Transgenic object of corn mon95275 and methods for its detection and use

Abstract

FIELD: biotechnology.SUBSTANCE: product containing a detectable amount of recombinant DNA molecules containing a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10; and the full complement of any of the above.EFFECT: reliable as a food product.9 cl, 3 dwg, 22 tbl, 9 ex

Description

LINK TO RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 014771, filed April 24, 2020, which is incorporated herein by reference in its entirety.INCLUSION OF SEQUENCE LISTING

[0002] The size of the sequence listing contained in the file named MONS480WO_ST25.txt is 83283 bytes (measured on Microsoft Windows®), it was generated on April 20, 2021, and is provided herein in electronic form and incorporated by reference.TECHNICAL FIELD

[0003] The invention relates to recombinant DNA molecules present in and / or isolated from the maize event MON95275. The invention also relates to transgenic maize plants, plant parts and seeds, pollen, cells and agricultural products containing the maize event MON95275, as well as methods for using them and detecting the presence of the maize event MON95275 in samples containing maize. Transgenic maize plants, plant parts, seeds and cells containing the DNA of the maize event MON95275 exhibit resistance to infestation by insects of the Coleoptera family. BACKGROUND OF THE INVENTION

[0004] Corn (Zea mays) is an important agricultural crop and a primary food source in many regions of the world. Biotechnology has been applied to corn to improve its agronomic properties and product quality. One such agronomic trait is insect resistance, achieved through the insertion of a recombinant DNA segment into the corn plant genome.

[0005] There are a number of different maize transgenic events described in the art that confer different types of resistance to insects, especially to Lepidoptera or Coleoptera species, and they include MON810, TC1507, MON89034, MON95379, and MIR162 among those that confer resistance to Lepidoptera, and MON863, MON88017, DAS-59122-7, DP-004114-3, DP23211, and MIR604 among those that confer resistance to Coleoptera, especially resistance to infestation by corn rootworm. These transgenic events have been used commercially in various geographic regions around the world for a long period of time, often using the same or similar toxins as those used in previously used transgenic events, and resistance to the toxins expressed in these events by target insect pests has been observed in many of the geographic regions where they have been used.

[0006] Therefore, there is a continuing need in the art to create new transgenic events of corn that exhibit resistance to insect infestation, and preferably, the new transgenic events confer resistance to target insects, including those races that have developed resistance to existing commercially used traits, using modes of action that do not overlap and are not similar to the modes of action previously used in earlier commercial embodiments. The inventions described herein are one example of such a new transgenic event that confers resistance to infestation by the corn rootworm, including resistance to rootworms that have developed resistance to commercial embodiments that were previously used. SUMMARY OF THE INVENTION

[0007] In one embodiment, the invention relates to a new transgenic corn event, MON95275, which provides insecticidal control of coleopteran pests of corn. In another embodiment, the invention also relates to transgenic plants, plant cells, seeds, plant parts, pollen, and commercial products that contain DNA that is specifically and identifiably present in the corn event MON95275 and is not present in corn that does not contain this particular event. This event-specific DNA is the inserted transgenic DNA and new DNA segments, which are described herein as junctional sequences formed at the chromosomal breakpoints into which the inserted DNA was introduced.In another embodiment, the invention relates to polynucleotides specific for the maize event MON95275 and a plant, plant cells, seeds, plant parts, pollen, plant progeny, and commercial products containing the DNA of the event MON95275. In yet another embodiment, methods are provided that are associated with the ability to select and detect the presence (or absence) of the maize event MON95275 in a sample, such methods allowing a researcher to confirm whether or not the DNA of the event is present in a particular sample subjected to the method.

[0008] Thus, in one aspect, the invention relates to a recombinant DNA molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, and a complete complement thereof.

[0009] In one embodiment, the recombinant DNA molecule is derived from corn containing the corn event MON95275 in a seed sample that has been deposited in the American Type Culture Collection (ATCC) repository and designated by accession number PTA-126049.

[0010] In another aspect, the invention relates to a DNA molecule comprising a polynucleotide segment of sufficient length to function as a DNA probe that specifically hybridizes under stringent hybridization conditions to the DNA of the maize event MON95275 in a sample, wherein detection of hybridization of the probe to the DNA of the maize event under stringent hybridization conditions is diagnostic for confirming the presence of the DNA of the maize event MON95275 in the sample.In certain embodiments, the sample includes a corn plant, a corn plant cell, a corn seed, a corn plant part, corn pollen, the progeny of any of the foregoing, processed corn seed, animal feed containing corn, corn oil, corn flour, corn starch, corn flakes, corn bran, pasta and other food products made from corn, corn biomass, and fuel products produced using corn and parts of corn, provided that such corn and corn products contain detectable amounts of corn event DNA MON95275 or detectable amounts of a novel toxin protein or double-stranded DNA produced by corn plants, cells, and the like that contain corn event DNA MON95275.

[0011] Another aspect of the invention relates to a first DNA molecule and a second DNA molecule different from the first DNA molecule, i.e., to a pair of DNA molecules that function as primers when used together in an amplification reaction containing the appropriate reagents necessary for carrying out the DNA amplification procedure, wherein the sample contains the template DNA of the maize event MON95275, for obtaining an amplicon diagnostic for the presence of said DNA of the maize event MON95275 in said sample. The obtained amplicon may contain at least a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10.

[0012] Another embodiment of the invention is a method for detecting the presence of a diagnostic DNA segment to confirm the presence or absence of maize event MON95275 DNA in a sample. In a specific embodiment, the method is carried out by contacting the sample with a DNA probe molecule that specifically hybridizes to DNA uniquely associated with the maize event MON95275, then subjecting the sample and the DNA probe molecule to stringent hybridization conditions to allow the probe to bind the corresponding complementary segment of the specific DNA of the maize event MON95275. Detection of hybridization of the DNA probe molecule with DNA in the sample will be conclusive, meaning that detection of such hybridization will be diagnostic that the DNA in the sample contains a detectable amount of maize event MON95275 DNA.

[0013] Another embodiment of the invention is a method for detecting the presence of a DNA segment diagnostic for the DNA of maize event MON95275 in a sample containing maize DNA. In one embodiment, the method comprises the steps of contacting the sample with a pair of DNA molecules that function as thermal amplification primers specific for the amplification of the DNA segment of maize event MON95275, and conducting an amplification reaction sufficient to produce a DNA amplicon, then detecting the presence of the DNA amplicon in the reaction. Detection of a DNA amplicon may be a diagnostic indication of the presence of a detectable amount of DNA of the maize event MON95275 in a sample, and the amplicon may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10.

[0014] Another embodiment of the invention is a corn plant, a part of a corn plant, a corn cell or a part thereof, containing a recombinant polynucleotide molecule containing a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10. This corn plant, part of a corn plant, corn cell or part thereof has an insecticidal effect if they are contained in the diet of coleopteran insect pests. Target coleopteran insect pests to be controlled include, but are not limited to, the western corn rootworm (Diabrotica virgifera virgifera) and the northern corn rootworm (Diabrotica barberi).In addition, a maize plant may be further defined as the progeny of any generation of a maize plant containing the maize event MON95275, provided that the progeny contains DNA from the maize event MON95275.

[0015] Another embodiment of the invention is a method for protecting a corn plant from insect infestation, said method comprising introducing into the diet of a coleopteran insect pest an insecticidally effective amount of corn plant cells or tissue comprising the corn event MON95275. Suspected coleopteran insect pests include the western corn rootworm (Diabrotica virgifera virgifera) and the northern corn rootworm (Diabrotica barberi).

[0016] Another embodiment of the invention is a method for producing a corn plant that is resistant to insects, comprising: a) crossing two different corn plants to produce progeny, wherein at least one of the two different corn plants comprises DNA of the corn event MON95275; b) confirming in the progeny the presence of a DNA segment diagnostic of DNA of the corn event MON95275; and c) selecting the progeny containing DNA of the corn event MON95275. In certain embodiments, the progeny are corn plants that are resistant to the corn rootworm.

[0017] Another embodiment of the invention is a corn seed, non-living plant material or microorganism containing a detectable amount of a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 or full complements thereof.

[0018] Another embodiment is a corn commodity product comprising a detectable amount of a DNA molecule unique to the DNA describing the corn event MON95275, wherein the molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10. Contemplated corn commodity products include, but are not limited to, whole or processed corn seeds, animal feed containing corn, corn oil, corn flour, corn starch, corn flakes, corn bran, corn biomass and fuel products produced using corn and parts of corn.

[0019] Another embodiment of the invention is a corn plant, a part of a corn plant, or a corn seed containing DNA that functions as a template when tested by a DNA amplification method to produce an amplicon diagnostic for the presence of DNA of the corn event MON95275.

[0020] Another embodiment of the invention is a method for determining the zygosity of a maize plant genome or maize seed containing DNA describing the maize event MON95275. Zygosity is determined in a series of sequential steps. In the first step, a sample containing maize DNA is contacted with a first pair of primers capable of producing an amplicon diagnostic for DNA that describes and is present exclusively in the maize event MON95275. The sample containing maize DNA is then contacted with a second pair of primers designed to produce an amplicon of an internal standard known to be single-copy and homozygous in the maize plant.The method further comprises contacting the DNA sample with a probe set comprising at least a first probe that specifically hybridises the allele of the MON95275 maize event and a second probe that specifically hybridises to an internal genomic DNA standard known to be single-copy and homozygous in a maize plant. The method also comprises a DNA amplification reaction carried out using real-time PCR and determining the cycle thresholds (Ct values) of the amplicon corresponding to the MON95275 maize event allele and the single-copy homozygous internal standard. After amplification, the difference (ΔCt) between the Ct value of the single-copy homozygous amplicon of the internal standard and the Ct value of the allele for the MON95275 maize event amplicon can be calculated.In one embodiment, zygosity is determined, wherein a ΔCt of about zero (0) indicates homozygosity of the inserted T-DNA of the maize event MON95275, and a ΔCt of about one (1) indicates heterozygosity of the inserted T-DNA of the maize event MON95275. In certain embodiments of the method, the primer pairs are selected from the group consisting of SEQ ID NO: 15 in combination with SEQ ID NO: 16 and SEQ ID NO: 18 in combination with SEQ ID NO: 19; and wherein the probes are SEQ ID NO: 17 and SEQ ID NO: 20. In another embodiment of the invention, a ΔCt value of about one (1), indicating heterozygosity of the inserted T-DNA of the maize event MON95275, is in the range of 0.75 to 1.25.In certain embodiments, a ΔCt value of about zero (0) can be about 0, 0.05, 0.1, 0.15, 0.2, or 0.25, in other embodiments, a ΔCt value of about one (1) can be about 0.75, 0.8, 0.85, 0.9, 0.95, 1.0, 1.05, 1.1, 1.15, 1.2, or 1.25.In a further embodiment, a ΔCt value of about one (1) may be in the range of 0.75 to 1.25, 0.8 to 1.25, 0.85 to 1.25, 0.9 to 1.25, 0.95 to 1.25, 1.0 to 1.25, 1.05 to 1.25, 1.1 to 1.25, 1.15 to 1.25, 1.2 to 1.25, 0.75 to 1.2, 0.8 to 1.2, 0.85 to 1.2, 0.9 to 1.2, 0.95 to 1.2, 1.0 to 1.2, 1.05 to 1.2, 1.1 to 1.2, 1.15 to 1.2, from 0.75 to 1.15, from 0.8 to 1.15, from 0.85 to 1.15, from 0.9 to 1.15, from 0.95 to 1.15, from 1.0 to 1.15, from 1.05 to 1.15, from 1.1 to 1.15, from 0.75 to 1.1, from 0.8 to 1.1, from 0.85 to 1.1, from 0.9 to 1.1, from 0.95 to 1.1, from 1.0 to 1.1, from 1.05 to 1.1, from 0.75 to 1.05, from 0.8 to 1.05, from 0.85 to 1.05, from 0.9 up to 1.05, from 0.95 to 1.05, 1.0 to 1.05, 0.75 to 1.0, 0.8 to 1.0, 0.85 to 1.0, 0.9 to 1.0, 0.95 to 1.0, 0.75 to 0.95, 0.8 to 0.95, 0.85 to 0.95, 0.9 to 0.95, 0.75 to 0.9, 0.75 to 0.85, 0.75 to 0.8, 0.8 to 0.9, 0.8 to 0.85 or 0.85 to 0.9.

[0021] Another embodiment of the invention is a method for determining the zygosity of a maize plant or maize seed containing maize event MON95275, comprising: a) contacting a sample containing maize DNA with a set of primer pairs comprising at least two different pairs of primers capable of producing a first amplicon diagnostic of maize event MON95275 and a second amplicon diagnostic of native genomic DNA of maize that does not contain maize event MON95275; i) performing a nucleic acid amplification reaction with the sample and the set of primer pairs;ii) detecting in a nucleic acid amplification reaction a first amplicon diagnostic for the maize event MON95275 or a second amplicon diagnostic for native genomic DNA of maize that does not contain the maize event MON95275, wherein the presence of only the first amplicon is diagnostic of homozygous DNA of the maize event MON95275 in the sample, and the presence of both the first amplicon and the second amplicon is diagnostic of a maize plant that is heterozygous for the allele of the maize event MON95275; or b) contacting a sample containing maize DNA with a probe set that comprises at least a first probe that specifically hybridizes to the DNA of the maize event MON95275 and at least a second probe that specifically hybridizes to genomic maize DNA that has been disrupted by the insertion of heterologous DNA of the maize event MON95275 and does not hybridize to the DNA of the maize event MON95275;i) hybridizing a set of probes to a sample under stringent hybridization conditions, wherein detection of hybridization of only the first probe under the hybridization conditions is diagnostic for a homozygous allele of the maize event MON95275 DNA in the sample, and wherein detection of hybridization of both the first probe and the second probe under the hybridization conditions is diagnostic for a heterozygous allele of the maize event MON95275 in said sample. In one embodiment of the method, the set of primer pairs comprises SEQ ID NO: 15 in combination with SEQ ID NO: 16, which can be used to produce an amplicon that can be detected using the probe sequence presented in SEQ ID NO: 17, and SEQ ID NO: 21 in combination with SEQ ID NO: 22, which can be used to produce an amplicon that can be detected using the probe sequence presented in SEQ ID NO: 23.

[0022] The above and other aspects of the invention will become more apparent from the following detailed description.BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Fig. 1 is a graphical representation of the orientation and alignment of DNA elements / segments that are present in the nucleotide sequence shown in SEQ ID NO: 10, which is the sequence of the inserted transgenic DNA and the corresponding adjacent 5' and 3' sequences of the maize genome present in the maize event MON95275. Each of [1] (SEQ ID NO: 1) and [2] (SEQ ID NO: 2) graphically represents the approximate sequence positions of 50 contiguous nucleotide segments, designated respectively as the 5' or 3' junction sequence, respectively, the arbitrarily assigned left, 5'-terminal, and right, 3'-terminal junction sequences [9], which consist, respectively, of 25 contiguous nucleotides of maize genome DNA (the ends of the light gray hatched segment

[10] ) and 25 contiguous nucleotides of adjacent inserted transgene DNA (the segment,shaded in darker grey

[10] ); each of [3] (SEQ ID NO: 3) and [4] (SEQ ID NO: 4) graphically represents 100 consecutive nucleotide segments of DNA at the 5'- and 3'-junction positions, respectively, represent 5'- or 3'-junction sequences, and each contains 50 consecutive nucleotides of maize genomic DNA and 50 consecutive nucleotides of adjacent inserted transgenic DNA; each of [5] (SEQ ID NO: 5) and [6] (SEQ ID NO: 6) graphically represents 200 consecutive nucleotide segments of DNA at the junction positions, respectively, represent 5'- or 3'-junction sequence,and each comprises 100 contiguous nucleotides of maize genome DNA and 100 contiguous nucleotides of contiguous inserted transgene DNA; [7] (SEQ ID NO: 7) is a 5' junction region of maize genomic DNA and inserted transgene DNA and comprises 1073 contiguous nucleotides of maize genomic DNA and 153 contiguous nucleotides of contiguous inserted transgene DNA; [8] (SEQ ID NO: 8) is a 3' junction region of maize genomic DNA and inserted transgene DNA, comprising 101 contiguous nucleotides of inserted transgene DNA and 1006 contiguous genomic maize DNA; [9] (SEQ ID NO: 9) represents the length and structure of the inserted DNA, and the arrows and labels under each arrow represent the expression elements in the three cassettes of the inserted DNA, in which RB / LB represent the positions of the right and left borders of the Agrobacterium double boundary-mediated transformation vector,LoxP represents the position of the residual Cre recombinase recognition site remaining in the inserted DNA after marker removal, the three Es represent the positions of enhancer elements in the corresponding constructs, the three Pis represent the positions of promoter elements in the corresponding constructs, the three Ls represent the positions of leader sequences (5'-untranslated regions, 5'UTR) in the corresponding constructs, the three I's represent the positions of intron sequences in the corresponding constructs, the three Ts represent the positions of transcription termination sequences (3'-untranslated regions, 3'UTR) in the corresponding constructs, and ISR represents the position of the intergenic sequence region (ISR4). The three constructs from right to left on the figure page encode the coleopteran pest toxins Vip4Da2 and Cry75Aa1, and the segment encoding an RNA molecule capable of folding into a double-stranded hairpin molecule,which is designed to suppress transcripts and thus reduce the translated protein Snf7, a protein essential for the survival of maize rootworm larvae.

[11] (SEQ ID NO: 11) represents the position of the maize genome DNA flanking the 5' end of the inserted DNA, and

[12] (SEQ ID NO: 12) represents the position of the maize genome DNA flanking the 3' end of the inserted DNA.

[15] (SEQ ID NO: 15, primer SQ51355) and

[16] (SEQ ID NO: 16, primer SQ51355) represent the position of a primer pair that can be used in a thermal amplification reaction to generate an amplicon of 74 nucleotides containing the right insertion / junction of the genome, the arrows indicate the direction in which amplification will occur to generate an amplicon from the corresponding positions within

[10] .

[17] (SEQ ID NO: 17, PB10263) is the probe and the position at which the probe will bind (or hybridize) to the amplicon obtained using primers

[16] and

[17] ,to detect the presence of the MON95275 object in a sample,

[0024] Figure 2 shows the T-DNA cassette in the plasmid vector used for maize transformation. One insertion event subjected to excision of the Cre recombinase marker resulted in the MON95275 event.

[13] (SEQ ID NO: 13) illustrates the DNA in the plasmid vector before the insertion (“T-DNA before insertion”). The arrows below

[13] represent the individual genetic elements contained in the three transgene cassettes designed to express the resulting potent coleopteran toxicants. The CP4 EPSPS selectable marker cassette is flanked by two LoxP segments that are recognized by Cre recombinase and are capable of excising the selectable marker from the insertion event containing

[13] . The DNA of the insertion target is represented by

[14] , differing from

[13] only in the fact that segment

[13] was inserted into the maize genome and is now depicted as flanked by 5' and 3' segments of the maize genome, labeled 5'-flank and 3'-flank.

[18] represents the segment shown in Fig. 1 as

[10] .

[0025] Fig. 3 is a schematic representation of the timeline of research, testing, and development that was relied upon to select the MON95275 corn subject. BRIEF DESCRIPTION OF SEQUENCES

[0026] SEQ ID NO: 1 is a 50 nucleotide sequence representing the 5' junction region of the maize genome DNA and the inserted transgene expression cassette (25 nucleotides of the maize genome DNA at the 5' end of SEQ ID NO: 1, 25 nucleotides of the transgene inserted DNA at the 3' end of SEQ ID NO: 1), and can be identified in SEQ ID NO: 10 at nucleotide positions 1049-1098.

[0027] SEQ ID NO: 2 is a 50 nucleotide sequence representing the 3' junction region of the inserted transgene expression cassette and the maize genome DNA (25 nucleotides of the transgene inserted DNA at the 5' end of SEQ ID NO: 2, 25 nucleotides of the maize genome DNA at the 3' end of SEQ ID NO: 2), and can be identified in SEQ ID NO: 10 at nucleotide positions 15731-15780.

[0028] SEQ ID NO: 3 is a 100 nucleotide sequence representing the 5' junction region of maize genome DNA and the inserted transgene expression cassette (50 nucleotides of maize genome DNA at the 5' end of SEQ ID NO: 3, 50 nucleotides of transgene inserted DNA at the 3' end of SEQ ID NO: 3) and can be identified in SEQ ID NO: 10 at nucleotide positions 1024-1123.

[0029] SEQ ID NO: 4 is a 100 nucleotide sequence representing the 3' junction region of the inserted transgene expression cassette and the maize genome DNA (50 nucleotides of the transgene inserted DNA at the 5' end of SEQ ID NO: 4, 50 nucleotides of the maize genome DNA at the 3' end of SEQ ID NO: 4), and can be identified in SEQ ID NO: 10 at nucleotide positions 15706-15805.

[0030] SEQ ID NO: 5 is a 200 nucleotide sequence representing the 5' junction region of the maize genome DNA and the inserted transgene expression cassette (100 nucleotides of the maize genome DNA at the 5' end of SEQ ID NO: 5, 100 nucleotides of the transgene inserted DNA at the 3' end of SEQ ID NO: 5), and can be identified in SEQ ID NO: 10 at nucleotide positions 974-1173.

[0031] SEQ ID NO: 6 is a 200 nucleotide sequence representing the 3' junction region of the inserted transgene expression cassette and the maize genome DNA (100 nucleotides of the transgene inserted DNA at the 5' end of SEQ ID NO: 6, 100 nucleotides of the maize genome DNA at the 3' end of SEQ ID NO: 6), and can be identified in SEQ ID NO: 10 at nucleotide positions 15656-15855.

[0032] SEQ ID NO: 7 is a 1226 nucleotide sequence representing the 5' junction region of maize genome DNA and the inserted transgene expression cassette (1073 nucleotides of maize genome DNA at the 5' end of SEQ ID NO: 5, 153 nucleotides of transgene inserted DNA at the 3' end of SEQ ID NO: 5), and can be identified in SEQ ID NO: 10 at nucleotide positions 1-1226.

[0033] SEQ ID NO: 8 is a 1,207 nucleotide sequence representing the 3' junction region of the inserted transgene expression cassette and maize genome DNA (101 nucleotides of transgene inserted DNA at the 3' end of SEQ ID NO: 8, 1106 nucleotides of maize genome DNA at the 3' end of SEQ ID NO: 8), and can be identified in SEQ ID NO: 10 at nucleotide positions 15655-16861.

[0034] SEQ ID NO: 9 is a 14,682 nucleotide sequence corresponding to the transgenic inserted T-DNA of the maize event MON95275 and can be identified in SEQ ID NO: 10 at nucleotide positions 1074-15755.

[0035] SEQ ID NO: 10 is a sequence of 16,861 nucleotides corresponding to the contiguous nucleotide sequence of the 5'-genomic flanking DNA nucleotide sequence, the inserted T-DNA nucleotide sequence in event MON95275, and the 3'-genomic flanking DNA nucleotide sequence; and includes SEQ ID NO: 11 (nucleotides 1-1073), SEQ ID NO: 9 (nucleotides 1074-15755), and SEQ ID NO: 12 (nucleotides 15756-16861).

[0036] SEQ ID NO: 11 is a 1073 nucleotide sequence representing maize genomic DNA flanking the 5' end of the inserted T-DNA and can be identified in SEQ ID NO: 10 at nucleotide positions 1-1073.

[0037] SEQ ID NO: 12 is a sequence of 1106 nucleotides representing the maize genomic DNA flanking the 3' end of the inserted T-DNA and can be identified in SEQ ID NO: 10 at nucleotide positions 15756-16861.

[0038] SEQ ID NO: 13 is a 19,612 nucleotide sequence representing a transgene cassette contained in a binary plasmid plant transformation vector used to transform maize to produce the maize event MON95275.

[0039] SEQ ID NO: 14 is a 35 nucleotide LoxP sequence used for Cre-mediated excision and recombination, and the residual sequence can be identified within SEQ ID NO: 10 at nucleotide positions 15444-15478.

[0040] SEQ ID NO: 15 is a 27-nucleotide sequence corresponding to a thermal amplification primer designated SQ20267, which can be used to identify the DNA of the maize event MON95275 in a sample or which can be used to detect an insertion event that, upon excision of the Cre recombinase marker, results in the DNA of the event MON95275. SEQ ID NO: 15 is identical to the nucleotide sequence corresponding to positions 15706-15732 of SEQ ID NO: 10.

[0041] SEQ ID NO: 16 is a 24-nucleotide sequence corresponding to a thermal amplification primer designated SQ51355 used to identify the maize event MON95275 DNA in a sample or which can be used to detect an insertion event that, upon excision of the Cre recombinase marker, results in the event MON95275 DNA. SEQ ID NO: 16 is identical to the reverse complement of the nucleotide sequence corresponding to positions 15756-15779 of SEQ ID NO: 10.

[0042] SEQ ID NO: 17 is a 19-nucleotide sequence corresponding to a probe designated PB10263 used to identify the DNA of the maize event MON95275 in a sample or which can be used to detect an insertion event that, upon excision of the Cre recombinase marker, results in the DNA of the event MON95275. SEQ ID NO: 17 is identical to the nucleotide sequence corresponding to positions 15734-15752 of SEQ ID NO: 10 and, as a probe, can bind to a polynucleotide segment having the reverse complement of nucleotides at this position.

[0043] SEQ ID NO: 18 is a 24-nucleotide sequence corresponding to a thermal amplification primer designated SQ20222, used as an internal control for event and zygosity analysis for the maize event MON95275, and which hybridizes to a region of the maize genome.

[0044] SEQ ID NO: 19 is a 28-nucleotide sequence corresponding to a thermal amplification primer designated SQ20221, used as an internal control for event and zygosity analysis for the maize event MON95275, and which hybridizes to a region of the maize genome.

[0045] SEQ ID NO: 20 is a 17 nucleotide sequence corresponding to a probe designated PB50298, used as an internal control for event and zygosity analysis for the maize event MON95275, and which hybridizes to a region of the maize genome.

[0046] SEQ ID NO: 21 is a 20-nucleotide sequence corresponding to the thermal amplification primer designated PNEG95275 F used in the zygosity assay for the maize event MON95275 and which hybridizes to the region of maize genomic DNA that was removed when T-DNA was used to generate the MON95275 event inserted into the maize genome. The amplicon obtained in the thermal amplification reaction using the combination of primers PNEG95275_F and PNEG95275_R (SEQ ID NO: 22) and native maize DNA as a template is diagnostic for the wild-type allele lacking the inserted T-DNA of MON95275.

[0047] SEQ ID NO: 22 is a 20-nucleotide sequence corresponding to the thermal amplification primer designated PNEG95275 R used in the zygosity assay for the maize event MON95275 and which hybridizes to a region of maize genomic DNA that was removed when T-DNA was used to generate the MON95275 event inserted into the maize genome. The amplicon obtained in the thermal amplification reaction using the combination of primers PNEG95275_F (SEQ ID NO: 21) and PNEG95275_R and native maize DNA as a template is diagnostic for the wild-type allele lacking the inserted T-DNA of MON95275.

[0048] SEQ ID NO: 23 is a 17 nucleotide sequence corresponding to the probe designated PRBNEG95275 used in the zygosity assay to confirm the absence of the maize event MON95275 and which hybridizes to a region of native maize genomic DNA that was removed when T-DNA was used to generate the MON95275 event inserted into the maize genome.

[0049] SEQ ID NO: 24 is a DNA sequence that functions as an expression enhancer segment in plants.

[0050] SEQ ID NO: 25 is a functional plant promoter operably linked to an untranslated leader sequence.

[0051] SEQ ID NO: 26 is a DNA sequence that functions as an expression enhancer segment in plants. DETAILED DESCRIPTION OF THE INVENTION

[0052] The present invention provides a transgenic maize event, MON95275, which provides insecticidal control of coleopteran pests of maize by expressing Cry75Aa1, Vip4Da2, and dsRNA designed to suppress the native and major maize rootworm DvSnf7. In particular, the maize event MON95275 provides resistance to coleopteran insect pests, the western corn rootworm (Diabrotica virgifera virgifera, WCR) and the northern corn rootworm (Diabrotica barberi, NCR).Corn entity MON95275 will address a significant need for control of these insects in corn production where corn rootworms are present, as chemical insecticides often fail to provide adequate control of these insects or require multiple applications of such chemicals throughout the harvest season, increasing labor requirements, the carbon footprint, and the release of chemical pesticides into the environment, as well as significantly increasing the cost of corn production. Reference to corn entity MON95275 in this document is intended to be equivalent to a reference to MON 95275, entity MON95275, entity MON 95275, MON95275 entity, entity MON 95275; the references are interchangeable.

[0053] Resistance to infestation by Coleoptera species conferred by event MON95275 occurs due to the expression of a DNA segment encoding two insecticidal proteins and a double-stranded RNA (dsRNA) capable of interfering with an essential gene of corn rootworm, which are operably and covalently linked within an inserted transgene DNA that partially defines the maize event MON95275. The two insecticidal proteins in event MON95275 are the Cry75Aa1 protein (U.S. Patent Application Publication No. 2016-0319302A2, SEQ ID NO: 25, coding sequence SEQ ID NO: 37) and the Vip4Da2 protein (U.S. Patent No. 10100330, SEQ ID NO: 2, coding sequence SEQ ID NO: 3). The dsRNA produced in event MON95275 targets the suppression of a gene called DvSnf7 in the western corn rootworm (Diabrotica virgifera virgifera) when ingested by the rootworm (see, e.g., U.S. Patent No. 7,943,818, SEQ ID NO: 818).The two insecticidal proteins and dsRNA are expressed from three expression cassettes within an integrated transgene DNA construct as indicated in SEQ ID NO: 9 and illustrated in Fig. 1.

[0054] The Cry75Aa1 protein in the maize event MON95275 is expressed by the Tripsacum dactyloides RCc3 promoter (U.S. Patent No. 9617553, SEQ ID NO: 13) and leader operably linked to an enhancer derived from the bulgur mosaic virus promoter, Genbank accession number EF513491, nucleotides 1-322; and an intron of the Setaria italica 14-3-3C protein gene (U.S. Patent Application Publication No. 2013-0031672 A2, SEQ ID NO: 151).

[0055] The Vip4Da2 protein in the maize event MON95275 is expressed by the Zea mays lipid transfer protein promoter and leader, an enhancer with a rearranged enhancer formed from several publicly available bulgur mosaic virus promoters, and an intron of the Setaria italica actin 4 gene (US Patent Application Publication No. 2013-0031672 A2, SEQ ID NO: 627). The bulgur mosaic virus (DaMV) enhancer operably linked to the Zea mays lipid transfer protein promoter and leader are fragments of a rearranged composite of several publicly available DaMV Genbank accessions and are presented as SEQ ID NO: 24. The first fragment is derived from the DaMV-Holland (DaMV-H) promoter, Genbank accession number EU090957, nucleotides 1177-1494. This fragment is operably linked to the second fragment, derived from the DaMV-H promoter, nucleotides 1003-1176.In the first fragment, relative to SEQ ID NO: 24, nucleotides 287-288 and nucleotides 319-322 were changed to sequences at similar positions in the DaMV promoter in Genbank accession number JX272320. In the original configuration of the DaMV promoter, the second fragment would precede the first fragment. The rearrangement of these two fragments provided higher expression relative to the original fragment and, therefore, was selected for use in event MON95275.

[0056] dsRNA specific for the DvSnf7 coding sequence in maize event MON95275 is driven by a promoter and leader derived from cauliflower mosaic virus (CaMV) isolate NY8153 (represented by SEQ ID NO: 25), which is enhanced by an enhancer derived from the pIIG gene promoter encoding physical impedance-induced protein from Zea mays and the Zea mays hsp70 intron. The CaMV promoter / leader is derived from Genbank accession number M90541, nucleotides 6907-7482. Relative to SEQ ID NO: 25, the second nucleotide was changed from threonine (T) to adenine (A) to remove a potential start codon in the operably linked cassette configuration. This CaMV promoter / leader contains a longer leader sequence relative to the CaMV promoter and leader in the maize MON87411 event. This longer leader increased DvSNF7 dsRNA expression levels in MON95275 relative to MON87411.

[0057] The expression of the Cry75Aa1 and Vip4Da2 transgene cassettes in MON95275 are oriented in a convergent manner, as shown in Fig. 1. The DvSnf7 transgene cassette in MON95275 is oriented in a non-parallel direction relative to the Cry75Aa1 transgene cassette, as shown in Fig. 1. The DvSnf7 and Cry75Aa1 transgene cassettes are separated from each other by an intergenic sequence region (ISR4, U.S. Provisional Patent Application Serial No. 62 / 875,752). In Fig. 1 shows the relative positions of each element—enhancer (E), promoter (P), 5' UTR or leader (L), intron (I), 3' UTR (T), ISR4 (ISR), DvSnf7, Cry75Aa1, and Vip4Da2—included in SEQ ID NO: 9 and SEQ ID NO: 10.

[0058] As described herein, multiple constructs were evaluated that differed in the use of expression elements, toxin encoding, sequence, and orientation. The construct used to generate the maize event MON95275, shown in Fig. 2 and represented as SEQ ID NO: 13, provided superior performance compared to other constructs in assessing resistance to coleopteran insect pest infestation. In addition, the maize event MON95275 does not contain markers used for selection of the transformed plant cell by Cre recombinase excision. The CP4 selection cassette is shown in Fig. 2 and is contained in SEQ ID NO: 13. The CP4 selection cassette is flanked by two LoxP sites. Cre recombinase-mediated excision resulted in the loss of the CP4 selection cassette after crossing with Cre-expressing maize transgenics.The resulting progeny were assessed for the absence of the selection cassette, as well as the absence of the Cre-recombinase selection cassette, and those progeny lacking both were selected for further evaluation, leading to the selection of the markerless maize event MON95275.

[0059] Event MON95275 was selected based on the comparison of thousands of different independent transgenic events, each transformed with a construct containing the transgene cassette represented by SEQ ID NO: 13 or with other constructs containing the same or different toxins. The resulting events expressing insect toxins were compared with non-transgenic control maize plants of the same variety. The results shown in the examples demonstrate that event MON95275 exhibited superior performance due to the expression of the Cry75Aa1 and Vip4Da2 proteins and DvSnf7-specific dsRNA. Each of the multiple transgenic events obtained using the construct used to generate event MON95275 was more likely than other events obtained with different constructs to demonstrate effective control of coleopteran insect pests.

[0060] MON95275 was created using plant transformation techniques to randomly insert heterologous DNA (also known as transgenic DNA) into the chromosome of a maize cell genome, producing a genetically modified maize cell, also called a "transgenic" or "recombinant" maize cell. Using this technique, many individual cells are transformed, each resulting in a unique "transgenic event" or "object" due to the random insertion of foreign DNA into the genome. A transgenic plant is then regenerated from each individual transgenic cell. This results in each cell of the transgenic plant containing a uniquely inserted transgenic event as a stable part of its genome. This transgenic plant can then be used to produce seeds, which are then planted and grown to produce progeny plants, each containing a unique transgenic event.

[0061] The MON95275 maize event was generated by Agrobacterium-mediated transformation of immature maize embryos with a single binary T-DNA system. This system utilized an Agrobacterium strain that utilizes a single binary plasmid vector with a single T-DNA. The T-DNA construct contained three transgene cassettes for expressing the coding sequences of an insect toxin encoding Cry75Aa, Vip4Da2, and a dsRNA coding sequence encoding DvSnf7, and a transgene cassette used for selection of transformed maize cells using glyphosate selection (CP4). The T-DNA construct is SEQ ID NO: 13 and is illustrated in Fig. 2 (“T-DNA before insertion”). During the insertion, one nucleotide was changed from guanine (G) to threonine (T) at nucleotide position (nt) 5300 in SEQ ID NO: 13 (nt 4986 in SEQ ID NO: 9 and nt 6059 in SEQ ID NO: 10) in a region that is not within any coding sequence or expression elements.Additionally, during the insertion, six (6) nucleotides were inserted between the inserted T-DNA and the 3' genomic flanking DNA, and seven hundred forty-six (746) nucleotides were deleted from the wild-type genomic DNA. The glyphosate selection cassette was flanked on both sides by LoxP recognition sites, which are recognized by Cre recombinase derived from Enterobacteria phage P1 (Larry Gilbertson (2003) Cre-lox recombination: Cre-active tools for plant biotechnology. TRENDS in Biotechnology, 21:12, 550-555).

[0062] As specifically described herein, the MON95275 maize event was generated through a complex research and development process in which: (1) over one hundred sixty (160) plasmid vector constructs that varied with respect to coding sequences for insecticidal proteins, coding sequences for transcriptional regulatory elements, and the number and orientation of cassettes in the constructs were designed and transformed into maize cells to generate thousands of events that were tested and analyzed, leading to the selection of the construct used to generate the MON95275 event; (2) thousands of maize cells were transformed with the construct used to generate the MON95275 event, generating a population of transgenic plants in which each plant contained a unique transgenic event that was regenerated and tested;(3) the final event MON95275 was selected after a rigorous multi-year event selection process, including testing and analysis of molecular characteristics, potency, protein expression, and agronomic properties under various genetic conditions; and (4) the glyphosate selection cassette in the maize event MON95275 was removed by in vivo Cre deletion to create the “markerless” final event MON95275. The maize event MON95275 was thus obtained and selected as a uniquely improved event suitable for large-scale agronomic purposes.

[0063] The plasmid DNA inserted into the genome of the maize event MON95275 was characterized through detailed molecular analysis. This analysis included the following: insertion number (number of integration sites in the maize genome), genomic insertion location (specific site in the maize genome where the insertion occurred), copy number (number of T-DNA copies within a single locus), and the integrity of the inserted transgene DNA. Detailed molecular analysis showed that the inserted T-DNA containing the expression cassettes for Cry75Aa1, Vip4Da2, and DvSnf7 remained intact after insertion and Cre excision of the glyphosate (CP4) selection cassette. In the context of this document, an "expression cassette" or "cassette" is a recombinant DNA molecule containing a combination of individual elements to be expressed by a transformed cell. Table 1 shows the list of elements contained in SEQ ID NO: 10, the DNA sequence corresponding to the maize event MON95275.

[0064] The MON95275 maize event is characterized by an insertion into one locus in the maize genome resulting in two new loci or junction sequences (e.g., the sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and SEQ ID NO: 8) between the inserted DNA and the maize genome DNA that are not known to naturally occur in the genome of maize or other transgenic maize events - they are unique to the MON95275 event. These junction sequences are useful for detecting the presence of the MON95275 event in maize cells, maize tissue, maize seeds, and maize plants or maize plant products, such as commercial maize products.This document describes molecular DNA probes and primer pairs that were designed for use in identifying the presence of these various junctional segments in biological samples containing or suspected of containing maize cells, maize seeds, maize plant parts, or maize plant tissues that contain event MON95275.

[0065] Sample is intended to refer to a composition that is either substantially pure corn DNA or a composition containing corn DNA. In either case, the sample is a biological sample, i.e., it contains biological materials, including, but not limited to, DNA obtained or derived directly or indirectly from the genome of the corn event MON95275. “Directly” refers to the ability of a person skilled in the art to directly obtain DNA from the corn genome by disrupting corn cells (or by obtaining corn samples containing disrupted corn cells) and exposing the genomic DNA for detection purposes. “Indirectly” refers to the ability of a person skilled in the art to obtain a target or specific reference DNA, i.e., a new and unique connecting segment described herein as diagnostic for the detection of the MON95275 event in a specific sample, by methods other than directly disrupting corn cells or obtaining a corn sample that contains disrupted corn cells. Such indirect methods include, but are not limited to, amplifying a DNA segment that contains a DNA sequence designed for a specific probe designed to bind with specificity to the target sequence, or amplifying a DNA segment that can be measured and characterized, i.e., measured by separation from other DNA segments by some effective matrix, such as an agarose or acrylamide gel, or the like, or characterized by direct amplicon sequence analysis, or by cloning the amplicon into a vector and directly sequencing the inserted amplicon present in such a vector.

[0066] Detailed molecular analysis also revealed that event MON95275 contains a single T-DNA insert with one copy each of the Cry75Aa1, Vip4Da2, and DvSnf7 specific dsRNA expression cassettes. No additional elements from the transformation construct were identified in event MON95275, except for portions of the left and right extreme regions of Agrobacterium tumefaciens used to transfer the transgene DNA from the plant transformation plasmid into the maize genome. In addition, thermal amplification was performed to obtain specific amplicons diagnostic of the presence of event MON95275 in the sample, and DNA sequence analysis was performed to determine the randomly assigned genomic junctions of the 5' and 3' inserts with the plant, confirm the organization of the elements within the insert, and determine the complete DNA sequence of the inserted transgene DNA (SEQ ID NO: 9).SEQ ID NO: 11 is a sequence that is one thousand seventy-three (1073) base pairs (bp) of the 5' LH244 maize genomic DNA sequence flanking the inserted T-DNA sequence shown as SEQ ID NO: 9. SEQ ID NO: 12 is a sequence that is one thousand one hundred six (1106) bp of the 3' LH244 maize genomic DNA sequence flanking the inserted T-DNA sequence shown as SEQ ID NO: 9. SEQ ID NO: 7 is a sequence that is one thousand two hundred twenty-six (1226) base pairs (bp) of the 5' LH244 maize genomic DNA sequence flanking the inserted T-DNA sequence, in combination with the inserted T-DNA sequence of one hundred fifty-three (153) p. o., presented as SEQ ID NO: 9.SEQ ID NO: 8 is a sequence representing a one hundred and one (101) bp long inserted T-DNA sequence with a one thousand one hundred and six (1106) bp long maize genomic DNA sequence 3' LH244 flanking the inserted T-DNA sequence presented as SEQ ID NO: 9. SEQ ID NO: 10 corresponds to the maize event MON95275 and contains a contig including the 5'-flanking sequence of LH244, the transgenic insert of MON95275 and the 3'-flanking sequence of LH244, and thus contains connecting sequences of the genome of the insert to the plant.

[0067] Unless otherwise specified in this document, terms are to be understood in accordance with generally accepted usage by those skilled in the art. Definitions of common terms in molecular biology can be found in Rieger et al., Glossary of Genetics: Classical and Molecular, 5 еedition, Springer-Verlag: New York, 1991; and Lewin, Genes V, Oxford University Press: New York, 1994, along with other sources known to those skilled in the art. As used herein, the term "maize" means a species belonging to the genus Zea, preferably Zea mays, and includes all plant species that can be crossed with maize plants containing event MON95275, including wild maize species, as well as those plants belonging to the genus Zea that allow breeding between species.

[0068] Transgenic plants transformed with a DNA construct containing expression cassettes expressing toxic amounts of the insecticidal proteins Cry75Aa1 and Vip4Da2, and toxic amounts of insecticidal dsRNA specific for the suppression of DvSnf7 are provided. The term "toxic amount" means an effective amount, an insecticidal amount, an insecticidal-effective amount, an inhibitory amount of target insects, an effective pesticidal amount, an amount in the diet of insects of the order Coleoptera that has insecticidal action, and other similar terms should be understood in accordance with the generally accepted usage by specialists in the relevant field. Corn plants transformed in accordance with the methods and the DNA construct described herein are resistant to Coleoptera insect pests.

[0069] A transgenic "plant" is produced by transforming a plant cell with heterologous DNA, i.e., a polynucleic acid construct that includes a number of effective traits of interest, regenerating the plant by inserting the transgene into the plant cell genome, and selecting a specific plant characterized by the insertion at a specific genomic location and a number of effective traits in the regenerated transgenic plant. The term "object" refers to the DNA from the original transformant, including the inserted DNA and flanking genomic sequences immediately adjacent to the inserted DNA.Such DNA is unique and is expected to be transmitted to progeny that have received the inserted DNA, including the transgene of interest, as a result of a sexual cross between a parental line containing the inserted DNA (e.g., the original transformant and the offspring obtained from self-pollination) and a second parental line, e.g., a parental line that does not contain the inserted DNA. The present invention also relates to the original transformant plant and the transformant's offspring that contain heterologous DNA. Such offspring can be obtained as a result of a sexual cross between plants containing the object and another plant, the offspring of which contain the heterologous DNA. Even after repeated backcrosses with the recurrent parent, the object is present in the offspring from the cross at the same chromosomal location.

[0070] As used in this document, the term "recombinant" refers to a non-naturally occurring DNA, protein, or organism that is not normally found in nature and has been created through human intervention. A "recombinant DNA molecule" is a DNA molecule containing a combination of DNA molecules that would not normally occur together in nature and is the result of human intervention. For example, a DNA molecule consisting of a combination of at least two DNA molecules that are heterologous to each other, such as a DNA molecule containing a transgene and plant genomic DNA adjacent to the transgene, is a recombinant DNA molecule.

[0071] The terms "DNA" and "DNA molecule" as used herein refer to a deoxyribonucleic acid (DNA) molecule. A DNA molecule may be of genomic or synthetic origin and typically extends from the 5' end (upstream) to the 3' end (downstream). As used herein, the term "DNA sequence" refers to the nucleotide sequence of a DNA molecule. Conventionally, the DNA sequences of the present invention and fragments thereof are disclosed with reference to only one strand of a double-stranded complementary sequence of DNA strands. Complementary sequences of the sequences provided herein (the complementary strand sequence), also referred to in the art as the reverse complementary sequence, are intended to be within the scope of this invention and are expressly contemplated as being within the scope of the claimed subject matter.

[0072] As used herein, the term "fragment" refers to a smaller portion of a whole. For example, fragments of SEQ ID NO: 10 will include sequences that are at least about 12 consecutive nucleotides, at least about 13 consecutive nucleotides, at least about 14 consecutive nucleotides, at least about 15 consecutive nucleotides, at least about 16 consecutive nucleotides, at least about 17 consecutive nucleotides, at least about 18 consecutive nucleotides, at least about 19 consecutive nucleotides, at least about 20 consecutive nucleotides, at least about 25 consecutive nucleotides, at least about 30 consecutive nucleotides, at least about 35 consecutive nucleotides, at least about 40 consecutive nucleotides, at least about 45 consecutive nucleotides,at least about 50 consecutive nucleotides, at least about 60 consecutive nucleotides, at least about 70 consecutive nucleotides, at least about 80 consecutive nucleotides, at least about 90 consecutive nucleotides, or at least about 100 consecutive nucleotides of the entire sequence of SEQ ID NO: 10.

[0073] Reference in this application to an "isolated DNA molecule" or an equivalent term or phrase is intended to mean that the DNA molecule is a molecule that is present alone or in combination with other compositions, but not in its natural environment. For example, nucleic acid elements such as a coding sequence, an intron sequence, an untranslated leader sequence, a promoter sequence, a transcription termination sequence, and the like, that are naturally present in the DNA of the genome of an organism, are not considered "isolated" provided that the element is located in the genome of the organism and at the location of the genome at which it is naturally found. However, each of these elements and subportions of these elements will be "isolated" within the scope of this disclosure if the element is not located in the genome of the organism and at the location of the genome at which it is naturally found.Similarly, a nucleotide sequence encoding an insecticidal protein or any naturally occurring insecticidal variant of that protein will be considered an isolated nucleotide sequence if that nucleotide sequence is not found in the DNA of the bacterium from which the protein-encoding sequence is naturally found. A synthesized nucleotide sequence encoding the amino acid sequence of a naturally occurring insecticidal protein will be considered isolated for the purposes of this invention. For the purposes of this disclosure, any transgenic nucleotide sequence, i.e.,A DNA nucleotide sequence incorporated into the genome of plant or bacterial cells or present in an extrachromosomal vector will be considered an isolated nucleotide sequence, regardless of whether it is present in a plasmid or similar structure used to transform cells, in the genome of the plant or bacterium, or in detectable quantities in tissues, progeny, biological samples, or commercial products derived from the plant or bacterium. In any case, an isolated DNA molecule is a chemical molecule, regardless of whether it is called a nucleic acid, a nucleic acid sequence, a polynucleotide sequence, a construct, a cassette, or the like.This is a new molecule of the present invention that exhibits industrial applicability when present in a plant cell or in the genome of a plant, and when present outside a plant cell, and therefore exhibits and is intended to exhibit such utility regardless of where the molecule is located.

[0074] The DNA sequence of the region encompassing the phosphodiester bond junction of one end of the transgene insert with the flanking maize genomic DNA is called a "junction." The junction is the point of connection of the transgene insert and the flanking DNA as one continuous molecule. One junction is at the 5' end of the transgene insert, and the other is at the 3' end of the transgene insert, referred to herein as the 5' and 3' junction, respectively. The "junction sequence" refers to a DNA sequence of any length that encompasses the 5' or 3' junction of the event. The junction sequences of the maize event MON95275 are obvious to those skilled in the art using SEQ ID NO: 10. Examples of junction sequences of MON95275 are provided as SEQ ID NOs: 1-8. In Fig. 1 illustrates the physical arrangement of the junction sequences located from 5' to 3' relative to SEQ ID NO: 10.The MON95275 sequence junction may be present as part of the genome of a plant, seed, or cell containing MON95275. Identification of any one or more junctions sequentially in a sample containing DNA from a maize plant, maize plant part, maize seed, or maize cell indicates that the DNA was obtained from maize containing the MON95275 event and is diagnostic of the presence of the MON95275 maize event.

[0075] The junction sequences for MON95275 can be represented by a sequence from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 10. For example, the junction sequences can be conventionally represented by the nucleotide sequences shown as SEQ ID NO: 1 (5' junction sequence) and SEQ ID NO: 2 (3' junction sequence). Alternatively, the junction sequences can be conventionally represented by the nucleotide sequences shown as SEQ ID NO: 3 (5' junction sequence) and SEQ ID NO: 4 (3' junction sequence). Alternatively, the junction sequences may be conventionally represented by the nucleotide sequences shown as SEQ ID NO: 5 (junction sequence 5') and SEQ ID NO: 6 (junction sequence 3').Alternatively, the junction sequences may be conventionally represented by the nucleotide sequences shown as SEQ ID NO: 7 (5' junction sequence) and SEQ ID NO: 8 (3' junction sequence). These nucleotide sequences are linked via a phosphodiester bond and are represented as part of the recombinant plant's cellular genome in the MON95275 maize event.

[0076] These junction sequences are diagnostic for the presence of event MON95275, or a construct included therein. Thus, the identification of one or more of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 10 in a sample obtained from a corn plant, corn seed, or corn plant part is diagnostic that the DNA was obtained from the corn event MON95275. Thus, the present invention provides a DNA molecule that comprises at least one of the nucleotide sequences shown as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10.Any DNA segment obtained from the MON95275 maize transgenic event that is sufficient to include at least one of the sequences set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10 is within the scope of the present invention. Furthermore, any polynucleotide comprising a sequence complementary to any of the sequences described in this paragraph is within the scope of the present invention.

[0077] The present invention provides exemplary DNA molecules that can be used either as primers or probes for detecting the presence of DNA derived from a maize plant containing event MON95275 DNA in a sample. Such primers or probes are specific for a target nucleic acid sequence and, accordingly, are suitable for identifying the nucleic acid sequence of the maize event MON95275 using the methods of the present invention described herein.

[0078] The use of the word "derivative" implies that a specific DNA molecule is present in the genome of a maize plant or can be detected in the DNA of a maize plant. "Detectability" refers to the ability of a specific DNA segment to be amplified and its size or sequence, characterized or elucidated by DNA sequence analysis, i.e., the target DNA segment, and the subsequent ability to detect binding of the probe to the target. The specific DNA segment or target DNA segment of the present invention is present in maize that contains the inserted event MON95275.

[0079] A "probe" is a nucleic acid molecule complementary (reverse complementary) to a target nucleic acid strand and used in hybridization methods. The probe may be attached to a conventional detectable label or reporter molecule, such as a radioactive isotope, ligand, chemiluminescent agent, or enzyme. Such a probe is complementary to the target nucleic acid strand and, in the case of the present invention, to a strand of DNA from MON95275, whether from a plant containing MON95275 or from a sample that includes MON95275 DNA. Thus, probes for use herein may comprise DNA molecules or polynucleotide segments of sufficient length to function under the stringent hybridization conditions, as defined herein, to bind to a specific unique DNA segment present within and diagnostic for the MON95275 entity in the sample.Such a probe may be designed to bind to only one compound or another novel sequence present only in the maize event MON95275, or to two or more such segments of a single compound. The probes of the present invention include not only deoxyribonucleic or ribonucleic acids, but also polyamides and other probe materials that specifically bind to a target DNA sequence and can be used to detect the presence of this target DNA sequence. An exemplary DNA sequence suitable as a probe for detecting the maize event MON95275 is presented as SEQ ID NO: 17 (PB10263).

[0080] A "primer" is typically a DNA molecule designed for use in specific annealing or hybridization methods involving thermal amplification. Primers may contain pairs of different oligonucleotide or polynucleotide segments for use in a thermal amplification reaction that amplifies a specific target DNA segment. Each primer in a pair is designed to bind to a highly specific DNA segment within or adjacent to the DNA segment of interest for amplification. The primers bind in such a way that they then act as localized sites for nucleic acid polymerization, resulting in the production of one or more amplicons (amplified target DNA segments). The amplicon resulting from such a reaction will have a DNA sequence corresponding to the sequence of the template DNA located between the two sites where the primers hybridize to the template.In certain embodiments, the use of primers designed to bind to unique segments of the MON95275 maize event and which amplify specific amplicons containing one or more junction sequences described herein, and the detection and / or characterization of such amplicons after completion or termination of the polymerase reaction, is diagnostic for the presence of the MON95275 maize event in a particular sample. A skilled artisan is well acquainted with this amplification method, and it is unnecessary to list the amplification features herein.

[0081] A primer is typically designed to hybridize with a complementary target DNA strand to form a hybrid between the primer and the target DNA strand, and the presence of the primer is a recognition point for the polymerase to initiate primer extension (i.e., polymerization of additional nucleotides into an elongating nucleotide molecule) using the target DNA strand as a template. Primer pairs refer to the use of two primers that bind opposite strands of a double-stranded nucleotide segment for the purpose of linearly amplifying the polynucleotide segment between the positions intended for binding by the individual members of the primer pair, typically in a thermal amplification reaction or other conventional nucleic acid amplification methods. Exemplary DNA molecules suitable as primers are provided as SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 21, and SEQ ID NO: 22.

[0082] The pair of primers of SEQ ID NO: 15 and SEQ ID NO: 16 is useful as a first DNA molecule and a second DNA molecule that is different from the first DNA molecule, and each of them has a sufficient length of contiguous nucleotides of SEQ ID NO: 10 to function as DNA primers that, when used together in a thermal amplification reaction with template DNA obtained from maize event MON95275, are useful for producing an amplicon diagnostic of the DNA of maize event MON95275 in a sample.The pair of primers SEQ ID NO: 18 and SEQ ID NO: 19 are used as a first DNA molecule and a second DNA molecule that is different from the first DNA molecule, and each of them has a sufficient length of contiguous nucleotides of a locus within the maize genome to function as DNA primers that, when used together in a thermal amplification reaction with template DNA obtained from the maize event MON95275, produce an amplicon that serves as an internal control for both the diagnosis of the maize event MON95275 and for the zygosity of the DNA of the maize event MON95275 in the sample.The pair of primers SEQ ID NO: 21 and SEQ ID NO: 22 are used as a first DNA molecule and a second DNA molecule that is different from the first DNA molecule, and each of them has a sufficient length of contiguous nucleotides of a locus within the maize genome to function as DNA primers that, when used together in a thermal amplification reaction with template DNA obtained from the maize event MON95275, produce an amplicon diagnostic for non-integrated genomic DNA of wild-type maize that does not contain the event MON95275.

[0083] DNA probes and DNA primers typically have a length of eleven (11) polynucleotides or more, often eighteen (18) polynucleotides or more, twenty-four (24) polynucleotides or more, or thirty (30) polynucleotides or more. Such probes and primers are selected so that they have sufficient length to specifically hybridize with the target sequence under stringent hybridization conditions. Preferably, the probes and primers of the present invention have complete sequence similarity to the target sequence, although probes different from the target sequence that retain the ability to hybridize with the target sequence can be designed by conventional methods.

[0084] The nucleic acid probes and primers of the present invention hybridize under stringent conditions with a target DNA molecule. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of transgenic plant DNA in a sample. Polynucleic acid molecules, also called nucleic acid segments or fragments, are capable of specifically hybridizing with other nucleic acid molecules under certain circumstances.

[0085] In the context of this document, two polynucleic acid molecules are said to be capable of specifically hybridizing with each other if the two molecules are capable of forming an antiparallel double-stranded nucleic acid structure. A nucleic acid molecule is said to be the "complement" of another nucleic acid molecule if they exhibit perfect complementarity. In the context of this document, molecules exhibit "complete complementarity" if every nucleotide of one molecule is complementary to a nucleotide of the other. Two molecules are said to be "minimally complementary" if they can hybridize with each other with sufficient stability to allow them to remain annealed to each other at least under normal "low stringency" conditions.Similarly, molecules are called "complementary" if they can hybridize with one another with sufficient stability to remain annealed under typical "high stringency" conditions. Typical stringency conditions are described in Sambrook et al., 1989, and in Hames et al., in Nucleic Acid Hybridization: A Practical Approach, IRL Press, Washington, DC (1985). Thus, deviations from perfect complementarity are permissible as long as such deviations do not completely preclude the ability of the molecules to form a double-stranded structure. For a nucleic acid molecule to serve as a primer or probe, it must be sufficiently complementary in sequence to be capable of forming a stable double-stranded structure at the specific solvent and salt concentrations used.

[0086] As used herein, the term "substantially homologous sequence" is a nucleic acid sequence that will specifically hybridize to the complement of the nucleic acid sequence to which it is compared under high stringency conditions. Appropriate stringent conditions that promote DNA hybridization, such as 6.0× sodium chloride / sodium citrate (SSC) at about 45°C followed by a wash with 2.0× SSC at 50°C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6. For example, the salt concentration in the washing step can be selected from a low stringency of about 2.0× SSC at 50°C to a high stringency of about 0.2× SSC at 50°C.In addition, the temperature in the washing step can be increased from low stringency conditions at room temperature, about 22°C, to high stringency conditions at a temperature of about 65°C. Both the temperature and the salt concentration can be varied, or the temperature or salt concentration can be held constant while the other variable is changed. In a preferred embodiment, the polynucleic acid of the present invention will specifically hybridize to one or more nucleic acid molecules indicated in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10, or complements or fragments thereof under moderately stringent conditions, for example, at a temperature of about 2.0 x SSC and about 65°C.In a particularly preferred embodiment, the nucleic acid of the present invention will specifically hybridize to one or more nucleic acid molecules indicated in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10, or complements or fragments of any of them under high stringency conditions. In one aspect of the invention, the preferred marker nucleic acid molecule of the present invention has a nucleic acid sequence as indicated in SEQ ID NO: 1, or SEQ ID NO: 2, or SEQ ID NO: 3, or SEQ ID NO: 4, or SEQ ID NO: 5, or SEQ ID NO: 6, or SEQ ID NO: 7, or SEQ ID NO: 8, or SEQ ID NO: 9, or SEQ ID NO: 10, or complements thereof, or fragments of any of them.Hybridization of the probe with the target DNA molecule may be detected by any number of methods known to those skilled in the art, including, but not limited to, fluorescent labels, radioactive labels, antibody-based labels, and chemiluminescent labels.

[0087] With respect to the amplification of a target nucleic acid sequence (e.g., by PCR) using a specific pair of amplification primers, "stringent conditions" are conditions that allow the primer pair to hybridize only to the target nucleic acid sequence to which the primer having the corresponding wild-type sequences (or its complement) will bind and form a unique amplification product, an amplicon, in a DNA thermal amplification reaction.

[0088] The term "specific for (target sequence)" indicates that the probe or primer hybridizes under stringent hybridization conditions only to the target sequence in a sample containing the target sequence.

[0089] As used herein, the term "amplified DNA" or "amplicon" refers to the product of a polynucleic acid amplification method directed at a target polynucleic acid molecule that is part of a polynucleic acid template. For example, to determine whether a corn plant obtained as a result of sexual cross-breeding contains the genomic DNA of a transgenic corn plant containing the MON95275 event of the present invention, DNA that is extracted from a tissue sample of the corn plant can be subjected to a polynucleic acid amplification method using a pair of primers that includes a first primer derived from a genomic DNA sequence in a region flanking the heterologous inserted DNA of the MON95275 event and extended by a polymerase from 5' to 3' in the direction of the inserted DNA.The second primer is derived from a heterologous inserted DNA molecule extended by polymerase from 5' to 3' in the direction of the flanking genomic DNA from which the first primer was derived. The length of the amplicon can vary from the total length of the primer pair plus one base pair, or plus approximately fifty base pairs, or plus approximately two hundred and fifty base pairs, or plus approximately four hundred and fifty base pairs, or more.Alternatively, a pair of primers may be derived from the genomic sequence on either side of the inserted heterologous DNA to produce an amplicon comprising the entire inserted polynucleotide sequence (e.g., a forward primer derived from the genomic portion at the 5' end of SEQ ID NO: 10 and a reverse primer derived from the genomic portion at the 3' end of SEQ ID NO: 10, which amplifies a DNA molecule containing the inserted DNA sequence (SEQ ID NO: 9) identified herein in the genome of event MON95275). A member of the primer pair derived from the plant genomic sequence adjacent to the inserted transgenic DNA is located at a distance from the inserted DNA sequence, this distance may vary from one base pair to about twenty thousand base pairs. The use of the term "amplicon" specifically excludes primer dimers that may form in the thermal DNA amplification reaction.

[0090] For practical purposes, primers should be designed that produce amplicons of a limited size range, for example, from 100 to 1000 bases. Smaller amplicons (with shorter polynucleotide lengths) are generally produced more reliably in thermal amplification reactions, allow for shorter cycle times, and can be easily separated and visualized on agarose gels or adapted for use in assays such as TAQMAN®. Smaller amplicons can be generated and detected using methods known in the art of DNA amplicon detection. Furthermore, amplicons generated using primer pairs can be cloned into vectors, amplified, isolated, and sequenced, or they can be sequenced directly using methods well-established in the art.Any pair of primers derived from the combination of SEQ ID NO: 11 and SEQ ID NO: 9 or the combination of SEQ ID NO: 12 and SEQ ID NO: 9, which are useful in a DNA amplification method for producing an amplicon diagnostic for MON95275 or its progeny, are an aspect of the present invention. Any single isolated DNA polynucleotide primer molecule containing less than 15 consecutive nucleotides of SEQ ID NO: 11 or its complement, which can be used in a DNA amplification method for producing an amplicon diagnostic for MON95275 or its progeny, is an aspect of the present invention. Any single isolated DNA polynucleotide primer molecule comprising less than 15 consecutive nucleotides of SEQ ID NO: 12 or its complement that can be used in a DNA amplification method to produce an amplicon diagnostic for plants containing MON95275 or their progeny is an aspect of the present invention.Any single isolated DNA polynucleotide primer molecule comprising less than 15 consecutive nucleotides of SEQ ID NO: 9 or its complement that can be used in a DNA amplification method to produce an amplicon diagnostic for MON95275 or its progeny is an aspect of the present invention.

[0091] The amplification of polynucleic acids can be accomplished by any of the various polynucleic acid amplification methods known in the art, including the polymerase chain reaction (PCR). Amplification methods are known in the art and are described, inter alia, in U.S. Patent Nos. 4,683,195 and 4,683,202 and in PCR Protocols: A Guide to Methods and Applications, ed. Innis et al., Academic Press, San Diego, 1990. PCR amplification methods have been developed to amplify up to 22 kb (kilobases) of genomic DNA and up to 42 kb of bacteriophage DNA (Cheng et al., Proc. Natl. Acad. Sci. USA 91:5695-5699, 1994). These methods, as well as other methods known in the art of DNA amplification, can be used in the practice of the present invention.The sequence of the heterologous DNA insert or flanking genomic DNA sequence from the MON95275 maize events can be verified (and corrected if necessary) by amplifying such DNA molecules from maize seeds containing the MON95275 event DNA or maize plants grown from maize seeds containing the MON95275 event DNA deposited with the ATCC under accession number PTA-126049, using primers derived from the sequence presented in this document, followed by standard DNA sequencing of the PCR amplicon or fragments of its cloned DNA.

[0092] The diagnostic amplicon obtained by these methods can be detected using a variety of techniques. One such technique is genetic bit analysis (Nikiforov et al. Nucleic Acid Res. 22:4167–4175, 1994), in which a DNA oligonucleotide is designed to overlap both adjacent flanking genomic DNA sequences and inserted DNA sequences. The oligonucleotide is immobilized in the wells of a microtiter plate. Following PCR of the region of interest (using one primer in the inserted sequence and one in the adjacent flanking genomic sequence), the single-stranded PCR product can be hybridized to the immobilized oligonucleotide and serve as a template for a single-base extension reaction using DNA polymerase and labeled dideoxynucleotide triphosphates (ddNTPs) specific for the expected next base. Reading can be fluorescence or ELISA based.The signal indicates the presence of the transgene / genomic sequence due to successful amplification, hybridization and single base extension.

[0093] Another method is the pyrosequencing method described in Winge (Innov. Pharma. Tech. 00:18-24, 2000). In this method, an oligonucleotide is designed that overlaps the adjacent region of genomic DNA and the insert DNA. The oligonucleotide is hybridized with the single-stranded PCR product from the region of interest (one primer in the inserted sequence and one in the flanking genomic sequence) and incubated in the presence of DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5' phosphosulfate, and luciferin. DNTP is added individually, and incorporation results in a measurable light signal. The light signal indicates the presence of the transgene / genomic sequence due to successful amplification, hybridization, and extension with one or more bases.

[0094] Fluorescence polarization described in Chen et al. (Genome Res. 9:492-498, 1999) is a method that can be used to detect the amplicon of the present invention. By this method, an oligonucleotide is generated that spans the genomic flanking and inserted DNA junction. The oligonucleotide is hybridized with a single-stranded PCR product from the region of interest (one primer in the inserted DNA and one in the flanking genomic DNA sequence) and incubated in the presence of DNA polymerase and fluorescently labeled ddNTP. Single-base extension results in ddNTP incorporation. Incorporation can be measured as a change in polarization using a fluorometer. The change in polarization indicates the presence of the transgene / genomic sequence due to successful amplification, hybridization, and single-base extension.

[0095] Real-time polymerase chain reaction (PCR) provides the ability to monitor the progress of a PCR reaction as it occurs (i.e., in real time). Data is collected throughout the PCR process, rather than at the end of the PCR. In real-time PCR, reactions are characterized by the time point during the cycle when target amplification is first detected, rather than by the amount of target accumulated after a fixed number of cycles. In real-time PCR, a positive reaction is detected by the accumulation of a fluorescent signal. The higher the initial copy number of the target nucleic acid, the sooner a significant increase in fluorescence is observed. The cycle threshold (Ct value) is defined as the number of cycles required for the fluorescent signal to cross the threshold (i.e., exceed background levels). Ct levels are inversely proportional to the amount of target nucleic acid in the sample (i.e.,, the lower the Ct value, the greater the amount of target nucleic acid in the sample).

[0096] Taqman® (PE Applied Biosystems, Foster City, CA) is described as a method for detecting and quantifying the presence of a DNA sequence using real-time PCR and is fully understood according to the instructions provided by the manufacturer. Briefly, an oligonucleotide FRET probe is designed that spans the genomic flanking and junction of a DNA insert. The FRET probe and PCR primers (one primer in the DNA sequence insert and one in the genomic sequence insert) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage and release of a fluorescent fragment from a quencher fragment on the FRET probe. The fluorescent signal indicates the presence of the transgene / genomic sequence due to successful amplification and hybridization.

[0097] Molecular beacons were described for use in sequence detection as described by Tyangi et al. (Nature Biotech. 14:303–308, 1996). Briefly, an oligonucleotide FRET probe was designed that spans the junction of flanking genomic DNA and insert DNA. The unique structure of the FRET probe results in it containing a secondary structure that holds the fluorescent and quencher moieties in close proximity. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the insert genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Following successful PCR amplification, hybridization of the FRET probe to the target sequence results in the removal of the probe's secondary structure and spatial separation of the fluorescent and quencher moieties. The result is a fluorescent signal.The fluorescent signal indicates the presence of the flanking / transgene insert sequence following successful amplification and hybridization.

[0098] DNA detection kits based on DNA amplification methods comprise DNA primer molecules that specifically hybridize to a target DNA and amplify a diagnostic amplicon under appropriate reaction conditions. The kit may provide an agarose gel-based detection method or any number of diagnostic amplicon detection methods known in the art. DNA detection kits can be developed using the compositions disclosed herein and can be used to identify the MON95275 maize event DNA in a sample and can be used in methods for breeding maize plants containing the MON95275 event DNA. A kit comprising DNA primers homologous or complementary to any portion of the maize genomic region as set forth in SEQ ID NO: 10 and any portion of the inserted transgenic DNA as set forth in SEQ ID NO: 10 is the subject of the present invention.DNA molecules can be used in DNA amplification methods (PCR) or as probes in polynucleic acid hybridization methods, i.e., Southern analysis, Northern analysis.

[0099] The probes and primers of the present invention may have complete sequence identity with the target sequence, although primers and probes different from the target sequence that retain the ability to hybridize preferentially to the target sequence can be designed using conventional methods. For a nucleic acid molecule to serve as a primer or probe, it must be sufficiently complementary in sequence to be capable of forming a stable double-stranded structure at the specific solvent and salt concentrations used. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of transgenic DNA from the MON95275 maize event in a sample.Probes and primers are typically at least about 11 nucleotides long, at least about 18 nucleotides long, at least about 24 nucleotides long, or at least about 30 nucleotides long or longer. Such probes and primers hybridize specifically to the target DNA sequence under stringent hybridization conditions. Typical stringency conditions are described in Sambrook et al., 1989, and in Hames et al., in Nucleic Acid Hybridization: A Practical Approach, IRL Press, Washington, DC (1985).

[0100] Any number of methods well known to those skilled in the art can be used to isolate and manipulate the DNA molecule or fragment thereof disclosed in the present invention, including thermal amplification methods. DNA molecules or fragments thereof can also be obtained using other methods, such as direct synthesis of the fragment by chemical means, as is commonly practiced using an automated oligonucleotide synthesizer.

[0101] Thus, the DNA molecules and corresponding nucleotide sequences provided herein are useful, among other things, for identifying the maize event MON95275, detecting the presence of DNA derived from the transgenic maize event MON95275 in a sample, and monitoring samples for the presence and / or absence of the maize event MON95275 or plant parts derived from maize plants containing the event MON95275.

[0102] With respect to corn, corn sprouts, corn plant cells, corn seeds, corn plant parts, corn progeny plants, and corn commercial products are intended to be within the scope of the present invention, provided that each embodiment comprises a detectable amount of DNA corresponding to any one, two, or more segments described herein as diagnostic for the presence of the MON95275 corn event (e.g., such as a polynucleotide having at least one of the sequences set forth as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10). The corn plants, plant cells, seeds, plant parts, and progeny plants of the present invention may also comprise one or more additional transgenes.Such additional transgene may be any nucleotide of the sequence encoding a protein or RNA molecule that confers a desired trait, including, but not limited to, increased insect resistance, increased water use efficiency, increased yield, increased drought tolerance, increased seed quality, and / or increased herbicide tolerance.

[0103] The present invention relates to corn plants, corn plant cells, corn seeds, corn plant parts (such as pollen, ovule, stigma, spike, anther, ear, root tissue, stem tissue, leaf tissue, and seeds), and corn plant progeny obtained from a transgenic corn plant containing MON95275 DNA. An illustrative example of a corn seed containing the DNA of the event MON95275 has been deposited under the Budapest Treaty with the American Type Culture Collection (ATCC®). The ATCC repository has assigned Patent Deposit Designation PTA-126049 to a seed containing the DNA of the event MON95275.

[0104] The present invention relates to a microorganism comprising a DNA molecule having at least one sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, present in its genome. The microorganism is intended to include any microscopic cell, whether prokaryotic, eukaryotic or otherwise, that contains DNA in a genome or chromosome or an extrachromosomal DNA structure, more commonly referred to as a plasmid or vector. Microscopic organisms include bacteria (prokaryotes) and cells corresponding to higher life forms (eukaryotes) that are below the visual field of the average human. An example of such a microorganism is a transgenic plant cell.

[0105] Microorganisms, such as the plant cell of the present invention, are useful in many industrial applications, including, but not limited to, the following: (i) use as a research tool for scientific research or industrial research; (ii) use in culture to produce endogenous or recombinant carbohydrates, lipids, nucleic acids or protein products, or small molecules that can be used for subsequent scientific research or as industrial products; and (iii) use with modern plant tissue culture methods to produce transgenic plants or plant tissue cultures that can then be used for agricultural research or production. The production and use of microorganisms, such as transgenic plant cells, utilizes modern microbiological methods and human intervention to produce an artificial unique microorganism.In this process, recombinant DNA is integrated into the plant cell genome to create a transgenic plant cell that is distinct and unique from naturally occurring plant cells. This transgenic plant cell can then be cultured similarly to bacterial and yeast cells using modern microbiological techniques and can exist in an undifferentiated, single-cell state. The new genetic makeup and phenotype of the transgenic plant cell represents a technical effect created by the integration of heterologous DNA into the cell genome. Another aspect of this invention is a method of using the microorganism of the present invention.Methods of using the microorganisms of the present invention, such as transgenic plant cells, include (i) methods of producing transgenic cells by integrating recombinant DNA into the genome of a cell and then using the cell to produce additional cells having the same heterologous DNA; (ii) methods of culturing cells containing recombinant DNA using modern microbiological techniques; (iii) methods of obtaining and purifying endogenous or recombinant carbohydrates, lipids, nucleic acids, or protein products from cultured cells; and (iv) methods of using modern plant tissue culture techniques with transgenic plant cells to produce transgenic plants or transgenic plant tissue cultures.

[0106] The plants of the present invention can transmit to progeny the DNA of the event MON95275, including a transgene inserted into the maize event MON95275. In the context of this document, "progeny" includes any plant, plant cell, seed and / or regenerable part of a plant containing the DNA of the event MON95275 obtained from the ancestral plant and / or containing a DNA molecule having at least one sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10. The plants, progeny and seeds can be homozygous or heterozygous for the transgene of the event MON95275. The offspring may be grown from seeds of a plant containing the maize event MON95275 and / or from seeds of a plant fertilized with pollen of a plant containing the maize event MON95275.

[0107] Progeny plants can be self-pollinated (also known as "selfing") to produce true breeding lines, i.e., plants homozygous for the transgene. Selfing of the corresponding progeny can produce plants homozygous for both added exogenous genes.

[0108] Alternatively, the progeny plants may be outcrossed, such as crossed with another unrelated plant, to produce varietal or hybrid seeds or plants. The other unrelated plant may be transgenic or non-transgenic. Thus, varietal or hybrid seeds or plants of the present invention may be obtained by sexually crossing a first parent that lacks the specific and unique DNA of the maize event MON95275 with a second parent that contains the maize event MON95275, resulting in a hybrid containing the specific and unique DNA of the maize event MON95275. Each parent may be a hybrid or inbred / variegate, so long as the crossing or selection provides a plant or seed of the present invention, i.e.a seed comprising at least one allele comprising DNA of the maize event MON95275 and / or a DNA molecule having at least one sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10. Thus, two different transgenic plants can be crossed to obtain hybrid progeny that contain two independently segregating added exogenous genes. For example, MON95275, which contains Cry75Aa1, Vip4Da2, and DvSnf7, a specific dsRNA that confers insect resistance to maize, can be crossed with other transgenic maize plants to produce a plant that has the characteristics of both transgenic ancestors.One example of this would be crossing MON95275, which contains Cry75Aa1, Vip4Da2, and DvSnf7, a specific dsRNA gene suppressor that confers coleopteran resistance to corn, with a plant possessing one or more additional traits, such as herbicide resistance, insect resistance, or drought tolerance. This would result in progeny or seed plants that are resistant to coleopteran insect pests and possess at least one or more additional traits. Backcrossing with the parent plant and outcrossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Descriptions of other breeding methods commonly used for different traits and crops can be found in one of several references, such as Fehr, in Breeding Methods for Cultivar Development, Wilcox J. ed., American Society of Agronomy, Madison WI (1987).

[0109] The plants, progeny, seeds, cells and plant parts of the present invention may also comprise one or more additional corn traits or transgenic events, in particular those introduced by crossing a corn plant containing the MON95275 corn event with another corn plant containing the additional trait(s) or transgenic events. Such traits or transgenic events include, but are not limited to, increased insect resistance, herbicide resistance, increased water use efficiency, increased yield, increased drought tolerance, increased seed quality, improved nutritional quality, hybrid seed production or disease resistance, or fungal resistance. Corn transgenic events are known to those skilled in the art.For example, a list of such traits is provided by the Animal and Plant Health Inspection Service (APHIS) of the United States Department of Agriculture (USDA) and can be found on the website aphis.usda.gov. Thus, two or more transgenic events can be combined into a progeny seed or plant by crossing two parent plants, each containing one or more transgenic events, collecting the progeny seed, and selecting the progeny seed or plants that contain two or more transgenic events. These steps can be repeated until the desired combination of transgenic events in the progeny is achieved. Backcrossing with the parent plant, outcrossing with a non-transgenic plant, and vegetative propagation are also possible.

[0110] Also provided is a plant part derived from a corn plant comprising the object MON95275. As used herein, the term "plant part" refers to any plant part consisting of material derived from a corn plant comprising the object MON95275. Plant parts include, but are not limited to, seeds, pollen, ovules, stigmas, spikes, anthers, cobs, root tissue, stem tissue, and leaf tissue. Plant parts may be viable, non-viable, regenerable, and / or non-regenerable.

[0111] Further provided is a commercial product derived from corn plants comprising event MON95275 and comprising a detectable amount of nucleic acid specific for event MON95275. As used herein, the term "commercial product" refers to any composition or product that consists of material derived from a corn plant, whole or processed corn seeds, or one or more plant cells and / or plant parts that contain DNA of the corn event MON95275. Non-viable commercial products include, but are not limited to, non-viable seeds, whole or processed seeds, seed parts, and plant parts; animal feed comprising corn, corn oil, corn flour, corn starch, corn flakes, corn bran, corn pasta, corn biomass, and fuel products produced using corn and corn parts.Viable commodity products include, but are not limited to, seeds, plants, and plant cells. Thus, corn plants containing the event MON95275 can be used to produce any commodity product typically obtained from corn. Any such commodity product obtained from corn plants containing the event MON95275 may contain at least a detectable amount of specific and unique DNA corresponding to the corn event MON95275, and, in particular, may contain a detectable amount of polynucleotides comprising a DNA molecule having at least one sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10. Any standard method for detecting nucleotide molecules can be used, including the detection methods disclosed herein.A commercial product falls within the scope of this invention if it contains any detectable amount of a DNA molecule having at least one sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10 in the commercial product.

[0112] Therefore, the corn plants, corn plant cells, corn seeds, corn plant parts (such as pollen, ovule, stigma, spike, anther, ear, root tissue, stem tissue, leaf tissue), corn plant progeny and commercial products of the present invention are useful, among other things, for growing plants to obtain seeds and / or plant parts containing the corn event MON95275 for agricultural purposes, obtaining progeny containing the corn event MON95275 for plant breeding, use with microbiological techniques for industrial and research purposes and sale to consumers.

[0113] Methods for producing an insect-resistant corn plant comprising DNA specific and unique to the event MON95275 of the present invention are provided. The transgenic plants used in these methods may be homozygous or heterozygous for the transgene. The progeny plants obtained by these methods may be a varietal or hybrid plant; may be grown from seeds of a plant comprising the event MON95275 corn and / or from seeds of a plant fertilized with pollen of a plant comprising the event MON95275 corn; and may be homozygous or heterozygous for the transgene. The progeny plants may subsequently be self-pollinated to produce a true breeding line of plants, i.e. plants homozygous for the transgene, or alternatively, outcrossing may be performed, such as crossing with another unrelated plant to produce varietal or hybrid seeds or plants.

[0114] Methods are provided for detecting DNA obtained from a corn cell, corn tissue, corn seed, or corn plant containing a MON95275 corn event in a sample. One method comprises (i) extracting a DNA sample from at least one corn cell, corn tissue, corn seed, or corn plant; (ii) contacting the DNA sample with at least one primer capable of producing a DNA sequence specific for the MON95275 event DNA under conditions suitable for DNA sequencing; (iii) conducting a DNA sequencing reaction; and then (iv) confirming that the nucleotide sequence comprises a nucleotide sequence characteristic of event MON95275, a construct contained therein, such as one selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10.Another method comprises (i) extracting a DNA sample from less than one maize cell, maize tissue, maize seed, or maize plant; (ii) contacting the DNA sample with a primer pair that is capable of producing an amplicon from the DNA of event MON95275 under conditions suitable for DNA amplification; (iii) conducting a DNA amplification reaction; and then (iv) detecting the amplicon molecule and / or confirming that the nucleotide sequence of the amplicon comprises a nucleotide sequence specific for event MON95275, for example, selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6. The amplicon must be specific for event MON95275, for example, an amplicon comprising SEQ ID NO: 1, or SEQ ID NO: 2, or SEQ ID NO: 3, or SEQ ID NO: 4, or SEQ ID NO: 5, or SEQ ID NO: 6.Detection of a nucleotide sequence specific for the maize event MON95275 in the amplicon is a determining and / or diagnostic feature of the presence of DNA specific for the maize event MON95275 in the sample. An example of a primer pair that is capable of producing an amplicon from the DNA of the event MON95275 under conditions suitable for DNA amplification is presented as SEQ ID NO: 15 and SEQ ID NO: 16. Other primer pairs can be easily designed by a person skilled in the art and will produce an amplicon containing SEQ ID NO: 1, or SEQ ID NO: 2, or SEQ ID NO: 3, or SEQ ID NO: 4, or SEQ ID NO: 5 or SEQ ID NO: 6, wherein such a primer pair contains at least one primer in the genomic region flanking the insert and a second primer in the insert.Another method for detecting DNA derived from a corn cell, corn tissue, corn seed, or corn plant containing a MON95275 corn event in a sample comprises (i) extracting a DNA sample from less than one corn cell, corn tissue, corn seed, or corn plant; (ii) contacting the DNA sample with a DNA probe specific for the MON95275 event DNA; (iii) allowing the probe and the DNA sample to hybridize under stringent hybridization conditions; and then (iv) detecting hybridization between the probe and the target DNA sample. An exemplary sequence of a DNA probe specific for the MON95275 event is provided as SEQ ID NO: 17.Other probes can be easily designed by one of skill in the art and will comprise at least one fragment of genomic DNA flanking the insert and at least one fragment of insert DNA, such as the sequence described in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 10. Detection of hybridization of the probe with the DNA sample is a diagnostic indicator of the presence of DNA specific to the maize event MON95275 in the sample. Alternatively, the absence of hybridization is a diagnostic indicator of the absence of DNA specific to the maize event MON95275 in the sample.

[0115] DNA detection kits are provided that are useful for identifying the MON95275 maize event DNA in a sample and can also be used for methods of breeding maize plants containing the corresponding event DNA. Such kits comprise DNA primers and / or probes comprising fragments of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10. One example of such a kit comprises at least one DNA molecule of sufficient length from the contiguous nucleotides of SEQ ID NO: 10, which functions as a DNA probe suitable for detecting the presence and / or absence of DNA obtained from transgenic maize plants containing the MON95275 event in a sample.The DNA obtained from transgenic maize plants containing the MON95275 event will consist of a DNA molecule having at least one sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10. A DNA molecule sufficient for use as a DNA probe that is useful for determining, detecting or diagnosing the presence and / or absence of MON95275 maize event DNA in a sample is provided as SEQ ID NO: 17.Other probes can be easily designed by one of skill in the art and should include at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, or at least 40 consecutive nucleotides of SEQ ID NO: 10 and be sufficiently unique to the DNA of the maize event MON95275 to identify the DNA obtained from the event.

[0116] Another type of kit comprises a pair of primers suitable for producing an amplicon suitable for detecting the presence and / or absence of DNA derived from the MON95275 maize transgenic event in a sample. Such a kit may employ a method comprising contacting a target DNA sample with a pair of primers as described herein, then performing a nucleic acid amplification reaction sufficient to produce an amplicon comprising a DNA molecule having at least one sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, and then determining the presence and / or absence of the amplicon. This method may also include sequencing of the amplicon or its fragment, which will be decisive, i.e. diagnostic, for the presence of the specific DNA of the maize object MON95275 in the target DNA sample.Other primer pairs can be readily designed by one of skill in the art and should include at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive nucleotides of the sequence presented without limitation in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, and be sufficiently unique to the DNA of the maize event MON95275 to identification of DNA obtained from the object.

[0117] The detection kits and methods of the present invention are useful, among other things, for identifying the maize event MON95275, selecting plant varieties or hybrids containing the maize event MON95275, detecting the presence of DNA obtained from a transgenic maize plant containing the event MON95275 in a sample, and control samples for the presence and / or absence of maize plants containing the event MON95275 or plant parts obtained from maize plants containing the event MON95275.

[0118] Heterologous DNA insert sequences, sequences, junctions, or flanking sequences from the maize event MON95275 can be verified (and corrected if necessary) by amplifying such sequence from the event using primers derived from the sequence provided herein, followed by standard DNA sequencing of the amplicon or cloned DNA.

[0119] Methods are provided for determining the zygosity of a transgenic allele of DNA obtained from a maize cell, maize tissue, maize seed, or maize plant containing the maize event MON95275 in a sample.One method comprises (i) extracting a DNA sample from at least one corn cell, corn tissue, corn seed, or corn plant; (ii) contacting the DNA sample with a primer pair that is capable of producing a first amplicon diagnostic of event MON95275; (iii) contacting the DNA sample with a primer pair that is capable of producing a second amplicon diagnostic of native genomic DNA of corn that does not contain event MON95275; (iv) conducting a DNA amplification reaction; and then (v) detecting the amplicons, wherein the presence of only the first amplicon is diagnostic of homozygous event MON95275 DNA in the sample, and the presence of both the first amplicon and the second amplicon is diagnostic of a corn plant that is heterozygous for the event MON95275 allele.An exemplary set of primer pairs is provided as SEQ ID NO: 15 and SEQ ID NO: 16, which produce a diagnostic amplicon for event MON95275; and SEQ ID NO: 21 and SEQ ID NO: 22, which produce an amplicon diagnostic for wild-type maize genomic DNA that does not contain event MON95275. A set of probes can also be included in such an amplification method for use in a real-time PCR format using the sets of primer pairs described above. An exemplary set of probes is provided as SEQ ID NO: 17 (diagnostic for amplicon for event MON95275) and SEQ ID NO: 23 (diagnostic for amplicon for wild-type maize genomic DNA that does not contain event MON95275).

[0120] Another method for determining zygosity comprises (i) extracting a DNA sample from at least one corn cell, corn tissue, corn seed, or corn plant; (ii) contacting the DNA sample with a probe set that comprises at least a first probe that specifically hybridizes to event MON95275 DNA and at least a second probe that specifically hybridizes to corn genomic DNA that has been disrupted by the insertion of heterologous event MON95275 DNA and does not hybridize to event MON95275 DNA; (iii) hybridizing the probe set with the sample under stringent hybridization conditions, wherein detection of hybridization of only the first probe under the hybridization conditions is diagnostic for a homozygous allele of event MON95275 DNA in the sample; and the detection of hybridization of both the first probe and the second probe under hybridization conditions is diagnostic for the heterozygous allele of the MON95275 object in the DNA sample.

[0121] Another method for determining zygosity comprises (i) extracting a DNA sample from at least one corn cell, corn tissue, corn seed, or corn plant; (ii) contacting the DNA sample with a primer pair capable of producing an amplicon diagnostic for an allele of event MON95275; (iii) contacting the DNA sample with a primer pair that is capable of producing an amplicon of an internal standard known to be single-copy and homozygous in a corn plant; (iv) contacting the DNA sample with a probe set that comprises at least a first probe that specifically hybridizes to an allele of event MON95275 and at least a second probe that specifically hybridizes to an internal standard genomic DNA known to be single-copy and homozygous in a corn plant; (v) performing a DNA amplification reaction using real-time PCR and determining the cycle thresholds (Ct values) of the amplicon,corresponding toxin-coding sequence and a single-copy homozygous internal standard; (vi) calculating the difference (ΔCt) between the Ct value of the single-copy homozygous amplicon of the internal standard and the Ct value of the toxin-coding amplicon sequence; and (vii) determining the zygosity, where ΔCt around zero (0) indicates homozygosity of the inserted T-DNA, and ΔCt around one (1) indicates heterozygosity of the inserted T-DNA. Heterozygous and homozygous objects differ in unit ΔCt value, equal to approximately one (1). Considering the normal variability observed in real-time PCR due to many factors such as amplification efficiency and ideal annealing temperatures, the range of "around one (1)" is defined as a ΔCt from 0.75 to 1,25. The primer pairs and probes for the above zygosity determination method can amplify and detect amplicons from the event allele MON95275 and an internal standard. Exemplary primer pairs for detecting amplicons corresponding to the event allele MON95275 and an internal standard are shown as SEQ ID NO: 15 in combination with SEQ ID NO: 16 (event allele MON95275) and SEQ ID NO: 18 in combination with SEQ ID NO: 19 (internal standard). The accompanying exemplary probes are shown as SEQ ID NO: 17 (event allele MON95275) and SEQ ID NO: 20 (internal standard).Deposit information,

[0122] A deposit of an illustrative specimen of maize seed containing event MON95275 was made on August 21, 2019, pursuant to the Budapest Treaty, with the American Type Culture Collection (ATCC), located at 10801 University Boulevard, Manassas, Virginia, USA, ZIP Code 20110. The deposit has been accepted and assigned ATCC accession number PTA-126049. Access to the deposit will be open during the pendency of the application to the Commissioner of Patents and Trademarks and to such persons as the Commissioner may designate as authorized to make such access upon request. Upon grant of the patent, all restrictions on public availability will be irrevocably lifted. The deposit will be kept in the depository for thirty (30) years, or five (5) years after the last request, or for the life of the patent, whichever is longer, and will be replaced as necessary during that period.EXAMPLES

[0123] The following examples are included to more fully describe the present invention, which resulted from the design and testing of 163 constructs, the production of approximately 2,300 events, and the analysis of hundreds of thousands of individual plants over 6 years through the rigorous molecular, agronomic, and field testing necessary to create and select the MON95275 maize event.

[0124] Those skilled in the art, in light of the present disclosure, will appreciate that many changes can be made in the specific embodiments described and still obtain the same or similar result without departing from the spirit and scope of the invention. EXAMPLE 1 Expression Cassette Testing, Design of the Structure, Plant Testing, and Design Selection

[0125] It is often necessary to generate and screen a large number of gene expression constructs and transformation events to identify a construct and then an event that exhibits optimal expression of the introduced genes of interest and does not produce agronomic or phenotypic off-types.

[0126] For these reasons, developing a transgenic maize plant that produces insecticidal proteins active against coleopteran insects without any negative impact on agronomy, yield, or viability during stacking required extensive research, development, and analysis. Specifically, over a six-year period, more than 4,531 experimental and commercial transgenic objects derived from 163 different plasmid vector constructs were developed, tested, and analyzed.

[0127] This example describes the design and testing of 163 different constructs in maize plants to identify a preferred construct for object generation. Each construct differed in the sequential encoding of insecticidal proteins and transcriptional regulatory elements, and they were tested to select the preferred construct for use in expressing insecticidal proteins in plants. Each construct had a unique configuration, differing in the composition of the expression cassette (both insecticidal proteins, dsRNA, and expression elements), orientation, and whether the proteins were targeted for chloroplast insertion.

[0128] During the initial proof-of-concept and development phases, 160 constructs containing various combinations of 26 different promoters, 14 different enhancers, 14 different introns, 16 different insect toxin coding sequences, 16 different dsRNA coding sequences, and 14 different 3'-UTRs were used to generate over 2,000 transformants. Following initial molecular characterization for the presence of the transgene(s), 1,875 individual maize transformants were selected for further characterization and efficacy testing. These transformants were evaluated for phenotypic or agronomic abnormalities, insect toxin protein expression levels, and efficacy against the selected coleopteran pest species.The resulting protein efficiency and expression data, along with any information regarding phenotypic and agronomic biases, were used to eliminate ineffective proteins, expression elements, and combinations and to design a smaller number of binary commercial transformation plasmid constructs for use in the next stage of development. This proof-of-concept step in the development of MON95275 is designated "ROS Transformation and Analysis" in the timeline presented in Figure 3.

[0129] In the next phase of development, three new constructs were generated. These constructs included combinations of one to two insect toxin transgene expression cassettes and one dsRNA expression cassette in different orientations (convergent or divergent). These three constructs were used to generate transformed objects (also called “transformants”). After shoot formation in culture, a subset of transformed objects was selected based on visual characteristics and early molecular analysis. After initial transformation, 2,531 transformants were transferred to soil. 1,496 objects were removed after initial molecular characterization. Of the remaining 1,035 objects, 427 were removed based on plant health observations. The remaining 608 objects were potted and grown in a greenhouse (GH) for further analysis.Leaf samples from each event were used to measure DvSnf7-specific dsRNA expression using QuantiGene analysis and expressed as femtograms of DvSnf7 RNA per total micrograms of RNA (fg DvSnf7 RNA / μg RNA). An expression range of 1000-3000 fg DvSnf7 dsRNA / μg RNA was used to select events for further study. Of the remaining 608 events, 425 were found to express DvSnf7 dsRNA with an expression range of 1000-3000 fg DvSnf7 dsRNA / μg RNA. Nineteen of the remaining 425 events were eliminated due to lack of insect toxin protein expression, leaving 406 events for further analysis and characterization. R0 events were left to self-pollinate and produce R1 seeds. Based on observations of plant health and seed return, 152 sites were removed, leaving a total of 254 sites for further study.Following further molecular characterization, 102 events were removed, leaving a total of 152 events for the R1 nursery for performance studies, additional molecular characterization, expression studies, and seed recovery and segregation analysis. This commercial transformation and R0 screening stage in the development of event MON95275 is identified as "Comm, TFN R0 Screening" in the timeline presented in Fig. 3.

[0130] Because plant tests against the cereal rootworm are destructive assays requiring removal of the plant from the pot to assess overall root damage, R0 plants are used to generate R1 seeds so that there are sufficient seeds to continue generations of each selected species for further efficacy and agronomic evaluations, as well as for further molecular characterization. Plants generated from Ri seeds were evaluated for efficacy against the western corn rootworm (Diabrotica virgifera virgifera, WCR) and northern corn rootworm (Diabrotica barberi, NCR). Based on efficacy studies, additional molecular characterization, expression studies, seed recovery analysis, and segregation, 57 events derived from the 3 constructs were submitted for further analysis. This R1 efficacy / molecular screening step is identified as “GH / Mol Screening” in Fig. 3.Following the R1 efficiency / molecular screening step, objects derived from one construct (Construct-2 in Table 2) were removed based on decisions regarding the configuration of the construct and toxin expression cassettes.

[0131] Table 2 shows the number of events retained for each construct for each stage of the selection described above. The plasmid construct pM95275 was the construct used in the transformation, producing the maize event MON95275.

[0132] Field efficacy trials in the US in 2017 reduced the total number of targets to 14 from construct-1 and construct pM95275 based on efficacy, phenotypic observations, and molecular studies such as insertion site integration.

[0133] The objects obtained from construct-1 in Table 2 were removed based on decisions regarding the expression of the insecticidal protein.

[0134] Thus, multiple rounds of testing and comparison of various constructs have shown that events produced using the transgene cassette represented as SEQ ID NO: 13, construct pM95275, provide preferential efficacy against the coleopteran pest species western corn rootworm (Diabrotica virgifera virgifera, WCR) and northern corn rootworm (Diabrotica barberi, NCR), and preferential molecular characteristics and agronomic performance. EXAMPLE 2 Field trials, molecular testing and event selection

[0135] This example describes the molecular characterization, analysis, and field testing of targets generated using the pM95275 construct at multiple locations over several years, leading to the selection of the final target, MON95275.

[0136] Table 3 illustrates the process used to select the MON95275 event. One hundred forty (140) transformed R0 events from the pM95275 construct were generated and selected for growth in a commercial R0 transformation screen. After quantification of DvSnf7 expression, three events that did not meet the expression range criteria of 1000-3000 fg DvSnf7 dsRNA / μg RNA were removed, leaving 137 events for further analysis. The remaining 137 events were analyzed for Cry75Aa1 and Vip4Da2 toxin expression, and seven events were removed based on the assays, leaving 130 events for R0 screening. After R0 screening, five-hundred and fifty-two events were removed due to poor seed return or plant health, leaving a total of 78 for further molecular characterization. After molecular characterization, 56 objects remained.

[0137] The remaining 56 objects were sent to nursery R1 for further testing. From nursery R1, an additional 8 objects were removed due to poor seed returns and segregation analysis, and 21 objects were excluded due to issues related to protein expression and molecular characterization, leaving 19 objects.

[0138] The remaining 19 objects proceeded to the R2 / F1 Cre crossing phase, in which the CP4 marker cassette was removed by breeding. During the R2 / F1 Cre crossing phase, 12 objects were removed: 7 due to additional molecular characterization and 5 due to concerns regarding agronomic performance and other molecular studies.

[0139] The remaining 7 events went to the US field trials in 2017. After the field trials, 3 of the remaining 7 events were removed, 1 due to an incorrect phenotype observed in the field and 2 that performed worse than the others in terms of efficacy and agronomy, leaving 4 events for the US field trials in 2018. During the US field trials in 2018, 1 event was removed due to an incorrect transcription pattern of the DvSnf7 dsRNA expression cassette and 1 due to agronomic performance, leaving 2 events, event 1 and event MON95275.After further analysis of the agronomic performance of the events obtained from multiple field trials in the United States and Argentina, event MON95275 was selected as the event for commercialization because it scored higher as a dsRNA than event 1 when comparing all the molecular characterization, DvSnf7 protein and dsRNA expression, efficiency, and agronomy characteristics of each event. EXAMPLE 3Cre-cutting of glyphosate selection cassette in corn object MON95275

[0140] This example describes the removal of the glyphosate selection cassette from the MON95275 maize event via in vivo Cre excision. The glyphosate selection cassette was used to select transformed events. By removing the selection cassette, a "markerless" event was created, in which the final event contained only the insecticidal protein expression cassettes.

[0141] Immature embryos of maize cultivar LH244 were transformed using the Agrobacterium-mediated transformation process using the construct pM95275 (represented as SEQ ID NO: 13 and illustrated in Fig. 2). The construct pM95275 contains four expression cassettes: two expression cassettes for expressing the insecticidal proteins Cry75Aa1 and Vip4Da2, one expression cassette for expressing the dsRNA DvSnf7, and one cassette for selecting the transformed plant cells via glyphosate selection. The selection cassette was flanked on both sides by the sequence-recognizing Cre recombinase LoxP.

[0142] After transformation, the R0 transformants were self-pollinated for two generations, during which many events were removed based on various analyses, such as efficiency, DvSnf7 expression, protein expression, seed recovery, and plant health, as well as molecular characterization. In the R2 generation, 19 events remained from the original 140 events. The 19 homozygous events of the R2 generation were crossed with an elite line of transformed maize plants expressing the Cre recombinase enzyme derived from the Enterobacteria phage P1.

[0143] This step, during which the R2 generation objects were crossed with the Cre recombinase-expressing plants, is designated as “Cre Cross” in the timeline presented in Fig. 3. Specifically, in this step, the tassel-less R2 generation plants (females) homozygous for SEQ ID NO: 13 were cross-pollinated with transgenic maize plants (males) homozygous for the transgene cassette used to express the Cre recombinase enzyme. The Cre recombinase-expressing male donor pollen germinates after being planted on the female plant’s stigma tissue containing SEQ ID NO: 13. Once the pollen tube enters the embryo sac, the pollen tube ruptures, releasing two Cre recombinase-expressing male donor sperm. The nucleus of one sperm fuses with the nucleus of an egg, forming a zygote.The other sperm nucleus fuses with one of the two polar nuclei, which in turn fuses with the other polar nucleus, thereby forming the primary endosperm nucleus.

[0144] Thus, when a Cre recombinase-expressing plant is used as a male pollen donor, both the embryo and endosperm of the resulting cross will express Cre recombinase as the cells divide and develop to become a maize kernel (i.e., a seed). Cre recombinase binds to the inverted repeats at the LoxP site and catalyzes crossing over within the eight-base pair spacer region of the two LoxP sites flanking the expression cassette, resulting in excision of the marker cassette with one LoxP site remaining in the integrated T-DNA due to recombination (see Fig. 2, “Inserted T-DNA after Cre excision”).

[0145] F1 progeny resulting from the Cre cross were selected for the absence of the CP4 selection cassette and allowed to self-pollinate. This step, during which the F1 progeny were allowed to self-pollinate, is designated as “F1Self” in the timeline presented in Fig. 3. During this process, two alleles—the Cre recombinase allele and the T-DNA allele—were used to generate event MON95275—segregation in the resulting F2 population, resulting in progeny that are homozygous or heterozygous for one or both alleles.

[0146] F2 progeny demonstrating the absence of the Cre recombinase allele and homozygosity for SEQ ID NO: 9, the transgene T-DNA insertion after Cre excision, were selected. These selected F2 progeny were self-pollinated, yielding an F3 generation homozygous for SEQ ID NO: 9. This step, during which the F2 progeny were allowed to self-pollinate, is designated as “F2Self” in the timeline shown in Fig. 3.

[0147] Further self-pollination produced F3 offspring seeds (F4 seeds), which were tested for purity and designated as "gold standard seeds." F4 was the first generation of gold standard seeds. Gold standard seeds are seeds that have been tested for purity to ensure the absence of objects other than MON95275. This stage, during which the F3 offspring were allowed to self-pollinate, is designated "F3Self" in the timeline shown in Fig. 3.

[0148] Removal of the glyphosate selection marker cassette did not affect the expression of Cry75Aa1, Vip4Da2, and DvSnf7 dsRNA. Removal of the glyphosate selection cassette from the MON95275 maize event via Cre excision produced a maize event resistant to coleopteran pests without adding glyphosate tolerance to the final event. This “markerless” event provides flexibility in constructing maize breeding stacks with other maize transgenic events to provide multiple products incorporating the MON95275 event and allows for the use of multiple variants to provide additional traits in final commercial breeding stacks. EXAMPLE 4: Maize event MON95275 exhibits resistance to the coleopteran insect pests western corn rootworm and northern corn rootworm.

[0149] This example describes the activity of maize event MON95275 against coleopteran insect pests. The insect toxin proteins Cry75Aa1 and Vip4Da2 and the DvSnf7 dsRNA, when coexpressed in maize event MON95275, confer resistance to the western corn rootworm (Diabrotica virgifera virgifera, WCR) and northern corn rootworm (Diabrotica barberi, NCR). MON95275 demonstrates resistance to the western corn rootworm in both greenhouse and field conditions.

[0150] After transformation and introduction of the pM95275 construct, R0 stage plants were transferred to a greenhouse and allowed to self-pollinate and produce seeds. Selected R1 seeds were sown in pots and grown in a greenhouse. Western corn rootworm (WCR) eggs were incubated for approximately 10 days to ensure hatching within 4 days of inoculation. Six plants were analyzed for each plant. Plants were inoculated at approximately V2 to V3 stages. Approximately 2000 eggs were inoculated into each pot. Plants were grown after inoculation for approximately 28 days. The plants were then removed from the pots, and the roots were thoroughly washed to remove all soil. Root damage for each plant was scored on a damage score scale from 0 to 3, as shown in Table 4. Comparisons were made with a wild-type negative control of the same cultivar as the transformants.A root damage rating (RDR) of 0-0.75 represents good effectiveness, an RDR of 0.76-1.5 represents average effectiveness, and an RDR of 1.6-3.0 represents low or poor effectiveness.

[00100] As can be seen from Table 5, the maize event MON95275 demonstrated significant efficacy compared to the negative control.

[0151] Field efficacy trials were conducted in the United States to evaluate resistance of maize event MON95275 to WCR. Field trials were conducted at eight separate locations known to be infested with WCR: Colesburg, IA; Fairbank, IA; Independence, IA; Lee, NE; Pilger, NE; Roanoke, IL; Rowan, IA; and Shelby, NE. Hybrid plants produced by crossing the inbred maize event MON95275 (LH244) with maize cultivar 93IDI3 were grown in WCR-infested fields. Maize event MON95275 still contained the CP4 marker cassette in this field trial. In addition, two negative controls were also grown; (1) Lepidoptera-resistant maize hybrid MON89034 (93IDI3) x ​​LH244 and (2) non-transgenic maize hybrid 93IDI3 x LH244.

[0152] The trials at each location were set up as a randomized complete block design. Plots were blocked repeatedly, and within a given block, plot location was randomized. Both MON95275 and control treatments were presented once in each block. Block dimensions, such as the number of columns per row by the number of ranges in depth, varied across locations depending on the field size and shape. Each entry was evenly distributed across the field to compensate for any potential differences in WCR pressure. Approximately 10 plants each of MON95275 and control treatments were harvested at approximately the VT stage. Roots were thoroughly washed, and each plant was assigned a root damage rating (RDR) from 0.1 to 3.00, as presented in Table 6.

[0153] Tables 7 and 8 show the mean root damage scores for maize event MON95275 and two negative controls corresponding to each field.

[0154] ​​As shown in Tables 7 and 8, corn variant MON95275 demonstrated resistance to WCR compared to the negative control. While most control samples experienced damage that could potentially lead to economic losses based on the RDR scale presented in Table 6, corn variant MON95275 demonstrated resistance to WCR and only experienced damage that could be considered non-economic in all locations.

[0155] In the summer of 2018, field efficacy trials were conducted in 5 areas of the United States known to be infested with WCR to evaluate resistance of MON95275 corn events to WCR: Dundee, IA; Lee, NY; Oneida, IA; Pilger, NY; and Kingsley, IA. Field trials were conducted and root injury assessments were performed as described above. Both marker-positive and marker-free MON95275 corn events were analyzed along with the two previously described negative controls. Tables 9 and 10 show the mean root injury scores for marker-positive and marker-free MON95275 corn events and the two negative controls corresponding to each field.

[0156] As shown in Tables 9 and 10, both marker-positive and marker-free MON95275 maize specimens demonstrated resistance to WCR compared to the negative control. In all but one location, damage to both marker-positive and marker-free MON95275 maize specimens was unprofitable. Damage in Pilger, Nebraska, was higher, but still significantly lower than damage to the negative controls at this location.

[0157] Corn event MON95275 provides resistance to western corn rootworm (Diabrotica virgifera virgifera) as demonstrated in greenhouse and two field trials in the United States. MON95275 provides resistance to northern corn rootworm in the field.

[0158] In the summer of 2017, a single field trial was conducted in Hawkeye, Iowa, in a field known to be infested with northern corn rootworm (NCR). The marker-positive corn hybrid event MON95275 and two negative controls, as described above, were grown in multiple plots under field conditions similar to those used for the western corn rootworm. Root damage scores were assessed for event MON95275 and two negative controls using the same scale presented in Table 6. Table 11 shows the mean root damage scores and RDR ranges for the marker-positive corn event MON95275 and the negative control.

[0159] As can be seen from Table 11 above, the average RDR for the marker-positive MON95275 was lower than that of the negative control MON89034 (93IDI3) x ​​LH244. The average RDR was low for the non-transgenic control, suggesting that the NCR pressure under field conditions was low.

[0160] In the summer of 2018, field trials were conducted at three separate locations known to be infested with NCR: Belmond, Iowa; Benson, Minnesota; and Colton, South Dakota. The field trials were conducted as described above. Tables 12 and 13 show the average RDR and RDR range for the three locations.

[0161] As shown in Tables 12 and 13, corn event MON95275 exhibited resistance to NCR. For example, in Benson, Minnesota, NCR pressure was high, as evidenced by the high average RDR of the negative controls, but the average RDR was lower than the economic damage in corn event MON95275. In all three (3) locations, MON95275 demonstrated resistance to NCR compared to the two negative controls.

[0162] MON95275 provides resistance to the northern corn rootworm (Diabrotica barberi). EXAMPLE 5 The MON95275 corn plant produces stable yield and agronomic performance similar to non-transformed LH244 corn plants.

[0163] This example demonstrates that the MON95275 maize transgenic event provides stable yield and similar agronomic performance under field conditions to non-transformed LH244 maize plants.

[0164] Field trials were conducted with MON95275-matched plants before and after Cre-cutting of the glyphosate selection cassette to determine various aspects of yield and agronomy compared to control plants. Yield measurements were calculated and expressed as bushels per acre (b / ac). Plant height and ear height were measured in inches (in). 50% pollen shedding and 50% ear pubescence of corn were expressed as days after planting (DAP).

[0165] During the 2017 growing season in the United States, yield and management were determined for MON95275 inbreds and hybrids before Cre excision of the glyphosate marker cassette. Tables 14 and 15 show the yield and agronomic characteristics measured for MON95275 inbreds and hybrids, respectively. The negative control for inbred comparisons was the untransformed variety LH244. Hybrids containing MON95275 were created by cross-pollinating the inbred MON95275 with the maize variety 93IDI3, and the control was a cross between MON 89034 (93IDI3) and LH244.

[0166] As shown in Tables 15 and 16, yield and other agronomic traits for MON95275 in the 2017 US field trials were relatively similar for both inbreds and hybrids compared to controls. Variability between inbreds and hybrids and their respective controls was within acceptable limits and demonstrated no negative impact on yield and other agronomic traits caused by the T-DNA insertion into the MON95275 maize genome.

[0167] During the 2018 growing season in the United States, yield and agronomic management were determined for MON95275 inbreds and hybrids before Cre-excision and after Cre-excision of the glyphosate marker cassette. Tables 16 and 17 show the yield and agronomic characteristics measured for MON95275-positive and marker-free inbreds and hybrids, respectively.

[0168] As shown in Tables 16 and 17, yield and other agronomic traits for MON95275, both marker-positive and marker-free, were relatively similar for both inbreds and hybrids compared to controls in the 2018 US field trials. Variability between inbreds and hybrids and their respective controls was within acceptable limits and demonstrated no negative impact on yield and other agronomic traits caused by the T-DNA insertion into the MON95275 maize genome.

[0169] Yield and agronomic performance were also studied in Argentina during the 2018-2019 growing season for markerless MON95275 inbreds. Table 18 shows the yield and agronomic performance measured for markerless MON95275 inbreds.

[0170] As shown in Table 18, yield and other agronomic traits were relatively similar between marker-free inbred and control varieties from the 2018-2019 Argentina field trials. The variability between inbreds and controls was within acceptable limits, indicating that there was no negative impact on yield and other agronomic traits caused by the T-DNA insertion into the MON95275 maize genome. EXAMPLE 6 TAQMAN® event-specific endpoint assays for MON95275 maize

[0171] The following example describes methods suitable for identifying the presence of MON95275 in a corn sample. A pair of PCR primers and a probe were designed to identify the unique junction formed between corn genomic DNA and inserted MON95275 DNA in an object-specific endpoint TAQMAN® PCR assay. Examples of conditions used to detect the presence of MON95275 in a corn sample in an object-specific endpoint TAQMAN® PCR are described in Table 19 and Table 20.

[0172] The sequence of the oligonucleotide forward primer SQ20267 (SEQ ID NO: 15) is identical to the nucleotide sequence corresponding to positions 15706-15732 in SEQ ID NO: 10. The sequence of the oligonucleotide reverse primer SQ51355 (SEQ ID NO: 16) is identical to the reverse sequence of the nucleotide sequence corresponding to positions 15756-15779 in SEQ ID NO: 10. The sequence of the oligonucleotide probe PB10263 (SEQ ID NO: 17) is identical to the nucleotide sequence corresponding to positions 15734-15752 in SEQ ID NO: 10. Primers SQ20267 (SEQ ID NO: 15) and SQ51355 (SEQ ID NO: 16) with probe PB10263 (SEQ ID NO: 17), which can be fluorescently labeled (e.g., 6-FAM™ fluorescent label), can be used in the final TAQMAN® PCR assay to detect the presence of MON95275-derived DNA in a sample.

[0173] In addition to SQ20267 (SEQ ID NO:15), SQ51355 (SEQ ID NO:16), and PB10263 (SEQ ID NO:17), it will be apparent to those skilled in the art that other primers and / or probes can be designed to either amplify or hybridize to the sequences in SEQ ID NO:10 that are unique and suitable for detecting the presence of DNA derived from MON95275 in a sample.

[0174] In accordance with standard molecular biology laboratory practice, PCR assays were developed for target identification to detect MON95275 in the sample. Parameters for either the standard PCR assay or the TAQMAN® PCR assay were optimized for each set of primer and probe pairs (e.g., probes labeled with a fluorescent tag such as 6-FAM™) used to detect the presence of MON95275-derived DNA in the sample. The control for the PCR reaction includes internal control primers and an internal control probe (e.g., VIC®-labeled) specific to the region of the maize genome that is used as an internal control, and are primers SQ20222 (SEQ ID NO: 18), SQ20221 (SEQ ID NO: 19), and a VIC®-labeled probe PB50298 (SEQ ID NO: 20).

[0175] Typically, the parameters optimized for MON95275 detection in the sample included primer and probe concentrations, template DNA amount, and PCR amplification cycle parameters. Controls for this assay included a positive control from MON95275-containing corn, a negative control from non-transgenic corn, and a negative control containing no template DNA. EXAMPLE 7 Zygosity assays for maize object MON95275 using TAQMAN®

[0176] The following example describes methods useful for determining the zygosity of the MON95275 event. The PCR primer pairs and probe are designed to detect specific properties of the alleles positive for the T-DNA insertion that gave rise to the MON95275 event, and the PCR primer pairs and probe are designed as an internal control probe specific to a region of the maize genome that is used as an internal control and is present in the maize genome as homozygous.

[0177] The PCR primer and probe pairs specific for the allele of the MON95275 transgene described in Example 6, PCR primers SQ20267 (SEQ ID NO: 15), SQ51355 (SEQ ID NO: 16), 6-FAM™-labeled probe PB10263 (SEQ ID NO: 17), and the PCR primer and probe pairs specific for the internal control, primers SQ20222 (SEQ ID NO: 18), SQ20221 (SEQ ID NO: 19), and VIC®-labeled probe PB50298 (SEQ ID NO: 20) are used in a real-time PCR reaction such as the reaction described in Example 6.

[0178] After amplification, the cycle thresholds (Ct values) for the amplicon corresponding to the inserted MON95275 allele and the single-copy homozygous internal standard are determined. The difference (ΔCt) between the Ct value of the single-copy homozygous amplicon of the internal standard and the Ct value of the amplicon with the inserted MON95275 allele is determined. Regarding zygosity, ΔCt near zero (0) indicates homozygosity of the inserted MON95275 T-DNA, and ΔCt near one (1) indicates heterozygosity of the inserted MON95275 T-DNA. The absence of an amplicon corresponding to the inserted MON95275 allele indicates that the sample is null for the inserted MON95275 T-DNA. Ct values ​​in the TAQMAN® thermal strengthening process will have some variability due to a variety of factors, such as strengthening efficiency and ideal annealing temperatures. Therefore, the "near one (1)" range is defined as a ΔCt of 0.75 to 1.25.EXAMPLE 8 Zygosity assays for maize event MON95275 using TAQMAN®.

[0179] The following example describes the method used to determine the zygosity of the MON95275 object in a corn sample.

[0180] The PCR primer pair and probe are designed to detect specific properties of the T-DNA insertion-positive and -negative alleles giving rise to event MON95275. Examples of conditions that can be used in the TAQMAN® event-specific zygosity PCR are provided in Tables 21 and 22. For this assay, four different primers and two different probes are mixed with the sample. The DNA primer pairs used in the zygosity assay are (1) primers SQ20267 (SEQ ID NO: 15) and SQ51355 (SEQ ID NO: 16); and (2) primers PNEG95275_F (SEQ ID NO: 21) and PNEG95275_R (SEQ ID NO: 22). The probes used in the zygosity analysis were 6FAM™-labeled probe PB10263 (SEQ ID NO: 17) and VIC®-labeled probe PRBNEG95275 (SEQ ID NO: 23).Primers SQ20267 (SEQ ID NO: 15) and SQ51355 (SEQ ID NO: 16) produce the first amplicon that can be identified by binding to the 6FAM™-labeled probe PB10263 (SEQ ID NO: 17), and the detected binding of the probe to the amplicon is diagnostic of the presence of event MON95275 DNA in a sample containing maize DNA. Primers PNEG95275 F (SEQ ID NO: 21) and PNEG95275 R (SEQ ID NO: 22) produce a second amplicon that can be identified by binding to the VIC®-labeled probe PRBNEG95275 (SEQ ID NO: 23), and the detected binding of the amplicon probe is diagnostic in the absence of event DNA MON95275 when a sample containing maize DNA lacks a copy of MON95275; i.e., this second set of primers and probes is diagnostic for the wild-type allele.

[0181] When three primers and two probes are mixed together in a PCR reaction with DNA isolated from a plant heterozygous for event MON95275, a fluorescent signal is detected from both the 6FAM™-labeled probe PB10263 (SEQ ID NO: 17) and the VIC®-labeled probe PRBNEG95275 (SEQ ID NO: 23), and the detection of both fluorophores in this thermal amplification reaction indicates a diagnosis of a plant heterozygous for event MON95275. When three primers and two probes are mixed together in a PCR reaction with DNA isolated from a plant homozygous for event MON95275, a fluorescent signal is detected only from the 6FAM™-labeled probe PB10263 (SEQ ID NO: 17), and not from the VIC®-labeled probe PRBNEG95275 (SEQ ID NO: 23). When three primers and two probes are mixed together in a PCR reaction with DNA isolated from a plant that is null for MON95275 (i.e., wild-type), a fluorescent signal is detected only from the VIC®-labeled probe PRBNEG95275 (SEQ ID NO: 23).The template DNA samples and controls for this assay are a positive control from maize containing MON95275 DNA (from both known homozygous and known heterozygous samples), a negative control from non-transgenic maize, and a negative control that does not contain template DNA. EXAMPLE 9 Identification of corn object MON95275 in any breeding object MON95275

[0182] The following example describes how the DNA of event MON95275 can be identified in the progeny of any breeding activity using the maize event MON95275. For example, event MON95275 can be combined through breeding or in situ introgression with other events known in the art for controlling corn rootworm pests, such as any of the following maize events, including but not limited to MON863, MON88017, DAS-59122-7, DP-004114-3, DP23211, and MIR604.Event MON95275 may also be combined, through breeding or in situ introgression, with other transgenic maize events known in the art for controlling pests other than corn rootworms, such as events including, but not limited to, MON810, TC1507, MON89034, MON95379, and MIR162, among those that confer resistance to lepidopterans, or events that provide expression of proteins that confer resistance to any number of herbicides known in the art.

[0183] Pairs of DNA primers are used to generate an amplicon diagnostic for the maize event MON95275. The diagnostic amplicon for the event DNA MON95275 comprises at least one junction sequence. The junction sequences for the specific event DNA MON95275 are as follows: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6 ([1], [2], [3], [4], [5], and [6], respectively, in Fig. 1). SEQ ID NO: 1 is a fifty (50) nucleotide sequence representing the 5' junction regions of the maize genomic DNA and the expression cassette of the integrated transgene. SEQ ID NO: 1 is located in SEQ ID NO: 10 at nucleotide positions 1049-1098. SEQ ID NO: 2 is a fifty (50) nucleotide sequence representing the 3'-junction regions of maize genomic DNA and the expression cassette of the integrated transgene. SEQ ID NO: 2 is located in SEQ ID NO: 10 at nucleotide positions 15731-15780.SEQ ID NO:3 is a one hundred (100) nucleotide sequence representing the 5' junction regions of maize genomic DNA and the expression cassette of the integrated transgene. SEQ ID NO:3 is located in SEQ ID NO:10 at nucleotide positions 1024-1123. SEQ ID NO:4 is a one hundred (100) nucleotide sequence representing the 3' junction regions of maize genomic DNA and the expression cassette of the integrated transgene. SEQ ID NO:4 is located in SEQ ID NO:10 at nucleotide positions 15706-15805. SEQ ID NO:5 is a two hundred (200) nucleotide sequence representing the 5' junction regions of maize genomic DNA and the expression cassette of the integrated transgene. SEQ ID NO: 5 is located in SEQ ID NO: 10 at nucleotide position 974-1173. SEQ ID NO: 6 is a two hundred (200) nucleotide sequence representing the 3'-regions of the junction of the maize genomic DNA and the expression cassette of the integrated transgene.SEQ ID NO: 6 is located in SEQ ID NO: 10 at nucleotide positions 15656-15855.

[0184] The primer pairs that will produce amplicon diagnostics for event MON95275 include primer pairs based on the flanking sequence (SEQ ID NO: 11 and SEQ ID NO: 12) and the inserted T-DNA (SEQ ID NO: 9). To obtain a diagnostic amplicon in which SEQ ID NO: 1, or SEQ ID NO: 3, or SEQ ID NO: 5 is detected, a forward primer molecule can be designed based on the 5'-flanking maize genomic DNA (SEQ ID NO: 11) from bases 1-1073 and a reverse primer molecule based on the inserted T-DNA (SEQ ID NO: 9) from positions 1074 to 15755, in which the primer molecules have a sufficient length of contiguous nucleotides to specifically hybridize with SEQ ID NO: 11 and SEQ ID NO: 9.To obtain a diagnostic amplicon in which SEQ ID NO: 2, or SEQ ID NO: 4, or SEQ ID NO: 6 is detected, a forward primer molecule based on the inserted T-DNA (SEQ ID NO: 9) from positions 1074-15755 and a reverse primer molecule based on the 3'-flanking maize genomic DNA (SEQ ID NO: 12) from positions 15756-16861 can be designed, wherein the primer molecules have a sufficient length of adjacent nucleotides to specifically hybridize with SEQ ID NO: 9 and SEQ ID NO: 12.

[0185] For practical purposes, primers should be designed that produce amplicons of a limited size range, preferably between 200 and 1000 bases. Smaller amplicons are generally more reliably produced in thermal amplification reactions, allow for shorter cycle times, and can be easily separated and visualized on agarose or acrylamide gels or adapted for use in assays such as TAQMAN®. Furthermore, amplicons produced using these primer pairs can be cloned into vectors, amplified, isolated, and sequenced, or directly sequenced using methods well known in the art.Any pair of primers obtained from combinations of SEQ ID NO: 11 and SEQ ID NO: 9 or SEQ ID NO: 12 and SEQ ID NO: 9, which are useful in a method of amplifying DNA to produce an amplicon diagnostic for the DNA or progeny of event MON95275, is an aspect of the present invention. Any single isolated polynucleotide DNA primer molecule comprising at least eleven (11) contiguous nucleotides of SEQ ID NO: 11, SEQ ID NO: 9 or SEQ ID NO: 12 or their complements, which can be used in a method of amplifying DNA to produce an amplicon of event MON95275 DNA or its progeny containing such DNA, is an aspect of the present invention.

[0186] An example of amplification conditions for this assay is illustrated in Tables 19 and 20. Any modification of these methods or the use of DNA primers homologous or complementary to SEQ ID NO: 11 or SEQ ID NO: 12, or the DNA sequence of the genetic elements contained in the transgene insert (SEQ ID NO: 9) of the DNA of event MON95275, which produce a diagnostic amplicon for the DNA of event MON95275, are within the scope of the art. The diagnostic amplicon comprises a DNA molecule homologous or complementary to at least one transgene / genomic DNA compound or a substantial portion thereof.

[0187] The analysis of the event MON95275 plant tissue sample should include a positive control of plant tissue containing event MON95275 DNA, a negative control of a maize plant that does not contain event MON95275 DNA (e.g., LH244), and a negative control that does not contain maize genomic DNA. The primer pair will amplify the endogenous maize DNA molecule and will serve as an internal control for the DNA amplification conditions. The additional primer sequence can be selected from SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 9 by those skilled in the art of DNA amplification methods. The conditions selected for obtaining the amplicon using the methods presented in Table 19 and Table 20 may differ, but the resulting amplicon is diagnostic for event MON95275 DNA. The use of DNA primer sequences or with modifications of the methods from Table 23 and Table 24 is within the scope of the present invention.An amplicon produced by at least one DNA primer of a sequence derived from SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 9, which is diagnostic for event MON95275, is an aspect of the present invention.

[0188] DNA detection kits that contain at least one DNA primer of sufficient length from contiguous nucleotides derived from SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 9, which, when used in a DNA amplification method, produces an amplicon diagnostic for the DNA of event MON95275, or progeny containing such DNA, is an aspect of the present invention. A corn plant or seed, the genome of which will produce an amplicon diagnostic for the DNA of event MON95275, when tested by a DNA amplification method, is an aspect of the present invention. Amplicon analysis of event MON95275 can be performed using the Applied Biosystems GeneAmp™ 9700 PCR System, the Stratagene Robocycler®, the Eppendorf® Mastercycler® gradient thermal cycler, or any other amplification system that can be used to generate an amplicon diagnostic for event MON95275 DNA, as shown in Table 24.

[0189] All publications and published patent documents cited in this specification and essential to this invention are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0190] Having illustrated and described the basic ideas of the present invention, it will be apparent to those skilled in the art that the invention may be modified in design and detail without departing from these basic ideas. All modifications are hereby claimed that fall within the spirit and scope of the appended claims of the present invention.---> <?xml version="1.0" encoding="UTF-8"?><!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing1.3 / / EN" "ST26SequenceListing_V1_3.dtd"> <st26sequencelisting originalfreetextlanguagecode="en" dtdversion="V1_3" filename="MONS480USD2_ST26.xml" softwarename="WIPOSequence" softwareversion="2.3.0" productiondate="2024-11-21"> <applicantfilereference>MONS:480USD2 < / applicantfilereference> <earliestpriorityapplicationidentification> <ipofficecode> US < / ipofficecode> <applicationnumbertext> 63 / 014,771< / applicationnumbertext> <filingdate> 2020-04-24< / filingdate> < / earliestpriorityapplicationidentification> <applicantname languagecode="en"> Monsanto TechnologyLLC < / applicantname> <inventiontitle languagecode="en"> Transgenic Corn Event MON95275 andMethods for Detection and Uses Thereof < / inventiontitle> <sequencetotalquantity> 26< / sequencetotalquantity> <sequencedata sequenceidnumber="1"> <insdseq><INSDSeq_length>50< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..50< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q53"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 50 nucleotide sequence representing the5' junction region of corn genomic DNA and the integratedtransgenic expression cassette.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q2"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>ttcaggtctgtagcagccggcccgatcaaacactgatagtttcccggtaa< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="2"> <insdseq><INSDSeq_length>50< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..50< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q54"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 50 nucleotide sequence representing the3' junction region of the integrated transgenic expressioncassette and the corn genomic DNA.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q4"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>atcatactcattgctgatccatgtaactataacacagaggctggccaacc< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="3"> <insdseq><INSDSeq_length>100< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..100< / INSDFeature_location><INSDFeature_quals> <insdqualifier><INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q55"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 100 nucleotide sequence representingthe 5' junction region of corn genomic DNA and the integratedtransgenic expression cassette.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q6"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>ccgtcccttttttggcgcatgaagtttcaggtctgtagcagccggcccgatcaaacactgatagtttcccggtaactataacggtcctaaggtagcgact< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="4"> <insdseq><INSDSeq_length>100< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..100< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q56"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 100 nucleotide sequence representingthe 3' junction region of the integrated transgenic expressioncassette and the corn genomic DNA.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q8"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>ctctttctttttctccatattgaccatcatactcattgctgatccatgtaactataacacagaggctggccaacctggaggcgcagcggcgccacaaggt< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="5"> <insdseq><INSDSeq_length>200< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..200< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q57"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 200 nucleotide sequence representingthe 5' junction region of corn genomic DNA and the integratedtransgenic expression cassette.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q10"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>gactccaattttttatgaagacgggtcaaaactcaacaaatcaacggataccgtcccttttttggcgcatgaagtttcaggtctgtagcagccggcccgatcaaacactgatagtttcccggtaactataacggtcctaaggtagcgacttaggctgagcccgggcaggcctacccataatacccataatagctgtttgc< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="6"> <insdseq><INSDSeq_length>200< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..200< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q58"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 200 nucleotide sequence representingthe 3' junction region of the integrated transgenic expressioncassette and the corn genomic DNA.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q12"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>ataacgctgcggacatctacatttttgaattgaaaaaaaattggtaattactctttctttttctccatattgaccatcatactcattgctgatccatgtaactataacacagaggctggccaacctggaggcgcagcggcgccacaaggtccagatctcgttcatcctggccacgttgctcgcgactccgaggacgtgca< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="7"> <insdseq><INSDSeq_length>1226< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1226< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q59"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 1,226 nucleotide sequence representingthe 5' junction region of corn genomic DNA and the integratedtransgenic expression cassette.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q14"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="8"> <insdseq><INSDSeq_length>1207< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1207< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q60"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 1,207 nucleotide sequence representingthe 3' junction region of the integrated transgenic expressioncassette and the corn genomic DNA.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q16"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="9"> <insdseq><INSDSeq_length>14682< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..14682< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q61"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 14,682 nucleotide sequencecorresponding to the transgenic inserted T-DNA of corn eventMON95275.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q18"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="10"> <insdseq><INSDSeq_length>16861< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..16861< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q62"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 16,861 nucleotide sequencecorresponding to the contig nucleotide sequence of the 5'genomic flanking DNA nucleotide sequence, the inserted T-DNAnucleotide sequence in event MON95275, and the 3' genomicflanking nucleotide sequence.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q20"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="11"> <insdseq><INSDSeq_length>1073< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1073< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>genomic DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q74"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 1,073 nucleotide sequence representingthe 5' flanking corn genomic DNA up to the insertedT-DNA.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q22"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>Zea mays< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="12"> <insdseq><INSDSeq_length>1106< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..1106< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>genomic DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q75"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 1,106 nucleotide sequence representingthe 3' flanking corn genomic DNA after the insertedT-DNA.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q24"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>Zea mays< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="13"> <insdseq><INSDSeq_length>19612< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..19612< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q78"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 19,612 nucleotide sequence representingthe transgene cassette comprised within the binary plasmidtransformation vector used to transform corn to produce corn eventMON95275.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q26"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / insdseq> < / sequencedata> <sequencedata sequenceidnumber="14"> <insdseq><INSDSeq_length>35< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..35< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q76"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 35 nucleotide sequence representing theLoxP sites used for Cre-mediated excision andrecombination.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q80"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>Enterobacteria phageP1< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q28"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>Punavirus P1< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> tataacttcgtataatgtatgctatacgaagttat< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="15"> <insdseq><INSDSeq_length>27< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..27< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q63"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 27 nucleotide sequence corresponding toa thermal amplification primer referred to as SQ20267 used toidentify corn event MON95275 DNA in a sample.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q30"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> ctctttcttttctccatattgaccat< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="16"> <insdseq><INSDSeq_length>24< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..24< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q64"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 24 nucleotide sequence corresponding toa thermal amplification primer referred to as SQ51355 used toidentify corn event MON95275 DNA in a sample.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q32"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>gttggccagcctctgtgttatagt< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="17"> <insdseq><INSDSeq_length>19< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..19< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q65"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 19 nucleotide sequence corresponding toa probe referred to as PB10263 used to identify corn event MON95275DNA in a sample.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q34"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>atactcattgctgatccat< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="18"> <insdseq><INSDSeq_length>24< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..24< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q66"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 24 nucleotide sequence corresponding toa thermal amplification primer referred to as SQ20222 used as aninternal control for the event and zygosity assay for corn eventMON95275.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q36"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>gccctatgacttaccgagagttca< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="19"> <insdseq><INSDSeq_length>28< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..28< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q67"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 28 nucleotide sequence corresponding toa thermal amplification primer referred to as SQ20221 used as aninternal control for the event and zygosity assay for corn eventMON95275.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q38"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence> gttgctatgtactaacagaactgcatgt< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="20"> <insdseq><INSDSeq_length>17< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..17< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q68"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 17 nucleotide sequence corresponding toa probe referred to as PB50298 used as an internal control for theevent and zygosity assay for corn eventMON95275.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q40"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>ttgttgtgtggctccat< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="21"> <insdseq><INSDSeq_length>20< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..20< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q69"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 20 nucleotide sequence corresponding toa thermal amplification primer referred to as PNEG95275_F used in thezygosity assay for corn event MON95275.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q42"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>tctctttcttccacctcacg< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="22"> <insdseq><INSDSeq_length>20< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..20< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q70"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 20 nucleotide sequence corresponding toa thermal amplification primer referred to as PNEG95275_R used in thezygosity assay for corn event MON95275.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q44"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>cgaatgcctctgataccaat< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="23"> <insdseq><INSDSeq_length>17< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..17< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q71"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A 17 nucleotide sequence corresponding toa probe referred to as PRBNEG95275 used in the zygosity assay forcorn event MON95275.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q46"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>gtaccgcaacgctaaca< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="24"> <insdseq><INSDSeq_length>496< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..496< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q72"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>An enhancer that is a re-arrangement offragments derived from Dahlia mosaic virus with alterednucleotides.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q48"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>atcgacgggaagacaaaaatcaagatcaattacgcacagaaaaaggtattgatcatgagtcactacggagcaccaatctccagacaagatgttgacatcttatcttcctttgaagaaagcattgcacatgccaaagttgatgtagggacatctacaaaattattgctttgcaaacagctgaagaaattattggccgacaaccataaatgctcagcatgtgaaggtggggcctccaccagcaataatacaagctttacagcttgcagtgactcatcctccaataatgaggaaaaagacgtcagcagtgacgaacaagggcctgccagattgggaagaaggaaacagctaccaggcatatcacctgatagagataggtctctccggcaagagggattttaacccatcacaagaaatggtggacagtaaggatcttttactccagttatctcaagttagggtaaatggtttcatcagaatcctccaaaaatcccagtta< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="25"> <insdseq><INSDSeq_length>576< / INSDSeq_length><INSDSeq_moltype> DNA< / INSDSeq_moltype><INSDSeq_division> PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..576< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>other DNA< / INSDQualifier_value>< / insdqualifier> <insdqualifier id="q73"><INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>A promoter operably linked to a leaderderived from Cauliflower mosaic virus isolate NY8153, whereinnucleotide position 2 has been altered to change a potential startcodon.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q50"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>synthetic construct< / INSDQualifier_value> < / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>< / INSDSeq_sequence>< / insdseq> < / sequencedata> <sequencedata sequenceidnumber="26"> <insdseq><INSDSeq_length>322< / INSDSeq_length><INSDSeq_moltype>DNA< / INSDSeq_moltype><INSDSeq_division>PAT< / INSDSeq_division><INSDSeq_feature-table> <insdfeature><INSDFeature_key>source< / INSDFeature_key><INSDFeature_location>1..322< / INSDFeature_location><INSDFeature_quals> <insdqualifier> <INSDQualifier_name>mol_type< / INSDQualifier_name><INSDQualifier_value>unassigned DNA< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q77"> <INSDQualifier_name>note< / INSDQualifier_name><INSDQualifier_value>An enhancer derived from Dahlia mosaicvirus.< / INSDQualifier_value> < / insdqualifier> <insdqualifier id="q52"> <INSDQualifier_name>organism< / INSDQualifier_name><INSDQualifier_value>Dahlia mosaic virus< / INSDQualifier_value>< / insdqualifier> < / INSDFeature_quals>< / insdfeature> < / INSDSeq_feature-table><INSDSeq_sequence>atcaacggagaaacaaagataaaaatcaattactcacatgaaagagtattgatcacgagtcactatggagcgacaatctccagacaggatgtcagcatcttatcttcctttgaagaaagcatcatcaataacgatgtaatggtggggacatccactaagttattgctctgcaaacagctcaaaaagctactggccgacaatcataattgctcggcatgtgcaggtggggcctccactagcaataatacaagctttacagcttgcagtgactcatcctccaataatggagaaaaagacgtcagcagtgacgaacaagggtcga< / INSDSeq_sequence>< / insdseq> < / sequencedata> < / st26sequencelisting> <---

Claims

1. A food product containing a detectable amount of recombinant DNA molecules containing a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10; and a full complement of any of the above.

2. A food product according to claim 1, wherein the food product is a food product selected from the group consisting of corn oil, corn flour, corn starch, corn flakes and corn bran.

3. A food product according to claim 1, wherein the food product is a food feed product selected from the group consisting of whole or processed corn seed.

4. A food product according to claim 1, wherein the food product contains processed corn seed that contains a recombinant DNA molecule.

5. A food product according to claim 1, wherein the food product is selected from the group consisting of corn flour, corn starch, corn flakes and corn oil.

6. A food product according to paragraph 1, wherein the food product is a processed food product.

7. A food product according to claim 1, wherein the recombinant DNA molecule contains the nucleotide sequence SEQ ID NO:

1.

8. A food product according to claim 1, wherein the recombinant DNA molecule contains the nucleotide sequence SEQ ID NO:

2.

9. A food product according to claim 1, wherein the recombinant DNA molecule contains the nucleotide sequence SEQ ID NO:10.

Images