyperphosphorylation or tau protein aggregation.

[0032] In some such methods, the tau protein-targeting reagent is an RNAi agent or an antisense oligonucleotide. In some such methods, the tau protein-targeting reagent is an intrabody. In some such methods, the tau protein-targeting reagent is a nuclease agent. In some such methods, the nuclease agent comprises a Cas protein and a guide RNA designed to target a target sequence of the guide RNA within the tau protein-coding sequence.

[0033] Some of these methods involve assessing neurons in the central nervous system of a non-human animal.

[0034] In another aspect, compositions are provided. Some such compositions comprise: (a) a four-repeat (4R) tau protein isoform linked to a first reporter protein and a three-repeat (3R) tau protein isoform linked to a second reporter protein that is different from the first reporter protein; or (b) a first nucleic acid encoding a 4R tau protein isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau protein isoform linked to a second reporter protein.

[0035] In some such compositions, the composition comprises a first fusion protein comprising a 4R tau protein isoform fused to a first reporter protein and a second fusion protein comprising a 3R tau protein isoform fused to a second reporter protein, or wherein the first nucleic acid encodes the first fusion protein and the second nucleic acid encodes the second fusion protein. In some such compositions, the first nucleic acid comprises a coding sequence for a 4R tau protein isoform and a coding sequence for a first reporter protein, separated by a coding sequence for a first 2A peptide, and wherein the second nucleic acid comprises a coding sequence for a 3R tau protein isoform and a coding sequence for a second reporter protein, separated by a coding sequence for a second 2A peptide.In some such compositions, the first peptide 2A is a first peptide P2A, and the second peptide 2A is a second peptide P2A.

[0036] In some such compositions, the first nucleic acid and the second nucleic acid are in a viral vector. In some such compositions, the viral vector is a lentiviral vector or an adeno-associated virus (AAV) vector. In some such compositions, the first nucleic acid is in a first viral vector and the second nucleic acid is in a second viral vector. In some such compositions, the first viral vector and the second viral vector are lentiviral vectors or adeno-associated virus (AAV) vectors.

[0037] In some such compositions, the first reporter protein is a first fluorescent reporter protein, and the second reporter protein is a second fluorescent reporter protein. In some such compositions, the first reporter protein is eYFP, and the second reporter protein is mCherry.

[0038] In some of these compositions, the 4R tau protein isoform and the 3R tau protein isoform are human.

[0039] In some such compositions, the 4R tau protein isoform is the 2N4R tau protein isoform. In some such compositions, the 3R tau protein isoform is the 2N3R tau protein isoform. In some such compositions, the 4R tau protein isoform is the 2N4R tau protein isoform, and wherein the 3R tau protein isoform is the 2N3R tau protein isoform. In some such compositions, the 4R tau protein isoform comprises the sequence presented in SEQ ID NO: 13, and the 3R tau protein isoform comprises the sequence presented in SEQ ID NO: 14.

[0040] In some such compositions, the 4R tau protein isoform is the 1N4R tau protein isoform. In some such compositions, the 3R tau protein isoform is the 1N3R tau protein isoform. In some such compositions, the 4R tau protein isoform is the 1N4R tau protein isoform, and wherein the 3R tau protein isoform is the 1N3R tau protein isoform. In some such compositions, the 4R tau protein isoform comprises the sequence presented in SEQ ID NO: 23, 27, 31, or 47, and the 3R tau protein isoform comprises the sequence presented in SEQ ID NO: 24, 28, 32, or 49.

[0041] In another aspect, a cell comprising any of the above compositions is provided. In another aspect, a non-human animal comprising any of the above compositions is provided.

[0042] In another aspect, methods for creating any of the above cells are provided. Some such methods include introducing into the cell a four-repeat (4R) tau protein isoform linked to a first reporter protein and a three-repeat (3R) tau protein isoform linked to a second reporter protein, or introducing into the cell a first nucleic acid encoding a 4R tau protein isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau protein isoform linked to a second reporter protein.

[0043] In another aspect, methods for creating any of the above non-human animals are provided. Some such methods include administering to a non-human animal a four-repeat (4R) tau protein isoform linked to a first reporter protein and a three-repeat (3R) tau protein isoform linked to a second reporter protein, or administering to a non-human animal a first nucleic acid encoding a 4R tau protein isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau protein isoform linked to a second reporter protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 shows the different isoforms of tau protein with four repeats (4R) and three repeats (3R). Exon 10 encodes the “R2 domain,” which distinguishes tau protein 4R from tau protein 3R.

[0045] Fig. 2 shows the relative expression of 2N4R-eYFP and 2N3R-mCherry mRNA in 2N4R-eYFP / 2N3R-mCherry dual reporter cell lines using eYFP-specific and mCherry-specific TaqMan probes.

[0046] Fig. 3 shows immunofluorescence images of clones C2, C3, and C5 of the 2N4R-eYFP / 2N3R-mCherry cell line. The top row shows eYFP, the middle row shows mCherry, and the third row shows merged images of eYFP and mCherry.

[0047] Fig. 4 shows immunofluorescence images from the untreated 2N4R-eYFP / 2N3R-mCherry cell line (first column) or the cell line treated with 10 nM siRNA to total tau (targeting both tau 3R and tau 4R) or 10 nM siRNA to mCherry (HAIJE-000013).

[0048] Fig. 5 shows immunofluorescence images from the untreated 2N4R-eYFP / 2N3R-mCherry cell line (first column) or the cell line treated with 10 nM total YFP siRNA (P-002048-01) or 10 nM mCherry siRNA (HAIJE-000015 or HAIJE-000017).

[0049] Fig. 6 shows the possible selection criteria for “4R-specific” siRNAs and “4R-preferential siRNAs”.

[0050] Figure 7 shows the percentage of RNA knockdown measured by the tau 4R and mCherry TaqMan assays for 65 candidate siRNAs to tau 4R.

[0051] Fig. 8 shows the correlation between the percentage of tau 4R knockdown and the percentage of eYFP knockdown measured by TaqMan.

[0052] Figure 9A shows TaqMan qPCR data on the expression levels of tau 4R and mCherry (a mimic of tau 3R) after treatment of HEK293-2N4R-YFP+2N3R-mCherry dual reporter cells with 1 nM of 65 different GalNAc-conjugated siRNAs, which were generated by tracing the entire exon 10 of the MAPT gene. Lipofectamine was used as a negative control. siRNA to total tau was also used as a control.

[0053] Figure 9B shows the relative expression of 4R tau and mCherry for thirteen 4R-preferential siRNAs (1 nM and 0.1 nM). Lipofectamine was used as a negative control. Two siRNAs to total tau were also used as controls.

[0054] Figure 10A shows the IC50 plots for two candidate 4R siRNAs using the 3R / 4R dual reporter. The siRNAs were tested at eight different concentrations. Figure 10B shows the IC50 plots for two candidate 4R siRNAs using the 3R-mCherry reporter. The siRNAs were tested at eight different concentrations. Figure 10C shows the IC50 plots for two candidate 4R siRNAs using the 4R-YFP reporter. The siRNAs were tested at eight different concentrations.

[0055] Figure 11A shows the IC50 plots for two candidate 4R siRNAs using the 3R / 4R dual reporter. The siRNAs were tested at eight different concentrations. Figure 11B shows the IC50 plots for two candidate 4R siRNAs using the 3R-mCherry reporter. The siRNAs were tested at eight different concentrations. Figure 11C shows the IC50 plots for two candidate 4R siRNAs using the 4R-YFP reporter. The siRNAs were tested at eight different concentrations.

[0056] Figure 12 shows the validation of four 4R-preferential siRNAs for 4R tau knockdown using dot blots with 4R-specific and 3R-specific antibodies. On the left is shown the validation of antibodies with recombinant 1N3R or 1N4R tau proteins to confirm specificity, and on the right is shown testing with lysates from dual reporter cells treated with siRNAs. The experimental schematic is shown at the top.

[0057] Figure 13 shows the validation of four 411-preferential siRNAs for 4R tau knockdown using total tau and 3R tau ELISA. In the left panel, a commercially available ALPHALISA total tau assay (Perkin Elmer, Cat. No. AL271C) was used to measure total soluble tau according to the manufacturer’s instructions. In the right panel, 4R tau was measured using the PathScan ELISA kit from Cell Signaling Technologies (Cat. No. 29443). The experimental schematic is shown at the top.

[0058] Fig. 14 shows the RT-qPCR data of total tau and tau 4R expression levels on RNA extracted from the brains of MAPT-humanized mice treated with tau 4R siRNA. The values ​​are plotted as relative expression (l / 2 ΔΔCt ) for the intact group and normalized to mouse GAPDH.

[0059] Fig. 15 shows the schematics of tau protein 1N4R (R5L)-P2A-eYFP and tau protein 1N3R (R5L)-P2A-mCherry, tau protein 1N4R (L237V)-P2A-eYFP and tau protein 1N3R (L237V)-P2A-mCherry, and tau protein 1N4R (G243V)-P2A-eYFP and tau protein 1N3R (G243V)-P2A-mCherry for use in establishing a mouse model for in vivo testing of reagents targeting tau protein 4R. DEFINITIONS

[0060] The terms "protein," "polypeptide," and "peptide," as used interchangeably herein, include polymeric forms of amino acids of any length, including coded and non-coded amino acids, as well as chemically or biochemically modified or derivatized amino acids. These terms also include modified polymers, such as polypeptides having modified peptide backbones. The term "domain" refers to any portion of a protein or polypeptide that has a specific function or structure.

[0061] As is known, proteins have an "N-terminus" (amino terminus) and a "C-terminus" (carboxyl terminus or carboxy terminus). The term "N-terminus" refers to the beginning of a protein or polypeptide, ending with an amino acid with a free amino group (-NH2). The term "C-terminus" refers to the end of an amino acid chain (protein or polypeptide), ending with a free carboxyl group (-COOH).

[0062] The terms "nucleic acid" and "polynucleotide," as used interchangeably herein, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. They include single-, double-, and multistranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers containing purine bases, pyrimidine bases, or other naturally occurring, chemically modified, biochemically modified, non-naturally occurring, or derivatized nucleotide bases.

[0063] As is well known, nucleic acids have “5' ends” and “3' ends” because mononucleotides react to form oligonucleotides in such a way that the 5'-phosphate of one pentose ring of a mononucleotide is attached to the 3'-oxygen of an adjacent mononucleotide in one direction through a phosphodiester bond. The end of an oligonucleotide is called a “5' end” if its 5'-phosphate is not attached to the 3'-oxygen of the pentose ring of a mononucleotide. The end of an oligonucleotide is called a “3' end” if its 3'-oxygen is not attached to the 5'-phosphate of another pentose ring of a mononucleotide. It can be said that a nucleic acid sequence, even if it is located internally with respect to a larger oligonucleotide, has 5' and 3' ends. In either a linear or circular DNA molecule, discrete elements are referred to as "5'-oriented" or "3'-oriented".

[0064] The term "genomic integration" refers to a nucleic acid that has been introduced into a cell such that the nucleotide sequence is integrated into the cell's genome. Any protocol can be used to stably incorporate the nucleic acid into the cell's genome.

[0065] The term "expression vector," "expression construct," or "expression cassette" refers to a recombinant nucleic acid comprising a desired coding sequence operably linked to appropriate nucleic acid sequences required for expression of the operably linked coding sequence in a particular host cell or organism. Nucleic acid sequences required for expression in prokaryotes typically include a promoter, an operator (optional), and a ribosome binding site, among other sequences. Eukaryotic cells generally utilize promoters, enhancers, and termination and polyadenylation signals, although some elements can be removed and others added without affecting the desired expression.

[0066] The term “targeting vector” refers to a recombinant nucleic acid that can be introduced into a target position in the genome of a cell by homologous recombination, non-homologous end joining-mediated ligation, or any other recombination method.

[0067] The term "isolated" with respect to a cell, tissue, protein, or nucleic acid includes cells, tissues, proteins, and nucleic acids that are relatively purified compared to other bacterial, viral, cellular, or other components that may ordinarily be present in situ, up to and including a substantially pure preparation of cells, tissues, proteins, and nucleic acids. The term "isolated" also includes cells, tissues, proteins, and nucleic acids that have no analogues in nature, have been chemically synthesized and thus are substantially free of contamination by other cells, tissues, proteins, and nucleic acids, or have been separated or purified from most other components (e.g., cellular components or components of organisms) with which they are naturally associated (e.g., other cellular proteins, nucleic acids, or cellular or extracellular components).

[0068] The term "wild-type" refers to entities that have a structure and / or activity that are observed in a normal (as opposed to a mutant, pathological, altered, etc.) state or context. Wild-type genes and polypeptides often exist in several different forms (e.g., alleles).

[0069] The term "endogenous sequence" refers to a nucleic acid sequence that occurs naturally in a rat cell or within the body of a rat. For example, the endogenous MAPT sequence of a human cell refers to the native MAPT sequence that occurs naturally at the MAPT locus in a human cell.

[0070] "Exogenous" molecules or sequences include molecules or sequences that are not normally present in a cell in a given form. Normal presence includes presence dependent on the specific developmental stage and environmental conditions of the cell. An exogenous molecule or sequence, for example, may include a mutated version of the corresponding endogenous sequence in the cell, such as a humanized version of the endogenous sequence, or may include a sequence corresponding to the endogenous sequence in the cell but in a different form (i.e., not on a chromosome). In contrast, endogenous molecules or sequences include molecules or sequences that are normally present in this form in a particular cell at a particular developmental stage under particular environmental conditions.

[0071] The term "heterologous," when used in the context of a nucleic acid or protein, indicates that the nucleic acid or protein comprises at least two segments that are not naturally found together in the same molecule. For example, the term "heterologous," when used with respect to nucleic acid segments or protein segments, means that the nucleic acid or protein comprises two or more subsequences that are not naturally found in such a relationship with one another (e.g., linked together). As an example, a "heterologous" region of a nucleic acid vector is a nucleic acid segment within or attached to another nucleic acid molecule that is not naturally found in association with the other molecule.For example, a heterologous region of a nucleic acid vector may include a coding sequence flanked by sequences not naturally associated with said coding sequence. Similarly, a "heterologous" region of a protein is a segment of amino acids within another peptide molecule or attached to another peptide molecule that is not naturally associated with said other peptide molecule (e.g., a fusion protein or a tagged protein). Similarly, a nucleic acid or protein may contain a heterologous tag or a heterologous secretion or localization sequence.

[0072] "Codon optimization" utilizes the degeneracy property of codons, as demonstrated by the variety of three-base-pair codon combinations that specify an amino acid, and typically involves the process of modifying a nucleic acid sequence to enhance expression in specific host cells by replacing at least one codon of the native sequence with a codon that is more frequently or most frequently used in the host cell's genes, while maintaining the native amino acid sequence.For example, the nucleic acid encoding the tau protein can be modified to use as replacement codons that are more frequently used in a given prokaryotic or eukaryotic cell, including a bacterial cell, yeast cell, human cell, non-human cell, mammalian cell, rodent cell, mouse cell, rat cell, hamster cell, or any other host cell, compared to the naturally occurring nucleotide sequence. Codon usage tables are readily available, for example, in the Codon Usage Database. These tables can be adapted in a variety of ways. See Nakamura et al. (2000) Nucleic Acids Res. 28(1):292, incorporated herein by reference in its entirety for all purposes. Computer algorithms for optimizing the codons of a particular sequence for expression in a particular host are also available (see, for example, Gene Forge).

[0073] The term "locus" refers to a specific location of a gene (or significant sequence), DNA sequence, polypeptide-coding sequence, or chromosomal position of an organism's genome. For example, a "MAP locus" may refer to a specific location of a gene, a MAP, a MAP DNA sequence, a tau protein-coding sequence, or a chromosomal position of a MAP in the genome of an organism that has been identified as containing such a sequence. A "MAP locus" may contain a regulatory element of a gene, a MAP, including, for example, an enhancer, a promoter, a 5'- and / or 3'-untranslated region (UTR), or a combination thereof.

[0074] The term "gene" refers to DNA sequences in a chromosome that may contain, if naturally present, at least one coding region and at least one non-coding region. A DNA sequence in a chromosome that encodes a product (e.g., but not limited to, an RNA product and / or a polypeptide product) may comprise a coding region interrupted by non-coding introns and a sequence located adjacent to the coding region at both the 5' and 3' end, such that the gene corresponds to a full-length mRNA (including 5' and 3' untranslated sequences). In addition, other non-coding sequences may be present in a gene, including regulatory sequences (e.g., but not limited to, promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequences, and matrix attachment regions.These sequences may be close to the coding region of the gene (e.g., without limitation, within 10 kb) or located at distant sites, and they influence the level or rate of transcription and translation of the gene.

[0075] The term "allele" refers to a variant form of a gene. Some genes have multiple different forms that are located at the same location, or genetic locus, on a chromosome. A diploid organism has two alleles at each genetic locus. Each pair of alleles reflects the genotype of a specific genetic locus. Genotypes are described as homozygous if two identical alleles are found at a particular locus, and as heterozygous if the two alleles are different.

[0076] The "coding region" or "coding sequence" of a gene consists of the portion of the gene's DNA or RNA, consisting of exons, that encodes the protein. The region begins at the start codon at the 5' end and ends at the stop codon at the 3' end.

[0077] A "promoter" is a regulatory region of DNA, typically containing a TATA box, capable of directing RNA polymerase II to initiate RNA synthesis at the appropriate transcription initiation site for a particular polynucleotide sequence. In some cases, a promoter may further comprise other regions that influence the rate of transcription initiation. The promoter sequences disclosed herein modulate the transcription of an operably linked polynucleotide. A promoter may exhibit activity in one or more cell types described herein (e.g., a mouse cell, a rat cell, a pluripotent cell, a single-cell embryo, a differentiated cell, or a combination thereof).A promoter may be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a temporally restricted promoter (e.g., a developmentally regulated promoter), or a spatially restricted promoter (e.g., a cell-specific or tissue-specific promoter). Examples of promoters can be found, for example, in WO 2013 / 176772, which is incorporated herein by reference in its entirety for all purposes.

[0078] The term "functional linkage" or "functionally linked" includes the juxtaposition of two or more components (e.g., a promoter and another sequence element) such that both components function normally and allow for the possibility that at least one of the components can mediate a function that affects at least one other of the components. For example, a promoter can be operably linked to a coding sequence if the promoter controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. A functional linkage can include cases where such sequences are located adjacent to each other or act in trans (e.g., a regulatory sequence can act at a distance to control the transcription of the coding sequence).

[0079] "Sequence identity," or "identity," in the context of two polynucleotide or polypeptide sequences, refers to the residues in the two sequences that are the same when the sequences are aligned for maximum match within a specified comparison window. When percentage sequence identity is used in relation to proteins, the residue positions that are not identical often differ by conservative amino acid substitutions, in which amino acid residues are replaced by other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ by conservative amino acid substitutions, the percentage sequence identity may be increased to correct for the conservative nature of the substitution.Sequences distinguished by such conservative substitutions are said to have "sequence similarity" or "similarity." The means for implementing this correction are well known. It typically involves scoring a conservative substitution as a partial rather than a complete mismatch, thereby increasing the percentage of sequence identity. Thus, for example, if an identical amino acid is assigned a score of 1 and a non-conservative substitution is assigned a score of 0, then the conservative substitution is assigned a score between 0 and 1. The score for conservative substitutions is calculated, for example, as implemented in the PC / GENE program (Intelligenetics, Mountain View, California, USA).

[0080] The "percentage of sequence identity" includes a value determined by comparing two optimally aligned sequences (the highest number of completely matching residues) within a comparison window, where a portion of the polynucleotide sequence in the comparison window may contain additions or deletions (i.e., gaps), compared to a reference sequence (which does not contain additions or deletions) for optimal alignment of the two sequences. This percentage is calculated by determining the number of positions at which the same nucleic acid base or the same amino acid residue is present in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity.Unless otherwise stated (e.g., the shorter sequence includes a linked heterologous sequence), the comparison window is the full extent of the shorter of the two sequences being compared.

[0081] Unless otherwise noted, sequence identity / similarity values ​​include those generated using GAP version 10 using the following parameters: % identity and % similarity for the nucleotide sequence using a GAP weight of 50 and a length weight of 3 and the nwsgapdna.cmp scoring matrix; % identity and % similarity for the amino acid sequence using a GAP weight of 8 and a length weight of 2 and the BLOSUM62 scoring matrix; or any equivalent program. An "equivalent program" includes any sequence comparison program that, for any two sequences under consideration, generates an alignment having the same nucleotide or amino acid residue matches and the same percentage sequence identity as the corresponding alignment generated by GAP version 10.

[0082] The term "conservative amino acid substitution" refers to the replacement of an amino acid that is normally present in a given sequence with another amino acid of similar size, charge, or polarity. Examples of conservative substitutions include the replacement of a non-polar (hydrophobic) residue, such as isoleucine, valine, or leucine, with another non-polar residue. Similarly, examples of conservative substitutions include the replacement of one polar (hydrophilic) residue with another, such as the replacement of arginine with lysine and vice versa, the replacement of glutamine with asparagine and vice versa, or the replacement of glycine with serine and vice versa. Additionally, additional examples of conservative substitutions include the replacement of a basic residue, such as lysine, arginine, or histidine, with another residue, or the replacement of one acidic residue, such as aspartic acid or glutamic acid, with another acidic residue.Examples of non-conservative substitutions include the replacement of a non-polar (hydrophobic) amino acid residue, such as isoleucine, valine, leucine, alanine, or methionine, with a polar (hydrophilic) residue, such as cysteine, glutamine, glutamic acid, or lysine, and / or the replacement of a polar residue with a non-polar residue. A typical classification of amino acids is summarized below.

[0084] The term "homologous" sequence (e.g., a nucleic acid sequence) includes a sequence that is either identical or substantially similar to a known reference sequence such that it is, for example, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the known reference sequence. Homologous sequences may include, for example, an orthologous sequence and paralogous sequences. Homologous genes, for example, are usually descended from a common ancestral DNA sequence either as a result of a speciation event (orthologous genes) or as a result of a genetic duplication event (paralogous genes)."Orthologous" genes include genes from different species that evolved from a common ancestral gene through speciation. Orthologs typically retain the same function during evolution. "Paralogous" genes include genes associated with genomic duplication. Paralogs may develop new functions during evolution.

[0085] The term "in vitro" includes artificial environments and processes or reactions that occur in an artificial environment (e.g., in a test tube or in an isolated cell or cell line). The term "in vivo" includes natural environments (e.g., an organism or body, or a cell or tissue within an organism or body) and processes or reactions that occur in a natural environment. The term "ex vivo" includes cells that have been removed from the body of an individual, as well as processes or reactions that occur in such cells.

[0086] Compositions or methods “comprising” or “including” one or more listed elements may include other elements not specifically listed. For example, a composition that “comprises” or “includes” a protein may contain the protein alone or in combination with other ingredients. The transitional phrase “consisting essentially of” means that the scope of a claim should be interpreted as including the specific elements recited in the claim, as well as elements that do not materially affect the basic and novel feature(s) of the claimed invention. Thus, the term “consisting essentially of,” when used in a claim of the present invention, is not intended to be interpreted as equivalent to the term “comprising.”

[0087] "Optional" or "optional" means that the event or circumstance described may or may not occur and that the description includes cases in which the event or circumstance occurs and cases in which the event or circumstance does not occur.

[0088] A range designation includes all integers within the range, or all integers defining the range, and all subranges defined by integers within the range.

[0089] Unless otherwise obvious from the context, the term “about” covers values ​​±5% of the stated value.

[0090] The term "and / or" refers to combinations of one or more related listed elements and covers all possible such combinations, as well as the absence of combinations when interpreted in terms of the alternative ("or").

[0091] The term "or" refers to any member of a particular list.

[0092] Singular forms include their corresponding plural forms unless the context clearly dictates otherwise. For example, the terms "protein" or "at least one protein" may include multiple proteins, including mixtures thereof.

[0093] “Statistically significant” means p≤0.05.DETAILED DESCRIPTION OF THE SUMMARY OF THE INVENTIONI. Overview

[0094] Tau reporter compositions, tau reporter cells, and tau reporter animals are provided, which comprise a tau protein isoform with four repeats (4R) linked to a first reporter protein and a tau protein isoform with three repeats (3R) linked to a second reporter protein that is different from the first reporter protein. Methods for producing such tau reporter cells and tau reporter animals and using such tau reporter cells and tau reporter animals to evaluate the activity of reagents targeting tau protein are provided.

[0095] Human Gai MART encodes six different tau isoforms: 2N4R, 1N4R, 0N4R, 2N3R, 1N3R, and 0N3R. The difference between transcripts containing 4R (with 4 repeats) and 3R (with 3 repeats) tau is due to the inclusion (4R) or exclusion (3R) of exon 10. In humans, 3R and 4R tau are usually expressed in equal proportions. In some tauopathies, such as Alzheimer's disease, experimental data from postmortem studies of brain tissue indicate that insoluble tau aggregates consist of both 3R and 4R tau. In rarer tauopathies, such as progressive supranuclear palsy (PSP) and corticobasal degeneration (CBD), 4R tau proteins represent aggregation-prone forms of tau. The underlying mechanisms for the formation of these differentiated aggregate types in these diseases are unknown.Therapies targeting total tau (eg, 3R+4R tau) compared to 4R tau alone may have beneficial effects in a variety of disease conditions.

[0096] One of the major challenges to date is the development of assays for measuring mRNA for different tau isoforms. For example, the tau "R / repeat" domain complicates the design of TaqMan primer-probe pairs to measure 3R tau. This lack of assays for measuring specific tau isoforms makes it difficult to accurately test the specificity of reagents (e.g., siRNAs) that target only 4R tau and not 3R tau, compared to reagents (e.g., siRNAs) that target both tau proteins (e.g., a strategy targeting total tau).

[0097] Tau protein reporters, tau reporter cells, and non-human tau reporter animals are able to identify compounds (e.g., siRNA or gRNA) that target total tau protein compared to compounds that specifically target 4R tau protein. Until now, screening for 4R-Tay-specific reagents, such as siRNA, has been impossible due to the lack of protein and mRNA assays for specifically measuring 3R tau protein. II. Compositions containing 3R tau and 4R tau protein reporters

[0098] The present document provides compositions comprising tau protein 3R and tau protein 4R reporters that can be used in assays to distinguish between a tau protein-targeting reagent that specifically or selectively targets tau protein 4R, compared to reagents that target both tau protein 4R and tau protein 3R.

[0099] Tau protein is an intracellular microtubule-associated protein that binds to and stabilizes microtubules. It is predominantly expressed in neurons. Tau protein plays a role in stabilizing neuronal microtubules and thus promotes axonal outgrowth. In Alzheimer's disease (AD) and a family of related neurodegenerative diseases called tauopathies, tau protein is abnormally hyperphosphorylated and aggregated into filament bundles (paired helical threads) that manifest as neurofibrillary tangles. Tauopathies are a group of heterogeneous neurodegenerative pathologies characterized by the deposition of abnormal tau protein in the brain. The burden of tau tangles positively correlates with cognitive decline and neuronal death. In Alzheimer's disease (AD), extracellular beta-amyloid triggers the aggregation of 3R and 4R tau protein isoforms (secondary tauopathy), leading to cognitive decline.In primary tauopathies, tau protein isoforms aggregate differentially due to unknown causes / triggers. For example, 4R aggregates are associated with progressive supranuclear palsy (PSP) and corticobasal degeneration (CBD), while 3R aggregates are associated with Pick's disease.

[00100] Tau protein is encoded by the MAPT gene, which contains 16 exons. Exons 0 and 1 encode the 5'-untranslated region (UTR) of MAPT mRNA, while exon 14 encodes part of the 3'-untranslated region (UTR). Exons 4a, 6, and 8 are transcribed only in peripheral tissues. Exons 2 and 3 encode 29-amino acid insertions near the amino terminus (N1 and N2), and exons 9–12 encode microtubule-binding domain (MTBD) repeats near the carboxyl terminus (R1–R4). Alternative splicing of MAPT results in six isoforms ranging from amino acids 352 to 441.Tau protein isoforms differ and are named based on the number of amino-terminal insertions (0N, IN, and 2N) and the number of repeats of the carboxy-terminal microtubule-binding domain (3R and 4R). Depending on splicing, the repeat-containing domain of tau protein contains either three or four repeated regions that make up the aggregation-prone core of the protein, often referred to as the repeat-containing domain (RD). The three four-repeat (4R) tau isoforms are 2N4R, 1N4R, and 0N4R. The three three-repeat (3R) tau isoforms are 2N3R, 1N3R, and 0N3R.

[00101] The composition described herein may comprise a 4R tau protein isoform associated with a first reporter protein and a 3R tau protein isoform associated with a second reporter protein that is different from the first reporter protein.Alternatively, the composition described herein may comprise a first nucleic acid encoding a 4R tau protein isoform linked to a first reporter protein, and a second nucleic acid encoding a 3R tau protein isoform linked to a second reporter protein. By "linked" is meant that the tau protein isoform and the linked reporter protein are part of the same protein (i.e., a fusion protein) or are expressed from the same messenger RNA. In a fusion protein, the tau protein isoform and the reporter protein may be directly fused to each other or may be fused to each other via a linker. In a specific example, the tau protein isoform and the linked reporter protein are fused to each other via a linker.In a first example, the composition may comprise a first fusion protein comprising a 4R tau protein isoform fused to a first reporter protein, and a second fusion protein comprising a 3R tau protein isoform fused to a second reporter protein that differs from the first reporter protein. For example, the composition may comprise a first nucleic acid (e.g., an expression cassette) encoding the first fusion protein, and a second nucleic acid (e.g., an expression cassette) encoding the second fusion protein.In a second example, the composition may comprise a first nucleic acid (e.g., an expression cassette) comprising a coding sequence for the 4R tau protein isoform and a coding sequence for a first reporter protein, and a second nucleic acid (e.g., an expression cassette) comprising a coding sequence for the 3R tau protein isoform and a coding sequence for a second reporter protein that differs from the first reporter protein, wherein the coding sequence for the 4R tau protein isoform and the coding sequence for the first reporter protein are separated by a coding sequence for the first 2A peptide, and the coding sequence for the 3R tau protein isoform and the coding sequence for the second reporter protein are separated by a coding sequence for the second 2A peptide.

[00102] These 2A peptides are small "self-cleaving" peptides, typically 18-22 amino acids in length, that produce equimolar levels of multiple genes from the same mRNA. Ribosomes skip synthesis of the glycyl-prolyl peptide bond at the C-terminus of the 2A peptide, resulting in a "cleavage" between the 2A peptide and its immediately downstream peptide. See, e.g., Kim et al. (2011) PLoS One 6(4): e18556, incorporated herein by reference in its entirety for all purposes. The "cleavage" occurs between the glycine and proline residues found at the C-terminus, meaning that the upstream cistron will have several extra residues added to the end, while the downstream cistron will start with a proline. As a result, the "cleaved" peptide located downstream has a proline at its N-terminus. 2A-mediated cleavage is a universal phenomenon in all eukaryotic cells.2A peptides have been identified in picornaviruses, insect viruses, and rotavirus type C. See, e.g., Szymczak et al. (2005) Expert Opin. Biol. Ther. 5(5):627–638, which is incorporated herein by reference in its entirety for all purposes. Examples of 2A peptides that can be used include Thoseaasigna virus 2A (T2A); porcine teschovirus-1 2A (P2A); equine rhinitis virus A (ERAV) 2A (E2A), and FMDV 2A (F2A). Exemplary sequences of T2A, P2A, E2A, and F2A include the following: T2A (EGRGSLLTCGDVEENPGP; SEQ ID NO: 9); P2A (ATNFSLLKQAGDVEENPGP; SEQ ID NO: 10); E2A (QCTNYALLKLAGDVESNPGP; SEQ ID NO: 11) and F2A (VKQTLNFDLLKLAGDVESNPGP; SEQ ID NO: 12). GSG residues can be added to the 5' end of either of these peptides to improve cleavage efficiency. In this example, P2A is used.

[00103] In a composition comprising a first nucleic acid and a second nucleic acid, such nucleic acids may be RNA (e.g., messenger RNA (mRNA)) or DNA, may be single-stranded or double-stranded, and may be linear or circular. The DNA may be part of a vector, such as an expression vector or a targeting vector. The vector may also be a viral vector, such as an adenovirus, adeno-associated virus, lentivirus, and retrovirus vectors.

[00104] Optionally, the nucleic acids may be codon-optimized for efficient translation into protein in a particular cell or organism.For example, a nucleic acid can be modified to replace codons that are more frequently used in a human cell, a non-human cell, a mammalian cell, a rodent cell, a mouse cell, a rat cell, a bacterial cell, a yeast cell, or any other host cell of interest compared to a naturally occurring polynucleotide sequence.

[00105] The compositions described herein can exist in vitro, they can exist within a cell (e.g., an embryonic stem cell), or they can exist in a non-human animal. The cell can be any type of cell from any organism, such as an embryonic stem cell (e.g., a mouse or rat embryonic stem cell) or an induced pluripotent stem cell (e.g., a human induced pluripotent stem cell).A non-human animal may be any suitable non-human animal as further described herein.

[00106] The nucleic acids or expression cassettes may be stably integrated into the genome (i.e., into a chromosome) of a non-human cell or animal, or they may be located outside the chromosome (e.g., extrachromosomally replicating DNA). Stably integrated expression cassettes or nucleic acids may be randomly integrated into the genome of a non-human cell or animal (i.e., transgenic), or they may be integrated into a predetermined region of the genome of a non-human cell or animal (i.e., by knockin). In one example, the nucleic acid or expression cassette is stably integrated into a safe harbor locus as described herein.The target genomic locus into which the nucleic acid or expression cassette is stably integrated may be heterozygous for the nucleic acid or expression cassette or homozygous for the nucleic acid or expression cassette.

[00107] The nucleic acid or expression cassette described herein may be operably linked to any suitable promoter for expression in vivo in a cell of a non-human animal, or in vitro or ex vivo in a cell. The non-human animal may be any suitable non-human animal as described herein. As one example, the nucleic acid or expression cassette may be operably linked to an endogenous promoter at the target genomic locus, such as the Rosa26 promoter.Alternatively, the nucleic acid or expression cassette may be operably linked to an exogenous promoter, such as a constitutively active promoter (e.g., a CAG promoter), a conditional promoter, an inducible promoter, a temporally restricted promoter (e.g., a developmentally regulated promoter), or a spatially restricted promoter (e.g., a cell- or tissue-specific promoter). Such promoters are well known and described herein. Promoters that can be used in the expression construct include promoters active in, for example, one or more of a eukaryotic cell, a human cell, a non-human cell, a mammalian cell, a non-human mammalian cell, a rodent cell, a mouse cell, a rat cell, a hamster cell, a rabbit cell, a pluripotent cell, an embryonic stem (ES) cell, or a zygote.Such promoters may be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters.

[00108] The nucleic acids and expression cassettes described herein may be in any form. For example, an expression cassette may be in a vector or plasmid, such as a viral vector. The expression cassette may be operably linked to a promoter in an expression construct capable of directing the expression of a protein or RNA. Alternatively, the expression cassette may be in a targeting vector. For example, the targeting vector may contain homology arms flanking the expression cassette, wherein the homology arms are suitable for directing recombination with the desired target genomic locus to facilitate genomic integration and / or replacement of the endogenous sequence.

[00109] When the composition described herein is in a non-human cell or animal, the composition may comprise a first nucleic acid (e.g., an expression cassette) encoding a first fusion protein and a second nucleic acid (e.g., an expression cassette) encoding a second fusion protein, and the first fusion protein and the second fusion protein may be stably expressed in the non-human cell or animal. For example, the first nucleic acid (e.g., an expression cassette) and the second nucleic acid (e.g., an expression cassette) may be integrated into the genome of a non-human cell or animal and operably linked to promoters active in the non-human cell or animal. For example, the first nucleic acid and the second nucleic acid may be integrated into the genome of the germline of a non-human animal.Similarly, when the composition described herein is in a cell or in a non-human animal, the composition may comprise a first nucleic acid (e.g., an expression cassette) comprising a coding sequence for the 4R tau protein isoform and a coding sequence for a first reporter protein (e.g., separated by a first 2A coding sequence), and a second nucleic acid (e.g., an expression cassette) comprising a coding sequence for the 3R tau protein isoform and a coding sequence for a second reporter protein (e.g., separated by a second 2A coding sequence), and the 4R tau protein isoform, the first reporter protein, the 3R tau protein isoform and the second reporter protein can be stably expressed in a cell or non-human animal.For example, a first nucleic acid (e.g., an expression cassette) and a second nucleic acid (e.g., an expression cassette) can be integrated into the genome of a non-human cell or animal and operably linked to promoters active in the non-human cell or animal. For example, the first nucleic acid and the second nucleic acid can be integrated into the genome of the germline of a non-human animal. The nucleic acids (e.g., expression cassettes) can be randomly integrated into the genome of a non-human cell or animal, or they can be integrated at a target genomic locus, such as a safe harbor locus. Any target genomic locus capable of expressing the gene can be used. The promoter can be any suitable promoter. For example, the promoter can be a constitutive promoter, such as the EF1 alpha promoter.Alternatively, the promoter may be a tissue-specific promoter or an inducible promoter. For example, the promoter may be a neuron-specific promoter. One example of a suitable neuron-specific promoter is the synapsin-1 promoter (e.g., the human synapsin-1 promoter).

[00110] An example of a target genomic locus into which the nucleic acids or expression cassettes described herein can be stably integrated is a "safe harbor" locus in the genome of a cell or non-human animal. Interactions between the integrated exogenous DNA and the host genome may limit the reliability and safety of integration and may result in pronounced phenotypic effects that arise not from the targeted genetic modification, but from unintended effects of the integration on surrounding endogenous genes.For example, randomly inserted transgenes may be subject to positional effects and silencing, making their expression unreliable and unpredictable. Similarly, integration of exogenous DNA into a chromosomal locus may affect surrounding endogenous genes and chromatin, thereby altering cellular behavior and phenotypes. Safe harbor loci include chromosomal loci in which transgenes or other exogenous nucleic acid inserts can be stably and reliably expressed in all tissues of interest without significantly altering cellular behavior or phenotype (i.e., without any adverse effect on the host cell). See, e.g., Sadelain et al. (2012) Nat. Rev. Cancer 12:51 58, which is incorporated herein by reference in its entirety for all purposes.For example, a safe harbor locus may be a locus at which expression of the inserted gene sequence is not disrupted by any "pass-through" expression from adjacent genes. For example, safe harbor loci may include chromosomal loci at which exogenous DNA can integrate and function in a predictable manner without adversely affecting the structure or expression of the endogenous gene. Safe harbor loci may include extragenic regions or intragenic regions, such as loci in genes that are not essential, are dispensable, or can be disrupted without significant phenotypic consequences.

[00111] For example, the Rosa26 locus and its human equivalent have an open chromatin configuration in all tissues and are ubiquitously expressed during embryonic development and in adults. See, for example, Zambrowicz et al. (1997) Proc. Natl. Acad. Sci.USA 94:3789-3794, which is incorporated herein by reference in its entirety for all purposes. Furthermore, the Rosa26 locus can be targeted with high efficiency, and disruption of the Rosa26 gene does not result in an overt phenotypic change. Other examples of safe harbor loci include CCR5, HPRT, AAVS1, and albumin. See, e.g., U.S. Patent Nos. 7,888,121; 7,972,854; 7,914,796; 7,951,925; 8,110,379; 8,409,861; 8,586,526 and U.S. Patent Publication Nos. 2003 / 0232410; 2005 / 0208489; 2005 / 0026157; 2006 / 0063231; 2008 / 0159996; 2010 / 00218264; 2012 / 0017290; 2011 / 0265198; 2013 / 0137104; 2013 / 0122591; 2013 / 0177983; 2013 / 0177960 and 2013 / 0122591, each of which is incorporated herein in its entirety by reference for all purposes. Biallelic targeting of safe harbor loci such as the Rosa26 locus has no negative consequences, so different genes or reporters can be targeted to the two Rosa26 alleles.

[00112] Expression cassettes integrated into a target genomic locus may be operably linked to an endogenous promoter at the target genomic locus or may be operably linked to an exogenous promoter heterologous to the target genomic locus.

[00113] The compositions described herein may comprise a vector (e.g., a viral vector) comprising a first nucleic acid (e.g., an expression cassette) and a second nucleic acid (e.g., an expression cassette), or a first vector (e.g., a viral vector) comprising a first nucleic acid (e.g., an expression cassette) and a second vector (e.g., a viral vector) comprising a second nucleic acid (e.g., an expression cassette).

[00114] The vector may comprise additional sequences, such as, for example, origins of replication, promoters, and genes encoding antibiotic resistance. Some vectors may be circular.Alternatively, the vector may be linear. Non-limiting examples of vectors include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, transposons, viral vectors, and expression vectors. The term "viral vector" refers to a recombinant nucleic acid that includes at least one element of viral origin and includes elements sufficient for or permitting packaging into a viral vector particle. The vector and / or particle can be used to transfer DNA, RNA, or other nucleic acids into cells in vitro, ex vivo, or in vivo. Numerous forms of viral vectors are known. A viral vector can be, for example, an adeno-associated virus (AAV) vector or a lentiviral vector (LV) (i.e., a recombinant AAV vector or a recombinant LV vector). Other illustrative viruses / viral vectors include retroviruses, adenoviruses, vaccinia viruses, poxviruses, and herpes simplex viruses.Viruses can infect dividing cells, non-dividing cells, or both dividing and non-dividing cells. Viruses can integrate into the host genome or, alternatively, fail to integrate into the host genome. Such viruses can also be engineered to have reduced immunity. Viruses can be replication-competent or replication-defective (e.g., defective in one or more genes required for additional rounds of replication and / or virion packaging). Viruses can induce transient expression, long-term expression (e.g., at least 1 week, 2 weeks, 1 month, 2 months, or 3 months), or persistent expression.

[00115] In one example, the nucleic acid or expression construct is in an AAV vector. The AAV may be of any suitable serotype and may be single-chain AAV (ssAAV) or self-complementary AAV (scAAV).The AAV ssDNA genome consists of two open reading frames, Rep and Cap, flanked by two inverted terminal repeats that mediate the synthesis of the complementary DNA strand. When constructing an AAV transfer plasmid, the transgene is placed between the two ITRs, and Rep and Cap can be in trans. In addition to Rep and Cap, AAV may require a helper plasmid containing adenovirus genes. These genes (E4, E2a, and VA) mediate AAV replication. For example, the transfer plasmid, Rep / Cap, and the helper plasmid can be transfected into HEK293 cells containing the adenovirus E1+ gene to produce infectious AAV particles. Alternatively, Rep, Cap, and the adenovirus helper genes can be combined in a single plasmid. Similar packaging cells and methods can be used for other viruses, such as retroviruses.

[00116] Several serotypes of AAV have been identified. These serotypes differ in the types of cells they infect (i.e.,(their tropism), allowing for selective transduction of specific cell types. Serotypes for CNS tissues include AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9. The selectivity of AAV serotypes for gene delivery in neurons is described, for example, in Hammond et al. (2017) PLoS One 12(12): e0188830, the entire contents of which are incorporated herein by reference for all purposes. In a specific example, the AAV-PHP.eB vector is used. The AAV-PHP.eB vector exhibits high ability to cross the blood-brain barrier, increasing the efficiency of CNS transduction. In a specific example, the AAV9 vector is used.

[00117] Tropism can be further refined using pseudotyping, which is a mixture of the capsid and genome of different viral serotypes. For example, AAV2 / 5 refers to a virus containing the genome of serotype 2 packaged within a capsid from serotype 5. The use of pseudotyped viruses can improve transduction efficiency and also alter tropism.Hybrid capsids derived from different serotypes can also be used to alter viral tropism. For example, AAV-DJ contains a hybrid capsid from eight serotypes and exhibits high infectivity across a wide range of cell types in vivo. AAV-DJ8 is another example that displays the properties of AAV-DJ but with enhanced uptake in the brain. AAV serotypes can also be modified through mutations. Examples of AAV2 mutational modifications include Y444F, Y500F, Y730F, and S662V. Examples of AAV3 mutational modifications include Y705F, Y731F, and T492V. Examples of AAV6 mutational modifications include S663V and T492V. Other pseudotyped / modified AAV variants include AA V2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5, AAV8.2, and AAV / SASTG.

[00118] Self-complementary AAV variants (scAAV) can be used to accelerate transgene expression.Because AAV relies on the cellular DNA replication machinery to synthesize the complementary strand of the genome as single-stranded AAV DNA, transgene expression may be delayed. To overcome this delay, scAAVs containing complementary sequences that are capable of spontaneous annealing upon infection can be used, eliminating the need for host cell DNA synthesis. However, single-stranded AAV (ssAAV) vectors can also be used.

[00119] The 4R and 3R tau protein isoforms in the compositions can be obtained from any animal or mammal, such as a human, mouse, or rat. In a specific example, the 4R and 3R tau protein isoforms are human. The 4R and 3R tau protein isoforms can also be any combination of the 4R and 3R tau protein isoforms, respectively. In one example, the tau protein 4R isoform is the 2N4R isoform.For example, the 4R tau protein isoform may comprise the sequence presented in SEQ ID NO: 13, optionally wherein the 4R tau protein isoform is encoded by the sequence presented in SEQ ID NO: 17. For example, in compositions in which the 4R tau protein isoform is fused to a first reporter protein, the fusion protein may comprise the sequence presented in SEQ ID NO: 15, optionally wherein the fusion protein is encoded by the sequence presented in SEQ ID NO: 19. In another example, the 4R tau protein isoform is 1N4R. For example, the 4R tau protein isoform may comprise a sequence as set forth in SEQ ID NO: 23, 27, 31, or 47, and optionally the 4R tau protein isoform is encoded by a sequence as set forth in SEQ ID NO: 25, 29, 33, or 48, respectively.For example, in compositions in which the 4R tau isoform is fused to a first reporter protein, the fusion protein may comprise the sequence shown in SEQ ID NO: 35, optionally wherein the fusion protein is encoded by the sequence shown in SEQ ID NO: 36. For example, in compositions in which the 4R tau isoform is fused to a first reporter protein, the fusion protein may comprise the sequence shown in SEQ ID NO: 37, optionally wherein the fusion protein is encoded by the sequence shown in SEQ ID NO: 38. For example, in compositions in which the 4R tau isoform is fused to a first reporter protein, the fusion protein may comprise the sequence shown in SEQ ID NO: 39, optionally wherein the fusion protein is encoded by the sequence shown in SEQ ID NO: 40.

[00120] In one example, the 3R tau isoform is the 2N3R isoform.For example, the 3R tau protein isoform may comprise the sequence presented in SEQ ID NO: 14, optionally wherein the 3R tau protein isoform is encoded by the sequence presented in SEQ ID NO: 18. For example, in compositions in which the 3R tau protein isoform is fused to a second reporter protein, the fusion protein may comprise the sequence presented in SEQ ID NO: 16, optionally wherein the fusion protein is encoded by the sequence presented in SEQ ID NO: 20. In another example, the 4R tau protein isoform is 1N3R. For example, the 3R tau protein isoform may comprise a sequence as set forth in SEQ ID NO: 24, 28, 32, or 49, and optionally the 3R tau protein isoform is encoded by a sequence as set forth in SEQ ID NO: 26, 30, 34, or 50, respectively.For example, in compositions in which the 3R tau isoform is fused to a second reporter protein, the fusion protein may comprise the sequence shown in SEQ ID NO: 41, optionally wherein the fusion protein is encoded by the sequence shown in SEQ ID NO: 42. For example, in compositions in which the 3R tau isoform is fused to a second reporter protein, the fusion protein may comprise the sequence shown in SEQ ID NO: 43, optionally wherein the fusion protein is encoded by the sequence shown in SEQ ID NO: 44. For example, in compositions in which the 3R tau isoform is fused to a second reporter protein, the fusion protein may comprise the sequence shown in SEQ ID NO: 45, optionally wherein the fusion protein is encoded by the sequence shown in SEQ ID NO: 46.

[00121] In one specific example, the 4R tau isoform is the 2N4R isoform, and the 3R tau isoform is the 2N3R isoform.For example, the 4R tau protein isoform may comprise the sequence presented in SEQ ID NO: 13, and the 3R tau protein isoform may comprise the sequence presented in SEQ ID NO: 14 (optionally encoded by SEQ ID NOs: 17 and 18, respectively). For example, the 4R tau protein isoform may be fused to a first reporter protein, and the fusion protein may comprise the sequence presented in SEQ ID NO: 15, and the 3R tau protein isoform may be fused to a second reporter protein, and the fusion protein may comprise the sequence presented in SEQ ID NO: 16 (optionally encoded by SEQ ID NOs: 19 and 20, respectively). In another specific example, the 4R tau protein isoform is the 1N4R isoform, and the 3R tau protein isoform is the 1N3R isoform.For example, the 4R tau protein isoform may comprise the sequence presented in SEQ ID NO: 23, and the 3R tau protein isoform may comprise the sequence presented in SEQ ID NO: 24 (optionally encoded by SEQ ID NOs: 25 and 26, respectively). For example, the 4R tau protein isoform may comprise the sequence presented in SEQ ID NO: 27, and the 3R tau protein isoform may comprise the sequence presented in SEQ ID NO: 28 (optionally encoded by SEQ ID NOs: 29 and 30, respectively). For example, the 4R tau protein isoform may comprise the sequence presented in SEQ ID NO: 31, and the 3R tau protein isoform may comprise the sequence presented in SEQ ID NO: 32 (optionally encoded by SEQ ID NOs: 33 and 34, respectively).For example, the 4R tau protein isoform may comprise the sequence presented in SEQ ID NO: 47, and the 3R tau protein isoform may comprise the sequence presented in SEQ ID NO: 49 (optionally encoded by SEQ ID NOs: 48 and 50, respectively). For example, the 4R tau protein isoform may be fused to a first reporter protein, and the fusion protein may comprise the sequence presented in SEQ ID NO: 35, and the 3R tau protein isoform may be fused to a second reporter protein, and the fusion protein may comprise the sequence presented in SEQ ID NO: 41 (optionally encoded by SEQ ID NOs: 36 and 42, respectively).For example, the 4R tau protein isoform can be fused to a first reporter protein, and the fusion protein can comprise the sequence presented in SEQ ID NO: 37, and the 3R tau protein isoform can be fused to a second reporter protein, and the fusion protein can comprise the sequence presented in SEQ ID NO: 43 (optionally encoded by SEQ ID NOs: 38 and 44, respectively). For example, the 4R tau protein isoform can be fused to a first reporter protein, and the fusion protein can comprise the sequence presented in SEQ ID NO: 39, and the 3R tau protein isoform can be fused to a second reporter protein, and the fusion protein can comprise the sequence presented in SEQ ID NO: 45 (optionally encoded by SEQ ID NOs: 40 and 46, respectively). In addition to the 2N4R / 2N3R and 1N4R / 1N3R combinations described above, any other combination may be used (e.g. 0N4R / 0N3R, 0N4R / 1N3R, 0N4R / 2N3R, 1N4R / 0N3R, 1N4R / 1N3R, 1N4R / 2N3R, 2N4R / 0N3R, 2N4R / 1N3R, or 2N4R / 2N3R).

[00122] The 4R and / or 3R tau protein isoforms may be wild-type. Alternatively, the 4R and / or 3R tau protein isoforms may comprise a tau-pathogenic mutation, such as a pro-aggregation mutation. Such a mutation may be, for example, a mutation that is associated with (e.g., segregates with) a tauopathy or causes a tauopathy. In one example, the mutation may be an aggregation-sensitizing mutation that sensitizes tau protein to sedimentation, but does not cause tau protein to readily aggregate on its own, or it may be a mutation that is known to cause aggregation of both 3R tau protein and 4R tau protein. For example, the tau protein mutation may be R5L, L237V, or G243V.R5L is a mutation reported in a patient with PSP (although it is present in all six tau isoforms, selective aggregation of only 4R tau is observed in human carriers), while G243V and L237V are mutations reported to selectively exacerbate 4R aggregation. An R5L mutation refers to the R5L mutation in human tau or the corresponding mutation in another tau protein in optimal alignment with human tau. An L237V mutation refers to the L237V mutation in human tau or the corresponding mutation in another tau protein in optimal alignment with human tau. A G243V mutation refers to the G243V mutation in human tau or the corresponding mutation in another tau protein in optimal alignment with human tau. In one example, both the 4R and 3R tau isoforms contain the R5L mutation. In one example, both the 4R and 3R tau isoforms contain the L237V mutation.In one example, both the 4R and 3R tau isoforms contain the G243V mutation. In another example, the tau mutation could be N279K, L284R, or S285R. All of these are exon 10 mutants that have been reported in individuals with PSP-like symptoms and pathology. The N279K mutation refers to the N279K mutation in human tau or the corresponding mutation in another tau protein with optimal alignment to human tau. The L284R mutation refers to the L284R mutation in human tau or the corresponding mutation in another tau protein with optimal alignment to human tau. The S285R mutation refers to the S285R mutation in human tau or the corresponding mutation in another tau protein optimally aligned with human tau. In one example, both the 4R and 3R tau isoforms contain the N279K mutation. In one example, both the 4R and 3R tau isoforms contain the L284R mutation.In one example, both the 4R tau isoform and the 3R tau isoform contain the S285R mutation.

[00123] The first and second reporter proteins may be any suitable reporter proteins encoded by any suitable reporter gene. The term "reporter gene" refers to a nucleic acid having a sequence encoding a gene product (usually an enzyme) that is readily and quantitatively assayable upon introduction of a construct containing the reporter gene sequence operably linked to a heterologous promoter and / or enhancer element into cells that contain (or can be modified to contain) factors necessary for activating the promoter and / or enhancer elements.Examples of reporter genes include, but are not limited to, genes encoding beta-galactosidase (lacZ), bacterial chloramphenicol acetyltransferase (cat) genes, firefly luciferase genes, genes encoding beta-glucuronidase (GUS), and genes encoding fluorescent proteins. "Reporter protein" refers to a protein encoded by a reporter gene. In a specific example, the first and second reporter proteins are fluorescent reporter proteins.

[00124] The term "fluorescent reporter protein" as used herein means a reporter protein that can be detected by fluorescence, wherein the fluorescence can originate either directly from the reporter protein, or as a result of the action of the reporter protein on a fluorogenic substrate, or from a protein with binding affinity to a fluorescently labeled compound.Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, monomeric Azami Green, CopGFP, AceGFP, and ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, and ZsYellowl), blue fluorescent proteins (e.g., BFP, eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, and T-sapphire), cyan fluorescent proteins (e.g., CFP, eCFP, Cerulean, CyPet, AmCyanl, and Midoriishi-Cyan), red fluorescent proteins (e.g., RFP, mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed monomer, HcRed tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry, and Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, monomeric Kusabira-Orange, mTangerine, and tdTomato), and any other suitable fluorescent protein whose presence in cells can be detected by flow cytometry.In a specific example, the first and second reporter proteins are a yellow fluorescent protein (e.g., eYFP) and a red fluorescent protein (e.g., mCherry), respectively, or vice versa.

[00125] The present document also provides a cell or population of cells comprising the compositions described herein. The cells may be any type of cell and may be in vitro, ex vivo, or in vivo. The cell or population of cells may be a monoclonal cell line or population of cells. The cell may be from any source. For example, the cell may be a eukaryotic cell, an animal cell, a plant cell, or a fungal (e.g., yeast) cell. Such cells may be fish cells or avian cells, or such cells may be mammalian cells, such as human cells, non-human mammalian cells, rodent cells, mouse cells, or rat cells.Mammals include, for example, humans, non-human primates, monkeys, apes, cats, horses, bovines, deer, bison, sheep, rodents (e.g., mice, rats, hamsters, guinea pigs), and livestock (e.g., ruminants such as cows and oxen; bovids such as sheep and goats; and pigs such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese, and ducks. Also included are domestic animals and farm animals. The term "non-human animal" excludes humans. In a specific example, the cells are human cells (e.g., HEK293 cells).

[00126] The cell may be, for example, a totipotent cell or a pluripotent cell (e.g., an embryonic stem (ES) cell, such as a rodent ES cell, a mouse ES cell, or a rat ES cell).Totipotent cells include undifferentiated cells that can give rise to any cell type, while pluripotent cells include undifferentiated cells that have the capacity to develop into more than one differentiated cell type. Such pluripotent and / or totipotent cells may be, for example, ES cells or ES-like cells, such as induced pluripotent stem (iPS) cells. ES cells include totipotent or pluripotent cells of embryonic origin that are capable of contributing to the cell population of any tissue of the developing embryo when introduced into the embryo. ES cells may originate from the inner cell mass of the blastocyst and are capable of differentiating into cells of any of the three vertebrate germ layers (endoderm, ectoderm, and mesoderm).

[00127] The cell may also be a primary somatic cell or a cell that is not a primary somatic cell.Somatic cells can include any cell that is not a gamete, germ cell, gametocyte, or undifferentiated stem cell. A cell can also be a primary cell. Primary cells include cells or cell cultures that have been isolated directly from an organism, organ, or tissue. Primary cells include cells that are neither transformed nor immortalized. They include any cell obtained from an organism, organ, or tissue that has not previously been passaged in cell culture or that has previously been passaged in cell culture but is incapable of indefinite passage in cell culture.Such cells can be isolated using conventional techniques and include, for example, somatic cells, hematopoietic cells, endothelial cells, epithelial cells, fibroblasts, mesenchymal cells, keratinocytes, melanocytes, monocytes, mononuclear cells, adipocytes, preadipocytes, neurons, glial cells, hepatocytes, skeletal myoblasts, and smooth muscle cells. For example, primary cells can be derived from connective tissues, muscle tissues, nervous system tissues, or epithelial tissues.

[00128] Also, such cells typically do not proliferate indefinitely, but due to a mutation or alteration, have escaped normal cellular senescence and may instead continue to divide. Such mutations or alterations may occur naturally or be intentionally induced.Examples of immortalized cells include Chinese hamster ovary (CHO) cells, human embryonic kidney cells (e.g., HEK293 cells), and mouse embryonic fibroblast cells (e.g., 3T3 cells). Many types of immortalized cells are well known. Immortalized or primary cells include cells that are commonly used for culturing or for expressing recombinant genes or proteins.

[00129] The cell may also be a differentiated cell, such as a neuronal cell (e.g., a human neuronal cell). The cell may be an isolated cell.

[00130] Also provided herein are non-human animals comprising the compositions described herein. The non-human animals may be any suitable non-human animal.The term "animal" includes any member of the animal kingdom, including, for example, mammals, fish, reptiles, amphibians, birds, and worms. In a specific example, a non-human animal is a non-human mammal. Non-human mammals include, for example, primates and non-human rodents (e.g., mice and rats). The term "non-human animal" excludes humans. Preferred non-human animals include, for example, rodents such as mice and rats.

[00131] Non-human animals may be of any genetic origin. For example, suitable mice may be from the 129 strain, the C57BL / 6 strain, a mixture of the 129 and C57BL / 6 strain, the BALB / c strain, or the Swiss Webster strain. Examples of 129 lineages include 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / Svlm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, and 129T2. See, e.g., Festing et al. (1999) Mamm.Genome 10(8):836, which is incorporated herein by reference in its entirety for all purposes. Examples of C57BL strains include C57BL / A, C57BL / An, C57BL / GrFa, C57BL / Kal_wN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / 01a. Suitable mice can also be derived from a combination of the aforementioned 129 strain and the aforementioned C57BL / 6 strain (e.g., 50% 129 and 50% C57BL / 6). Likewise, suitable mice may be derived from a combination of the above-mentioned 129 strains or from a combination of the above-mentioned BL / 6 strains (e.g., 129S6 (129 / SvEvTac) strain)

[00132] Likewise, rats may be derived from any rat strain, including, for example, the ACI rat strain, the Dark Agouti (DA) rat strain, the Wistar rat strain, the LEA rat strain, the Sprague Dawley (SD) rat strain, or the Fischer rat strain, such as Fisher F344 or Fisher F6. Rats may also be derived from a strain derived from a combination of two or more of the strains listed above.For example, a suitable rat could come from the DA or ACI line. The ACI line of rats is characterized by a black agouti coloration with a white belly and paws and the RT1 haplotype. av1 These strains are available from various sources, including Harlan Laboratories. The dark agouti (DA) rat strain is characterized by the presence of the agouti color pattern and the RT1 haplotype. av1. Such rats are available from various sources, including Charles River and Harlan Laboratories. In some cases, suitable rats may be derived from an inbred strain of rats. See, for example, US 2014 / 0235933, incorporated herein by reference in its entirety for all purposes.III. Tau Reporter Cells and Non-Human Tau Reporter Animals

[00133] Provided herein is a tau reporter cell or population of tau reporter cells that can be used in cell-based screening assays to distinguish between a tau-targeting reagent that specifically or selectively targets tau 4R versus reagents that target both tau 4R and tau 3R. Similarly, this document provides non-human tau reporter animals that can be used in in vivo screening assays to distinguish between a tau-targeting reagent that specifically or selectively targets tau 4R,compared to reagents that target both 4R tau and 3R tau.

[00134] A tau reporter cell or a non-human tau reporter animal may comprise a 4R tau isoform linked to a first reporter protein and a 3R tau isoform linked to a second reporter protein that is different from the first reporter protein. Alternatively, a tau reporter cell or a non-human tau reporter animal may comprise a first nucleic acid encoding a 4R tau isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau isoform linked to a second reporter protein. By "linked" is meant,The tau protein isoform and the associated reporter protein are part of the same protein (i.e., a fusion protein) or are expressed from the same messenger RNA. In the fusion protein, the tau protein isoform and the reporter protein may be directly fused to each other or may be fused to each other via a linker. In a specific example, the tau protein isoform and the associated reporter protein are fused to each other via a linker. In the first example, a tau reporter cell or a tau reporter non-human animal may comprise a first fusion protein comprising the 4R tau protein isoform fused to a first reporter protein and a second fusion protein comprising the 3R tau protein isoform fused to a second reporter protein that is different from the first reporter protein. For example, a cell or non-human animal may comprise a first nucleic acid (e.g., an expression cassette) encoding a first fusion protein and a second nucleic acid (e.g.,an expression cassette) encoding a second fusion protein, wherein the cell or non-human animal expresses the first fusion protein and the second fusion protein. In a second example, a tau reporter cell or non-human tau reporter animal may comprise a first nucleic acid (e.g., an expression cassette) comprising a coding sequence for the 4R isoform of tau protein and a coding sequence for a first reporter protein and a second nucleic acid (e.g., an expression cassette) comprising a coding sequence for the 3R isoform of tau protein and a coding sequence for a second reporter protein that is different from the first reporter protein, wherein the coding sequence for the 4R isoform of tau protein and the coding sequence for the first reporter protein are separated by a coding sequence for the first 2A peptide,and the coding sequence for the 3R tau isoform and the coding sequence for the second reporter protein are separated by the coding sequence for a second 2A peptide, and wherein the non-human cell or animal expresses the 4R tau isoform, the 3R tau isoform, the first reporter protein, and the second reporter protein.

[00135] As described above, examples of 2A peptides that can be used include Thoseaasigna virus peptide 2A (T2A); porcine teschovirus-1 2A (P2A); equine rhinitis virus A (ERAV) 2A (E2A), and FMDV 2A (F2A). Exemplary sequences of T2A, P2A, E2A, and F2A include the following: T2A (EGRGSLLTCGDVEENPGP; SEQ ID NO: 9); P2A (ATNFSLLKQAGDVEENPGP; SEQ ID NO: 10); E2A (QCTNYALLKLAGDVESNPGP; SEQ ID NO: 11) and F2A (VKQTLNFDLLKLAGDVESNPGP; SEQ ID NO: 12). GSG residues can be added to the 5' end of any of these peptides. In a specific example, P2A is used.

[00136] In a tau reporter cell or a tau reporter animal other than humans,comprising a first nucleic acid and a second nucleic acid, such nucleic acids may be RNA (e.g., messenger RNA (mRNA)) or DNA, may be single-stranded or double-stranded, and may be linear or circular. The DNA may be part of a vector, such as an expression vector or a targeting vector. The vector may also be a viral vector, such as an adenovirus, adeno-associated virus, lentivirus, and retrovirus vectors.

[00137] Optionally, the nucleic acids may be codon-optimized for efficient translation into protein in a particular cell or organism. For example, a nucleic acid may be modified to substitute codons that have a higher frequency of usage in a human cell, a non-human cell, a mammalian cell, a rodent cell, a mouse cell, a rat cell, a bacterial cell,yeast cell or any other host cell of interest compared to a naturally occurring polynucleotide sequence.

[00138] The nucleic acids or expression cassettes may be stably integrated into the genome (i.e., into a chromosome) of a non-human cell or animal, or they may be located outside of a chromosome (e.g., extrachromosomally replicating DNA). Stably integrated expression cassettes or nucleic acids may be randomly integrated into the genome of a non-human cell or animal (i.e., transgenic), or they may be integrated into a predetermined region of the genome of a non-human cell or animal (i.e., by knockin). In one example, the nucleic acid or expression cassette is stably integrated at a safe harbor locus as described herein. The target genomic locus into which the nucleic acid or expression cassette is stably integrated ismay be heterozygous for the nucleic acid or expression cassette or homozygous for the nucleic acid or expression cassette.

[00139] The nucleic acid or expression cassette described herein can be operably linked to any suitable promoter for expression in vivo in a cell of a non-human animal, or in vitro or ex vivo in a cell, the non-human animal can be any suitable non-human animal as described herein. As one example, the nucleic acid or expression cassette can be operably linked to an endogenous promoter at a target genomic locus, such as the Rosa26 promoter. Alternatively, the nucleic acid or expression cassette can be operably linked to an exogenous promoter, such as a constitutively active promoter (e.g., a CAG promoter), a conditional promoter, an inducible promoter,a temporally restricted promoter (e.g., a developmentally regulated promoter) or a spatially restricted promoter (e.g., a cell- or tissue-specific promoter). Such promoters are well known and described herein. Promoters that can be used in an expression construct include promoters that are active in, for example, one or more of a eukaryotic cell, a human cell, a non-human cell, a mammalian cell, a non-human mammalian cell, a rodent cell, a mouse cell, a rat cell, a hamster cell, a rabbit cell, a pluripotent cell, an embryonic stem (ES) cell, or a zygote. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters.

[00140] The expression cassettes described herein can be presented in a variety of forms. For example,The expression cassette may be in a vector or plasmid, such as a viral vector. The expression cassette may be operably linked to a promoter in an expression construct capable of directing the expression of a protein or RNA. Alternatively, the expression cassette may be in a targeting vector. For example, the targeting vector may comprise homologous arms flanking the expression cassette, the homologous arms being suitable for directing recombination with a desired target genomic locus to facilitate genomic integration and / or replacement of endogenous sequence.

[00141] The expression cassettes described herein may exist in vitro, they may exist in a cell (e.g., an embryonic stem cell) ex vivo (e.g., integrated into the genome or extrachromosomal), or they may exist in an organism (e.g., a non-human animal) in vivo (e.g.,integrated into the genome or extrachromosomal). In the case of ex vivo, the expression cassette(s) may be in any type of cell from any organism, such as a totipotent cell, such as an embryonic stem cell (e.g., a mouse or rat embryonic stem cell) or an induced pluripotent stem cell (e.g., a human induced pluripotent stem cell). If in vivo, the expression cassette(s) may be in any type of organism (e.g., a non-human animal, as described herein).

[00142] In a tau reporter cell or a tau reporter non-human animal comprising a first nucleic acid (e.g., an expression cassette) encoding a first fusion protein and a second nucleic acid (e.g., an expression cassette) encoding a second fusion protein, the first fusion protein and the second fusion protein can be stably expressed in the cell or animal,non-human. For example, a first nucleic acid (e.g., an expression cassette) and a second nucleic acid (e.g., an expression cassette) can be integrated into the genome of a non-human cell or animal and operably linked to promoters active in the non-human cell or animal. For example, the first nucleic acid and the second nucleic acid can be integrated into the genome in the germline of a non-human animal. Similarly, in a tau reporter cell or non-human animal comprising a first nucleic acid (e.g., an expression cassette) comprising a coding sequence for the 4R isoform of tau protein and a coding sequence for a first reporter protein (e.g., separated by a first 2A coding sequence), and a second nucleic acid (e.g., an expression cassette),comprising a coding sequence for the 3R tau isoform and a coding sequence for a second reporter protein (e.g., separated by a second 2A coding sequence), the 4R tau isoform, the first reporter protein, the 3R tau isoform, and the second reporter protein can be stably expressed in a non-human cell or animal. For example, the first nucleic acid (e.g., expression cassette) and the second nucleic acid (e.g., expression cassette) can be integrated into the genome of a non-human cell or animal and operably linked to promoters active in the non-human cell or animal. For example, the first nucleic acid and the second nucleic acid can be integrated into the genome in the germline of a non-human animal. The nucleic acids (e.g., expression cassettes) can be randomly integrated into the genome of a cell or animal,non-human, or they can be integrated into a target genomic locus, such as a safe harbor locus. Any target genomic locus capable of expressing the gene can be used. The promoter can be any suitable promoter. For example, the promoter can be a constitutive promoter, such as the EF1 alpha promoter. Alternatively, the promoter can be a tissue-specific promoter or an inducible promoter. For example, the promoter can be a neuron-specific promoter. One example of a suitable neuron-specific promoter is the synapsin-1 promoter (e.g., the human synapsin-1 promoter).

[00143] An example of a target genomic locus into which the nucleic acids or expression cassettes described herein can be stably integrated is a safe harbor locus in the genome of a cell or non-human animal. Safe harbor loci are described above. For example,The Rosa26 locus and its human equivalent have an open chromatin configuration in all tissues and are ubiquitously expressed during embryonic development and in adults. Furthermore, the Rosa26 locus can be targeted with high efficiency, and disruption of the Rosa26 gene does not produce an overt phenotypic change. Other examples of safe harbor loci include CCR5, HPRT, AAVS1, and albumin. Biallelic targeting of safe harbor loci such as the Rosa26 locus has no negative consequences, so different genes or reporters can be targeted to the two Rosa26 alleles.

[00144] Expression cassettes integrated into a target genomic locus may be operably linked to an endogenous promoter at the target genomic locus or may be operably linked to an exogenous promoter heterologous to the target genomic locus.

[00145] Alternatively, a tau reporter cell or non-human animal may contain a vector (e.g.,

[00146] Vectors are described in more detail above. Some vectors may be circular. Alternatively, a vector may be linear. Non-limiting examples of vectors include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, transposons, viral vectors, and expression vectors. Viral vectors are described in more detail above. Many forms of viral vectors are known. A viral vector may be, for example,An adeno-associated virus (AAV) vector or a lentiviral vector (LV) (i.e., a recombinant AAV vector or a recombinant LV vector). Other illustrative viruses / viral vectors include retroviruses, adenoviruses, vaccinia viruses, poxviruses, and herpes simplex viruses. Viruses can infect dividing cells, non-dividing cells, or both dividing and non-dividing cells. Viruses can integrate into the host genome or, alternatively, fail to integrate into the host genome. Such viruses can also be engineered to have reduced immunity. Viruses can be replication-competent or replication-defective (e.g., defective in one or more genes required for additional rounds of replication and / or virion packaging). Viruses can cause transient expression, prolonged expression (e.g. at least 1 week, 2 weeks, 1 month,2 months or 3 months) or constant expression.

[00147] In one example, the nucleic acid or expression construct is in an AAV vector. The AAV may be of any suitable serotype and may be single-stranded AAV (ssAAV) or self-complementary AAV (scAAV). Such AAV vectors are described in more detail above.

[00148] The 4R and 3R tau isoforms in a tau reporter cell or non-human animal may be expressed at similar levels. For example, mRNAs of the 4R and 3R tau isoforms may have similar relative expression, and / or the 4R and 3R tau isoforms may have similar relative expression. In one example, mRNA levels of the 4R and 3R tau isoforms are within one cycle threshold (Ct) of each other when measured by quantitative polymerase chain reaction (qPCR).

[00149] The 4R and 3R tau isoforms in a tau reporter cell or non-human animal,can be obtained from any animal or mammal, such as a human, mouse, or rat. In a specific example, the 4R and 3R tau protein isoforms are human. The 4R and 3R tau protein isoforms can also be any combination of the 4R and 3R tau protein isoforms, respectively. In one example, the 4R tau protein isoform is the 2N4R isoform. For example, the 4R tau isoform may comprise the sequence presented in SEQ ID NO: 13, optionally wherein the 4R tau isoform is encoded by the sequence presented in SEQ ID NO: 17. For example, in compositions in which the 4R tau isoform is fused to a first reporter protein, the fusion protein may comprise the sequence presented in SEQ ID NO: 15, optionally wherein the fusion protein is encoded by the sequence presented in SEQ ID NO: 19. In another example, the 4R tau isoform is the 1N4R isoform. For example, the 4R tau isoform may comprise the sequence,presented in SEQ ID NO: 23, 27, 31 or 47, wherein optionally the 4R tau protein isoform is encoded by the sequence presented in SEQ ID NO: 25, 29, 33 or 48, respectively. For example, in compositions in which the 4R tau isoform is fused to a first reporter protein, the fusion protein may comprise the sequence presented in SEQ ID NO: 35, optionally wherein the fusion protein is encoded by the sequence presented in SEQ ID NO: 36. For example, in compositions in which the 4R tau isoform is fused to a first reporter protein, the fusion protein may comprise the sequence presented in SEQ ID NO: 37, optionally wherein the fusion protein is encoded by the sequence presented in SEQ ID NO: 38. For example, in compositions in which the 4R tau isoform is fused to a first reporter protein, the fusion protein may comprise the sequence presented in SEQ ID NO: 39, optionally wherein the fusion protein is encoded by the sequence presented in SEQ ID NO:

[00150] In one example, the 3R tau isoform is the 2N3R isoform. For example, the 3R tau isoform may comprise the sequence presented in SEQ ID NO: 14, optionally wherein the 3R tau isoform is encoded by the sequence presented in SEQ ID NO: 18. For example, in compositions in which the 3R tau isoform is fused to a second reporter protein, the fusion protein may comprise the sequence presented in SEQ ID NO: 16, optionally wherein the fusion protein is encoded by the sequence presented in SEQ ID NO: 20. In another example, the 4R tau isoform is the 1N3R isoform. For example, the 3R tau protein isoform may comprise a sequence as set forth in SEQ ID NO: 24, 28, 32, or 49, and optionally the 3R tau protein isoform is encoded by a sequence as set forth in SEQ ID NO: 26, 30, 34, or 50, respectively. For example, in compositions,in which the 3R tau isoform is fused to a second reporter protein, the fusion protein may comprise the sequence set forth in SEQ ID NO: 41, optionally wherein the fusion protein is encoded by the sequence set forth in SEQ ID NO: 42. For example, in compositions in which the 3R tau isoform is fused to a second reporter protein, the fusion protein may comprise the sequence set forth in SEQ ID NO: 43, optionally wherein the fusion protein is encoded by the sequence set forth in SEQ ID NO: 44. For example, in compositions in which the 3R tau isoform is fused to a second reporter protein, the fusion protein may comprise the sequence set forth in SEQ ID NO: 45, optionally wherein the fusion protein is encoded by the sequence set forth in SEQ ID NO: 46.

[00151] In one specific example, the 4R tau isoform is the 2N4R isoform, and the 3R tau isoform is the 2N3R isoform. For example,The 4R tau protein isoform may comprise the sequence presented in SEQ ID NO: 13, and the 3R tau protein isoform may comprise the sequence presented in SEQ ID NO: 14 (optionally encoded by SEQ ID NOs: 17 and 18, respectively). For example, the 4R tau protein isoform may be fused to a first reporter protein, and the fusion protein may comprise the sequence presented in SEQ ID NO: 15, and the 3R tau protein isoform may be fused to a second reporter protein, and the fusion protein may comprise the sequence presented in SEQ ID NO: 16 (optionally encoded by SEQ ID NOs: 19 and 20, respectively). In another specific example, the 4R tau protein isoform is the 1N4R isoform, and the 3R tau protein isoform is the 1N3R isoform. For example, the 4R tau protein isoform may comprise the sequence shown in SEQ ID NO: 23, and the 3R tau protein isoform may comprise the sequence shown in SEQ ID NO: 23,presented in SEQ ID NO: 24 (optionally encoded by SEQ ID NOs: 25 and 26, respectively). For example, the 4R tau protein isoform may comprise the sequence presented in SEQ ID NO: 27, and the 3R tau protein isoform may comprise the sequence presented in SEQ ID NO: 28 (optionally encoded by SEQ ID NOs: 29 and 30, respectively). For example, the 4R tau protein isoform may comprise the sequence presented in SEQ ID NO: 31, and the 3R tau protein isoform may comprise the sequence presented in SEQ ID NO: 32 (optionally encoded by SEQ ID NOs: 33 and 34, respectively). For example, the 4R tau isoform may comprise the sequence shown in SEQ ID NO: 47, and the 3R tau isoform may comprise the sequence shown in SEQ ID NO: 49 (optionally encoded by SEQ ID NOs: 48 and 50, respectively). For example, the 4R tau isoform may be fused to a first reporter protein, and the fusion protein may comprise a sequence,presented in SEQ ID NO: 35, and the 3R tau protein isoform can be fused to a second reporter protein, and the fusion protein can comprise the sequence presented in SEQ ID NO: 41 (optionally encoded by SEQ ID NOs: 36 and 42, respectively). For example, the 4R tau protein isoform can be fused to a first reporter protein, and the fusion protein can comprise the sequence presented in SEQ ID NO: 37, and the 3R tau protein isoform can be fused to a second reporter protein, and the fusion protein can comprise the sequence presented in SEQ ID NO: 43 (optionally encoded by SEQ ID NOs: 38 and 44, respectively). For example, the 4R tau isoform may be fused to a first reporter protein and the fusion protein may comprise the sequence shown in SEQ ID NO: 39, and the 3R tau isoform may be fused to a second reporter protein and the fusion protein may comprise the sequence shown in SEQ ID NO: 39.provided in SEQ ID NO: 45 (optionally encoded by SEQ ID NOs: 40 and 46, respectively). In addition to the 2N4R / 2N3R and 1N4R / 1N3R combinations described above, any other combination (e.g., 0N4R / 0N3R, 0N4R / 1N3R, 0N4R / 2N3R, 1N4R / 0N3R, 1N4R / 1N3R, 1N4R / 2N3R, 2N4R / 0N3R, 2N4R / 1N3R, or 2N4R / 2N3R) can be used.

[00152] The 4R and / or 3R tau isoforms may be wild-type. Alternatively, the 4R and / or 3R tau isoforms may comprise a tau pathogenic mutation, such as a pro-aggregation mutation. Such a mutation may be, for example, a mutation that is associated with (e.g., segregates with) a tauopathy or causes a tauopathy. In one example, the mutation may be an aggregation-sensitizing mutation that sensitizes tau protein to sedimentation but does not cause tau protein to readily aggregate on its own, or it may be a mutation that is known to cause aggregation of both 3R tau and 4R tau. For example,A tau protein mutation can be R5L, L237V, or G243V. An R5L mutation is defined as the R5L mutation in a human tau protein or the corresponding mutation in another tau protein when optimally aligned with a human tau protein. An L237V mutation is defined as the L237V mutation in a human tau protein or the corresponding mutation in another tau protein when optimally aligned with a human tau protein. A G243V mutation is defined as the G243V mutation in a human tau protein or the corresponding mutation in another tau protein when optimally aligned with a human tau protein. In one example, both the 4R and 3R tau isoforms contain the R5L mutation. In one example, both the 4R and 3R tau isoforms contain the L237V mutation. In one example, both the 4R and 3R tau isoforms contain the G243V mutation.

[00153] The first and second reporter proteins may be any suitable reporter proteins,encoded by any suitable reporter gene. Reporter genes and reporter proteins are described in more detail above. Examples of reporter genes include, but are not limited to, genes encoding beta-galactosidase (lacZ), bacterial chloramphenicol acetyltransferase (cat) genes, firefly luciferase genes, genes encoding beta-glucuronidase (GUS), and genes encoding fluorescent proteins. In a specific example, the first and second reporter proteins are fluorescent reporter proteins. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, monomeric Azami Green, CopGFP, AceGFP, and ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, and ZsYellowl), blue fluorescent proteins (e.g., BFP, eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, and T-sapphire), cyan fluorescent proteins (e.g., CFP, eCFP, Cerulean, CyPet, AmCyanl, and Midoriishi-Cyan),red fluorescent proteins (e.g., RFP, mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed monomer, HcRed tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry, and Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, monomeric Kusabira-Orange, mTangerine, and tdTomato), and any other suitable fluorescent protein whose presence in cells can be detected by flow cytometry. In a specific example, the first and second reporter proteins are a yellow fluorescent protein (e.g., eYFP) and a red fluorescent protein (e.g., mCherry), respectively, or vice versa.

[00154] The tau reporter cells described herein may be any cell type and may be in vitro, ex vivo, or in vivo. The tau reporter cell line or cell population may be a monoclonal cell line or cell population. The cell may be from any source. For example,A cell may be a eukaryotic cell, an animal cell, a plant cell, or a fungal (e.g., yeast) cell. Such cells may be fish cells or bird cells, or such cells may be mammalian cells such as human cells, non-human mammalian cells, rodent cells, mouse cells, or rat cells. Mammals include, for example, humans, non-human primates, monkeys, apes, cats, horses, bovines, deer, bison, sheep, rodents (e.g., mice, rats, hamsters, guinea pigs), and livestock (e.g., ruminants such as cows and oxen; bovids such as sheep and goats; and pigs such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese, and ducks. Also included are pets and farm animals. The term "animal,"non-human" excludes humans. In a specific example, the tau reporter cells are human cells (e.g., HEK293 cells).

[00155] The cell may be, for example, a totipotent cell or a pluripotent cell (e.g., an embryonic stem (ES) cell, such as a rodent ES cell, a mouse ES cell, or a rat ES cell). Totipotent cells include undifferentiated cells that can give rise to any cell type, and pluripotent cells include undifferentiated cells that have the capacity to develop into more than one differentiated cell type. Such pluripotent and / or totipotent cells may be, for example, ES cells or ES-like cells, such as induced pluripotent stem (iPS) cells. ES cells include totipotent or pluripotent cells of embryonic origin,which are capable of contributing to the cell population of any tissue of the developing embryo when introduced into the embryo. ES cells may originate from the inner cell mass of the blastocyst and are capable of differentiating into cells of any of the three vertebrate germ layers (endoderm, ectoderm, and mesoderm).

[00156] A cell may also be a primary somatic cell or a cell that is not a primary somatic cell. Somatic cells may include any cell that is not a gamete, germ cell, gametocyte, or undifferentiated stem cell. A cell may also be a primary cell. Primary cells include cells or cell cultures that have been isolated directly from an organism, organ, or tissue. Primary cells include cells that are neither transformed nor immortalized. They include any cell obtained from an organism, organ, or tissue,which have not previously been passaged in cell culture or have previously been passaged in cell culture but are not capable of indefinite passage in cell culture. Such cells can be isolated using conventional techniques and include, for example, somatic cells, hematopoietic cells, endothelial cells, epithelial cells, fibroblasts, mesenchymal cells, keratinocytes, melanocytes, monocytes, mononuclear cells, adipocytes, preadipocytes, neurons, glial cells, hepatocytes, skeletal myoblasts, and smooth muscle cells. For example, primary cells may originate from connective tissues, muscle tissues, nervous system tissues, or epithelial tissues.

[00157] Also, such cells typically do not proliferate indefinitely,but due to a mutation or change, have escaped normal cellular senescence and instead can continue to divide. Such mutations or changes may occur naturally or be intentionally induced. Examples of immortalized cells include Chinese hamster ovary (CHO) cells, human embryonic kidney cells (e.g., HEK293 cells), and mouse embryonic fibroblast cells (e.g., 3T3 cells). Many types of immortalized cells are well known. Immortalized or primary cells include cells that are commonly used for culture or for the expression of recombinant genes or proteins.

[00158] The cell may also be a differentiated cell, such as a neuronal cell (e.g., a human neuronal cell). The cell may be an isolated cell.

[00159] The non-human animals described herein may be any suitable animal,non-human. The term "animal" includes any member of the animal kingdom, including, for example, mammals, fish, reptiles, amphibians, birds, and worms. In a specific example, a non-human animal is a mammal other than a human. Non-human mammals include, for example, primates and non-human rodents (e.g., mice and rats). The term "non-human animal" excludes humans. Preferred non-human animals include, for example, rodents such as mice and rats.

[00160] Non-human animals may be of any genetic origin. For example, suitable mice may be from the 129 strain, the C57BL / 6 strain, a mixture of the 129 and C57BL / 6 strain, the BALB / c strain, or the Swiss Webster strain. Examples of 129 lines include 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129Sl / Svlm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, and 129T2. See, e.g.,Festing et al. (1999) Mamm. Genome 10(8):836, which is incorporated herein by reference in its entirety for all purposes. Examples of C57BL strains include C57BL / A, C57BL / An, C57BL / GrFa, C57BL / Kal wN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / 01a. Suitable mice can also be derived from a combination of the aforementioned 129 strain and the aforementioned C57BL / 6 strain (e.g., 50% 129 and 50% C57BL / 6).

[00161] Similarly, suitable mice may be derived from a combination of the above-mentioned 129 strains or from a combination of the above-mentioned BL / 6 strains (e.g., the 129S6 (129 / SvEvTac) strain).

[00161] Similarly, rats may be derived from any rat strain, including, for example, the ACI rat strain, the Dark Agouti (DA) rat strain, the Wistar rat strain, the LEA rat strain, the Sprague Dawley (SD) rat strain, or the Fischer rat strain, such as Fisher F344 or Fisher F6. Rats may also be derived from a strain derived from a combination of two or more of the strains listed above. For example,A suitable rat can be from the DA or ACI line. The ACI line of rats is characterized by a black agouti coloration with a white belly and paws and the RT1 haplotype. av1 These lines are available from various sources, including Harlan Laboratories. The dark agouti (DA) rat line is characterized by the agouti color pattern and the RT1 haplotype. av1. Such rats are available from various sources, including Charles River and Harlan Laboratories. In some cases, suitable rats may be from an inbred strain of rats. See, for example, US 2014 / 0235933, incorporated herein by reference in its entirety for all purposes.IV. Methods of Using Tau Reporter Cells and Non-Human Tau Reporter Animals

[00162] Various methods of using tau reporter cells and non-human tau reporter animals are provided, as described herein. Such methods can be used, for example, to assess the activity of a tau-targeting reagent (e.g., a 4R tau-targeting reagent). Such tau reporter cells and non-human tau reporter animals are particularly useful for distinguishing between a tau-targeting reagent that specifically or selectively targets tau 4R versus reagents that target both tau 4R and tau 3R.Methods for Assessing the Activity of Tau-Targeting Reagents in Tau Reporter Cells

[00163] Various methods for assessing the activity of a tau-targeting reagent in tau reporter cells described herein are provided. Such methods may include: (a) introducing a tau-targeting reagent into a cell; and (b) assessing the activity of the tau-targeting reagent in the cell. The assessment may, for example, be compared to a control tau reporter cell that has not been administered the tau-targeting reagent, or compared to a tau reporter cell before administration of the tau-targeting reagent.

[00164] Methods for assessing the activity of a tau-targeting reagent are well known and are provided herein. In some methods, the assessment may include measuring one or more of 4R tau protein messenger RNA expression, first reporter protein messenger RNA expression, and third reporter protein messenger RNA expression.Methods for assessing messenger RNA (mRNA) expression are provided herein and are well known.

[00165] In one example, the assessment comprises measuring the expression of 4R tau isoform mRNA and the expression of a second reporter protein mRNA, wherein a greater relative decrease in the expression of 4R tau isoform mRNA compared to the expression of the second reporter protein mRNA following administration of a tau targeting reagent indicates that the tau targeting reagent is a 4R-preferential tau targeting reagent.For example, the reduction in the expression of the 4R tau protein isoform mRNA after administration of the tau protein-targeting reagent may be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, and the reduction in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, or no more than 5%. In one example, the reduction in the expression of the 4R tau protein isoform mRNA after administration of the tau protein-targeting reagent may be at least 60%, and the reduction in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 30%.In another example, the reduction in the expression of the 4R tau protein isoform mRNA following administration of the tau protein-targeting reagent may be at least 70%, and the reduction in the expression of the second reporter protein mRNA following administration of the tau protein-targeting reagent may be no more than 30%. In one example, the reduction in the expression of the 4R tau protein isoform mRNA following administration of the tau protein-targeting reagent may be at least 75%, and the reduction in the expression of the second reporter protein mRNA following administration of the tau protein-targeting reagent may be no more than 10%.

[00166] In another example, the assessment includes measuring the expression of the mRNA of a first reporter protein and the expression of the mRNA of a second reporter protein, wherein a greater relative decrease in the expression of the mRNA of the first reporter protein compared to the expression of the mRNA of the second reporter protein after administration of the tau protein-targeting reagent indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent. For example, the reduction in the expression of the first reporter protein mRNA after administration of the tau protein-targeted reagent may be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, and the reduction in the expression of the second reporter protein mRNA after administration of the tau protein-targeted reagent may be no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, or no more than 5%.In one example, the decrease in the expression of the first reporter protein mRNA after administration of the tau protein-targeting reagent may be at least 60%, and the decrease in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 30%. In another example, the decrease in the expression of the first reporter protein mRNA after administration of the tau protein-targeting reagent may be at least 70%, and the decrease in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 30%. In one example, the decrease in the expression of the first reporter protein mRNA after administration of the tau protein-targeting reagent may be at least 75%, and the decrease in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 10%.

[00167] In some methods, the evaluation includes measuring one or more of the expression of a first reporter protein and the expression of a second reporter protein. Methods for evaluating protein expression are provided herein and are well known. For example, the evaluation may include measuring the expression of a first reporter protein and the expression of a second reporter protein, wherein a greater relative decrease in the expression of the first reporter protein compared to the expression of the second reporter protein after administration of the tau protein-targeting reagent indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent.For example, the reduction in expression of the first reporter protein after administration of the tau protein-targeted reagent may be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, and the reduction in expression of the second reporter protein after administration of the tau protein-targeted reagent may be no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, or no more than 5%. In one example, the reduction in expression of the first reporter protein after administration of the tau protein-targeted reagent may be at least 60%, and the reduction in expression of the second reporter protein after administration of the tau protein-targeted reagent may be no more than 30%.In another example, the reduction in expression of the first reporter protein after administration of the tau protein-targeting reagent may be at least 70%, and the reduction in expression of the second reporter protein after administration of the tau protein-targeting reagent may be no more than 30%. In one example, the reduction in expression of the first reporter protein after administration of the tau protein-targeting reagent may be at least 75%, and the reduction in expression of the second reporter protein after administration of the tau protein-targeting reagent may be no more than 10%.

[00168] In a specific example, the first reporter protein is a first fluorescent reporter protein, and the second reporter protein is a second fluorescent reporter protein, and the evaluation in step (b) comprises immunofluorescence staining or flow cytometry. In some methods, the evaluation comprises evaluating tau protein hyperphosphorylation or tau protein aggregation.

[00169] If the tau protein-targeting reagent is a genome-editing reagent (e.g., a nuclease agent), such methods may include assessing the modification of a nucleic acid encoding a 4R or 3R isoform of tau. As an example, said assessment may include measuring non-homologous end joining (NHEJ) activity. It may include, for example, measuring the frequency of insertions or deletions in the target region. For example, the assessment may include sequencing the nucleic acid encoding a 4R or 3R isoform of tau (e.g., next-generation sequencing).

[00170] As one specific example, if the tau protein-targeting reagent is a genome-editing reagent (e.g., a nuclease agent), the percentage of editing (e.g., the total number of insertions or deletions obtained from the total number of sequences read in a PCR reaction from a pool of lysed cells) of the target nucleic acid may be assessed.

[00171] A tau protein-targeting reagent may be a tau protein-targeting antibody or antigen-binding protein (e.g., an intrabody), or any other large molecule or small molecule that targets tau protein. Alternatively, a tau protein-targeting reagent may be any biological or chemical agent that targets the MAPT locus (MAPT gene), MAPT mRNA, or tau protein. Examples of tau protein-targeting reagents are provided herein.

[00172] Such tau protein-targeting reagents may be administered by any delivery method / using any vehicle (e.g., adenovirus, lentivirus, AAV, or LNP). Methods of delivering complexes and molecules are described in more detail herein. In specific methods, the reagents are delivered via AAV-mediated delivery or lentivirus-mediated delivery. In other particular embodiments of the methods, reagents are delivered via LNP-mediated delivery.The dose may be any suitable dose.B. Methods for Assessing the Activity of Tau-Targeting Reagents in Non-Human Tau Reporter Animals

[00173] Various methods for assessing the activity of a tau-targeting reagent in non-human tau reporter animals are described herein. Such methods may comprise: (a) administering a tau-targeting reagent to a non-human animal; and (b) assessing the activity of the tau-targeting reagent in the non-human animal. The assessment may be, for example, compared to a control non-human tau reporter animal that has not been administered the tau-targeting reagent, or compared to a non-human tau reporter animal before administration of the tau-targeting reagent.

[00174] Methods for assessing the activity of a tau-targeting reagent are well known and are provided herein.Activity may be assessed in any cell type, tissue type, or organ type as disclosed herein. In some methods, activity is assessed in neurons. In some methods, the assessment may include measuring one or more of the following: 4R tau mRNA expression, mRNA expression of a first reporter protein, and mRNA expression of a third reporter protein. For example, mRNA levels may be measured in a specific cell, tissue, or organ type (e.g., neurons). Methods for assessing mRNA expression are described herein and are generally known.

[00175] In one example, the assessment includes measuring the expression of 4R tau isoform mRNA and the expression of a second reporter protein mRNA, wherein a greater relative decrease in the expression of 4R tau isoform mRNA compared to the expression of the second reporter protein mRNA after administration of the tau targeting reagent indicates that the tau targeting reagent is a 4K-preferential tau targeting reagent. For example, the reduction in the expression of the 4R tau protein isoform mRNA after administration of the tau protein-targeting reagent may be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, and the reduction in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, or no more than 5%.In one example, the decrease in the expression of the 4R tau protein isoform mRNA after administration of the tau protein-targeting reagent may be at least 60%, and the decrease in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 30%. In another example, the decrease in the expression of the 4R tau protein isoform mRNA after administration of the tau protein-targeting reagent may be at least 70%, and the decrease in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 30%. In one example, the decrease in the expression of the 4R tau protein isoform mRNA after administration of the tau protein-targeting reagent may be at least 75%, and the decrease in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 10%.

[00176] In another example, the assessment includes measuring the expression of the mRNA of a first reporter protein and the expression of the mRNA of a second reporter protein, wherein a greater relative decrease in the expression of the mRNA of the first reporter protein compared to the expression of the mRNA of the second reporter protein after administration of the tau protein-targeting reagent indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent. For example, the reduction in the expression of the first reporter protein mRNA after administration of the tau protein-targeted reagent may be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, and the reduction in the expression of the second reporter protein mRNA after administration of the tau protein-targeted reagent may be no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, or no more than 5%.In one example, the decrease in the expression of the first reporter protein mRNA after administration of the tau protein-targeting reagent may be at least 60%, and the decrease in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 30%. In another example, the decrease in the expression of the first reporter protein mRNA after administration of the tau protein-targeting reagent may be at least 70%, and the decrease in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 30%. In one example, the decrease in the expression of the first reporter protein mRNA after administration of the tau protein-targeting reagent may be at least 75%, and the decrease in the expression of the second reporter protein mRNA after administration of the tau protein-targeting reagent may be no more than 10%.

[00177] In some methods, the evaluation includes measuring one or more of the expression of a first reporter protein and the expression of a second reporter protein. Methods for evaluating protein expression are provided herein and are well known. For example, the evaluation may include measuring the expression of a first reporter protein and the expression of a second reporter protein, wherein a greater relative decrease in the expression of the first reporter protein compared to the expression of the second reporter protein after administration of the tau protein-targeting reagent indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent.For example, the reduction in expression of the first reporter protein after administration of the tau protein-targeted reagent may be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, and the reduction in expression of the second reporter protein after administration of the tau protein-targeted reagent may be no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%, no more than 15%, no more than 10%, or no more than 5%. In one example, the reduction in expression of the first reporter protein after administration of the tau protein-targeted reagent may be at least 60%, and the reduction in expression of the second reporter protein after administration of the tau protein-targeted reagent may be no more than 30%.In another example, the reduction in expression of the first reporter protein after administration of the tau protein-targeting reagent may be at least 70%, and the reduction in expression of the second reporter protein after administration of the tau protein-targeting reagent may be no more than 30%. In one example, the reduction in expression of the first reporter protein after administration of the tau protein-targeting reagent may be at least 75%, and the reduction in expression of the second reporter protein after administration of the tau protein-targeting reagent may be no more than 10%.

[00178] In a specific example, the first reporter protein is a first fluorescent reporter protein, and the second reporter protein is a second fluorescent reporter protein, and the evaluation in step (b) comprises immunofluorescence staining or flow cytometry. In some methods, the evaluation comprises evaluating tau protein hyperphosphorylation or tau protein aggregation.

[00179] If the reagent targeting the tau protein is a genome editing reagent (e.g., a nuclease agent), such methods may include assessing the modification of a nucleic acid encoding the 4R or 3R isoform of the tau protein. As an example, said assessment may include measuring non-homologous end joining (NHEJ) activity. It may include, for example, measuring the frequency of insertions or deletions in the target region. For example, the assessment may include sequencing the nucleic acid encoding the 4R or 3R isoform of the tau protein (e.g., next-generation sequencing). The assessment may include isolating the target organ or tissue (e.g., neurons) from a non-human animal and assessing the modification of the nucleic acid encoding the 3R or 4R isoform of the tau protein in the target organ or tissue.Similarly, the assessment may include isolating a non-target organ or tissue (e.g., two or more non-target organs or tissues) from a non-human animal and assessing the modification of a nucleic acid encoding a 3R or 4R tau isoform in the non-target organ or tissue.

[00180] As one specific example, if the tau-targeting reagent is a genome editing reagent (e.g., a nuclease agent), the percentage of editing (e.g., the total number of insertions or deletions derived from the total number of sequences read in a PCR reaction from a pool of lysed cells) of the target nucleic acid may be assessed.

[00181] The tau-targeting reagent may be a tau-targeting antibody or antigen-binding protein (e.g., an intrabody), or any other large molecule or small molecule that targets tau.Alternatively, the tau protein-targeting reagent may be any biological or chemical agent that targets the MAPT locus (MAPT gene), MAPT mRNA, or the tau protein. Examples of tau protein-targeting reagents are provided herein.

[00182] Such tau protein-targeting reagents may be administered by any delivery method / vehicle (e.g., adenovirus, lentivirus, AAV, LNP, or by injection) and by any route of administration (e.g., intravitreal injection or intracameral injection). Methods of delivery of complexes and molecules, as well as routes of administration, are described in more detail herein. In particular methods, the reagents are delivered by AAV-mediated delivery or lentivirus-mediated delivery. In other particular embodiments of the methods, the reagents are delivered by LNP-mediated delivery. The dose may be any suitable dose.C.Tau Protein Targeting Reagents

[00183] A tau protein targeting reagent may be any reagent that targets a tau protein, a MAPT gene, or mRNAMAPT (e.g., human tau protein, a human MAPT gene, or human MAPT mRNA). A tau protein targeting reagent may be, for example, a known tau protein targeting reagent, may be a putative tau protein targeting reagent (e.g., candidate reagents designed to target a tau protein, a MAPT gene, or mRNAMAPT), or may be a reagent being screened for tau protein targeting activity.

[00184] For example, a tau protein targeting reagent may be an antigen-binding protein that targets an epitope of a tau protein. The term "antigen-binding protein" includes any protein that binds to an antigen.Examples of antigen-binding proteins include an antibody, an antigen-binding fragment of an antibody, a multispecific antibody (e.g., a bispecific antibody), scFV, bis-scFV, diabody, triabody, tetrabody, V-NAR, VHH, VL, F(ab), F(ab)2, DVD (dual variable domain antigen-binding protein), SVD (single variable domain antigen-binding protein), bispecific T-cell activator (BiTE), or the Davis antibody (U.S. Patent No. 8,586,713, incorporated herein by reference in its entirety for all purposes). In a specific example, the antigen-binding protein is an intrabody. An intrabody is an antibody engineered for intracellular expression. Other tau-targeting reagents include tau-targeting small molecules, the MAPT gene, and MAPT mRNA.

[00185] Other tau-targeting reagents may include genome editing reagents such as a nuclease agent (e.g., clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) nuclease (CRISPR / Cas), zinc finger nuclease (ZFN), or transcription activator-like effector nuclease (TALEN)) that cleaves a recognition site in the MAPT gene. Similarly, a tau-targeting reagent may be an exogenous donor nucleic acid (e.g., a targeting vector or a single-stranded oligodeoxynucleotide (ssODN)) designed to recombine with the MAPT gene.

[00186] Other tau-targeting reagents may include RNAi agents.An "RNAi agent" is a composition that includes a small double-stranded RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of facilitating the degradation or inhibiting the translation of a target RNA, such as messenger RNA (mRNA), depending on the sequence. The oligonucleotide in an RNAi agent is a polymer of linked nucleosides, each of which may or may not be independently modified. RNAi agents act through RNA interference (i.e., induce RNA interference by interacting with the RNA interference pathway (RNA-induced silencing complex, or RISC) of mammalian cells). Although RNAi agents, as the term is used herein, are believed to act primarily through RNA interference, the RNAi agents described are not associated with or limited to any particular pathway or mechanism of action.The RNAi agents described herein include a coding strand and an antisense strand and include, but are not limited to, small interfering RNAs (siRNAs), double-stranded RNAs (dsRNAs), short RNAs (siRNAs), short hairpin RNAs (shRNAs), and Dicer enzyme substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to a sequence (i.e., a sequence or order of nitrogenous bases or nucleotides described by a sequence of letters using standard nomenclature) in the target RNA.

[00187] Other reagents targeting tau protein may include antisense oligonucleotides (ASOs). Single-stranded ASOs and RNA interference (RNAi) share the fundamental principle that an oligonucleotide binds a target RNA through Watson-Crick base pairing.Without wishing to be bound by theory, during RNAi, a small duplex RNA (the RNAi agent) binds to the RNA-inducible silencing complex (RISC), one strand (the chaperone strand) is degraded, and the remaining strand (the guide strand) interacts with RISC to bind complementary RNA. Argonaute 2 (Ago2), the catalytic component of RISC, then cleaves the target RNA. The guide strand is always bound to either the complementary sense strand or the RISC protein. In contrast, the ASO must remain intact and function as a single strand. ASOs bind to the target RNA and block RNA binding by ribosomes or other factors, such as splicing factors, or recruit proteins such as nucleases. Different modifications and target regions are selected for ASOs based on the desired mechanism of action. A gapmer is an ASO oligonucleotide containing 2-5 chemically modified nucleotides (e.g., LNA or 2'-MOE) at each end flanking a central 8-10 DNA base long gap.After binding the target RNA, the DNA-RNA hybrid functions as a substrate for RNase H.

[00188] Other tau-targeting reagents include small molecule reagents.D. Administration of tau-targeting reagents to non-human cells or animals

[00189] The methods described herein may involve administering various molecules (e.g., tau-targeting reagents), including nucleic acids, proteins, nucleic acid-protein complexes, protein complexes, or small molecule compounds, to a cell or non-human animal. "Administering" includes presenting a molecule (e.g., a nucleic acid or protein) to a cell or non-human animal such that it gains access to the interior of the cell or to the interior of cells in the body of the non-human animal.Administration may be accomplished by any route, and two or more components (e.g., two components or all components) may be administered to a cell or non-human animal simultaneously or sequentially in any combination. Furthermore, two or more components may be administered to a cell or non-human animal via the same delivery route / vehicle or via different delivery routes / vehicles. Similarly, two or more components may be administered to a non-human animal via the same route of administration or via different routes of administration.

[00190] Molecules (e.g., Cas proteins or guide RNAs or ASOs) introduced into a cell or non-human animal can be provided in compositions comprising a carrier that enhances the stability of the introduced molecules, such as extending, under given storage conditions (e.g., -20°C, 4°C, or ambient temperature), the period during which degradation products remain below a threshold, such as below 0.5% by weight of the original nucleic acid or protein; or enhancing in vivo stability). Non-limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-co-glycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid cochleates, and lipid microtubules.

[00191] Disclosed herein are various methods and compositions for introducing a molecule (e.g., a nucleic acid or a protein) into a cell or non-human animal.Methods for introducing molecules into various types of cells are known and include, for example, stable transfection methods, transient transfection methods, and virus-mediated methods.

[00192] Transfection protocols, as well as protocols for introducing molecules into cells, can vary. Non-limiting transfection methods include chemical transfection methods using liposomes; nanoparticles; calcium phosphate (Graham et al. (1973) Virology 52 (2): 456-67, Bacchetti et al. (1977) Proc. Natl. Acad. Sci. USA 74 (4): 1590^1 and Kriegler, M (1991). Transfer and Expression: A Laboratory Manual. New York: WH Freeman and Company, pp. 96-97); dendrimers or cationic polymers such as DEAE-dextran or polyethyleneimine. Non-chemical methods include electroporation, sonoporation, and optical transfection. Particle-based transfection involves the use of a gene gun or magnetic transfection (Bertram (2006) Current Pharmaceutical Biotechnology 7, 277-28).Viral methods can also be used for transfection.

[00193] The introduction of nucleic acids or proteins into a cell can also be mediated by electroporation, intracytoplasmic injection, viral infection, adenovirus, adeno-associated virus, lentivirus, retrovirus, transfection, lipid-mediated transfection, or nucleofection. Nucleofection is an improved electroporation technology that allows for the delivery of nucleic acid substrates not only into the cytoplasm but also across the nuclear membrane and into the nucleus. Furthermore, the use of nucleofection in the methods described herein typically requires far fewer cells than conventional electroporation (e.g., only approximately 2 million compared to 7 million for conventional electroporation). As an example, nucleofection is performed using the LONZA® NUCLEOFECTOR™ System.

[00194] Introduction of molecules (e.g., nucleic acids or proteins) into a cell (e.g., a zygote) can also be accomplished by microinjection. In zygotes (i.e., one-cell stage embryos), microinjection can be performed into the maternal and / or paternal pronucleus or into the cytoplasm. When microinjecting into only one pronucleus, the paternal pronucleus is preferred due to its larger size. Microinjection of mRNA is preferably performed into the cytoplasm (e.g., to deliver mRNA directly to the translation apparatus), whereas microinjection of a protein or a polynucleotide encoding a protein or encoding an RNA is preferably performed into the nucleus / pronucleus.Alternatively, microinjection can be performed by injecting into both the nucleus / pronucleus and the cytoplasm: the needle can first be inserted into the nucleus / pronucleus and a first amount can be injected, and upon withdrawal of the needle from the one-cell stage embryo, a second amount can be injected into the cytoplasm. Methods for performing microinjections are well known. See, e.g., Nagy et al. (Nagy A, Gertsenstein M, Vintersten K, Behringer R., 2003, Manipulating the Mouse Embryo. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); see also Meyer et al. (2010) Proc. Natl. Acad. Sci. USA 107:15022–15026 and Meyer et al. (2012) Proc. Natl. Acad. Sci. USA 109:9354-9359.

[00195] Other methods of introducing molecules (e.g., nucleic acid or proteins) into a cell or non-human animal may include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid nanoparticle-mediated delivery, penetrating peptide-mediated delivery, or implantable device-mediated delivery. As specific examples, a nucleic acid or protein may be introduced into a cell or non-human animal in a carrier such as a poly(lactic acid) (PLA) microsphere, a D,L-lactic-co-glycolic acid (PLGA) microsphere, a liposome, a micelle, a reverse micelle, a lipid cochelate, or a lipid microtubule.Some specific examples of delivery to a non-human animal include hydrodynamic delivery, viral-mediated delivery (e.g., adeno-associated virus (AAV)-mediated delivery or lentivirus-mediated delivery), and lipid nanoparticle-mediated delivery.

[00196] Administration of nucleic acids can also be accomplished via viral-mediated delivery, such as adenovirus-mediated delivery, AAV-mediated delivery (e.g., AAV-PhPeB), or lentivirus-mediated delivery. Other illustrative viruses / viral vectors include retroviruses, vaccinia viruses, poxviruses, and herpes simplex viruses. Viruses can infect dividing cells, non-dividing cells, or both dividing and non-dividing cells. Viruses can integrate into the host genome or, alternatively, not integrate into the host genome. Such viruses can also be engineered to have reduced immunity.Viruses can be replication-competent or replication-defective (e.g., deficient in one or more genes required for additional rounds of replication and / or virion packaging). Viruses can induce transient expression, long-term expression (e.g., at least 1 week, 2 weeks, 1 month, 2 months, or 3 months), or persistent expression (e.g., Cas9 and / or gRNA). Illustrative viral titers (e.g., AAV titers) include 10. 12 , 10 13 , 10 14 , 10 15 , and 10 16 vector genomes / ml. Other illustrative viral titers (e.g., AAV titers) include approximately 10 12 , about 10 13 , about 10 14 , about 10 15 and about 10 16Vector genomes (vg) / icr body weight.

[00197] The AAV ssDNA genome consists of two open reading frames, Rep and Cap, flanked by two inverted terminal repeats that mediate the synthesis of the complementary DNA strand. When constructing an AAV transfer plasmid, the transgene is placed between the two ITRs, and Rep and Cap can be present in trans. In addition to Rep and Cap, AAV may require a helper plasmid containing adenovirus genes. These genes (E4, E2a, and VA) mediate AAV replication. For example, the transfer plasmid, Rep / Cap, and helper plasmid can be transfected into HEK293 cells containing the adenovirus E1+ gene to produce infectious AAV particles. Alternatively, the Rep, Cap, and helper genes of adenovirus can be combined on a single plasmid. Similar packaging cells and methods can be used for other viruses, such as retroviruses.

[00198] Several serotypes of AAV have been identified. These serotypes differ in the cell types,which they infect (i.e., their tropism), which allows for selective transduction of certain cell types. Serotypes for CNS tissues include AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9. Serotypes for cardiac tissue include AAV1, AAV8, and AAV9. Serotypes for kidney tissue include AAV2. Serotypes for lung tissue include AAV4, AAV5, AAV6, and AAV9. Serotypes for pancreatic tissue include AAV8. Serotypes for photoreceptor cells include AAV2, AAV5, and AAV8. Serotypes for retinal pigment epithelium include AAV1, AAV2, AAV4, AAV5, and AAV8. Serotypes for skeletal muscle tissue include AAV1, AAV6, AAV7, AAV8, and AAV9. Serotypes for liver tissue include AAV7, AAV8, and AAV9, and particularly AAV8. In a specific example, the serotype AAV-PhPeB is used.

[00199] Tropism can be further refined using pseudotyping, which is a mixture of the capsid and genome of different viral serotypes. For example, AAV2 / 5 denotes a virus containing the genome of serotype 2,packaged in a capsid from serotype 5. The use of pseudotyped viruses can improve transduction efficiency as well as alter tropism. Hybrid capsids derived from different serotypes can also be used to alter viral tropism. For example, AAV-DJ contains a hybrid capsid from eight serotypes and exhibits high infectivity in a wide range of cell types in vivo. AAV-DJ8 is another example that exhibits the properties of AAV-DJ but with improved uptake in the brain. AAV serotypes can also be modified through mutations. Examples of AAV2 mutational modifications include Y444F, Y500F, Y730F, and S662V. Examples of AAV3 mutational modifications include Y705F, Y731F, and T492V. Examples of AAV6 mutational modifications include S663V and T492V. Other pseudotyped / modified AAV variants include AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5,AAV8.2 and AAV / SASTG.

[00200] Self-complementary variants of AAV (scAAV) can be used to accelerate transgene expression. Because AAV relies on the cellular DNA replication machinery to synthesize the complementary strand of the genome as single-stranded AAV DNA, transgene expression can be delayed. To overcome this delay, scAAVs containing complementary sequences that are able to spontaneously anneal upon infection can be used, eliminating the need for host cell DNA synthesis. However, single-stranded AAV (ssAAV) vectors can also be used.

[00201] To increase packaging capacity, longer transgenes can be divided between two AAV transfer plasmids, the first with a 3' splice donor and the second with a 5' splice acceptor. When a cell is co-infected, these viruses form concatemers,are spliced ​​together and allow expression of the full-length transgene. Although this allows for longer-lasting transgene expression, it is less efficient. Similar approaches to increasing capacity utilize homologous recombination. For example, the transgene may be split between two transfer plasmids, but with significant sequence overlap, so that co-expression induces homologous recombination and expression of the full-length transgene.

[00202] Nucleic acid and protein delivery can also be achieved through lipid nanoparticle (LNP)-mediated delivery. Lipid formulations can protect biological molecules from degradation while enhancing their cellular uptake. Lipid nanoparticles are particles containing multiple lipid molecules physically linked to each other by intermolecular forces. These include microspheres (including unilamellar and multilamellar vesicles, such as liposomes),a dispersed phase in an emulsion, micelles, or an internal phase in a suspension. Such lipid nanoparticles can be used to encapsulate one or more nucleic acids or proteins for delivery. Formulations containing cationic lipids are suitable for the delivery of polyanions such as nucleic acids. Other lipids that can be included are neutral lipids (i.e., uncharged or zwitterionic lipids), anionic lipids, accessory lipids that enhance transfection, and stealth lipids that increase the longevity of the nanoparticles in vivo. Examples of suitable cationic lipids, neutral lipids, anionic lipids, accessory lipids, and stealth lipids can be found in WO 2016 / 010840 A1, which is incorporated herein by reference in its entirety for all purposes. An exemplary lipid nanoparticle may comprise a cationic lipid and one or more other components. As an example,Another component may include an accessory lipid such as cholesterol. In another example, the other components may include an accessory lipid such as cholesterol and a neutral lipid such as DSPC. As another example, the other components may include an accessory lipid such as cholesterol, an optional neutral lipid such as DSPC, and a stealth lipid such as S010, S024, S027, S031, or S033.

[00203] An LNP may contain one or more or all of the following: (i) a lipid for encapsulation and endosomal escape; (ii) a neutral lipid for stabilization; (iii) an accessory lipid for stabilization; and (iv) a stealth lipid. See, for example, Finn et al. (2018) Cell Reports 22:1-9 and WO 2017 / 173054 A1, each of which is incorporated herein by reference in its entirety for all purposes.

[00204] An illustrative dose of LNP includes, for example, about 0.1, about 0.25, about 0.3, about 0.5, about 1, about 2, about 3, about 4,about 5, about 6, about 8, or about 10 mg / kg (mpk) based on total RNA payload. By way of example, LNP doses of about 0.01 mg / kg to about 10 mg / kg, about 0.1 to about 10 mg / kg, or about 0.01 to about 0.3 mg / kg can be used. For example, LNP doses of about 0.01, about 0.03, about 0.1, about 0.3, about 1, about 3, or about 10 mg / kg can be used.

[00205] In vivo administration can be by any suitable route, including, for example, parenteral, intravenous, oral, subcutaneous, intraarterial, intracranial, intrathecal, intraperitoneal, topical, intranasal, or intramuscular. Systemic routes of administration include, for example, oral and parenteral routes. Examples of parenteral routes include intravenous, intraarterial, intraosseous, intramuscular, intradermal, subcutaneous,Intranasal and intraperitoneal routes. A specific example is intravenous infusion. Other specific examples are nasal instillation and intravitreal injection. Local routes of administration include, for example, intrathecal, intracerebroventricular, intraparenchymal (e.g., localized intraparenchymal delivery to the striatum (e.g., caudate nucleus or dorsolateral pars), cerebral cortex, precentral gyrus, hippocampus (e.g., dentate gyrus or CA3 area), temporal cortex, amygdala, frontal cortex, thalamus, cerebellum, medulla oblongata, hypothalamus, tectum, tegmentum, or substantia nigra), intraocular, intraorbital, subconjunctival, intravitreal, subretinal, and transcleral routes. Significantly smaller amounts of components (compared to systemic approaches) can have an effect when administered locally (for example,intraparenchymal or intravitreal) compared to systemic administration (e.g., intravenous). Local administration methods may also reduce or eliminate the incidence of potentially toxic side effects that may occur with systemic administration of therapeutically effective amounts of the component.

[00206] In vivo administration may be by any suitable route, including, for example, parenteral, intravenous, oral, subcutaneous, intraarterial, intracranial, intrathecal, intraperitoneal, topical, intranasal, or intramuscular. A specific example is intravenous infusion. Administerable compositions may be formulated using one or more physiologically and pharmaceutically acceptable carriers, diluents, excipients, or additives. The composition of the preparation may depend on the route of administration chosen. The term "pharmaceutically acceptable" means that the carrier, diluent,The excipient or auxiliary substance is compatible with the other ingredients of the formulation and is not substantially deleterious to the recipient thereof.

[00207] The frequency of administration and the number of doses may depend on, among other factors, the half-life of the administered molecules and the route of administration. The administration of nucleic acids or proteins into a cell or non-human animal may be carried out one or more times within a certain period of time. For example, the administration may be carried out at least twice within a certain period of time, at least three times within a certain period of time, at least four times within a certain period of time, at least five times within a certain period of time, at least six times within a certain period of time, at least seven times within a certain period of time, at least eight times within a certain period of time,at least nine times within a certain period of time, at least ten times within a certain period of time, at least eleven times, at least twelve times within a certain period of time, at least thirteen times within a certain period of time, at least fifteen times within a certain period of time, at least sixteen times within a certain period of time, at least seventeen times within a certain period of time, at least eighteen times within a certain period of time, at least nineteen times within a certain period of time, or at least twenty times within a certain period of time.E. Measuring the delivery, activity, or effectiveness of tau-targeting reagents

[00208] The methods described herein may further include detecting or measuring the activity of the reagents,targeting tau protein.

[00209] If the tau-targeting reagent is a genome editing reagent (e.g., a CRISPR / Cas system designed to target a nucleic acid encoding the 4R isoform of tau protein), the measurement may include assessing the target nucleic acid for modifications. Various methods may be used to identify cells that have the targeted genetic modification. Screening may include a quantitative assay to determine modifications of the allele (MOA) of the reference chromosome. See, for example, US 2004 / 0018626; US 2014 / 0178879; US 2016 / 0145646; WO 2016 / 081923; and Frendewey et al. (2010) Methods Enzymol. 476:295-307, each of which is incorporated herein by reference in its entirety for all purposes. For example, quantitative analysis can be performed using quantitative PCR, such as real-time PCR (qPCR). Real-time PCR can use a first set of primers,which recognizes the target locus, and a second set of primers that recognizes a non-target reference locus. The primer set may include a fluorescent probe that recognizes the amplified sequence. Other examples of suitable quantitative assays include fluorescence in situ hybridization (FISH), comparative genomic hybridization, isothermal DNA amplification, quantitative hybridization with immobilized probe(s), INVADER® probes, TAQMAN® Molecular Beacon probes, or ECLIPSE™ probe technology (see, e.g., US 2005 / 0144655, incorporated herein by reference in its entirety for all purposes). Next-generation sequencing (NGS) may also be used for screening. Next-generation sequencing may also be referred to as NGS, or massively parallel sequencing,or high-throughput sequencing. NGS can be used as a screening tool in addition to MOA assays to determine the precise nature of the targeted genetic modification and its uniformity across different cell types, tissue types, or organ types.

[00210] Assessment of a modification in a non-human animal can be performed in any cell type from any tissue or organ. For example, assessment can be performed in multiple cell types from the same tissue or organ, or in cells from multiple locations within a tissue or organ. This can provide information about which cell types in the target tissue or organ are targeted or which sites within the tissue or organ are reached by the tau-targeting reagent. As another example, assessment can be performed in multiple tissue types or in multiple organs. In methods in which targeting is performed to a specific tissue, organ, or cell type, this can provide information abouthow efficiently the tissue or organ is targeted and whether there are off-target effects in other tissues or organs.

[00211] If the reagent is designed to inactivate nucleic acid encoding a 4R or 3R tau isoform, affect the expression of a 4R or 3R tau isoform, prevent the translation of a 4R or 3R tau isoform mRNA, or purify a 4R or 3R tau isoform protein, the measurement may include assessing the expression of a 4R tau isoform, a 3R tau isoform, protein expression, or mRNA for a first or second reporter protein. This measurement may be performed, for example, in neurons.

[00212] The production of a 4R or 3R tau isoform can be assessed by any known method. For example, expression can be assessed by measuring the levels of the encoded mRNA in a non-human animal or the levels of the encoded protein in a non-human animal using known assays. For example,The measurement may be directed to determining whether a tau-targeting reagent reduces levels of the 4R or 3R tau isoform in a non-human animal.

[00213] The assessment in a non-human animal may be performed in any cell type from any tissue or organ. For example, the assessment may be performed in multiple cell types from the same tissue or organ (e.g., the central nervous system) or in cells from multiple locations within a tissue or organ. It may provide information about which cell types in the target tissue or organ are targeted or which areas of the tissue or organ are reached by the tau-targeting reagent. As another example, the assessment may be performed in multiple tissue types or multiple organs. In methods in which targeting is performed to a specific tissue, organ, or cell type, this may provide information abouthow efficiently the targeting of that tissue or organ is achieved, and whether off-target effects are present in other tissues or organs.

[00214] One example of an assay that can be used is the RNA in situ hybridization (ISH) assays RN AS COPE™ and BASESCOPE™, which can quantify cell-specific edited transcripts, including single nucleotide changes, in the context of intact fixed tissue. The BASESCOPE™ RNA ISH assay can complement NGS and qPCR in characterizing gene editing. While NGS / qPCR can provide quantitative averages for wild-type and edited sequences,They do not provide information on the heterogeneity or percentage of edited cells within the tissue. The BASESCOPE™ ISH assay can provide an overview of the entire tissue and quantification of wild-type transcripts versus edited transcripts at the single-cell resolution, where the actual number of cells in the target tissue containing the edited mRNA transcript can be quantified. The BASESCOPE™ assay provides single RNA molecule detection using paired oligoprobes (ZZ) to amplify the signal without non-specific background. However, the BASESCOPE™ probe construct and signal amplification system allow for the detection of single RNA molecules with the ZZ probe and is capable of differentially detecting single nucleotide changes and mutations in intact fixed tissue.

[00215] Evaluation of any of these phenotypes can be performed in comparison to a control cell or control animal,non-human. Control cells or non-human animals may be, for example, the same age as the test cell or non-human animal and / or the same sex as the test cell or non-human animal. Evaluation of any of these phenotypes may also be performed in comparison with a control cell or non-human animal that is identical to the non-human test animal except that it has not been treated with the tau-targeting reagent. Evaluation of any of these phenotypes may also be performed in comparison with the test cell or non-human test animal prior to administration of the tau-targeting reagent to the non-human test animal.

[00216] Evaluation of any of these phenotypes may be performed on a single cell or non-human animal, assessing changes in that cell or animal,non-human. Alternatively, the assessment may be performed in a population of non-human cells or animals, comparing, for example, the percentage of non-human cells or animals that have a particular phenotype.V. Methods for Obtaining Tau Reporter Cells and Tau Reporter Non-Human Animals

[00217] The tau reporter cells and non-human animals described herein may be obtained by any known method. For example, the tau reporter cells and non-human animals described herein can be produced by introducing a 4R tau protein isoform linked to a first reporter protein and a 3R tau protein isoform linked to a second reporter protein, or a first nucleic acid encoding a 4R tau protein isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau protein isoform linked to a second reporter protein, into a cell or animal.non-human. The 4R tau isoform linked to a first reporter protein and the 3R tau isoform linked to a second reporter protein, or the first nucleic acid encoding the 4R tau isoform linked to a first reporter protein and the second nucleic acid encoding the 3R tau isoform linked to a second reporter protein, may be introduced into a non-human cell or animal in any form (e.g., DNA, RNA, or protein) by any known means. "Introducing" includes providing the nucleic acid or protein to a non-human cell or animal such that it gains access to the interior of the cell or to cells within the body of the non-human animal. The methods provided herein do not depend on the particular method of introducing the nucleic acid or protein into a non-human cell or animal, but only on whetherthat the nucleic acid or protein gains access to the interior of at least one cell. Methods for introducing nucleic acids and proteins into various types of cells are known and include, for example, stable transfection methods, transient transfection methods, and viral-mediated methods. Optionally, targeting vectors can be used.

[00218] Transfection protocols, as well as protocols for introducing nucleic acids or proteins into cells or non-human animals, can vary. Non-limiting transfection methods include chemical transfection methods using liposomes; nanoparticles; calcium phosphate (Graham et al. (1973) Virology 52 (2): 456–67, Bacchetti et al. (1977) Proc. Natl. Acad. Sci. USA, 74 (4): 1590–4, and Kriegler, M (1991). Transfer and Expression: A Laboratory Manual. New York: WH Freeman and Company, pp. 96–97); dendrimers or cationic polymers,such as DEAE-dextran or polyethyleneimine. Non-chemical methods include electroporation, sonoporation, and optical transfection. Particle-based transfection includes the use of a gene gun or magnetic transfection (Bertram (2006) Current Pharmaceutical Biotechnology 7, 277-28). Viral methods can also be used for transfection.

[00219] The introduction of nucleic acids or proteins into a cell or non-human animal can also be mediated by electroporation, intracytoplasmic injection, viral infection, adenovirus, adeno-associated virus, lentivirus, retrovirus, transfection, lipid-mediated transfection, or nucleofection. Nucleofection is an improvement on electroporation that allows the delivery of nucleic acid substrates not only into the cytoplasm but also across the nuclear membrane and into the nucleus. Besides,The use of nucleofection in the methods described herein typically requires far fewer cells than conventional electroporation (e.g., only approximately 2 million compared to 7 million for conventional electroporation). As an example, nucleofection is performed using the LONZA® NUCLEOFECTOR™ System.

[00220] Introduction of nucleic acids or proteins into a cell can also be accomplished by microinjection. Microinjection of mRNA is preferably performed into the cytoplasm (e.g., to deliver mRNA directly into the cellular translation system), whereas microinjection of a protein or DNA encoding a protein is preferably performed into the nucleus. Alternatively, microinjection can be performed by injection into both the nucleus and the cytoplasm: the needle can first be inserted into the nucleus and a first amount can be injected,and upon withdrawal of the needle from the cell, a second amount can be injected into the cytoplasm. Methods for performing microinjections are well known. See, for example, Nagy et al. (Nagy A, Gertsenstein M, Vintersten K, Behringer R., 2003, Manipulating the Mouse Embryo. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Meyer et al. (2010) Proc. Natl. Acad. Sci. USA 107:15022–15026 and Meyer et al. (2012) Proc. Natl. Acad. Sci. USA 109:9354–9359.

[00221] Other methods of introducing nucleic acid or proteins into a cell or non-human animal may include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid nanoparticle-mediated delivery, penetrating peptide-mediated delivery, or implantable device-mediated delivery. Methods of introducing nucleic acids or proteins into a subject for in vivo cell modification are described herein.

[00222] In one example, a first nucleic acid,encoding a 4R tau isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau isoform linked to a second reporter protein may be introduced via viral transduction, such as lentiviral transduction or AAV transduction.

[00223] Screening for non-human cells or animals containing a 4R tau isoform linked to a first reporter protein and a 3R tau isoform linked to a second reporter protein may be performed by any known method.

[00224] As one example, reporter genes can be used to screen for non-human cells or animals that have a 4R tau isoform linked to a first reporter protein and a 3R tau isoform linked to a second reporter. Illustrative reporter genes include genes encoding luciferase, β-galactosidase, green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP),Cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (eYFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (eBFP), DsRed, ZsGreen, MmGFP, mPlum, mCherry, tdTomato, mStrawberry, J-Red, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, Cerulean, T-Sapphire, and alkaline phosphatase. For example, if the first reporter and the second reporter are fluorescent proteins (e.g., mCherry and eYFP), cells containing these reporters can be selected using flow cytometry technology to select double-positive cells. These double-positive cells can then be pooled to generate a polyclonal line, or monoclonal lines can be generated from single double-positive cells.

[00225] As another example, selectable markers can be used to screen cells that contain the 4R tau protein isoform associated with the first reporter protein,and the 3R tau isoform associated with a second reporter protein. Examples of selection markers include neomycin phosphotransferase (neo, r ), hygromycin-B-phosphotransferase (hyg r ), puromycin-M-acetyltransferase (puro r ), blasticidin-S-deaminase (bsr 1), xanthine-guanine phosphoribosyltransferase (gpt), or herpes simplex virus thymidine kinase (HSV-k). Another illustrative selection marker is the bleomycin resistance protein encoded by the Sh ble gene (the bleomycin gene from Streptoalloteichus hindustanus), which confers resistance to zeocin (phleomycin D1).

[00226] Various other methods have been proposed for producing a non-human animal comprising a 4R tau isoform linked to a first reporter protein and a 3R tau isoform linked to a second reporter protein, or a first nucleic acid encoding a 4R tau isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau isoform linked to a second reporter protein. Any convenient method or protocol for producing a genetically modified organism is suitable for producing such a genetically modified non-human animal. See, for example,Poueymirou et al. (2007) Nat. Biotechnol. 25(l):91-99; US 7,294,754; US 7,576,259; US 7,659,442; US 8,816,150; US 9,414,575; US 9,730,434 and US 10,039,269, the entire contents of each document are incorporated herein by reference for all purposes (description of mouse ES cells and the VELOCIMOUSE® method for producing a genetically modified mouse). See also US 2014 / 0235933 A1, US 2014 / 0310828 A1, each of which is incorporated herein by reference in its entirety for all purposes (description of rat ES cells and methods for producing a genetically modified rat). See also Cho et al. (2009) Curr. Protoc. Cell. Biol. 42:19.11.1–19.11.22 (doi: 10.1002 / 0471143030.cbl911s42) and Gama Sosa et al. (2010) Brain Struct. Funct. 214(2–3):91 109, each of which is incorporated herein by reference in its entirety for all purposes.

[00227] For example, a method for producing a non-human tau reporter animal as described herein,may include: (1) providing a pluripotent cell (e.g., an embryonic stem (ES) cell, such as a mouse ES cell or a rat ES cell) comprising a first nucleic acid encoding a 4R tau isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau isoform linked to a second reporter protein; (2) introducing the genetically modified pluripotent cell into a non-human host animal embryo; and (3) gestating the host embryo in a surrogate mother.

[00228] As another example, a method for producing a non-human tau reporter animal as described herein may comprise: (1) modifying the genome of a pluripotent cell (e.g., an embryonic stem (ES) cell, such as a mouse ES cell or a rat ES cell) to include a first nucleic acid encoding a 4R tau isoform associated with a first reporter protein and a second nucleic acid,encoding a 3R tau isoform linked to a second reporter protein; (2) identifying or selecting a genetically modified pluripotent cell comprising a first nucleic acid encoding a 4R tau isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau isoform linked to a second reporter protein; (3) introducing the genetically modified pluripotent cell into a non-human host animal embryo; and (4) gestation of the host embryo in a surrogate mother. The donor cell may be introduced into the host embryo at any stage, such as the blastocyst stage or the premorula stage (i.e., the 4-cell stage or the 8-cell stage). Optionally, a host embryo containing a modified pluripotent cell (e.g., a non-human ES cell) may be incubated to the blastocyst stage before implantation and gestation in a surrogate mother to produce an animal,non-human, F0 generation. Then, using a surrogate mother, a non-human animal of the F0 generation can be produced that contains the 4R tau isoform linked to a first reporter protein and the 3R tau isoform linked to a second reporter protein, or a first nucleic acid encoding the 4R tau isoform linked to a first reporter protein and a second nucleic acid encoding the 3R tau isoform linked to a second reporter protein. The non-human animal may be capable of transmitting the first nucleic acid encoding the 4R tau isoform linked to the first reporter protein and the second nucleic acid encoding the 3R tau isoform linked to the second reporter protein through the germ line.

[00229] Alternatively, a method for producing the non-human tau reporter animals described herein may comprise: (1) modifying the genome of a one-cell stage embryo so thatto comprise a first nucleic acid encoding a 4R tau isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau isoform linked to a second reporter protein, using the methods described above for modifying pluripotent cells; (2) selecting a genetically modified embryo; and (3) growing the genetically modified embryo in a surrogate mother. Offspring capable of transmitting the genetic modification through the germ line are obtained.

[00230] Nuclear transfer techniques may also be used to generate non-human mammals. Briefly, nuclear transfer techniques may include the following steps: (1) enucleating an oocyte or providing an enucleated oocyte; (2) isolating or providing a donor cell or nucleus,which are to be united with the enucleated oocyte; (3) inserting a cell or nucleus into the enucleated oocyte to form a reconstituted cell; (4) implanting the reconstituted cell into the uterus of the animal to form an embryo; and (5) allowing the embryo to develop. In such methods, oocytes are usually obtained from deceased animals, although they can also be isolated from the fallopian tubes and / or ovaries of living animals. Prior to enucleation, oocytes can be matured in a variety of well-known environments. Removal of the nucleus from the oocyte can be accomplished by a number of well-known methods. Insertion of a donor cell or nucleus into an anucleated oocyte to form a reconstituted cell can be accomplished by microinjection of the donor cell under the zona pellucida prior to fusion. Fusion can be induced by the application of a direct current electrical pulse across the contact / fusion plane (electrofusion), by exposing the cells to fusion-promoting chemicals such as polyethylene glycol,or via an inactivated virus, such as Sendai virus. The reconstituted cell can be activated by electrical and / or non-electrical means before, during, and / or after fusion of the donor nucleus and the recipient oocyte. Activation methods include electrical pulses, chemically induced shock, sperm penetration, increased levels of divalent cations in the oocyte, and decreased phosphorylation of cellular proteins (e.g., using kinase inhibitors) in the oocyte. Activated reconstituted cells or embryos can be cultured in well-known media and then transferred into the animal's uterus. See, for example, US 2008 / 0092249, WO 1999 / 005266, US 2004 / 0177390, WO 2008 / 017234, and US 7612250, each of which is incorporated herein by reference in its entirety for all purposes.

[00231] A modified cell or single-cell stage embryo can be created, for example,by recombination by (a) introducing into a cell one or more exogenous donor nucleic acids (e.g., targeting vectors) comprising a nucleic acid insert flanked by, for example, 5' and 3' homologous arms corresponding to 5' and 3' target sites (e.g., target sites flanking endogenous sequences intended for deletion and replacement by the nucleic acid insert), wherein the nucleic acid insert(s) comprises a first nucleic acid encoding a 4R isoform of tau protein associated with a first reporter protein, and a second nucleic acid encoding a 3R isoform of tau protein associated with a second reporter protein; and (b) identifying at least one cell comprising in its genome a first nucleic acid encoding the 4R tau protein isoform associated with a first reporter protein and a second nucleic acid encoding the 3R tau protein isoform,linked to a second reporter protein. Similarly, a modified genome of a non-human animal or a humanized target locus of a non-human animal can be produced, for example, by recombination by (a) contacting the genome or gene with one or more exogenous donor nucleic acids (e.g., targeting vectors) comprising 5' and 3' homologous arms corresponding to 5' and 3' target sites, for example, target sites flanking endogenous sequences intended for deletion and replacement with one or more insertion nucleic acids (e.g., a first nucleic acid encoding the 4R tau isoform linked to a first reporter protein and a second nucleic acid encoding the 3R tau isoform linked to a second reporter protein). Optionally, a nuclease agent targeting endogenous sequences may be introduced together with the exogenous donor nucleic acid,designed for deletions. Any nuclease agent that causes a nick or double-strand break at the desired recognition site can be used. Examples of suitable nucleases include transcription activator-like effector nuclease (TALEN), zinc finger nuclease (ZFN), meganuclease, and clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems (e.g., CRISPR / Cas9 systems) or components of such systems (e.g., CRISPR / Cas9). See, e.g., US 2013 / 0309670 and US 2015 / 0159175, each of which is incorporated by reference herein in its entirety for all purposes. In one example, the nuclease comprises the Cas9 protein and guide RNA. In another example, the nuclease comprises a Cas9 protein and two or more, three or more, or four or more guide RNAs.

[00232] Exogenous donor nucleic acids may be destined for insertion mediated by non-homologous end joining,or for homologous recombination. Exogenous donor nucleic acids may include deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), they may be single-stranded or double-stranded, and they may be linear or circular. For example, the donor nucleic acid may be a single-stranded oligodeoxynucleotide (ssODN). Exogenous donor nucleic acids may also contain a heterologous sequence that is not present at the non-target endogenous locus. For example, an exogenous donor nucleic acid may contain a selection cassette, such as a selection cassette flanked by recombinase recognition sites.

[00233] In cells other than single-cell stage embryos, the exogenous donor nucleic acid may be a "large targeting vector" (LTVEC), which includes targeting vectors containing homologous arms that correspond to nucleic acid sequences,LTVECs are comprised of, and derived from, nucleic acid inserts that are longer than those typically used in other approaches designed to effect homologous recombination in cells. See, for example, US 2004 / 0018626; WO 2013 / 163394; US 9,834,786; US 10,301,646; WO 2015 / 088643; US 9,228,208; US 9,546,384; US 10,208,317, and US 2019-0112619, each of which is incorporated herein by reference in its entirety for all purposes. LTVECs also include targeting vectors containing nucleic acid inserts that have nucleic acid sequences that are longer than those typically used in other approaches designed to effect homologous recombination in cells. For example, LTVECs enable the modification of large loci that cannot be covered by traditional plasmid-based targeting vectors due to their size limitations. For example, the target locus can be (i.e., the 5' and 3' homology arms can match) a cell locus,which cannot be targeted by a conventional method, or which can be targeted only incorrectly or only with very low efficiency in the absence of a nick or double-strand break caused by a nuclease agent (e.g., a Cas protein). LTVECs can be of any length and are typically at least 10 kbp long. The 5' homology arm and the 3' homology arm in LTVECs together are typically at least 10 kbp. The production and use of large targeting vectors (LTVECs) derived from bacterial artificial chromosome (BAC) DNA by bacterial homologous recombination (BHR) reactions using VELOCIGENE® genetic engineering technology is described, for example, in US 6586251 and Valenzuela et al. (2003) Nat. Biotechnol. 21(6):652–659, each of which is incorporated herein by reference in its entirety for all purposes. The creation of LTVECs using in vitro assembly methods is described, for example,

[00234] The methods may further include identifying a cell or animal having a modified target genomic locus. Various methods may be used to identify cells and animals having a target genetic modification. The screening step may include, for example, a quantitative assay to determine allele modifications (AMs) of the reference chromosome. See, for example, US 2004 / 0018626; US 2014 / 0178879; US 2016 / 0145646; WO 2016 / 081923 and Frendewey et al. (2010 Methods Enzymol. 476:295–307, each of which is incorporated herein by reference in its entirety for all purposes. For example, quantitative analysis can be performed using quantitative PCR, such as real-time PCR (qPCR). Real-time PCR can use a first set of primers that recognizes the target locus,and a second set of primers that recognizes the non-target reference locus. The set of primers may include a fluorescent probe that recognizes the amplified sequence. Other examples of suitable quantitative assays include fluorescence in situ hybridization (FISH), comparative genomic hybridization, isothermal DNA amplification, quantitative hybridization with immobilized probe(s), INVADER® probes, TAQMAN® Molecular Beacon probes, or ECLIPSE™ probe technology (see, e.g., US 2005 / 0144655, incorporated herein by reference in its entirety for all purposes).

[00235] The various methods provided herein enable the production of a genetically modified non-human F0 animal, wherein the cells of the genetically modified F0 animal comprise a first nucleic acid encoding a 4R tau isoform linked to a first reporter protein and a second nucleic acid,encoding the 3R tau isoform linked to a second reporter protein. It should be understood that, depending on the method used to produce the F0 animal, the number of cells in the body of the F0 animal that have a first nucleic acid encoding the 4R tau isoform linked to a first reporter protein and a second nucleic acid encoding the 3R tau isoform linked to a second reporter protein will vary. For example, in the case of mice, the introduction of donor ES cells into a mouse embryo at the premorula stage (e.g., an 8-cell mouse embryo), for example, using the VELOCIMOUSE method, ®, allows to obtain a higher percentage of the F0 mouse cell population containing cells having the target genetic modification. For example, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 85%, at least 86%, at least 87%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% of the cells of the non-human F0 animal may contain a population of cells with the target modification.The cells of the genetically modified F0 animal may be heterozygous for a first nucleic acid encoding a 4R tau protein isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau protein isoform linked to a second reporter protein, or may be homozygous for a first nucleic acid encoding a 4R tau protein isoform linked to a first reporter protein and a second nucleic acid encoding a 3R tau protein isoform linked to a second reporter protein.

[00236] All patent documents, websites, other publications, accession numbers, and the like cited above or below are incorporated by reference in their entirety for all purposes to the same extent as if each individual item was specifically and individually indicated to be incorporated by reference.If different versions of a sequence are associated with a particular accession number at different times, the version associated with the accession number on the effective filing date of the application is considered to be the version. The effective filing date is the earlier of the actual filing date or the filing date of the priority application containing the accession number reference, if applicable. Similarly, if different versions of a publication, website, etc. are published at different times, the version most recently published on the effective filing date of the application is considered to be the version considered to be the version most recently published on the effective filing date of the application, unless otherwise indicated. Any feature, step, element, embodiment, or aspect of the invention may be used in combination with any other, unless otherwise specifically indicated.While the present invention has been described in some detail by means of illustrations and examples for the purpose of clarity and understanding, it is obvious that certain changes and modifications can be made within the scope of the appended claims. BRIEF DESCRIPTION OF SEQUENCES

[00237] The nucleotide and amino acid sequences listed in the appended sequence listing are presented using standard letter abbreviations for nucleotide bases and a three-letter code for amino acids. The nucleotide sequences follow the standard convention of being listed starting from the 5' end of the sequence and moving toward the 3' end (i.e., from left to right on each line). Only one strand of each nucleotide sequence is shown, but the complementary strand is intended to be included by any reference to the strand shown.When a nucleotide sequence encoding an amino acid sequence is presented, it is implied that variants with degenerate codons encoding the same amino acid sequence are also presented. Amino acid sequences follow a standard convention: they are presented starting from the amino terminus of the sequence and moving toward the carboxyl terminus (i.e., from left to right in each line). EXAMPLESExample 1. Development of a Cell-Based Screening Assay to Discriminate Reagents Targeting 4R versus 3R Tau

[00239] The human MAPT gene encodes six different tau isoforms: 2N4R, 1N4R, 0N4R, 2N3R, 1N3R, 0N3R. See Fig. 1. The distinction between 4R (4-repeat) and 3R (3-repeat) tau-containing transcripts is due to the inclusion (4R) or exclusion (3R) of exon 10. In humans, 3R and 4R tau are normally expressed in equal ratios. In some tauopathies, such as Alzheimer's disease, experimental data from postmortem studies of brain tissue indicate that insoluble tau aggregates consist of 3R and 4R tau proteins. In rarer tauopathies, such as progressive supranuclear palsy (PSP) and corticobasal degeneration (CBD), 4R tau proteins represent aggregation-prone forms of tau protein. The underlying mechanisms for the formation of these differentiated aggregate types in these diseases are unknown.Therapies that target total tau (e.g., 3R+4R tau), rather than just 4R tau, may have beneficial effects across a variety of disease states.

[00240] One of the major challenges to date is the development of assays to measure mRNA for different tau isoforms. For example, the R / repeat domain of tau complicates the design of TaqMan primer-probe pairs to measure 3R tau. This lack of assays that measure specific tau isoforms makes it difficult to accurately test the specificity of reagents (e.g., siRNAs) that should reduce only 4R tau and not 3R tau, compared to reagents (e.g., siRNAs) that should reduce both tau proteins (e.g., a total tau targeting strategy).

[00241] For example, the inventors wanted to identify siRNAs targeting 4R tau, but the lack of mRNA assays for measuring 3R tau made this type of screening impossible. To circumvent this problem, the inventors created a cell-based screening assay to identify compounds (e.g., siRNAs or gRNAs) that target total tau, as opposed to compounds that specifically target 4R tau. The assay involved generating a secondary cell line (e.g., HEK293) that expressed fluorescently labeled 4R and 3R tau fusion proteins. More specifically, the HEK293 cell line equally expressed both xN4R-tau-eYFP and xN3R-Tay-mCherry (where xN = ON, IN, or 2N), providing a simple and reliable system for screening compounds that specifically target 4R tau. Furthermore, the fusion messenger RNA and protein can be used as a surrogate for the reduction of each form of tau.For example, an siRNA that targets 4R tau should reduce four measures: (1) 4R tau mRNA using 4R-specific TaqMan probes; (2) eYFP mRNA using eYFP-specific TaqMan probes; (3) eYFP protein levels (e.g., as measured by any protein detection assay (Western blot, ELISA)); and (4) eYFP fluorescence. Alternatively, an siRNA that also reduces 3R tau should affect the following: (1) mCherry messenger RNA using mCherry-specific TaqMan probes; (2) mCherry protein levels (e.g., as measured by any protein detection assay (Western blot, ELISA)); and (3) mCherry fluorescence.

[00242] This cell line can be used to screen for a variety of therapeutic modalities, including siRNA, gRNA, and intrabodies (intracellular antibodies). Intrabodies may be suitable for the intracellular degradation of cytoplasmic proteins.For example, an intrabody that targets tau 4R or tau 3R should reduce yellow (eYFP) or red (mCherry) protein signals, respectively.

[00243] To generate the cell line, full-length human tau 2N4R (NCBI accession number: NM_005910.6) and tau 2N3R (NCBI accession number: NM_001203252.2) were cloned into the pLvX vector in frame with eYFP or mCherry, generating 2N4R-eYFP and 2N3R-mCherry fusion proteins. The fusion protein coding sequences were operably linked to the EF1A promoter. The plasmid DNA was packaged into lentiviruses. The 2N4R-eYFP fusion protein is shown as SEQ ID NO: 15 and is encoded by the sequence shown as SEQ ID NO: 19. The 2N3R-mCherry fusion protein is shown as SEQ ID NO: 16 and is encoded by the sequence shown as SEQ ID NO: 20.

[00244] HEK293 cells were grown to 80% confluence in 24-well plates and cultured in 10% fetal bovine serum in high glucose DMEM.The cells were then transduced with lentivirus carrying 2N4R-eYFP. After 3 days, eYFP+ cells were sorted individually into individual wells for expansion of clonal cell lines. Once the eYFP+ cells reached confluence, five cell lines were selected for subsequent cryopreservation and further expansion by transduction with lentivirus carrying 2N3R-mCherry. After an additional 3 days, eYFP+ mCherry+ cells were sorted individually into individual wells in 96-well plates and grown for approximately two weeks to identify surviving clones that continued to proliferate. Twenty different eYFP / mCherry double-positive clonal cell lines were generated and used for subsequent screening in TaqMan assays. Three 2N4R-eYFP / 2N3R-mCherry cell lines (clones C2, C3, and C5) expressed an approximate 1:1 ratio of eYFP and mCherry mRNA. See Fig. 2.Clone C3 was chosen as it had a high copy number of 2N4R-eYFP and 2N3R mCherry RNA and similar relative expression levels of each. See Fig. 3.

[00245] HEK293 cells with 2N4R-eYFP / 2N3R-mCherry were cultured in complete medium (DMEM, 10% FBS, penicillin, streptomycin, GlutaMax, G418, and hygromycin) at 37°C, 5% CO2. To show that eYFP and mCherry could serve as representatives of tau 4R and tau 3R levels, respectively, cells with the dual 2N4R-eYFP / 2N3R-mCherry reporters were seeded in a 24-well plate at 1.6 × 10. 5cells / well. On the day of transfection (-70% confluence), complete medium was aspirated from each well and replaced with 450 µl OptiMEM. Duplex siRNA solutions were diluted in OptiMem to 200 nM, 20 nM, and 2 nM. Lipofectamine RNAMax was diluted in OptiMem according to the manufacturer's protocol (3 µl Lipofectamine / 50 µl medium). Equal volumes of duplex siRNA solutions and diluted Lipofectamine solutions were combined (10x siRNA / lipid solution), mixed, and incubated at room temperature for at least 5 min. Fifty µl of each 10x siRNA / lipid solution was added to the corresponding well of a 24-well plate in triplicate. The plates were then returned to the incubator for 48 hours, after which immunofluorescence analysis was performed. Specifically, the cells were treated with either 10 nM siRNA to total tau (targeting both 3R and 4R isoforms) or 10 nM siRNA to mCherry (HAIJE-000013; SEQ ID NOs: 1 and 2). After 48 hours, eYFP and mCherry immunofluorescence was measured.siRNA to mCherry decreased the mCherry signal, but the eYFP signal was unchanged. In contrast, siRNA to total tau decreased both the eYFP and mCherry signal intensities. See Fig. 4.

[00246] A similar experiment was then performed using 10 nM siRNA to mCherry (HAIJE-000015 (SEQ ID NOs: 3 and 4) or HAIJE-000017 (SEQ ID NOs: 5 and 6)) or 10 nM siRNA to YFP (P-002048-01; SEQ ID NOs: 7 and 8). Both siRNAs to mCherry decreased the mCherry signal intensities but not the eYFP signal intensities, whereas siRNA to YFP decreased the eYFP signal intensities but not the mCherry signal intensities. See Fig. 5.

[00247] Next, potential 4R-specific siRNAs were designed by constructing 65 siRNAs along exon 10 of the M4RT gene, which encodes the R2 domain. The R2 domain is shown in SEQ ID NO: 21, and the coding sequence for the R2 domain is shown in SEQ ID NO: 22.Two siRNAs to total tau were designed as positive controls, siRNA to YFP was used as an eYFP knockdown control, and siRNA to mCherry was used as an mCherry knockdown control. Doses of 0.1 nM and 1 nM were tested in triplicate 24 hours after treatment. TaqMan assays were performed for total tau, 4R tau, mCherry, and eYFP.

[00248] To select 4R-specific or 4R-preferential siRNAs, parameters can be set, for example, as in Fig. 6. One could choose an siRNA that is specific only to 4R, such as an siRNA that consistently knocks down 4R tau and eYFP (e.g., at least a 75% reduction in mRNA) and has no effect on mCherry (e.g., ~0% reduction in mCherry mRNA). One could choose an siRNA that is preferential to 4R, such as an siRNA that consistently knocks down 4R tau and eYFP (e.g., at least a 70% reduction in mRNA) and has virtually no knockdown of mCherry (e.g., no more than a 30% reduction in mCherry mRNA).According to the 4R-preferential criteria, 13 of the 65 4R candidate siRNAs met the criteria when administered at the 1 nM dose (at 1 nM, no more than 30% of 4R tau signal and no more than 30% of mCherry knockdown remained). See Figure 7. We also found near-perfect correlation in TaqMan assays for 4R tau and eYFP, confirming the validity of eYFP as a proxy for 4R tau levels. See Figure 8. Similarly, mCherry was a reliable proxy for 3R tau levels.

[00249] The relative expression of 4R tau and mCherry for the 65 candidate 4R siRNA duplexes is shown in Figure 9A. HEK293-2N4R-YFP+2 N3R-mCherry cells were treated with 1 nM GalNAc-conjugated siRNA in Lipofectamine and harvested 48 hours later for TaqMan assays (for mCherry and eYFP). For each sample, the left column shows the 4R assay results, and the right column shows the mCherry assay results (as a 3R tau surrogate).The relative expression of 4R tau and mCherry for 13 selected siRNAs is shown in Fig. 9B. Solid bars represent samples treated with 1 nM siRNA, and hatched bars represent samples treated with 0.1 nM siRNA. The data confirmed that the cell line is a tool for screening 4R-specific reagents. Until now, screening 4R-specific reagents, such as siRNAs, was impossible due to the lack of protein and mRNA assays to measure 3R tau. To address this issue, we generated and validated the HEK293 2N4R-eYFP + 2N3R-mCherry dual-reporter fusion protein cell line to screen 4R-specific candidates.

[00250] A dose-response analysis was performed for each compound as described above using TaqMan to examine the relative expression of 4R tau and the relative expression of eYFP (a 4R tau surrogate), as well as the relative expression of mCherry (a 3R tau surrogate) using 3R / 4R dual reporter cells. The results for the two 4R tau-preferential siRNAs are shown in Fig. 10A, and the results for two additional 4R tau siRNA candidates are shown in Fig. 11A. The data indicate that the 4R-preferential siRNAs are highly specific for 4R tau, with little effect on 3R tau. However, given the sequence homology of the R2 domain to other R domains, we wanted to ensure that 4R-preferential siRNAs retain specificity when presented with only the 2N3R-mCherry target.Therefore, we performed an identical set of experiments in HEK293 2N3R-mCherry cells only, using the same dose ranges as in the dual-reporter cell line. No effect of the 4R-preferential siRNA molecules was detected when tested in this cell system (i.e., no knockdown of 2N3R-mCherry). See Figs. 10B and 11B. As a final control, we performed the same experiment in HEK293 2N4R-YFP cells only, where 4R-preferential siRNA activity was still observed. See Figs. 10C and 11C.

[00251] The same four tau 4R siRNAs were then validated for tau 4R knockdown using protein dot blotting with a commercially available antibody to total tau (mouse monoclonal antibody; clone Tau 12), antibody to tau 4R (mouse monoclonal antibody; clone 7D12.1), and antibody to tau 3R (mouse monoclonal antibody; clone 8E6 / C11).Antibodies were first validated to confirm specificity by blotting with recombinant 1N3R or 1N4R proteins (left panel in Fig. 12). HEK293 cells with the dual reporter were then treated with vehicle control or siRNA (1 nM for 48 hours) in Lipofectamine RNAiMax transfection reagent (diluted according to the manufacturer's instructions) (three 4R-preferential siRNAs and one mixed-selectivity siRNA). Lysates were collected in RIPA buffer supplemented with protease / phosphatase inhibitors, a total of 7 μg (for total tau dot blot), 21 μg (for 4R tau dot blot), or 7 μg (for 3R tau dot blot), placed in a dot blot device, and the blots were blotted with antibodies to total tau, 4R tau, and 3R tau. The results are shown in Fig. 12 and further confirm the suitability of the HEK293 2N4R-eYFP + 2N3R-mCherry dual reporter fusion protein cell line for screening 4R-specific candidates.

[00252] The inventors also validated the preferential knockdown of 4R tau by the same 4R tau siRNAs using ELISA-type protein assays. As shown in Fig. 13, a commercial ALPHALISA total tau kit (Perkin Elmer, Cat. #: AL271C) was used to measure total soluble tau according to the manufacturer's instructions, and 4R tau was measured using the PathScan ELISA kit from Cell Signaling Technologies (Cat. #: 29443). As predicted, 4R tau levels were lower than total tau levels, since the total tau assay measures levels of both 4R tau (should be reduced) and 3R tau (should be minimally affected or not affected at all). The 3R tau protein ELISA assay is used to quantify 3R tau protein levels. Flow cytometric analysis of eYFP and mCherry intensities is also performed to assess effects on protein levels.

[00253] The same 4R tau siRNAs were then tested in vivo in humanized MAPT mice to further validate the HEK293 2N4R-eYFP + 2N3R-mCherry dual reporter fusion protein cell line. siRNAs with identical targeting sequences were synthesized with C16 conjugates to ensure delivery to CNS cells. 300 μg of each siRNA were then injected intracerebrally and the siRNAs were allowed to incubate in vivo for 30 days. Naive and vehicle (artificial cerebrospinal fluid (aCSF)-treated mice were used as negative controls. TaqMan assays for total tau (to assess total 3R+4R tau levels) and 4R tau assays were performed, and the results are shown in Fig. 14.

[00254] Dot blots were performed using antibodies to total tau, tau 3R, and tau 4R on brain lysates from humanized MAPT mice injected with siRNA to tau 4R.Lysates were collected and a total of 1 μg / well (for total tau dot blot), 1 μg / well (for 4R tau dot blot), or 5 μg / well (for 3R tau dot blot) were placed in a dot blot device and blotted with antibodies to total tau, 4R tau, and 3R tau. Results confirmed preferential knockdown of 4R for the top 4 siRNAs (data not shown). RNAscope assays for the detection of 3R tau, 4R tau, and total tau mRNA are performed in neuronal cultures (in vitro) and in brain sections from mice treated with 4R tau-preferential siRNAs. Example 2. Development of an in vivo screening assay to discriminate between 4R tau-targeting reagents and 3R tau

[00255] A mouse model for in vivo testing of 4R siRNAs is being developed.Two constructs were virally introduced into tau knockout mice using AAV-PhPeB with the synapsin promoter (ensuring robust expression in central nervous system neurons): 1N4R Tay(R5L)-P2A-eYFP and 1N3R Tay(R5L)-P2A-mCherry. The fusion protein 1N4R Tay(R5L)-P2A-eYFP is shown as SEQ ID NO: 35 and is encoded by the sequence shown as SEQ ID NO: 36. The fusion protein 1N3R Tay(R5L)-P2A-mCherry is shown as SEQ ID NO: 41 and is encoded by the sequence shown as SEQ ID NO: 42. Similarly, two constructs were virally introduced into tau knockout mice using AAV-PhPeB with the synapsin promoter (ensuring robust expression in central nervous system neurons): 1N4R Tay(L237V)-P2A-eYFP and 1N3R Tay(L237V)-P2A-mCherry. The fusion protein 1N4R Tay(L237V)-P2A-eYFP is shown in SEQ ID NO: 37 and is encoded by the sequence shown in SEQ ID NO: 38.The fusion protein 1N3R Tay(L237V)-P2A-mCherry is shown in SEQ ID NO: 43 and is encoded by the sequence shown in SEQ ID NO: 44. Similarly, two constructs were virally introduced into tau knockout mice using AAV-PhPeB with the synapsin promoter (ensuring robust expression in central nervous system neurons): 1N4R Tay(G243V)-P2A-eYFP and 1N3R Tay(G243V)-P2A-mCherry. The 1N4R Tay(G243V)-P2A-eYFP fusion protein is shown in SEQ ID NO: 39 and is encoded by the sequence shown in SEQ ID NO: 40. The 1N3R Tay(G243V)-P2A-mCherry fusion protein is shown in SEQ ID NO: 45 and is encoded by the sequence shown in SEQ ID NO: 46. See Fig. 15. Similar to the in vitro cell line screening described above, eYFP and mCherry mRNA levels were used as surrogates for tau 4R and tau 3R mRNA levels, respectively.The difference is that, since the goal is to direct neuronal expression of aggregation-prone tau proteins, it is undesirable for eYFP and mCherry to interfere with the proper function / folding and microtubule binding of these aggregation-prone tau proteins. Therefore, each construct utilizes P2A, which results in the production of two proteins from a single mRNA molecule due to a ribosome-skipping site.

[00256] Mouse models are used to test candidate reagents targeting tau 4R using the assays described in Example 1. Behavioral measurements are performed to assess motor and ophthalmological impairments. Disease behavior and pathology, in particular tau aggregates, are assessed. <?xml version="1.0" encoding="UTF-8"?><!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing1.3 / / EN" "ST26SequenceListing_V1_3.dtd"><ST26SequenceListing originalFreeTextLanguageCode="en"nonEnglishFreeTextLanguageCode="ru" dtdVersion="V1_3"fileName="057766-590201.xml" softwareName="WIPO Sequence"softwareVersion="2.2.0" productionDate="2023-02-03">. <applicantfilereference> 057766 / 590201< / applicantfilereference> <earliestpriorityapplicationidentification> <ipofficecode>US< / ipofficecode> <applicationnumbertext> 63 / 309,055< / applicationnumbertext> <filingdate> 2022-02-11< / filingdate> < / earliestpriorityapplicationidentification> <applicantname languagecode="ru"> Regeneron Pharmaceuticals, Inc.< / applicantname> <applicantnamelatin> Regeneron Pharmaceuticals, Inc.< / applicantnamelatin> <inventiontitle languagecode="en"> COMPOSITIONS AND METHODS FORSCREENING 4R TAU TARGETING AGENTS< / inventiontitle> <inventiontitle languagecode="ru"> Compositions and methods for screening agents targeting 4R TAU protein< / inventiontitle> <sequencetotalquantity> 50< / sequencetotalquantity> <sequencedata sequenceidnumber="1"> <insdseq><INSDSeq_length>21< / INSDSeq_length><INSDSeq_moltype> RNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q1"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other RNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q2"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> gcaagggcgaggaggataatt< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="2"> <insdseq><INSDSeq_length>21< / INSDSeq_length><INSDSeq_moltype>RNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q3"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other RNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q4"><INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>ttatcctcctcgcccttgctt< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="3"> <insdseq><INSDSeq_length>21< / INSDSeq_length><INSDSeq_moltype>RNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q5"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other RNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q6"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>cctacaacgtcaacatcaatt< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="4"> <insdseq><INSDSeq_length>21< / INSDSeq_length><INSDSeq_moltype> RNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q7"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other RNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q8"><INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> ttgatgttgacgttgtaggtt< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="5"> <insdseq><INSDSeq_length>21< / INSDSeq_length><INSDSeq_moltype> RNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q9"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other RNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q10"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> tggacgagctgtacaagtatt< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="6"> <insdseq><INSDSeq_length>21< / INSDSeq_length><INSDSeq_moltype>RNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q11"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..21< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other RNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q12"><INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>tacttgtacagctcgtccatt< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="7"> <insdseq><INSDSeq_length>24< / INSDSeq_length><INSDSeq_moltype> RNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..24< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q13"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..24< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other RNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q14"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> ttgcaagctgaccctgaagttctt< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="8"> <insdseq><INSDSeq_length>24< / INSDSeq_length><INSDSeq_moltype>RNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..24< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q15"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..24< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other RNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q16"><INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>ttgaacttcagggtcagcttgctt< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="9"> <insdseq><INSDSeq_length>18< / INSDSeq_length><INSDSeq_moltype>AA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..18< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q17"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..18< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q18"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>EGRGSLLTCGDVEENPGP< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="10"> <insdseq><INSDSeq_length>19< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..19< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q19"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..19< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q20"><INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> ATNFSLLKQAGDVEENPGP< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="11"> <insdseq><INSDSeq_length>20< / INSDSeq_length><INSDSeq_moltype>AA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..20< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q21"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..20< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q22"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>QCTNYALLKLAGDVESNPGP< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="12"> <insdseq><INSDSeq_length>22< / INSDSeq_length><INSDSeq_moltype>AA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..22< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q23"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..22< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q24"><INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>VKQTLNFDLLKLAGDVESNPGP< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="13"> <insdseq><INSDSeq_length>441< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..441< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q25"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..441< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q26"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> MAEPRQEFEVMEDHAGTYGLGDRKDQGGYTMHQDQEGDTDAGLKESPLQTPTEDGSEEPGSETSDAKSTPTAEDVTAPLVDEGAPGKQAAAQPHTEIPEGTTAEEAGIGDTPSLEDEAAGHVTQARMVSKSKDGTGSDDKKAKGADGKTKIATPRGAAPPGQKGQANATRIPAKTPPAKTPPPSGEPPKSGDRSGYSSPGTPGSRSRTPSLPTPPTTREPKKVAVVRTPPKSPSSAKSRLQTAPVMPDPLDLKNVKSKIGSTENLKHQPGGGKVQIINKKLDLSNVQSKCGSKDNIKHVPGGGSVQIVYKPVDLSKVTSKCGSLGNHIHHKPGGGQVEVKSEKLDFKDRVQSKIGSLDNITHVPGGGNKIETHKLTFRENAKAKTDHGAEIVYKSPVVSGDTSPRHLSNVSTGSIDMVDSPQLATLADEVSASLAKQGL< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="14"> <insdseq><INSDSeq_length>410< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..410< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q27"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..410< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q28"><INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> MAEPRQEFEVMEDHAGTYGLGDRKDQGGYTMHQDQEGDTDAGLKESPLQTPTEDGSEEPGSETSDAKSTPTAEDVTAPLVDEGAPGKQAAAQPHTEIPEGTTAEEAGIGDTPSLEDEAAGHVTQARMVSKSKDGTGSDDKKAKGADGKTKIATPRGAAPPGQKGQANATRIPAKTPPAKTPPPSGEPPKSGDRSGYSSPGTPGSRSRTPSLPTPPTTREPKKVAVVRTPPKSPSSAKSRLQTAPVPMPDLKNVKSKIGSTENLKHQPGGGKVQIVYKPVDLSKVTSKCGSLGNHIHHKPGGGQVEVKSEKLDFKDRVQSKIGSLDNITHVPGGNKKIETHKLTFRENAKAKTDHGAEIVYKSPVVSGDTSPRHLSNVSTGSIDMVDSPQLATLADEVSASLAKQGL< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="15"> <insdseq><INSDSeq_length>680< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q29"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..441< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q30"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE - 2N4RTau< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE - tau protein 2N4R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>442..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q31"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -eYFP< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —eYFP< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q32"><INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="16"> <insdseq><INSDSeq_length>646< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..646< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q33"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..410< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q34"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE - 2N3RTau< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE - tau protein 2N3R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 411..646< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q35"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -mCherry< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —mCherry< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..646< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q36"><INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="17"> <insdseq><INSDSeq_length>1323< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1323< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q37"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1323< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q38"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="18"> <insdseq><INSDSeq_length>1230< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1230< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q39"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1230< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q40"><INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="19"> <insdseq><INSDSeq_length>2040< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q41"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1323< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q42"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> 2N4R Tau< / INSDQualifier_value><NonEnglishQualifier_value> tau protein 2N4R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1324..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q43"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> eYFP< / INSDQualifier_value><NonEnglishQualifier_value> eYFP< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q44"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="20"> <insdseq><INSDSeq_length>1938< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1938< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q45"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1230< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q46"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> 2N3R Tau< / INSDQualifier_value><NonEnglishQualifier_value> tau protein 2N3R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1231..1938< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q47"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> mCherry< / INSDQualifier_value><NonEnglishQualifier_value> mCherry< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1938< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q48"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="21"> <insdseq><INSDSeq_length>31< / INSDSeq_length><INSDSeq_moltype>AA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..31< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q49"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..31< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q50"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>KVQIINKKLDLSNVQSKCGSKDNIKHVPGGG< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="22"> <insdseq><INSDSeq_length>93< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..93< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q51"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..93< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q52"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> aaggtgcagataattaataagaagctggatcttagcaacgtccagtccaagtgtggctcaaaggataatatcaaacacgtcccgggaggcgg< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="23"> <insdseq><INSDSeq_length>412< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..412< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q53"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..412< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q54"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> MAEPLQEFEVMEDHAGTYGLGDRKDQGGYTMHQDQEGDTDAGLKESPLQTPTEDGSEEPGSETSDAKSTPTAEAEEAGIGDTPSLEDEAAGHVTQARMVSKSKDGTGSDDKKAKGADGKTKIATPRGAAPPGQKGQANATRIPAKTPPAKTPPSSGEPPKSGDRSGYSSPGTPGSRSRTPSLPTPPTREPKKVAVVRTPPKSPSSAKSRLQTAPVMPDPLDLKNVKSKIGSTENLKHQPGGGKVQIINKKLDLSNVQSKCGSKDNIKHVPGGGSVQIVYKPVDLSKVTSKCGSLGNHIHHKPGGGQVEVKSEKLDFKDRVQSKIGSLDNITHVPGGNKKIETHKLTFRENAKAKTDHGAEIVYKSPVVSGDTSPRHLSNVSTGSIDMVDSPQLATLADEVSASLAKQGL< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="24"> <insdseq><INSDSeq_length>381< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..381< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q55"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..381< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q56"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> MAEPLQEFEVMEDHAGTYGLGDRKDQGGYTMHQDQEGDTDAGLKESPLQTPTEDGSEEPGSETSDAKSTPTAEAEEAGIGDTPSLEDEAAGHVTQARMVSKSKDGTGSDDKKAKGADGKTKIATPRGAAPPGQKGQANATRIPAKTPPAKTPPSSGEPPKSGDRSGYSSPGTPGSRSRTPSLPTPPTTREPKKVAVVRTPPKSPSSAKSRLQTAPVMPDPLDLKNVKSKIGSTENLKHQPGGGKVQIVYKPVDLSKVTSKCGSLGNHIHHKPGGGQVEVKSEKLDFKDRVQSKIGSLDNITHVPGGNKKIETHKLTFRENAKAKTDHGAEIVYKSPVVSGDTSPRHLSNVSTGSIDMVDSPQLATLADEVSASLAKQGL< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="25"> <insdseq><INSDSeq_length>1236< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1236< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q57"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1236< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q58"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="26"> <insdseq><INSDSeq_length>1143< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1143< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q59"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1143< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q60"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="27"> <insdseq><INSDSeq_length>412< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..412< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q61"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..412< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q62"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> MAEPRQEFEVMEDHAGTYGLGDRKDQGGYTMHQDQEGDTDAGLKESPLQTPTEDGSEEPGSETSDAKSTPTAEAEEAGIGDTPSLEDEAAGHVTQARMVSKSKDGTGSDDKKAKGADGKTKIATPRGAAPPGQKGQANATRIPAKTPPAKTPPSSGEPPKSGDRSGYSSPGTPGSRSRTPSLPTPPTREPKKVAVVRTPPKSPSSAKSRLQTAPVMPDPLDLKNVKSKIGSTENVKHQPGGGKVQIINKKLDLSNVQSKCGSKDNIKHVPGGGSVQIVYKPVDLSKVTSKCGSLGNHIHHKPGGGQVEVKSEKLDFKDRVQSKIGSLDNITHVPGGGNKIETHKLTFRENAKAKTDHGAEIVYKSPVVSGDTSPRHLSNVSTGSIDMVDSPQLATLADEVSASLAKQGL< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="28"> <insdseq><INSDSeq_length>381< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..381< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q63"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..381< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q64"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> MAEPRQEFEVMEDHAGTYGLGDRKDQGGYTMHQDQEGDTDAGLKESPLQTPTEDGSEEPGSETSDAKSTPTAEAEEAGIGDTPSLEDEAAGHVTQARMVSKSKDGTGSDDKKAKGADGKTKIATPRGAAPPGQKGQANATRIPAKTPPAKTPPSSGEPPKSGDRSGYSSPGTPGSRSRTPSLPTPPTTREPKKVAVVRTPPKSPSSAKSRLQTAPVMPDPLDLKNVKSKIGSTENVKHQPGGGKVQIVYKPVDLSKVTSKCGSLGNHIHHKPGGGQVEVKSEKLDFKDRVQSKIGSLDNITHVPGGNKKIETHKLTFRENAKAKTDHGAEIVYKSPVVSGDTSPRHLSNVSTGSIDMVDSPQLATLADEVSASLAKQGL< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="29"> <insdseq><INSDSeq_length>1236< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1236< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q65"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1236< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q66"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="30"> <insdseq><INSDSeq_length>1143< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1143< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q67"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1143< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q68"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="31"> <insdseq><INSDSeq_length>412< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..412< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q69"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..412< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q70"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> MAEPRQEFEVMEDHAGTYGLGDRKDQGGYTMHQDQEGDTDAGLKESPLQTPTEDGSEEPGSETSDAKSTPTAEAEEAGIGDTPSLEDEAAGHVTQARMVSKSKDGTGSDDKKAKGADGKTKIATPRGAAPPGQKGQANATRIPAKTPPAKTPPSSGEPPKSGDRSGYSSPGTPGSRSRTPSLPTPPTTREPKKVAVVRTPPKSPSSAKSRLQTAPVMPDPLDLKNVKSKIGSTENLKHQPGVGKVQIINKKLDLSNVQSKCGSKDNIKHVPGGGSVQIVYKPVDLSKVTSKCGSLGNHIHHKPGGGQVEVKSEKLDFKDRVQSKIGSLDNITHVPGGGNKIETHKLTFRENAKAKTDHGAEIVYKSPVVSGDTSPRHLSNVSTGSIDMVDSPQLATLADEVSASLAKQGL< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="32"> <insdseq><INSDSeq_length>381< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..381< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q71"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..381< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q72"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> MAEPRQEFEVMEDHAGTYGLGDRKDQGGYTMHQDQEGDTDAGLKESPLQTPTEDGSEEPGSETSDAKSTPTAEAEEAGIGDTPSLEDEAAGHVTQARMVSKSKDGTGSDDKKAKGADGKTKIATPRGAAPPGQKGQANATRIPAKTPPAKTPPSSGEPPKSGDRSGYSSPGTPGSRSRTPSLPTPPTTREPKKVAVVRTPPKSPSSAKSRLQTAPVPMPDLKNVKSKIGSTENLKHQPGVGKVQIVYKPVDLSKVTSKCGSLGNHIHHKPGGGQVEVKSEKLDFKDRVQSKIGSLDNITHVPGGGNKIETHKLTFRENAKAKTDHGAEIVYKSPVVSGDTSPRHLSNVSTGSIDMVDSPQLATLADEVSASLAKQGL< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="33"> <insdseq><INSDSeq_length>1236< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1236< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q73"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1236< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q74"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="34"> <insdseq><INSDSeq_length>1143< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1143< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q75"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1143< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q76"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="35"> <insdseq><INSDSeq_length>680< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q77"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..412< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q78"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE - 1N4RTau< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE - tau protein 1N4R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>SITE< / INSDFeature_key><INSDFeature_location>5< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q79"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -Mutation< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —Mutation< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>413..419< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q80"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE - Furin-GSGlinker< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE - Furin - GSG linker< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>420..441< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q81"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -P2A< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —P2A< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>442..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q82"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -eYFP< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —eYFP< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q83"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="36"> <insdseq><INSDSeq_length>2040< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q84"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1236< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q85"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> 1N4R Tau< / INSDQualifier_value><NonEnglishQualifier_value> tau protein 1N4R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>13..15< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q86"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Mutation< / INSDQualifier_value><NonEnglishQualifier_value> Mutation< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1237..1257< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q87"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Furin-GSGlinker< / INSDQualifier_value><NonEnglishQualifier_value> Furin - GSG linker< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1258..1323< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q88"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value> P2A< / INSDQualifier_value><NonEnglishQualifier_value> P2A< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1324..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q89"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> eYFP< / INSDQualifier_value><NonEnglishQualifier_value> eYFP< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q90"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="37"> <insdseq><INSDSeq_length>680< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q91"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..412< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q92"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE - 1N4RTau< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE - tau protein 1N4R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>SITE< / INSDFeature_key><INSDFeature_location> 237< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q93"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -Mutation< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —Mutation< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>413..419< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q94"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE - Furin-GSGlinker< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE - Furin - GSG linker< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>420..441< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q95"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -P2A< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —P2A< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>442..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q96"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -eYFP< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —eYFP< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q97"><INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="38"> <insdseq><INSDSeq_length>2040< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q98"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1236< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q99"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> 1N4R Tau< / INSDQualifier_value><NonEnglishQualifier_value> tau protein 1N4R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>709..711< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q100"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Mutation< / INSDQualifier_value><NonEnglishQualifier_value> Mutation< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1237..1257< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q101"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Furin-GSGlinker< / INSDQualifier_value><NonEnglishQualifier_value> Furin - GSG linker< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1258..1323< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q102"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> P2A< / INSDQualifier_value><NonEnglishQualifier_value> P2A< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1324..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q103"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value> eYFP< / INSDQualifier_value><NonEnglishQualifier_value> eYFP< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q104"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="39"> <insdseq><INSDSeq_length>680< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q105"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..412< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q106"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE - 1N4RTau< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE - tau protein 1N4R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>SITE< / INSDFeature_key><INSDFeature_location> 243< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q107"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -Mutation< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —Mutation< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>413..419< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q108"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE - Furin-GSGlinker< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE - Furin - GSG linker< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>420..441< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q109"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -P2A< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —P2A< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>442..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q110"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -eYFP< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —eYFP< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..680< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q111"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="40"> <insdseq><INSDSeq_length>2040< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q112"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1236< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q113"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> 1N4R Tau< / INSDQualifier_value><NonEnglishQualifier_value> tau protein 1N4R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>727..729< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q114"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Mutation< / INSDQualifier_value><NonEnglishQualifier_value> Mutation< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1237..1257< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q115"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Furin-GSGlinker< / INSDQualifier_value><NonEnglishQualifier_value> Furin - GSG linker< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1258..1323< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q116"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> P2A< / INSDQualifier_value><NonEnglishQualifier_value> P2A< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1324..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q117"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> eYFP< / INSDQualifier_value><NonEnglishQualifier_value> eYFP< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..2040< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value> other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q118"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="41"> <insdseq><INSDSeq_length>646< / INSDSeq_length><INSDSeq_moltype> AA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..646< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q119"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 1..381< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q120"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE - 1N3RTau< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE - tau protein 1N3R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>SITE< / INSDFeature_key><INSDFeature_location>5< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q121"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -Mutation< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —Mutation< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>382..388< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q122"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE - Furin-GSGlinker< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE - Furin - GSG linker< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location>389..410< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q123"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -P2A< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —P2A< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>REGION< / INSDFeature_key><INSDFeature_location> 411..646< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q124"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> MISC_FEATURE -mCherry< / INSDQualifier_value><NonEnglishQualifier_value> MISC_FEATURE —mCherry< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..646< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name> mol_type< / INSDQualifier_name><INSDQualifier_value> protein< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q125"><INSDQualifier_name> organism< / INSDQualifier_name><INSDQualifier_value> syntheticconstruct< / INSDQualifier_value><NonEnglishQualifier_value> synthetic construction< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="42"> <insdseq><INSDSeq_length>1938< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1938< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q126"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value> Synthetic< / INSDQualifier_value><NonEnglishQualifier_value> Synthetic< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1..1143< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q127"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> 1N3R Tau< / INSDQualifier_value><NonEnglishQualifier_value> tau protein 1N3R< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>13..15< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q128"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Mutation< / INSDQualifier_value><NonEnglishQualifier_value> Mutation< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1144..1164< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q129"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> Furin-GSGlinker< / INSDQualifier_value><NonEnglishQualifier_value> Furin - GSG linker< / NonEnglishQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> <insdfeature><INSDFeature_key>misc_feature< / INSDFeature_key><INSDFeature_location>1165..1230< / INSDFeature_location><INSDFeature_quals> <insdqualifier id="q130"><INSDQualifier_name> note< / INSDQualifier_name><INSDQualifier_value> P2A< / INSDQualifier_value><...

Claims

1. A method for assessing the activity of a reagent targeting tau protein, comprising: (a) introducing a tau protein-targeting reagent into a cell containing a tau protein isoform with four repeats (4R) associated with a first reporter protein and a tau protein isoform with three repeats (3R) associated with a second reporter protein that is different from the first reporter protein; and (b) assessment of the activity of the tau-targeting reagent in the cell, and (I) the assessment includes measuring the expression of 4R tau isoform messenger RNA and the expression of a second reporter protein messenger RNA, wherein a greater relative decrease in the expression of 4R tau isoform messenger RNA compared to the expression of the second reporter protein messenger RNA after administration of the tau protein targeting reagent to the cell indicates that the tau protein targeting reagent is a 4R-preferential tau protein targeting reagent; (II) the assessment includes measuring the expression of messenger RNA of a first reporter protein and the expression of messenger RNA of a second reporter protein, wherein a greater relative decrease in the expression of messenger RNA of the first reporter protein compared to the expression of messenger RNA of the second reporter protein after introduction of the tau protein-targeting reagent into the cell indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent; or (III) the evaluation includes measuring the expression of the first reporter protein and the expression of the second reporter protein, wherein a greater relative decrease in the expression of the first reporter protein compared to the expression of the second reporter protein after introduction of the tau protein-targeting reagent into the cell indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent.

2. The method according to claim 1, wherein the activity of the tau-targeting reagent is assessed in comparison with a control cell into which the tau-targeting reagent is not administered, or is assessed in comparison with a cell before the administration of the tau-targeting reagent.

3. The method according to paragraph 1 or 2, in which (I) a decrease in the expression of the 4R tau protein isoform messenger RNA by at least 70% and a decrease in the expression of the second reporter protein messenger RNA by no more than 30% after administration of the tau protein targeting reagent to the cell indicates that the tau protein targeting reagent is a 4R-preferential tau protein targeting reagent; (II) a decrease in the expression of the messenger RNA of the first reporter protein by at least 70% and a decrease in the expression of the messenger RNA of the second reporter protein by no more than 30% after administration of the tau protein targeting reagent to the cell indicates that the tau protein targeting reagent is a 4R-preferential tau protein targeting reagent; or (III) a decrease in the expression of the first reporter protein by at least 70% and a decrease in the expression of the second reporter protein by no more than 30% after the introduction of the tau protein-targeting reagent into the cell indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent.

4. The method according to any one of paragraphs 1-3, in which (I) the 4R tau isoform and the 3R tau isoform are human; and / or (II) (a) the cell comprises a first fusion protein comprising a 4R tau isoform fused to a first reporter protein and a second fusion protein comprising a 3R tau isoform fused to a second reporter protein, wherein optionally the cell comprises a first nucleic acid encoding a first fusion protein and a second nucleic acid encoding a second fusion protein, wherein the cell expresses the first fusion protein and the second fusion protein; or (b) the cell comprises a first nucleic acid comprising a coding sequence for a 4R tau protein isoform and a coding sequence for a first reporter protein, and a second nucleic acid comprising a coding sequence for a 3R tau protein isoform and a coding sequence for a second reporter protein, wherein the cell expresses a 4R tau protein isoform, a 3R tau protein isoform, a first reporter protein and a second reporter protein, wherein the coding sequence of the tau protein isoform 4R and the coding sequence of the first reporter protein are optionally separated by the coding sequence of the first peptide 2A, and the coding sequence of the tau protein isoform 3R and the coding sequence of the second reporter protein are separated by the coding sequence of the second peptide 2A, wherein the first peptide 2A is optionally the first peptide P2A, and the second peptide 2A is the second peptide P2A.

5. The method according to paragraph 4, in which (I) the first nucleic acid and the second nucleic acid are integrated into the genome of the cell; and / or (II) (a) the cell comprises a viral vector comprising a first nucleic acid and a second nucleic acid, optionally, wherein the viral vector is a lentiviral vector or an adeno-associated virus (AAV) vector; or (b) the cell comprises a first viral vector comprising a first nucleic acid and a second viral vector comprising a second nucleic acid, wherein optionally the first viral vector and the second viral vector are lentiviral vectors or adeno-associated virus (AAV) based vectors.

6. The method according to any one of claims 1-5, wherein the cell is a mammalian cell, optionally the cell is a human cell, the cell is an immortalized cell, and / or the cell is a HEK293 cell.

7. A method for assessing the activity of a tau-targeting reagent in vivo, comprising: (a) administering to a non-human animal a tau protein-targeting reagent comprising a four-repeat (4R) tau protein isoform linked to a first reporter protein and a three-repeat (3R) tau protein isoform linked to a second reporter protein that is different from the first reporter protein; and (b) assessing the activity of a tau-targeting reagent in a non-human animal, wherein (I) wherein the assessment comprises measuring the expression of 4R tau isoform messenger RNA and the expression of a second reporter protein messenger RNA, wherein a greater relative reduction in the expression of 4R tau isoform messenger RNA compared to the expression of the second reporter protein messenger RNA following administration of a tau protein-targeting reagent to a non-human animal indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent; (II) wherein the evaluation comprises measuring the expression of messenger RNA of a first reporter protein and the expression of messenger RNA of a second reporter protein, wherein a greater relative decrease in the expression of messenger RNA of the first reporter protein compared to the expression of messenger RNA of the second reporter protein following administration of the tau protein-targeting reagent to a non-human animal indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent; or (III) wherein the evaluation comprises measuring the expression of a first reporter protein and the expression of a second reporter protein, wherein a greater relative decrease in the expression of the first reporter protein compared to the expression of the second reporter protein following administration of the tau protein-targeting reagent to a non-human animal indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent.

8. The method of claim 7, wherein the activity of the tau-targeting reagent is assessed in comparison to a non-human control animal that is not administered the tau-targeting reagent, or is assessed in comparison to a state prior to administration of the tau-targeting reagent.

9. The method according to paragraph 7 or 8, in which (I) a reduction in the expression of messenger RNA of the 4R tau isoform by at least 70% and a reduction in the expression of messenger RNA of a second reporter protein by no more than 30% following administration of a tau targeting reagent to a non-human animal indicates that the tau targeting reagent is a 4R-preferential tau targeting reagent; (II) a reduction in the expression of messenger RNA of the first reporter protein by at least 70% and a reduction in the expression of messenger RNA of the second reporter protein by no more than 30% following administration of the tau protein-targeting reagent to a non-human animal indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent; or (III) a reduction in the expression of the first reporter protein by at least 70% and a reduction in the expression of the second reporter protein by no more than 30% following administration of the tau protein-targeting reagent to a non-human animal indicates that the tau protein-targeting reagent is a 4R-preferential tau protein-targeting reagent.

10. The method according to any one of paragraphs 7-9, in which (I) the tau protein 4R isoform and the tau protein 3R isoform are human, optionally each tau protein 4R isoform and tau protein 3R isoform comprises an R5L mutation, an L237V mutation, or a G243V mutation, or optionally each tau protein 4R isoform and tau protein 3R isoform comprises an N279K mutation, an L284R mutation, or an S285R mutation; and / or (II) (a) the non-human animal comprises a first fusion protein comprising the 4R isoform of tau protein fused to a first reporter protein and a second fusion protein comprising the 3R isoform of tau protein fused to a second reporter protein, wherein, optionally, the non-human animal comprises a first nucleic acid encoding a first fusion protein and a second nucleic acid encoding a second fusion protein, wherein the non-human animal expresses the first fusion protein and the second fusion protein; or (b) a non-human animal comprises a first nucleic acid comprising a coding sequence for a 4R tau isoform and a coding sequence for a first reporter protein, and a second nucleic acid comprising a coding sequence for a 3R tau isoform and a coding sequence for a second reporter protein, wherein the non-human animal expresses a 4R tau isoform, a 3R tau isoform, a first reporter protein, and a second reporter protein, wherein the coding sequence of the tau protein isoform 4R and the coding sequence of the first reporter protein are optionally separated by the coding sequence of the first peptide 2A, and the coding sequence of the tau protein isoform 3R and the coding sequence of the second reporter protein are separated by the coding sequence of the second peptide 2A, wherein the first peptide 2A is optionally the first peptide P2A, and the second peptide 2A is the second peptide P2A.

11. The method according to claim 10, in which (i) the first nucleic acid and the second nucleic acid are inserted into the genome of a non-human animal; and / or (II) (a) the non-human animal comprises a viral vector comprising a first nucleic acid and a second nucleic acid, optionally, wherein the viral vector is a lentiviral vector or an adeno-associated virus (AAV) vector; or (b) the non-human animal comprises a first viral vector comprising a first nucleic acid and a second viral vector comprising a second nucleic acid, wherein optionally the first viral vector and the second viral vector are lentiviral vectors or adeno-associated virus (AAV) based vectors.

12. The method according to any one of paragraphs 7-11, in which (i) the non-human animal is a mammal, optionally the non-human animal is a rodent, optionally the non-human animal is a mouse, or the non-human animal is a rat; and / or (II) the 4R tau isoform, the first reporter protein, the 3R tau isoform, and the second reporter protein are expressed in neurons of the central nervous system of a non-human animal; and / or (III) the non-human animal contains filamentous inclusions of tau protein.

13. The method according to any one of paragraphs 1-12, in which (I) the first reporter protein is a first fluorescent reporter protein and the second reporter protein is a second fluorescent reporter protein, and the evaluation in step (b) involves immunofluorescence staining or flow cytometry; (II) the assessment in stage (b) includes assessment of tau protein hyperphosphorylation or tau protein aggregation; (III) the tau protein-targeting reagent is an RNAi agent or an antisense oligonucleotide; (IV) the tau-targeting reagent is an intrabody; or (V) the tau protein targeting reagent is a nuclease agent, wherein optionally the nuclease agent comprises a Cas protein and a guide RNA designed to target a target sequence of the guide RNA in a sequence encoding the tau protein.

14. The method according to any one of paragraphs 1-13, in which (I) the first reporter protein is a first fluorescent reporter protein, and the second reporter protein is a second fluorescent reporter protein, wherein optionally the first reporter protein is eYFP and the second reporter protein is mCherry; and / or (II) (a) the 4R tau protein isoform is 2N4R tau protein, and wherein the 3R tau protein isoform is 2N3R tau protein, wherein optionally the 4R tau protein isoform comprises the sequence presented in SEQ ID NO: 13 and the 3R tau protein isoform comprises the sequence presented in SEQ ID NO: 14; or (b) the 4R tau protein isoform is 1N4R tau protein, and wherein the 3R tau protein isoform is 1N3R tau protein, optionally the 4R tau protein isoform comprises the sequence presented in SEQ ID NO: 23, 27, 31 or 47, and the 3R tau protein isoform comprises the sequence presented in SEQ ID NO: 24, 28, 32 or 49.

Images