NUTRITIONAL COMPOSITION CONTAINING miR-3126

Abstract

FIELD: biotechnology.SUBSTANCE: nutritional composition for feeding a subject, containing miR-3126-5p.EFFECT: protecting the health of the gastrointestinal tract in a subject and / or stimulating the development and functioning of the intestinal barrier in a subject.10 cl, 6 tbl, 2 ex

Description

[0001] Field of application of the invention

[0002] The present invention relates to nutritional compositions containing miR-3126. The present invention also relates to uses of miR-3126 and said nutritional compositions and methods for producing said nutritional compositions.

[0003] Prerequisites for the creation of the invention

[0004] MicroRNAs (miRNAs) are small noncoding RNAs of approximately 17–25 nucleotides in length. They are regulatory RNA molecules that function to regulate the activity of specific mRNA targets and play important roles in a wide range of physiological and pathological processes. Deregulation of miRNA expression has been shown to impact health and disease (Wang et al. 2016, J. Cell Phys. 231:25–30).

[0005] Breast milk, which is produced in mammals during lactation, naturally contains miRNAs. Milk miRNAs occur as free molecules but can also be packaged in microvesicles, such as milk exosomes and lipid globules. During breastfeeding, breast milk not only provides nutrients to the infant but also transfers miRNAs from mother to infant. This may promote normal growth and development in the infant (Tome-Carneiro et al. 2018, Pharma. Res. 132:21-25).

[0006] Although the beneficial effects of breast milk on infants are known, not all infants have access to natural breast milk. Therefore, there is a need for nutritional compositions that mimic natural breast milk. In particular, there is a need to mimic the natural composition of breast milk at different stages of lactation, as the expression of these miRNA regulatory molecules corresponds to the different growth and developmental needs of the infant at different times after birth. Therefore, miRNA can be considered an important component of breast milk at different stages of lactation.

[0007] Statement of the invention

[0008] The present inventors discovered that miR-3126 is present in natural breast milk. Specifically, the present inventors found that miR-3126 expression in natural breast milk increases between two weeks and three months postpartum. Furthermore, miR-3126 may influence infant health and development.

[0009] In one aspect, the present invention provides a nutritional composition comprising miR-3126. The nutritional composition may be an infant formula, a fortifier, or a supplement. Preferably, the nutritional composition is an infant formula.

[0010] MiR-3126 may be present at a concentration of 0.1-10,000 pmol / L, 0.1-1000 pmol / L, 1-1000 pmol / L, 10-1000 pmol / L, or 100-1000 pmol / L. Preferably, miR-3126 is present at a concentration of 10-1000 pmol / L. More preferably, miR-3126 is present at a concentration of 100-1000 pmol / L.

[0011] The nutritional composition may comprise one or more additional microRNAs selected from the list consisting of: let-7b, let-7c, miR-19b, miR-22, miR-24, miR-25, miR-29a, miR-30a, miR-92a, miR-99a, miR-100, miR-197, miR-30d, miR-181a, miR-181b, miR-205, miR-210, miR-221, miR-125b, miR-125a, miR-149, miR-193a, miR-320a, miR-200a, miR-99b, miR-130b, miR-30e, miR-375, miR-378a, miR-151a, miR-425, miR-484, miR-146b, miR-574, miR-652, miR-320c, miR-3141, let-7d, miR-196a, miR-187, miR-516a, miR-92b and miR-3184. Preferably, the nutritional composition comprises one or more additional microRNAs selected from the list consisting of: let-7d, miR-196a, miR-187, miR-516a, miR-92b and miR-3184. More preferably, the nutritional composition comprises miR-3184 and / or miR-3141. One or more additional microRNAs may be present at a concentration of 0.1-10,000 pmol / L, 0.1-1000 pmol / L, 1-1000 pmol / L, 10-1000 pmol / L, or 100-1000 pmol / L.Preferably, one or more additional microRNAs are present at a concentration of 10-1000 pmol / L. More preferably, one or more additional microRNAs are present at a concentration of 100-1000 pmol / L.

[0012] In another aspect, the present invention provides a nutritional composition of the present invention for use as a medicine.

[0013] In another related aspect, the present invention provides a nutritional composition of the present invention for use in maintaining gastrointestinal health in a subject, promoting growth and development (e.g., neural and epidermal development) of a subject, or reducing the risk of a subject developing infections, lymphoproliferative disorders, allergic diseases (e.g., allergic asthma), or inflammatory diseases.

[0014] In another related aspect, the present invention provides a method of feeding a subject comprising administering to the subject a nutritional composition of the present invention.

[0015] In another related aspect, the present invention provides a method for maintaining gastrointestinal health in a subject, promoting growth and development (e.g., neural and epidermal development) of the subject, or reducing the risk of the subject developing infections, lymphoproliferative disorders, allergic diseases (e.g., allergic asthma), or inflammatory diseases, comprising administering to the subject a nutritional composition of the present invention.

[0016] In another aspect, the present invention provides miR-3126 for use as a medicine. MiR-3126 can be present in the nutritional composition of the present invention.

[0017] In another related aspect, the present invention provides miR-3126 for use in maintaining gastrointestinal health in a subject, promoting growth and development (e.g., neural and epidermal development) of a subject, or reducing the risk of a subject developing infections, lymphoproliferative disorders, allergic diseases (e.g., allergic asthma), or inflammatory diseases.

[0018] In another related aspect, the present invention provides a method of feeding a subject, comprising administering miR-3126 to the subject.

[0019] In another related aspect, the present invention provides a method for maintaining gastrointestinal health in a subject, promoting growth and development (e.g., neural and epidermal development) of the subject, or reducing the risk of developing infections, lymphoproliferative disorders, allergic diseases (e.g., allergic asthma), or inflammatory diseases in the subject. MiR-3126 may be present in the nutritional composition of the present invention.

[0020] In preferred embodiments of these aspects of the present invention, the subject is an infant. The infant may be 0-12 months, 2-12 months, 3-12 months, 0-6 months, 2-6 months, or 3-6 months old. Preferably, the infant is 0-6 months old. More preferably, the infant is 2-6 months old. Most preferably, the infant is 3-6 months old.

[0021] In another aspect, the present invention provides the use of miR-3126 to provide a nutritional composition that mimics natural breast milk. The nutritional composition may be a nutritional composition according to the present invention.

[0022] In another aspect, the present invention provides the use of miR-3126 for modulating gene expression of one or more genes selected from: ninein, Unc-13 homologue D, sulfatase 2, IL-32, OXER1, TMEM127, butyrophilin, alpha-2 integrin subunit, beta-1 integrin, tubulin alpha-4A, tubulin beta-6, tubulin beta-2A and tubulin beta-2B.

[0023] In another aspect, the present invention provides a method for producing a nutritional composition of the present invention, comprising:

[0024] (i) providing a basic nutritional composition; and

[0025] (ii) adding miR-3126 to the base nutritional composition to provide the nutritional composition of the present invention.

[0026] Detailed Description

[0027] Various preferred features and embodiments of the present invention are described below by way of non-limiting examples.

[0028] It should be noted that in this document and in the appended claims, singular forms also include objects in the plural, unless the context clearly indicates otherwise.

[0029] As used herein, the terms "comprising," "contains," and "consisting of" are synonymous with the terms "including" or "includes"; or "embedded" or "contains," and are inclusive or open-ended and do not exclude additional unrecited members, elements, or steps. The terms "comprising," "contains," and "consisting of" also include the term "having."

[0030] As used herein, the term "about" means approximately, in the range, approximately, or in the order of. When used in conjunction with a numerical value or range, the term "about" modifies that value or range by extending the boundaries above and below the stated numerical value(s). In general, the terms "about" and "approximately" are used herein to indicate an increase or decrease of the numerical value(s) compared to the stated value(s) within 10%.

[0031] The publications discussed herein are cited solely for their description prior to the filing date of this application. Nothing herein shall be construed as an admission that such publications constitute prior art with respect to the claims appended hereto.

[0032] This disclosure is not limited to the examples of methods and materials described herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present disclosure. Numerical ranges include numbers defining the range.

[0033] Nutritious composition

[0034] In one aspect, the present invention provides a nutritional composition comprising miR-3126.

[0035] According to the present invention, the term "nutritional composition" refers to a composition that is fed to a subject. As used herein, the term "nutritional composition" does not include natural milk of human or animal origin, i.e., the nutritional composition is not natural human or animal milk. The term "natural breast milk" or "natural animal milk" refers to milk directly obtained from humans or animals and does not include, for example, artificial milk, infant formula, etc.

[0036] The nutritional composition of the present invention may contain components derived from natural milk. For example, the nutritional composition of the present invention may contain components derived from natural breast milk and / or components derived from natural animal milk (e.g., cow's milk).

[0037] In a preferred embodiment of the invention, the nutritional composition comprises miR-3126 as an active ingredient.

[0038] The nutritional composition is not particularly limited, provided that it is suitable for administration (e.g., oral or intravenous administration). Examples of suitable nutritional compositions include foods, beverages, supplements, drug bases, and animal feed.

[0039] Preferably, the nutritional composition according to the invention is suitable for infants. For example, the nutritional composition may be an infant formula, infant food, a cereal-based infant formula, a fortifier, such as a breast milk fortifier, or a supplement. Preferably, the nutritional composition is an infant formula, fortifier, or supplement.

[0040] In some embodiments, the nutritional composition of the invention is a complete nutritional composition (meeting all or most of the nutritional needs of a subject). In other embodiments, the nutritional composition is a supplement or fortifier intended, for example, to supplement breast milk or supplement infant formula.

[0041] The nutritional composition of the invention can be administered orally or intravenously, preferably orally.

[0042] The nutritional composition of the present invention may be in solid (eg, powder), liquid or gel form.

[0043] The nutritional composition according to the invention may be a nutritional composition for enteral nutrition. An "enteral nutritional composition" is a food product that is administered through the gastrointestinal tract.

[0044] The nutritional composition according to the invention may be a hypoallergenic nutritional composition. The term "hypoallergenic" composition means a composition to which the likelihood of causing allergic reactions is unlikely.

[0045] The nutritional composition according to the invention can be obtained by any suitable method.

[0046] Infant formula

[0047] In a preferred embodiment, the nutritional composition is an infant formula.

[0048] The term "infant formula" may refer to a food intended for consumption by infants during the first year of life which in itself satisfies the nutritional needs of infants as referred to in Commission Regulation (EU) 2016 / 127 of 25 September 2015. The term "infant formula" may also refer to a nutritional composition intended for infants as referred to in the Codex Alimentarius (Codex STAN 72-1981).

[0049] The term "infant formula" encompasses both "infant formula" and "follow-on formula." In one embodiment, the infant formula is an infant formula. In another embodiment, the infant formula is a follow-on formula or a complementary formula. The follow-on formula or the complementary formula is given beginning at the age of 6 months. Infant formula is the main liquid element in the gradually increasing diversity of the diet for this category of individuals.

[0050] Infants can be fed exclusively with infant formula, or infant formula can be used as a supplement to breast milk.

[0051] The infant formula of the invention may be in the form of powder or liquid.

[0052] The liquid may be, for example, a concentrated liquid infant formula or a ready-to-feed infant formula. The infant formula may be in the form of a reconstituted infant formula (i.e., a liquid infant formula reconstituted from a powdered form). The concentrated liquid infant formula should preferably be reconstitutable into a liquid composition suitable for feeding to an infant, for example, by adding water.

[0053] In one embodiment, the infant formula is in powder form. The powder should be reconstitutable into a liquid composition suitable for feeding to an infant, for example by adding water.

[0054] Infant formula prepared according to the instructions may have an energy value of approximately 60-72 kcal per 100 ml. Accordingly, infant formula prepared according to the instructions may have an energy value of approximately 60-70 kcal per 100 ml.

[0055] Enricher

[0056] In other preferred embodiments, the nutritional composition is a fortifier.

[0057] The term "fortifier" may refer to liquid or solid nutritional compositions that are suitable for mixing with breast milk or infant formula.

[0058] The fortifier may be a milk fortifier. The term "milk fortifier" refers to any composition used to fortify or supplement human breast milk or infant formula.

[0059] The fortifier may be, for example, 10-fold concentrated, 15-fold concentrated, 20-fold concentrated, 25-fold concentrated, 30-fold concentrated, 35-fold concentrated, 40-fold concentrated, 45-fold concentrated, 50-fold concentrated, 60-fold concentrated, 70-fold concentrated, 80-fold concentrated, 90-fold or 100-fold concentrated compared to the desired final concentration in breast milk or infant formula.

[0060] Additive

[0061] In other preferred embodiments, the nutritional composition is a supplement.

[0062] The term "supplement" or "dietary supplement" may be used to refer to a supplement to the nutrition of a subject (usually it is used alone, but it may also be added to any kind of composition intended to be taken as food).

[0063] The additive can be presented, for example, in the form of tablets, capsules, lozenges or liquid. The additive may further contain protective hydrocolloids (e.g. gums, proteins, modified starches), binders, film-forming agents, encapsulating agents / materials, wall / shell materials, matrix compounds, coatings, emulsifiers, surfactants, solubilizing agents (oils, fats, waxes, lecithins, etc.), adsorbents, carriers, fillers, auxiliary compounds, dispersing agents, wetting agents, processing aids (solvents), anti-caking agents, taste-masking agents, weighting agents, gelling agents and gelling agents.The supplement may also contain traditional pharmaceutical additives and auxiliary substances, excipients and diluents, including, without limitation, water, gelatin of any origin, vegetable gums, lignin sulfonate, talc, sugars, starch, gum arabic, vegetable oils, polyalkylene glycols, flavoring agents, preservatives, stabilizers, emulsifying agents, buffers, lubricants, colorants, wetting agents, fillers, etc.

[0064] In addition, the supplement may contain organic or inorganic carrier material acceptable for oral or parenteral administration, as well as vitamins, minerals, trace elements and other trace elements in accordance with recommendations of government agencies, such as the Recommended Dietary Allowances (RDA) of the United States.

[0065] If the nutritional composition is a supplement, it may be provided in unit dose form.

[0066] Pharmaceutical composition

[0067] In some embodiments, the nutritional composition is a pharmaceutical composition.

[0068] The form of the pharmaceutical preparation is not particularly limited, and examples include tablet, pill, powder, solution, suspension, emulsion, granule, capsule, syrup, etc. Additives widely used as pharmaceutical carriers for oral administration, such as excipients, binders, disintegrating agents, lubricants, stabilizers, adjusting agents, diluents and surfactants, can be used.

[0069] Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, bulk lactose, beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth or sodium alginate, carboxymethylcellulose and polyethyleneglycol.

[0070] Examples of acceptable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, etc.

[0071] Components

[0072] The nutritional composition of the invention may comprise a protein source, a carbohydrate source, and / or a lipid source. However, in some embodiments, particularly if the nutritional composition of the invention is a supplement or fortifier, only lipids (or a lipid source) may be present.

[0073] Squirrels

[0074] The nutritional composition according to the present invention may contain a protein source.

[0075] The protein may be present in the nutritional composition of the present invention in any suitable amount. For example, the protein content of the nutritional composition of the invention may be in the range of 1.6 to 3 g per 100 kcal, especially if the nutritional composition is an infant formula. In some embodiments, particularly if the nutritional composition is intended for premature infants, the amount of protein may be from 2.4 to 4 g / 100 kcal or more than 3.6 g / 100 kcal. In some other embodiments, the amount of protein may be below 2.0 g per 100 kcal, such as from 1.8 to 2 g / 100 kcal, or the protein may be contained in an amount below 1.8 g per 100 kcal.

[0076] The protein source may be any protein source suitable for use in the nutritional composition. Protein sources based on, for example, whey, casein, and mixtures thereof, as well as soy-based protein sources, may be used. Regarding whey proteins, the protein source may be based on acid whey or sweet whey, or mixtures thereof, and may include alpha-lactalbumin and beta-lactoglobulin in any desired proportions. In some embodiments, the protein source is predominantly whey (i.e., more than 50% of the proteins, such as 60% or 70%, are derived from whey proteins).

[0077] Proteins may be native or hydrolyzed, or may be a mixture of native and hydrolyzed proteins.

[0078] By the term "native" is meant that the majority of proteins are native, i.e. their molecular structure is not altered, for example, at least 80% of the proteins are not altered, for example, at least 85% of the proteins are not altered, preferably at least 90% of the proteins are not altered, even more preferably at least 95% of the proteins are not altered, for example, at least 98% of the proteins are not altered. In a specific embodiment, 100% of the proteins are not altered.

[0079] The term "hydrolyzed" as used herein means a protein that has been hydrolyzed or broken down into its constituent amino acids.

[0080] The proteins may be fully or partially hydrolyzed. It may be desirable to administer partially hydrolyzed proteins (degree of hydrolysis from 2 to 20), for example, to infants or young children suspected of being at risk of developing cow's milk allergy. The degree of hydrolysis (DH) of the protein may be from 2 to 20, or from 8 to 40, or from 20 to 60, or from 20 to 80, or more than 10, 20, 40, 60, 80 or 90. In one embodiment of the invention, at least 70% of the proteins are hydrolyzed, preferably at least 80% of the proteins are hydrolyzed, such as at least 85% of the proteins are hydrolyzed, even more preferably at least 90% of the proteins are hydrolyzed, such as at least 95% of the proteins are hydrolyzed, in particular at least 98% of the proteins are hydrolyzed. In a specific embodiment, 100% of the proteins are hydrolyzed.

[0081] When hydrolyzed proteins are required, the hydrolysis process can be carried out as desired and in a manner known in the art. For example, whey protein hydrolysates can be obtained by enzymatic hydrolysis of a whey fraction in one or more stages. If the whey fraction used as the starting material is substantially lactose-free, it has been found that lysine blocking of the protein occurs to a much lesser extent during the hydrolysis process. This makes it possible to reduce the degree of lysine blocking from about 15% by weight of total lysine to less than about 10% by weight of lysine; for example, about 7% by weight of lysine, which significantly improves the nutritional quality of the protein source.

[0082] Carbohydrates

[0083] The nutritional composition according to the present invention may contain a carbohydrate source.

[0084] Carbohydrates may be present in the nutritional composition of the present invention in any suitable amount. For example, the carbohydrate content of the nutritional composition of the invention may be in the range of 9-14 g of carbohydrates per 100 kcal, particularly when the nutritional composition is an infant formula.

[0085] The carbohydrate source may be any carbohydrate source acceptable for use in the nutritional composition. Some acceptable carbohydrate sources that may be used include lactose, sucrose, maltodextrin, starch, and mixtures thereof.

[0086] Fats

[0087] The nutritional composition according to the present invention may contain a lipid source (fat).

[0088] Fat may be present in the nutritional composition of the present invention in any suitable amount. For example, the fat content in the nutritional composition of the invention may be in the range of 4.0-6.0 g of fat per 100 kcal, particularly when the nutritional composition is an infant formula.

[0089] Examples of fats for use in the nutritional composition of the invention include sunflower oil, low-erucic acid rapeseed oil, safflower oil, canola oil, olive oil, coconut oil, palm kernel oil, soybean oil, fish oil, oleic palm oil, high-oleic acid sunflower oil, high-oleic acid safflower oil and oil obtained by microbial fermentation containing long-chain polyunsaturated fatty acids.

[0090] Fat may also be in the form of fractions derived from these oils, such as palm oil olein, medium chain triglycerides (MCTs), and fatty acid esters such as arachidonic acid, linoleic acid, palmitic acid, stearic acid, docosahexaenoic acid, linolenic acid, oleic acid, lauric acid, capric acid, caprylic acid, caproic acid, etc.

[0091] Additional examples of fats include structured lipids (i.e., lipids modified chemically or enzymatically to alter their structure). Preferably, structured lipids are sn2-structured lipids, such as triglycerides having an increased concentration of palmitic acid at the sn2 position of the triglyceride. Structured lipids may or may not be added.

[0092] Oils containing high concentrations of pre-formed arachidonic acid (ARA) and docosahexaenoic acid (DHA), such as fish oils or microbial oils, can be added.

[0093] Long-chain polyunsaturated fatty acids such as dihomo-gamma-linolenic acid, arachidonic acid (ARA), eicosapentaenoic acid and docosahexaenoic acid (DHA) can also be added.

[0094] The essential fatty acids linoleic acid and α-linolenic acid, as well as small amounts of oils containing large amounts of arachidonic acid and docosahexaenoic acid in their prepared form, such as fish oils or microbial oils, can also be added. The ratio of n-6 to n-3 fatty acids in the fat source can range from about 5:1 to about 15:1; for example, from about 8:1 to about 10:1.

[0095] Additional components

[0096] The nutritional composition of the invention may also contain any acceptable vitamins and minerals.

[0097] For example, the nutritional composition of the invention may contain all vitamins and minerals considered essential in the daily diet, in nutritionally significant amounts. For some vitamins and minerals, minimum requirements are established. Examples of minerals, vitamins, and other nutrients that are optionally present in the nutritional composition of the invention include vitamin A, vitamin B1, vitamin B2, vitamin B6, vitamin B12, vitamin E, vitamin K, vitamin C, vitamin D, folic acid, inositol, niacin, biotin, pantothenic acid, choline, calcium, phosphorus, iodine, iron, magnesium, copper, zinc, manganese, chlorine, potassium, sodium, selenium, chromium, molybdenum, taurine, and L-carnitine. Minerals are typically added in the form of salts. The presence and amounts of specific minerals and other vitamins will vary depending on the intended population.

[0098] The nutritional composition of the invention may contain emulsifiers and stabilizers, such as soy, lecithin, mono- and diglyceryl esters of citric acid, etc.

[0099] The nutritional composition of the invention may also contain one or more carotenoids. In some specific embodiments, the nutritional composition of the invention does not contain any carotenoids.

[0100] The nutritional composition of the invention may also contain other substances that can have a beneficial effect, such as lactoferrin, osteopontin, TGFbeta, sIgA, glutamine, nucleotides, nucleosides, etc.

[0101] The nutritional composition of the invention may further comprise at least one non-digestible oligosaccharide (eg, a prebiotic).

[0102] Examples of prebiotics include fructooligosaccharide, galactooligosaccharide, acid oligosaccharides, human milk oligosaccharide (HMO) or cow's milk oligosaccharide (BMO), cow's milk-like oligosaccharide (CMO), such as "CMOS-GOS." Some examples include N-acetylated oligosaccharides, sialylated oligosaccharides, fucosylated oligosaccharides, and any mixtures thereof.

[0103] The nutritional composition of the present invention may further comprise at least one probiotic (or probiotic strain), such as a probiotic bacterial strain. The term "probiotic" refers to microbial cell preparations or microbial cell components that have a beneficial effect on the health or well-being of the host organism. In particular, probiotics can improve intestinal barrier function.

[0104] Preferred Probiotics are probiotics that are generally safe, are L(+)-lactic acid producing cultures, and have an acceptable shelf life of the products needed to maintain stability and potency for up to 24 months.

[0105] Examples of probiotic microorganisms for use in the nutritional composition of the present invention include yeasts such as Saccharomyces, Debaromyces, Candida, Pichia and Torulopsis; and bacteria such as the genera Bifidobacterium, Bacteroides, Clostridium, Fusobacterium, Melissococcus, Propionibacterium, Streptococcus, Enterococcus, Lactococcus, Staphylococcus, Peptostrepococcus, Bacillus, Pediococcus, Micrococcus, Leuconostoc, Weissella, Aerococcus, Oenococcus and Lactobacillus.

[0106] Specific examples of suitable probiotic microorganisms are: Saccharomyces cereviseae, Bacillus coagulans, Bacillus licheniformis, Bacillus subtilis, Bifidobacterium bifidum, Bifidobacterium infantis, Bifidobacterium longum, Enterococcus faecium, Enterococcus faecalis, Lactobacillus acidophilus, Lactobacillus alimentarius, Lactobacillus casei subsp. casei, Lactobacillus casei Shirota, Lactobacillus curvatus, Lactobacillus delbruckii subsp. lactis, Lactobacillus farciminus, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus johnsonii, Lactobacillus rhamnosus (Lactobacillus GG), Lactobacillus sake, Lactococcus lactis, Micrococcus varians, Pediococcus acidilactici, Pediococcus pentosaceus, Pediococcus acidilactici, Pediococcus halophilus, Streptococcus faecalis, Streptococcus thermophilus, Staphylococcus carnosus and Staphylococcus xylosus.

[0107] MicroRNA

[0108] MicroRNAs (miRNAs) are small noncoding RNAs of approximately 17-25 nucleotides in length. They are regulatory RNA molecules whose function is to regulate the activity of specific mRNA targets.

[0109] Mature miRNA is designated by the prefix miR followed by a hyphen and a number. The lowercase prefix mir- refers to the precursor miRNA and the primary miRNA. MIR refers to the human gene that encodes the miRNA.

[0110] The present invention preferably uses mature miRNA. However, the present invention can also be implemented using a precursor miRNA and / or a primary miRNA. The mature miRNA can be obtained by cleaving the precursor miRNA and / or a primary miRNA with a Dicer enzyme (e.g., Dicer1) or the like, which naturally occurs in humans and animals. Accordingly, although the mature miRNA (e.g., miR-3126) is essentially referred to, the present invention can also use a precursor miRNA and / or a primary miRNA (e.g., pri-miR-3126) (e.g., in combination with the mature miRNA or instead of the mature miRNA). Accordingly, the mature miRNA mentioned herein can be replaced by an appropriate precursor miRNA and / or a primary miRNA.

[0111] The species from which the miRNAs are derived are designated by a three-letter prefix, for example, hsa-miR-124 is a human (Homo sapiens) miRNA, and oap-miR-124 is a sheep (Ovis aries) miRNA.

[0112] If two mature miRNAs originate from opposite arms of the same miRNA precursor and are present in approximately similar quantities, they are designated by the suffix -3p or -5p. If a mature miRNA is found in much higher quantities in one arm of a hairpin than in the other arm, an asterisk after the name indicates the mature species present in lower concentrations compared to the opposite arm of the hairpin. For example, the miRNA precursor hairpin is present in both miR-124 and miR-124*, but miR-124 is present in much higher concentrations in the cell.

[0113] The miRNA sequences were deposited in the miRBase database (http: / / www.mirbase.org / ). The miRBase database is a searchable database containing published miRNA sequences and annotations.

[0114] miR-3126

[0115] The present inventors discovered that miR-3126 is present in natural breast milk. Specifically, the present inventors discovered that miR-3126 expression in natural breast milk increases between two weeks and three months postpartum.

[0116] Accordingly, in one aspect, the present invention provides the use of miR-3126 for providing a nutritional composition. In particular, the present invention provides the use of miR-3126 for providing a nutritional composition for simulating natural breast milk (e.g., human breast milk). The nutritional composition may be a nutritional composition according to the present invention.

[0117] MiR-3126 is also known as microRNA 3126 and belongs to the MIPF0001525 or mir-3126 gene family. Hsa-mir-3126 has the accession number MI0014143.

[0118] MiR-3126 for use in the present invention may comprise or consist of miR-3126-5p and / or miR-3126-3p. Preferably, miR-3126 includes miR-3126-5p. For example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% of miR-3126 may be miR-3126-5p. More preferably, miR-3126 consists of miR-3126-5p.

[0119] MiR-3126 for use in the present invention may be human miR-3126, i.e., hsa-miR-3126.

[0120] MiR-3126 for use in the present invention may comprise or consist of hsa-miR-3126-5p and / or hsa-miR-3126-3p. Preferably, miR-3126 comprises hsa-miR-3126-5p. For example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% of miR-3126 may be hsa-miR-3126-5p. More preferably, miR-3126 consists of hsa-miR-3126-5p.

[0121] An exemplary sequence for hsa-miR-3126 (i.e., the precursor miRNA from which hsa-miR-3126 is derived) is shown below as SEQ ID NO: 1. MiR-3126 for use in the present invention can be derived from a precursor miRNA comprising or consisting of a sequence that is at least 20%, at least 30%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 1. Preferably, miR-3126 for use in the present invention is derived from a precursor miRNA comprising or consisting of a sequence that is at least 95% identical to SEQ ID NO: 1. More preferably, miR-3126 for use in the present invention is obtained from a precursor miRNA comprising or consisting of a sequence according to SEQ ID NO: 1.

[0122] SEQ ID NO: 1 - Illustrative sequence of hsa-mir-3126

[0123] AUGAUUAUAUGAGGGACAGAUGCCAGAAGCACUGGUUAUGAUUUGCAUCUGGCAUCCGUCACACAGAUAAUUAU

[0124] An exemplary sequence of hsa-miR-3126-5p (i.e., mature miRNA) is provided below as SEQ ID NO: 2. MiR-3126 for use in the present invention may comprise or consist of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 2. Preferably, miR-3126 for use in the present invention comprises or consists of a sequence that is at least 95% identical to SEQ ID NO: 2. More preferably, miR-3126 for use in the present invention comprises or consists of a sequence according to SEQ ID NO: 2.

[0125] SEQ ID NO: 2 - Illustrative sequence of hsa-miR-3126-5p

[0126] UGAGGGACAGAUGCCAGAAGCA

[0127] An exemplary sequence of hsa-miR-3126-3p (i.e., mature miRNA) is provided below as SEQ ID NO: 3. MiR-3126 for use in the present invention may comprise or consist of a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 3. Preferably, miR-3126 for use in the present invention comprises or consists of a sequence that is at least 95% identical to SEQ ID NO: 2. More preferably, miR-3126 for use in the present invention comprises or consists of a sequence according to SEQ ID NO: 3.

[0128] SEQ ID NO: 3 - Illustrative sequence of hsa-miR-3126-3p

[0129] CAUCUGGCAUCCGUCACACAGA

[0130] MiR-3126 may be present in the nutritional composition of the present invention at a concentration of 0.1-10,000 pmol / L, 0.1-1000 pmol / L, 1-1000 pmol / L, 10-1000 pmol / L or 100-1000 pmol / L, especially when the nutritional composition is an infant formula. Preferably, miR-3126 is present in the nutritional composition of the present invention at a concentration of 10-1000 pmol / L, especially when the nutritional composition is an infant formula. More preferably, miR-3126 is present in the nutritional composition of the present invention at a concentration of 100-1000 pmol / L, especially when the nutritional composition is an infant formula. MiR-3126 may be present in the nutritional composition of the present invention in an amount such that the concentration is approximately the same as in natural breast milk.

[0131] If the nutritional composition is a fortifier, miR-3126 may be present in the fortifier in an amount such that after mixing with breast milk or infant formula, the concentration of miR-3126 is 0.1-10,000 pmol / L, 0.1-1000 pmol / L, 1-1000 pmol / L, 10-1000 pmol / L, or 100-1000 pmol / L. Preferably, miR-3126 is present in the fortifier in an amount such that after mixing with breast milk or infant formula, the concentration of miR-3126 is 10-1000 pmol / L. More preferably, miR-3126 is present in the fortifier in an amount such that, after mixing with human milk or infant formula, the concentration of miR-3126 is 100-1000 pmol / L. MiR-3126 may be present in the fortifier in an amount such that, after mixing with human milk or infant formula, the concentration of miR-3126 is approximately the same as in natural human milk.

[0132] If the nutritional composition is a supplement, miR-3126 may be present in the supplement in an amount sufficient to provide a standard dose. Thus, the supplement can provide a dose of miR-3126 equivalent to 50-250 ml, 100-250 ml, 150-250 ml, or about 100 ml, or about 200 ml of natural breast milk. For example, miR-3126 may be present in the supplement in an amount of 0.02-2000 pmol, 0.02-200 pmol, 0.2-200 pmol, 2-200 pmol, or 20-200 pmol. Preferably, miR-3126 is present in the supplement in an amount of 2-200 pmol. More preferably, miR-3126 is present in the supplement in an amount of 20-200 pmol.

[0133] The nutritional composition of the present invention preferably contains hsa-miR-3126-5p at a concentration of 10-1000 pmol / L, especially when the nutritional composition is an infant formula. The nutritional composition of the present invention more preferably contains hsa-miR-3126-5p at a concentration of 100-1000 pmol / L, especially when the nutritional composition is an infant formula.

[0134] If the nutritional composition is in the form of a powder that can be dissolved in a liquid composition, the concentration of miR-3126 is determined based on the dissolved liquid composition.

[0135] Other miRNAs

[0136] The nutritional composition of the present invention may contain one or more microRNAs in addition to miR-3126.

[0137] For example, the nutritional composition may contain one or more additional microRNAs that are found in large quantities in natural breast milk. Suitable additional miRNAs that are abundant in natural breast milk include: let-7b, let-7c, miR-19b, miR-22, miR-24, miR-25, miR-29a, miR-30a, miR-92a, miR-99a, miR-100, miR-197, miR-30d, miR-181a, miR-181b, miR-205, miR-210, miR-221, miR-125b, miR-125a, miR-149, miR-193a, miR-320a, miR-200a, miR-99b, miR-130b, miR-30e, miR-375, miR-378a, miR-151a, miR-425, miR-484, miR-146b, miR-574, miR-652, miR-320c, miR-3141, let-7d, miR-196a, miR-187, miR-516a, miR-92b and miR-3184.

[0138] The nutritional composition may comprise one or more additional microRNAs selected from: let-7b, let-7c, miR-19b, miR-22, miR-24, miR-25, miR-29a, miR-30a, miR-92a, miR-99a, miR-100, miR-197, miR-30d, miR-181a, miR-181b, miR-205, miR-210, miR-221, miR-125b, miR-125a, miR-149, miR-193a, miR-320a, miR-200a, miR-99b, miR-130b, miR-30e, miR-375, miR-378a, miR-151a, miR-425, miR-484, miR-146b, miR-574, miR-652, miR-320c and miR-3141.

[0139] The nutritional composition may contain one or more additional microRNAs selected from: let-7d, miR-196a, miR-187, miR-516a, miR-92b and miR-3184.

[0140] In one embodiment, the nutritional composition comprises miR-3184 and / or miR-3141. In another embodiment, the nutritional composition comprises miR-3184.

[0141] One or more additional microRNAs for use in the present invention may be human or bovine microRNAs or consist of them. Preferably, one or more additional microRNAs are human microRNAs.

[0142] One or more additional microRNAs for use in the present invention may be both mature microRNAs derived from opposite arms of the same precursor miRNA, or consist of these microRNAs. Preferably, one or more additional microRNAs for use in the present invention are a mature microRNA from one arm of a hairpin, for example, a mature microRNA that is found in the highest amount in breast milk, or consist of this microRNA.

[0143] The nutritional composition may comprise one or more additional microRNAs selected from: hsa-let-7b-5p, hsa-let-7c-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa-miR-24-3p, hsa-miR-25-3p, hsa-miR-29a-3p, hsa-miR-30a-5p, hsa-miR-92a-3p, hsa-miR-99a-5p, hsa-miR-100-5p, hsa-miR-197-3p, hsa-miR-30d-5p, hsa-miR-181a-5p, hsa-miR-181b-5p, hsa-miR-205-5p, hsa-miR-210-3p, hsa-miR-221-3p, hsa-miR-125b-5p, hsa-miR-125a-5p, hsa-miR-149-3p, hsa-miR-193a-5p, hsa-miR-193a-3p, hsa-miR-320a, hsa-miR-200a-3p, hsa-miR-99b-5p, hsa-miR-130b-3p, hsa-miR-30e-5p, hsa-miR-375, hsa-miR-378a-3p, hsa-miR-151a-3p, hsa-miR-425-5p, hsa-miR-484, hsa-miR-146b-5p, hsa-miR-574-5p, hsa-miR-652-3p, hsa-miR-320c, hsa-miR-3141, hsa-let-7d-3p, hsa-miR-196a-5p, hsa-miR-187-5p, hsa-miR-516a-5p, hsa-miR-92b-5p, hsa-miR-3184-3p, bta-let-7b, bta-let-7c, bta-miR-19b, bta-miR-22-3p, bta-miR-24-3p, bta-miR-25, bta-miR-29a, bta-miR-30a-5p, bta-miR-92a, bta-miR-99a-5p, bta-miR-100, bta-miR-197, bta-miR-30d, bta-miR-181a,bta-miR-181b, bta-miR-205, bta-miR-210, bta-miR-221, bta-miR-125b, bta-miR-125a, bta-miR-149-3p, bta-miR-193a-5p, bta-miR-193a-3p, bta-miR-320a, bta-miR-200a, bta-miR-99b, bta-miR-130b, bta-miR-30e-5p, bta-miR-375, bta-miR-378, bta-miR-151-3p, bta-miR-425-5p, bta-miR-484, bta-miR-146b, bta-miR-574, bta-miR-652, bta-miR-320b, bta-miR-3141, bta-let-7d, bta-miR-196a-5p, bta-miR-187-5p и bta-miR-92b-5p.,

[0144] The nutritional composition may comprise one or more additional microRNAs selected from: hsa-let-7b-5p, hsa-let-7c-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa-miR-24-3p, hsa-miR-25-3p, hsa-miR-29a-3p, hsa-miR-30a-5p, hsa-miR-92a-3p, hsa-miR-99a-5p, hsa-miR-100-5p, hsa-miR-197-3p, hsa-miR-30d-5p, hsa-miR-181a-5p, hsa-miR-181b-5p, hsa-miR-205-5p, hsa-miR-210-3p, hsa-miR-221-3p, hsa-miR-125b-5p, hsa-miR-125a-5p, hsa-miR-149-3p, hsa-miR-193a-5p, hsa-miR-193a-3p, hsa-miR-320a, hsa-miR-200a-3p, hsa-miR-99b-5p, hsa-miR-130b-3p, hsa-miR-30e-5p, hsa-miR-375, hsa-miR-378a-3p, hsa-miR-151a-3p, hsa-miR-425-5p, hsa-miR-484, hsa-miR-146b-5p, hsa-miR-574-5p, hsa-miR-652-3p, hsa-miR-320c, hsa-miR-3141, hsa-let-7d-3p, hsa-miR-196a-5p, hsa-miR-187-5p, hsa-miR-516a-5p, hsa-miR-92b-5p, hsa-miR-3184-3p.

[0145] The nutritional composition may comprise one or more additional microRNAs selected from: hsa-let-7b-5p, hsa-let-7c-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa-miR-24-3p, hsa-miR-25-3p, hsa-miR-29a-3p, hsa-miR-30a-5p, hsa-miR-92a-3p, hsa-miR-99a-5p, hsa-miR-100-5p, hsa-miR-197-3p, hsa-miR-30d-5p, hsa-miR-181a-5p, hsa-miR-181b-5p, hsa-miR-205-5p, hsa-miR-210-3p, hsa-miR-221-3p, hsa-miR-125b-5p, hsa-miR-125a-5p, hsa-miR-149-3p, hsa-miR-193a-5p, hsa-miR-193a-3p, hsa-miR-320a, hsa-miR-200a-3p, hsa-miR-99b-5p, hsa-miR-130b-3p, hsa-miR-30e-5p, hsa-miR-375, hsa-miR-378a-3p, hsa-miR-151a-3p, hsa-miR-425-5p, hsa-miR-484, hsa-miR-146b-5p, hsa-miR-574-5p, hsa-miR-652-3p, hsa-miR-320c, hsa-miR-3141, bta-let-7b, bta-let-7c, bta-miR-19b, bta-miR-22-3p, bta-miR-24-3p, bta-miR-25, bta-miR-29a, bta-miR-30a-5p, bta-miR-92a, bta-miR-99a-5p, bta-miR-100, bta-miR-197, bta-miR-30d, bta-miR-181a, bta-miR-181b, bta-miR-205, bta-miR-210, bta-miR-221, bta-miR-125b, bta-miR-125a, bta-miR-149-3p,bta-miR-193a-5p, bta-miR-193a-3p, bta-miR-320a, bta-miR-200a, bta-miR-99b, bta-miR-130b, bta-miR-30e-5p, bta-miR-375, bta-miR-378, bta-miR-151-3p, bta-miR-425-5p, bta-miR-484, bta-miR-146b, bta-miR-574, bta-miR-652, bta-miR-320b and bta-miR-3141.,

[0146] The nutritional composition may comprise one or more additional microRNAs selected from: hsa-let-7b-5p, hsa-let-7c-5p, hsa-miR-19b-3p, hsa-miR-22-3p, hsa-miR-24-3p, hsa-miR-25-3p, hsa-miR-29a-3p, hsa-miR-30a-5p, hsa-miR-92a-3p, hsa-miR-99a-5p, hsa-miR-100-5p, hsa-miR-197-3p, hsa-miR-30d-5p, hsa-miR-181a-5p, hsa-miR-181b-5p, hsa-miR-205-5p, hsa-miR-210-3p, hsa-miR-221-3p, hsa-miR-125b-5p, hsa-miR-125a-5p, hsa-miR-149-3p, hsa-miR-193a-5p, hsa-miR-193a-3p, hsa-miR-320a, hsa-miR-200a-3p, hsa-miR-99b-5p, hsa-miR-130b-3p, hsa-miR-30e-5p, hsa-miR-375, hsa-miR-378a-3p, hsa-miR-151a-3p, hsa-miR-425-5p, hsa-miR-484, hsa-miR-146b-5p, hsa-miR-574-5p, hsa-miR-652-3p, hsa-miR-320c and hsa-miR-3141.

[0147] The nutritional composition may contain one or more additional microRNAs selected from: hsa-let-7d-3p, hsa-miR-196a-5p, hsa-miR-187-5p, hsa-miR-516a-5p, hsa-miR-92b-5p, miR-3184-3p, bta-let-7d, bta-miR-196a-5p, bta-miR-187-5p and bta-miR-92b-5p.

[0148] The nutritional composition may contain one or more additional microRNAs selected from: hsa-let-7d-3p, hsa-miR-196a-5p, hsa-miR-187-5p, hsa-miR-516a-5p, hsa-miR-92b-5p and hsa-miR-3184-3p.

[0149] In one embodiment, the nutritional composition comprises hsa-miR-3184-3p and / or hsa-miR-3141. In another embodiment, the nutritional composition comprises hsa-miR-3184-3p.

[0150] Illustrative sequences for eligible additional microRNAs are provided in Table 1 below.

[0151] Table 1. Illustrative microRNA sequences Human miRNA Illustrative sequence Bovine miRNA Illustrative sequence hsa-let-7b-5p UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 4) bta-let-7b UGAGGUAGUAGGUUGUGUGGUU (SEQ ID NO: 49) hsa-let-7c-5p UGAGGUAGUAGGUUGUAUGGUU (SEQ ID NO: 5) bta-let-7c UGAGGUAGUAGGUUGUAUGGUU (SEQ ID NO: 50) hsa-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGA (SEQ ID NO: 6) bta-miR-19b UGUGCAAAUCCAUGCAAAACUGA (SEQ ID NO: 51) hsa-miR-22-3p AAGCUGCCAGUUGAAGAACUGU (SEQ ID NO: 7) bta-miR-22-3p AAGCUGCCAGUUGAAGAACUG (SEQ ID NO: 52) hsa-miR-24-3p UGGCUCAGUUCAGCAGGAACAG (SEQ ID NO: 8) bta-miR-24-3p UGGCUCAGUUCAGCAGGAACAG (SEQ ID NO: 53) hsa-miR-25-3p CAUUGCACUUGUCUCGGUCUGA (SEQ ID NO: 9) bta-miR-25 CAUUGCACUUGUCUCGGUCUGA (SEQ ID NO: 54) hsa-miR-29a-3p UAGCACCAUCUGAAAUCGGUUA (SEQ ID NO: 10) bta-miR-29a CUAGCACCAUCUGAAAUCGGUUA (SEQ ID NO: 55) hsa-miR-30a-5p UGUAAACAUCCUCGACUGGAAG (SEQ ID NO: 11) bta-miR-30a-5p UGUAAACAUCCUCGACUGGAAGCU (SEQ ID NO: 56) hsa-miR-92a-3p UAUUGCACUUCCCGGCCU (SEQ ID NO: 12) bta-miR-92a UAUUGCACUUCCCGGCCUGU (SEQ ID NO: 57) hsa-miR-99a-5p AACCCWATERAUCCAUCUUGUG (SEQ ID NO: 13) bta-miR-99a-5p WATERWATER WATER (SEQ ID NO: 58) hsa-miR-100-5p AACCCWATERCAUCCACCESSION (SEQ ID NO: 14) bta-miR-100 AACCCWATERCAUCCAUCTION (SEQ ID NO: 59) hsa-miR-197-3p UUCACCCUUCUCCACCCAGC (SEQ ID NO: 15) bta-miR-197 UUCACCCUUCUCCACCCAGC (SEQ ID NO: 60) hsa-miR-30d-5p UGUAAACAUCCCCGACUGGAAG (SEQ ID NO: 16) bta-miR-30d UGUAAACAUCCCCGACONTROL (SEQ ID NO: 61) hsa-miR-181a-5p AACAUUCAACGCUGUCGGUGA (SEQ ID NO: 17) bta-miR-181a AACAUUCCACGCOMMERCE (SEQ ID NO: 62) hsa-miR-181b-5p AACAUUCUGCUGUCGGUGGGU (SEQ ID NO: 18) bta-miR-181b AACAUUCUGCUGUCGGUGGUGGUGGU (SEQ ID NO: 63) hsa-miR-205-5p UCCUUCCACCCGGAGUCUG (SEQ ID NO: 19) bta-miR-205 UCCUUCCACCCGGACUT (SEQ ID NO: 64) hsa-miR-210-3p CUSTOMCALLCACCGGCALL (SEQ ID NO: 20) bta-miR-210 CURRENT CURRENTCAGGGCUGA (SEQ ID NO: 65) hsa-miR-221-3p PROCEDURES (SEQ ID NO: 21) bta-miR-221 REQUIREMENTS (SEQ ID NO: 66) hsa-miR-125b-5p BACKUPACCESSION (SEQ ID NO: 22) bta-miR-125b BACKUPACCESSION (SEQ ID NO: 67) hsa-miR-125a-5p UCCUACCUUUUACUACUATE (SEQ ID NO: 23) bta-miR-125a UCCUPACKUUUACUACK (SEQ ID NO: 68) hsa-miR-149-3p AGGGAGGGACGGGGGCUGUGC (SEQ ID NO: 24) bta-miR-149-3p GAGGGAGGGACGGGGGCUGUGC (SEQ ID NO: 69) hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA (SEQ ID NO: 25) bta-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA (SEQ ID NO: 70) hsa-miR-193a-3p WATERWATERWATERWATER (SEQ ID NO: 26) bta-miR-193a-3p WATERWATERWATERWATER (SEQ ID NO: 71) hsa-miR-320a AAAAGCUGGGUUGAGGGCGA (SEQ ID NO: 27) bta-miR-320a AAAAGCUGGGUUGAGGGCGA (SEQ ID NO: 72) hsa-miR-200a-3p UAACACULTURAL (SEQ ID NO: 28) bta-miR-200a UAACACULTURAL (SEQ ID NO: 73) hsa-miR-99b-5p CACCGUAGAACCCACCUUGCG (SEQ ID NO: 29) bta-miR-99b CACCGUAGAACCCACCUUGCG (SEQ ID NO: 74) hsa-miR-130b-3p END (SEQ ID NO: 30) bta-miR-130b END (SEQ ID NO: 75) hsa-miR-30e-5p UGUAAACAUCCUUGACUGGAAG (SEQ ID NO: 31) bta-miR-30e-5p UGUAAACAUCCUUGACUGGAAGCU (SEQ ID NO: 76) hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA (SEQ ID NO: 32) bta-miR-375 UUUUGUUCGUUCGGCUCGCGUGA (SEQ ID NO: 77) hsa-miR-378a-3p ACUGGACUUGGAGUCAGAAGGC (SEQ ID NO: 33) bta-miR-378 ACUGGACUUGGAGUCAGAAGGC (SEQ ID NO: 78) hsa-miR-151a-3p CUAGACUGAAGCUCCUUGAGG (SEQ ID NO: 34) bta-miR-151-3p CUAGACUGAAGCUCCUUGAGG (SEQ ID NO: 79) hsa-miR-425-5p AAUGACACGAUCACUCCCGUUGA (SEQ ID NO: 35) bta-miR-425-5p AUGACACGAUCACUCCCGUUGA (SEQ ID NO: 80) hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU (SEQ ID NO: 36) bta-miR-484 UCAGGCUCAGUCCCCUCCCGAU (SEQ ID NO: 81) hsa-miR-146b-5p UGAGAACUGAAUUCCAUAGGCU (SEQ ID NO: 37) bta-miR-146b UGAGAACUGAAUUCCAUAGGCUGU (SEQ ID NO: 82) hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU (SEQ ID NO: 38) bta-miR-574 UGAGUGUGUGUGUGUGAGUGUGUUG (SEQ ID NO: 83) hsa-miR-652-3p AAUGGCGCCACUAGGGUUGUG (SEQ ID NO: 39) bta-miR-652 AAUGGCGCCACUAGGGUUGUG (SEQ ID NO: 84) hsa-miR-320c AAAAGCUGGGUUGAGAGGGU (SEQ ID NO: 40) bta-miR-320b AGCUGGGUUGAGAGGGUGGU (SEQ ID NO: 85) hsa-miR-3141 GAGGGCGGGUGGAGGAGGA (SEQ ID NO: 41) bta-miR-3141 GAGGGCGGGUGGAGGAGG (SEQ ID NO: 86) hsa-miR-4478 GAGGCUGAGCUGAGGAG (SEQ ID NO: 42) N / A N / A hsa-let-7d-3p CUAUACGACCUGCUGCCUUUCU (SEQ ID NO: 43) bta-let-7d AGAGGUAGUAGGUUGCAUAGUU (SEQ ID NO: 87) hsa-miR-196a-5p UAGGUAGUUUCAUGUUGUUGGG (SEQ ID NO: 44) bta-miR-196a-5p UAGGUAGUUUCAUGUUGUUGGG (SEQ ID NO: 88) hsa-miR-187-5p GGCUACAACACAGGACCCGGGC (SEQ ID NO: 45) bta-miR-187-5p UCGUGUCUUGUGUUGCAGCCGG (SEQ ID NO: 89) hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC (SEQ ID NO: 46) N / A N / A hsa-miR-92b-5p AGGGACGGGACGCGGUGCAGUG (SEQ ID NO: 47) bta-miR-92b-5p UAUUGCACUCGUCCCGGCCUCC (SEQ ID NO: 90) hsa-miR-3184-3p AAAGUCUCGCUCUCUGCCCCUCA (SEQ ID NO: 48) N / A N / A

[0152] The nutritional composition may comprise one or more additional microRNAs that are at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any of SEQ ID NOs: 4-90. The nutritional composition may comprise one or more additional microRNAs comprising a sequence according to SEQ ID NOs: 4-90, presented in Table 1.

[0153] The nutritional composition may comprise one or more additional microRNAs that are at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any of SEQ ID NOs: 4-42 or 49-86. The nutritional composition may comprise one or more additional microRNAs comprising a sequence according to SEQ ID NOs: 4-42 or 49-86, shown in Table 1.

[0154] The nutritional composition may comprise one or more additional microRNAs that are at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any of SEQ ID NOs: 4-42. The nutritional composition may comprise one or more additional microRNAs comprising a sequence according to SEQ ID NOs: 4-42, presented in Table 1.

[0155] The nutritional composition may comprise one or more additional microRNAs that are at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any of SEQ ID NOs: 43-48 or 87-90. The nutritional composition may comprise one or more additional microRNAs comprising a sequence according to SEQ ID NOs: 43-48 or 87-90, shown in Table 1.

[0156] The nutritional composition may comprise one or more additional microRNAs that are at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to any of SEQ ID NOs: 43-48. The nutritional composition may comprise one or more additional microRNAs comprising a sequence according to SEQ ID NOs: 43-48, presented in Table 1.

[0157] The nutritional composition may comprise a microRNA that is at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, or 100% identical to SEQ ID NO: 41 or 48. Preferably, the nutritional composition comprises a microRNA comprising a sequence according to SEQ ID NO: 41 or 48. More preferably, the nutritional composition comprises a microRNA comprising a sequence according to SEQ ID NO: 48.

[0158] Each of the one or more additional microRNAs may be present in the nutritional composition of the present invention at a concentration of 0.1-10,000 pmol / L, 0.1-1000 pmol / L, 1-1000 pmol / L, 10-1000 pmol / L or 100-1000 pmol / L, especially when the nutritional composition is an infant formula. Preferably, each of the one or more additional microRNAs is present in the nutritional composition of the present invention at a concentration of 10-1000 pmol / L, especially when the nutritional composition is an infant formula. More preferably, each of the one or more additional microRNAs is present in the nutritional composition of the present invention at a concentration of 100-1000 pmol / L, especially when the nutritional composition is an infant formula.One or more additional microRNAs may be present in the nutritional composition of the present invention in amounts such that the concentration of each of the one or more additional microRNAs is approximately the same as that in natural human milk.

[0159] If the nutritional composition is a fortifier, each of the one or more additional microRNAs may be present in the fortifier in such an amount that after mixing with breast milk or infant formula, the concentration of each of the one or more additional microRNAs is 0.1-10,000 pmol / L, 0.1-1000 pmol / L, 1-1000 pmol / L, 10-1000 pmol / L, or 100-1000 pmol / L. Preferably, each of the one or more additional microRNAs is present in the fortifier in such an amount that after mixing with breast milk or infant formula, the concentration of each of the one or more additional microRNAs is 10-1000 pmol / L. More preferably, each of the one or more additional microRNAs is present in the fortifier in an amount such that, after mixing with human milk or infant formula, the concentration of each of the one or more additional microRNAs is 100-1000 pmol / L.One or more additional microRNAs may be present in the fortifier in an amount such that, after mixing with human milk or infant formula, the concentration of each of the one or more additional microRNAs is approximately the same as that found in natural human milk.

[0160] If the nutritional composition is a supplement, each of the one or more additional microRNAs may be present in the fortifier in an amount such as to provide a standard dose of each microRNA. Thus, the supplement can provide a dose equivalent to 50-250 ml, 100-250 ml, 150-250 ml, or about 100 ml, or about 200 ml of natural breast milk. For example, each of the one or more additional microRNAs may be present in the supplement in an amount of 0.02-2000 nmol, 0.02-200 nmol, 0.2-200 nmol, 2-200 nmol, or 20-200 nmol. Preferably, each of the one or more additional microRNAs is present in the supplement in an amount of 2-200 nmol. More preferably, each of the one or more additional microRNAs is present in the supplement in an amount of 20-200 nmol.

[0161] If the nutritional composition is in the form of a powder capable of being dissolved in a liquid composition, the concentration of each of the one or more additional microRNAs is determined based on the dissolved liquid composition.

[0162] Obtaining siRNA

[0163] The miRNA for use in the present invention can be obtained by any suitable method known in the art.

[0164] miRNA can be produced synthetically or isolated from physiological fluid.

[0165] Mature miRNAs can be produced synthetically by obtaining partially double-stranded RNA as a miRNA precursor (pre-miRNA) and cleaving it with the Dicer enzyme. Commercially available Dicer enzymes can be used. Double-stranded RNA (e.g., a miRNA precursor) can be produced, for example, by an RNA polymerase reaction using double-stranded DNA with a complementary sequence as a template. Double-stranded DNA can be produced by PCR amplification using mammalian chromosomal DNA as a template and primers capable of amplifying the miRNA sequence.

[0166] Furthermore, miRNA can also be produced through chemical synthesis. Thus, miRNA can be obtained by synthesizing the sense and antisense strands and annealing them.

[0167] miRNA can be isolated from colostrum or breast milk. miRNA can be isolated from bovine colostrum or breast milk.

[0168] Variants and fragments

[0169] In addition to the siRNAs mentioned herein, the present invention also encompasses the use of variants and fragments thereof.

[0170] As used herein, the term "variant" refers to an siRNA that has a certain homology to the wild-type siRNA sequence or SEQ ID NO described herein. The term "homology" may be equivalent to the term "identity."

[0171] A variant miRNA sequence may comprise a nucleotide sequence that is at least 50%, at least 55%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% identical, preferably at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the subject's miRNA sequence. Typically, miRNA variants will have similar chemical properties / functions, such as regulating gene expression in the same way as the subject's miRNA sequence. Although homology can also be considered in terms of similarity (i.e., as amino acid residues having similar chemical properties / functions), in the context of the present invention, it is preferable to express homology in terms of sequence identity.

[0172] Identity comparisons can be performed visually or, more commonly, using readily available sequence comparison programs. Commercially available computer programs can calculate the percentage of homology or identity between two or more sequences.

[0173] Percent homology can be calculated from adjacent sequences. This means that one sequence is aligned with another sequence, and each nucleotide in one sequence is directly compared to the corresponding nucleotide in the other sequence, one residue at a time. This is called a "gapless" alignment. Typically, such gapless alignments are performed only on a relatively small number of residues.

[0174] While this method is very simple and consistent, most sequence comparison methods are designed to produce optimal alignments that account for possible insertions and deletions without unduly reducing the overall homology score. This is achieved by inserting "gaps" during the sequence alignment to maximize local homology.

[0175] However, these more sophisticated methods impose "gap penalties" on each gap that occurs during alignment, so that, given the same number of identical nucleotides, a sequence alignment with as few gaps as possible, reflecting a higher correlation between the two sequences being compared, will yield a higher score than one with many gaps. Typically, "affine gap penalties" are used, imposing a relatively high penalty for the presence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties certainly ensure optimal alignments with fewer gaps. Most alignment programs allow you to change gap penalties. However, when using such software for sequence comparisons, it is recommended to use the default values.

[0176] Thus, to calculate the maximum percentage homology, an optimal alignment taking into account gap penalties is first required. A suitable computer program for performing such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, USA; Devereux et al. (1984) Nucleic Acids Res. 12: 387). Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al. (1999) ibid. - Ch. 18), FASTA (Atschul et al. (1990) J. Mol. Biol. 403–410), and the GENEWORKS comparison toolbox. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al. (1999) ibid., pp. 7-58 to 7-60). However, in some applications, the GCG Bestfit program is preferred. Another tool, called BLAST 2 sequences, is also available for comparing nucleotide sequences (see FEMS Microbiol. Lett.(1999) 174: 247-50; FEMS Microbiol. Lett. (1999) 177: 187-8).

[0177] Although the final percentage homology can be measured in terms of identity, the alignment method itself is typically not based on an all-or-nothing pairwise comparison. Instead, a recalculated similarity scoring matrix is ​​typically used, assigning scores to each pairwise comparison based on chemical similarity or evolutionary distance. A commonly used example of such a matrix is ​​the BLOSUM62 matrix, which is the default matrix for the BLAST software package. GCG Wisconsin programs typically use either the generic defaults or a user-defined symbol comparison table, if available (see the user manual for more information). For some applications, it is preferable to use the generic defaults for the GCG package or, in the case of other software, a default matrix such as BLOSUM62.Accordingly, the percentage of identity is determined for the entire reference and / or query sequence.

[0178] After obtaining an optimal alignment using software, the percentage of homology, preferably the percentage of sequence identity, can be calculated. Software typically performs this as part of a sequence comparison and generates a numerical result.

[0179] The term "fragments" typically refers to a selected region of miRNA that is functionally of interest. Thus, the term "fragment" refers to a miRNA sequence that represents a portion of a full-length miRNA.

[0180] Such variants and fragments can be obtained using standard techniques.

[0181] Regulation of gene expression

[0182] The inventors showed that miR-3126 specifically modulates the expression of genes including genes encoding ninein, Unc-13 homolog D, sulfatase 2, IL-32, OXER1, TMEM127, butyrophilin, integrin alpha-2 subunit, integrin beta-1, tubulin alpha 4A, tubulin beta-6, tubulin beta 2A and / or tubulin beta 2B.

[0183] Accordingly, in one aspect, the present invention provides the use of miR-3126 for modulating the gene expression of one or more genes selected from: ninein, Unc-13 homologue D, sulfatase 2, IL-32, OXER1, TMEM127, butyrophilin, alpha-2 integrin subunit, beta-1 integrin, tubulin alpha 4A, tubulin beta-6, tubulin beta 2A, tubulin beta 2B and butyrophilin.

[0184] Ninein

[0185] The authors showed that miR-3126 significantly increased the expression of ninein.

[0186] Accordingly, in one aspect, the invention provides the use of miR-3126 for increasing the expression of ninein.

[0187] Ninein (UniProt Q8N4C6) is also known as hNinein, glycogen synthase kinase-3 beta-interacting protein and GSK3B-interacting protein.

[0188] Ninein is a centrosomal protein required for the positioning and anchoring of microtubule minus ends in epithelial cells. Ninein can also function as a centrosome maturation factor and may play a role in microtubule nucleation by recruiting the gamma-tubulin ring complex to the centrosome. Overexpression of ninein does not interfere with microtubule nucleation or elongation but suppresses microtubule release. Ninein is required for centriole organization and microtubule anchoring to the mother centriole. Thus, ninein may play a role in growth and development.

[0189] Ninein may play a role in neuronal development. For example, it has been shown that alternative splicing in ninein appears to be sufficient for the differentiation of neural progenitor cells (NPCs) from neurons (Zhang, X., et al., 2016. Cell, 166(5), pp.1147-1162).

[0190] Ninein may also play a role in epidermal development. In mammalian skin, ninein is localized to the centrosomes of progenitor cells and translocates to the cortex during keratinocyte differentiation. Ninein has been shown to be necessary for maintaining normal protein levels of the differentiation markers filaggrin and involucrin for desmosome formation, lamellar body secretion, and epidermal barrier formation. Ninein-deficient mice are viable but have thinner skin with a partially compromised epidermal barrier (Lecland, N., et al., 2019. Life science alliance, 2(2), p.e201900373).

[0191] Unc-13 D protein homolog

[0192] The authors of the invention showed that miR-3126 significantly increased the expression of the Unc-13 protein homologue D.

[0193] Accordingly, in one aspect, the invention provides the use of miR-3126 for increasing the expression of the Unc-13 D protein homologue.

[0194] Unc-13 protein homolog D (UniProt Q70J99) is also known as Munc13-4.

[0195] Unc-13 D homolog plays a role in the exocytosis of protease-containing vacuoles in lymphocytes. Unc-13 D homolog is required for both granule maturation and granule docking and priming at the immunological synapse. Unc-13 D homolog regulates the assembly of recycling structures and late endosome structures, leading to the formation of an endosomal exocytic compartment that fuses with perforin-containing granules at the immunological synapse and licenses them for exocytosis. Unc-13 D homolog also regulates Ca2+-dependent secretory lysosomal exocytosis in mast cells.

[0196] The Unc-13 D protein homolog may play a role in infection protection and in the leukocyte killing system. Mutations in the UNC13D gene are associated with hemophagocytic lymphohistiocytosis 3. Hemophagocytic lymphohistiocytosis is a rare hematological disorder that is more common in children than in adults. It is a life-threatening disease with severe hyperinflammation caused by the uncontrolled proliferation of activated lymphocytes and macrophages, characterized by the proliferation of morphologically benign lymphocytes and macrophages that secrete large amounts of inflammatory cytokines. It is classified as one of the cytokine storm syndromes.

[0197] Sulfatase 2

[0198] The authors showed that miR-3126 significantly increased the expression of sulfatase 2.

[0199] Accordingly, in one aspect, the invention provides the use of miR-3126 for increasing the expression of the sulfatase 2 gene.

[0200] Sulfatase 2 (UniProt Q8IWU5) is also known as extracellular sulfatase Sulf-2 and hSulf-2.

[0201] Sulfatase 2 exhibits arylsulfatase activity and highly specific endoglucosamine-6-sulfatase activity. Sulfatase 2 can remove sulfate from the C-6 position of glucosamine within specific subregions of intact heparin.

[0202] Sulfatase 2 may play a role in neuronal development. Sulfatase 2 modulates cell fate transition from motor neurons (MNs) to oligodendrocyte progenitor cells (OPCs) by regulating Shh signaling in the ventral rootlets of the mouse spinal cord in coordination with Sulf1 (Jiang, W., et al., 2017. Developmental neuroscience, 39(5), pp.361-374).

[0203] IL-32

[0204] The authors showed that miR-3126 significantly increased the expression of IL-32.

[0205] Accordingly, in one aspect, the invention provides the use of miR-3126 for increasing the expression of IL-32 genes.

[0206] IL-32 (UniProt P24001) is also known as interleukin-32, natural killer cell protein 4, and tumor necrosis factor-inducing factor alpha. IL-32 is a cytokine that may play a role in innate and adaptive immune responses. IL-32 induces various cytokines, such as TNFA / TNF-alpha and IL-8. IL-32 activates the typical cytokine signaling pathways NF-kappa-B and p38 MAPK.

[0208] IL-32 may play a role in protection against allergies and / or an anti-inflammatory role. Abnormal presence of IL-32 has been repeatedly noted in the pathogenesis of allergic, infectious, oncological, and inflammatory diseases. Of particular note is the observation of the anti-inflammatory property of IL-32 in a mouse model of ovalbumin-induced allergic asthma. Compared with wild-type mice, mice transgenic for IL-32γ exhibit reduced levels of inflammatory cells, recruited eosinophils, and lymphocytes in bronchoalveolar lavage fluid in a mouse model of acute asthma (Xin, T., et al., 2018. Respiratory research, 19(1), p.124).

[0209] OXER1

[0210] The authors showed that miR-3126 significantly reduced the expression of OXER1.

[0211] Accordingly, in one aspect, the invention provides the use of miR-3126 for reducing the expression of the OXER1 gene.

[0212] OXER1 (UniProt Q8TDS5) is also known as oxoeicosanoid receptor 1, 5-oxo-ETE, G protein-coupled receptor, G protein-coupled receptor 170, G protein-coupled receptor R527 and G protein-coupled receptor TG1019.

[0213] OXER1 is a receptor for eicosanoids and polyunsaturated fatty acids such as 5-oxo-6E, 8Z, 11Z, 14Z-eicosatetraenoic acid (5-OXO-ETE), 5(S)-hydroperoxy-6E, 8Z, 11Z, 14Z-eicosatetraenoic acid (5(S)-HPETE), and arachidonic acid. OXER1 appears to be associated with the G(i) / G(o) family of heteromeric G proteins.

[0214] OXER1 may play an anti-inflammatory role. Furthermore, OXER1 may play a role in protection against allergies. OXER1 is activated by 5-oxo-ETE, 5-HETE, and other members of the 5-hydroxyeicosatetraenoic acid family, metabolites of arachidonic acid, and thus mediates the stimulatory effects of this family on cell types involved in mediating immune inflammatory responses, such as neutrophils, monocytes, and macrophages, as well as cells involved in mediating allergic reactions, such as eosinophils and basophils. OXER1 also mediates in vitro proliferation and other promalignant responses of cultured prostate, breast, ovarian, and renal cancer cells to the 5-HETE family of agonists. These studies suggest that OXER1 may be involved in orchestrating inflammatory and allergic responses in humans and promote the growth and spread of prostate, breast, ovarian, and kidney cancers in humans.OXER1 is responsible for the steroid-producing response to 5-oxo-ETE in human steroidogenic cells in vitro and, therefore, may be involved in steroid production in humans. Feline leukocytes have been shown to synthesize and respond to 5-oxo-ETE, potentially playing a significant role in the development of asthma in cats (Cossette, C., et al., 2015. Biochemical pharmacology, 96(3), pp.247-255).

[0215] TMEM127

[0216] The authors showed that miR-3126 significantly reduced the expression of TMEM127.

[0217] Accordingly, in one aspect, the invention provides the use of miR-3126 for reducing the expression of the TMEM127 gene.

[0218] TMEM127 (UniProt O75204) is also known as transmembrane protein 127.

[0219] TMEM127 controls cell proliferation by acting as a negative regulator of the TOR signaling pathway mediated by mTORC1. TMEM127 can act as a tumor suppressor. Inactivating germline mutations cause hereditary pheochromocytoma and paraganglioma (Qin, Y., et al., 2010. Nature genetics, 42(3), p.229; and Neumann, HP, et al., 2011. The Journal of Clinical Endocrinology & Metabolism, 96(8), pp.E1279-E1282).

[0220] Butyrophilin

[0221] The authors showed that miR-3126 significantly increased the expression of butyrophilin.

[0222] Accordingly, in one aspect, the invention provides the use of miR-3126 for increasing the expression of the butyrophilin gene.

[0223] Butyrophilin (UniProt Q13410) is also known as member A1 of the butyrophilin subfamily 1 or BT.

[0224] Butyrophilin may be involved in the secretion of fat droplets by the mammary gland. Butyrophilin may function as a specific membrane-associated receptor for the association of cytoplasmic droplets with the apical plasma membrane. Butyrophilin can inhibit the proliferation of CD4 and CD8 T cells activated by CD3 antibodies, T cell metabolism, and the secretion of IL2 and IFNγ.

[0225] Integrins [ITGA2 (integrin alpha-2 subunit) and ITGB1 (integrin beta-1 subunit)]

[0226] The inventors have shown that miR-3126 significantly increases the expression of ITGA2 and ITGB1. Accordingly, in one aspect, the invention provides the use of miR-3126 to increase the expression of the ITGA2 and / or ITGB1 genes.

[0227] ITGA2 (UniProt P17301) is also known as integrin alpha-2 subunit, integrin, alpha-2 and platelet membrane glycoprotein Ia or CD49b or VLA2.

[0228] ITGB1 (UniProt P05556) is also known as integrin beta-1 subunit, integrin, beta-1 and glycoprotein IIa or CD29 or FNRB, MSK12, MDF2.

[0229] Integrins perform two main functions: cell attachment to the extracellular matrix (ECM) and signal transduction from the ECM to cells. Integrins thus perform pleiotropic cell-specific roles, including normal blood coagulation, extravasation, cell-cell adhesion, and cell migration. A growing body of evidence indicates that collagen-binding integrins, and particularly alpha-2 / beta-1, are important regulatory molecules involved in T cell activation. Alpha-2 / beta-1 integrin has been shown to co-stimulate production of the signature cytokine IFN-g in human effector T cells (also called Th1), suggesting its important role in optimal immune responses against pathogens (Mol Immunol. 2007 Jul; 44(15): 3732-40, https: / / www.ncbi.nlm.nih.gov / pubmed / 17521731).In addition to participating in co-stimulation, alpha-2 / beta-1 integrin can also activate the migration, localization, and retention of IFN-g-producing Th1 cells in infected tissues for optimal pathogen clearance.

[0230] Tubulins [TUBA4A (tubulin alpha-4A), TUBB6 (tubulin beta-6 class V), TUBB2A (tubulin beta-2a class IIa), TUBB2B (tubulin beta-2b class IIb)]

[0231] The inventors showed that miR-3126 significantly increased the expression of TUBA4A (tubulin alpha-4A), TUBB6 (tubulin beta-6 class V), TUBB2A (tubulin beta-2a class IIa) and TUBB2B (tubulin beta-2b class IIb).

[0232] Accordingly, in one aspect, the invention provides the use of miR-3126 for increasing gene expression of at least one gene selected from the group consisting of: TUBA4A, TUBA4A (tubulin alpha-4A), TUBB6 (tubulin beta-6 class V), TUBB2A (tubulin beta-2a class IIa), TUBB2B (tubulin beta-2b class IIb)

[0233] In one embodiment, the invention provides the use of miR-3126 to increase the expression of the TUBA4A gene.

[0234] TUBA4A (UniProt P68366) is also known as tubulin alpha-4A and tubulin alpha-1 (TUBA1).

[0235] TUBA4A (tubulin alpha-4a) is a protein-encoding gene. Tubulin is the main component of microtubules. It binds two moles of GTP, one at the interchangeable site on the beta chain and one at the non-interchangeable site on the alpha chain. Microtubules of the eukaryotic cytoskeleton perform important and diverse functions and are composed of a heterodimer of alpha- and beta-tubulin. The genes encoding these microtubule components are part of the tubulin superfamily, which consists of six distinct families. Genes from the alpha-, beta-, and gamma-tubulin families are found in all eukaryotes. Alpha- and beta-tubulins are the main components of microtubules, and gamma-tubulin plays a critical role in the nucleation of microtubule assembly. There are numerous alpha- and beta-tubulin genes, which are highly conserved among and between species. TUBA4A encodes alpha-tubulin, which is a highly conserved homologue of rat testis-specific alpha-tubulin.Alternatively spliced ​​transcript variants encoding different isoforms have been identified for this gene.

[0236] In another embodiment, the invention provides the use of miR-3126 for increasing the expression of the TUBB6 gene.

[0237] TUBB6 (UniProt Q9BUF5) is also known as tubulin beta-6 and class V tubulin beta-6 (TUBB6).

[0238] TUBB6 (class V tubulin beta-6) is a protein coding gene.

[0239] Tubulin is the main component of microtubules. It binds two moles of GTP, one at the interchangeable site on the beta chain and one at the non-interchangeable site on the alpha chain.

[0240] In another embodiment, the invention provides the use of miR-3126 to increase the expression of the TUBB2A gene.

[0241] TUBB2A (UniProt Q13885) is also known as class IIa tubulin beta-2A, class IIa beta-tubulin, and tubulin beta-2A.

[0242] TUBB2A (class IIa tubulin beta-2A) is a protein coding gene.

[0243] Tubulin is the main component of microtubules. It binds two moles of GTP, one at the interchangeable site on the beta chain and one at the non-interchangeable site on the alpha chain.

[0244] In another embodiment, the invention provides the use of miR-3126 to increase the expression of the TUBB2B gene.

[0245] TUBB2B (UniProt Q9BVA1) is also known as class IIb tubulin beta-2B, class IIb beta-tubulin, and tubulin beta-2B.

[0246] TUBB2B (class IIb tubulin beta-2B) is a protein coding gene.

[0247] Tubulin is the main component of microtubules. It binds two moles of GTP, one at the interchangeable site on the beta chain and one at the non-interchangeable site on the alpha chain.

[0248] Microtubules play a crucial role in many aspects of polarity in multicellular organisms, ranging from the asymmetric distribution of cell fate determinants in single-cell embryos to the transient polarity generated in migrating fibroblasts. Epithelial cells exhibit persistent cell polarity, characterized by apical and basolateral surface domains with distinct protein and lipid compositions, separated by tight junctions. They are also equipped with a microtubule network that reflects the asymmetry of their cell surface: the minus ends of the microtubules face the apical domain, and the plus ends of the microtubules face the basal domain. Remarkably, the formation of distinct surface domains during epithelial differentiation is accompanied by a reorganization of microtubules from a uniform array focused on the centrosome to a noncentrosomal network that aligns along the apical-basolateral polar axis.The implications of this coincidence for epithelial morphogenesis and the signaling mechanisms that regulate microtubule repolymerization in developing epithelia remain major unanswered questions, which we are only beginning to address. Studies of cultured polarized epithelial cells have shown that microtubules serve as tracks facilitating directed vesicular transport. Furthermore, new findings suggest that microtubule-based transport stimulates protein sorting and even the generation of transport carriers in the endo- and exocytic pathways (Musch, Traffic, January 2004, volume 5, issue 1).

[0249] It has been globally established that microtubules are essential for effective homeostasis of epithelial tight junctions, barrier maintenance, and repair in the event of challenges (Lila et al., Am J Physiol Cell Physiol 307: C245-C254, 2014). Indeed, when microtubule dynamics are chemically altered, occlusive migration, formation, and maintenance of tight junctions are reduced, with a reduced overall impact on transepithelial resistance.

[0250] Modulation of biological pathways

[0251] The inventors showed that miR-3126 specifically activates certain pathways, including the aryl hydrocarbon receptor signaling pathway and / or the epithelial adherens junction signaling pathway.

[0252] Accordingly, in one aspect, the present invention provides the use of miR-3126 for activating one or more signaling pathways selected from the group consisting of: the aryl hydrocarbon receptor signaling pathway and the epithelial adherens junction signaling pathway.

[0253] Aryl hydrocarbon receptor signaling

[0254] The aryl hydrocarbon receptor (AHR) is a transcription factor that can bind xenobiotic chemicals. AHR has been shown to be involved in the regulation of cellular physiology (migration, proliferation, and adhesion) (Larigot et al., 2018, AhR signaling pathways and regulatory functions. Biochim Open 7, 1-9).

[0255] AHR also plays an important role in the development of the nervous system (Kimura and Tohyama, 2017, Embryonic and Postnatal Expression of Aryl Hydrocarbon Receptor mRNA in Mouse Brain Front Neuroanat 11, 4). It has been reported that disruption of AHR signaling in utero leads to abnormal dendritic growth of neurons in mice (Kimura et al., 2015, Developmental origin of abnormal dendritic growth in the mouse brain induced by in utero disruption of aryl hydrocarbon receptor signaling. Neurotoxicol Teratol 52, 42-50).

[0256] Furthermore, AHR has been shown to play a role in maintaining the intestinal barrier (Esser and Rannug, 2015, The aryl hydrocarbon receptor in barrier organ physiology, immunology, and toxicology. Pharmacol Rev 67, 259–279) and regulating intestinal immunosurveillance (Murray et al., 2016, “Expression of the aryl hydrocarbon receptor contributes to the establishment of intestinal microbial community structure in mice.” Sci Rep 6, 33969; Qiu et al., 2012, “The aryl hydrocarbon receptor regulates gut immunity through modulation of innate lymphoid cells.” Immunity 36, 92–104). Furthermore, AHR has been shown to promote the establishment of gut microbiota in mice (Murray et al., 2016). Interestingly, AHR ligands such as polyphenols (Larigot et al., 2018) have antioxidant, anti-inflammatory, neuroprotective, antidiabetic and antiadipogenic properties.Taken together, these results strongly suggest that modulation of AHR signaling by miRNAs may be beneficial in promoting intestinal cell development and function, likely by modulating microbiota composition, intestinal immunosurveillance, and / or intestinal barrier maintenance / formation.

[0257] MiR-3126 activates aryl hydrocarbon receptor signaling and may therefore be useful for promoting neural growth, promoting microbiota formation, and / or promoting intestinal barrier integrity and / or function and the corresponding protection of the subject.

[0258] Epithelial adherens junction signaling.

[0259] Adherins, such as cadherins, are responsible for cell-cell adhesion, as well as maintaining cell polarity and regulating epithelial migration and proliferation (Groschwitz and Hogan, 2009, Intestinal barrier function: molecular regulation and disease pathogenesis. J Allergy Clin Immunol 124, 3-20; quiz 21-22). Adherens junction and tight junction have been shown to mediate intestinal barrier function through their ability to maintain cell-cell communication. After birth, the intestinal barrier in neonates is more permeable than in adults, and barrier function gradually increases during early life, a process that can be modulated by miR-3126-5p.

[0260] MiR-3126 activates aryl hydrocarbon receptor signaling and may therefore be useful in promoting intestinal barrier maintenance and the corresponding protection of the subject.

[0261] Applications of miR-3126 and nutritional composition

[0262] In one aspect, the invention provides the use of miR-3126 as a medicament. In a related aspect, the invention provides the use of miR-3126 for the preparation of a medicament. In a related aspect, the invention provides a method of treatment comprising administering miR-3126.

[0263] In another aspect, the invention provides a nutritional composition of the invention for use as a medicament. In a related aspect, the invention provides the use of the nutritional composition of the invention for the preparation of a medicament. In a related aspect, the invention provides a method of treatment comprising administering the nutritional composition of the invention.

[0264] Gastrointestinal Health

[0265] In addition to analyzing the effects on gene expression as described above, the present inventors performed an analysis of the biological function. The identified biological functions of miR-3126 include: (i) upregulating cell migration, epithelial cell differentiation, and neovascularization; and (ii) downregulating the survival of tumor cell lines, infections, and gastrointestinal tumors. These results and the knowledge of the effects on gene expression suggest that miR-3126 can promote and / or protect gastrointestinal health.

[0266] In one aspect, the invention provides the use of miR-3126 for promoting and / or protecting gastrointestinal health. In a related aspect, the invention provides the use of miR-3126 for the preparation of a medicament for promoting and / or protecting gastrointestinal health. In a related aspect, the invention provides a method for promoting and / or protecting gastrointestinal health in a subject, comprising administering miR-3126 to the subject.

[0267] In one aspect, the invention provides a nutritional composition of the invention for use in promoting and / or protecting gastrointestinal health. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for promoting and / or protecting gastrointestinal health. In a related aspect, the invention provides a method for promoting and / or protecting the gastrointestinal health of a subject, comprising administering to the subject the nutritional composition of the invention.

[0268] In one aspect, the invention provides the use of miR-3126 for promoting and / or protecting gastrointestinal health. In another aspect, the invention provides the use of a nutritional composition of the invention for promoting and / or protecting gastrointestinal health.

[0269] Growth and Development

[0270] As described above, the inventors showed that miR-3126 significantly reduced the expression of TMEM127, which plays a role in cell proliferation (growth).

[0271] In one aspect, the invention provides the use of miR-3126 for promoting growth and / or development. In a related aspect, the invention provides the use of miR-3126 for the production of a medicament for promoting growth and / or development. In a related aspect, the invention provides a method for promoting growth and / or development of a subject, comprising administering miR-3126 to the subject.

[0272] In one aspect, the invention provides a nutritional composition of the invention for use in promoting growth and / or development. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for promoting growth and / or development. In a related aspect, the invention provides a method for promoting growth and / or development of a subject, comprising administering to the subject the nutritional composition of the invention.

[0273] In one aspect, the invention provides the use of miR-3126 for promoting growth and / or development. In another aspect, the invention provides the use of a nutritional composition of the invention for promoting growth and / or development.

[0274] Neural development

[0275] As described above, the inventors showed that miR-3126 significantly increased the expression of ninein and sulfatase 2, both of which may play a role in neuronal development.

[0276] In addition, miR-3126 activates the aryl hydrocarbon receptor signaling pathway, which also promotes neural growth.

[0277] Defects in neural development can lead to abnormalities and a wide range of neurodevelopmental disorders. Children with neurodevelopmental disorders may experience difficulties with language and speech, motor skills, behavior, memory, learning, or other neurological functions.

[0278] In one aspect, the invention provides the use of miR-3126 for stimulating the development of the central nervous system (CNS). In a related aspect, the invention provides the use of miR-3126 for the preparation of a medicament for stimulating the development of the CNS. In a related aspect, the invention provides a method for stimulating the development of the CNS in a subject, comprising administering miR-3126 to the subject.

[0279] In one aspect, the invention provides a nutritional composition of the invention for use in stimulating CNS development. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for stimulating CNS development. In a related aspect, the invention provides a method for stimulating CNS development in a subject, comprising administering to the subject the nutritional composition of the invention.

[0280] In one aspect, the invention provides the use of miR-3126 for stimulating CNS development. In another aspect, the invention provides the use of a nutritional composition of the invention for stimulating CNS development.

[0281] Epidermal development

[0282] As described above, the present inventors showed that miR-3126 significantly increased the expression of ninein, which may play a role in epidermal development.

[0283] Defects in epidermal development can lead to tissue fragility, hypertrophic and inflammatory skin conditions, or malignant transformation of epidermal keratinocytes.

[0284] In one aspect, the invention provides the use of miR-3126 for stimulating epidermal development. In a related aspect, the invention provides the use of miR-3126 for the preparation of a medicament for stimulating epidermal development. In a related aspect, the invention provides a method for stimulating epidermal development in a subject, comprising administering miR-3126 to the subject.

[0285] In one aspect, the invention provides a nutritional composition of the invention for use in stimulating epidermal development. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for stimulating epidermal development. In a related aspect, the invention provides a method for stimulating epidermal development in a subject, comprising administering to the subject the nutritional composition of the invention.

[0286] In one aspect, the invention provides the use of miR-3126 for stimulating epidermal development. In another aspect, the invention provides the use of a nutritional composition of the invention for stimulating epidermal development.

[0287] Infection

[0288] As described above, the present inventors showed that miR-3126 significantly increased the expression of Unc-13 homolog D and several integrins mentioned above, which may play a role in protection against infection.

[0289] In one aspect, the invention provides the use of miR-3126 for reducing the risk of infection. In a related aspect, the invention provides the use of miR-3126 for the preparation of a medicament for reducing the risk of infection. In a related aspect, the invention provides a method for reducing the risk of infection in a subject, comprising administering miR-3126 to the subject.

[0290] In one aspect, the invention provides the use of miR-3126 for the prevention and / or treatment of infection. In a related aspect, the invention provides the use of miR-3126 for the production of a medicament for the prevention and / or treatment of infection. In a related aspect, the invention provides a method for the prevention and / or treatment of infection in a subject, comprising administering miR-3126 to the subject.

[0291] In one aspect, the invention provides a nutritional composition of the invention for use in reducing the risk of infection. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for reducing the risk of infection. In a related aspect, the invention provides a method for reducing the risk of infection in a subject, comprising administering to the subject the nutritional composition of the invention.

[0292] In one aspect, the invention provides a nutritional composition of the invention for use in the prevention and / or treatment of an infection. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for the prevention and / or treatment of an infection. In a related aspect, the invention provides a method for the prevention and / or treatment of an infection in a subject, comprising administering to the subject the nutritional composition of the invention.

[0293] In one aspect, the invention provides the use of miR-3126 for reducing the risk of infection. In another aspect, the invention provides the use of a nutritional composition of the invention for reducing the risk of infection.

[0294] In one aspect, the invention provides the use of miR-3126 for the prevention and / or treatment of infection. In another aspect, the invention provides the use of a nutritional composition of the invention for the prevention and / or treatment of infection.

[0295] Lymphoproliferative disorders

[0296] As described above, the present inventors showed that miR-3126 significantly increased the expression of Unc-13 homologue D, which may play a role in the leukocyte killing system and protection against lymphoproliferative disorders.

[0297] Lymphoproliferative disorders (LPD) refer to several conditions in which lymphocytes are produced in excessive quantities. They typically occur in people with compromised immune systems.

[0298] In one aspect, the invention provides the use of miR-3126 for reducing the risk of developing a lymphoproliferative disorder in a subject. In a related aspect, the invention provides the use of miR-3126 for the preparation of a medicament for reducing the risk of developing a lymphoproliferative disorder in a subject. In a related aspect, the invention provides a method for reducing the risk of developing a lymphoproliferative disorder in a subject, comprising administering miR-3126 to the subject.

[0299] In one aspect, the invention provides the use of miR-3126 for the prevention and / or treatment of a lymphoproliferative disorder. In a related aspect, the invention provides the use of miR-3126 for the preparation of a medicament for the prevention and / or treatment of a lymphoproliferative disorder. In a related aspect, the invention provides a method for the prevention and / or treatment of a lymphoproliferative disorder in a subject, comprising administering miR-3126 to the subject.

[0300] In one aspect, the invention provides a nutritional composition of the invention for use in reducing the risk of developing a lymphoproliferative disorder in a subject. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for reducing the risk of developing a lymphoproliferative disorder in a subject. In a related aspect, the invention provides a method for reducing the risk of developing a lymphoproliferative disorder in a subject, comprising administering to the subject the nutritional composition of the invention.

[0301] In one aspect, the invention provides a nutritional composition of the invention for use in the prevention and / or treatment of a lymphoproliferative disorder. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for the prevention and / or treatment of a lymphoproliferative disorder. In a related aspect, the invention provides a method for the prevention and / or treatment of a lymphoproliferative disorder in a subject, comprising administering to the subject a nutritional composition of the invention.

[0302] In one aspect, the invention provides the use of miR-3126 for reducing the risk of developing a lymphoproliferative disorder in a subject. In another aspect, the invention provides the use of a nutritional composition of the invention for reducing the risk of developing a lymphoproliferative disorder in a subject.

[0303] In one aspect, the invention provides the use of miR-3126 for the prevention and / or treatment of a lymphoproliferative disorder. In another aspect, the invention provides the use of a nutritional composition of the invention for the prevention and / or treatment of a lymphoproliferative disorder.

[0304] Allergy

[0305] As described above, the present inventors demonstrated that miR-3126 significantly increased IL-32 expression and significantly decreased OXER1 expression. Both IL-32 and OXER1 may play a role in protecting against allergic diseases.

[0306] Allergic diseases are a range of conditions caused by the immune system's hypersensitivity to normally harmless substances in the environment. Allergic diseases include hay fever, food allergies, atopic dermatitis, allergic asthma, and anaphylaxis. In one embodiment, the allergic disease is allergic asthma.

[0307] In one aspect, the invention provides the use of miR-3126 for reducing the risk of developing an allergic disease in a subject. In a related aspect, the invention provides the use of miR-3126 for the preparation of a medicament for reducing the risk of developing an allergic disease in a subject. In a related aspect, the invention provides a method for reducing the risk of developing an allergic disease in a subject, comprising administering miR-3126 to the subject.

[0308] In one aspect, the invention provides the use of miR-3126 for the prevention and / or treatment of an allergic disease. In a related aspect, the invention provides the use of miR-3126 for the production of a medicament for the prevention and / or treatment of an allergic disease. In a related aspect, the invention provides a method for the prevention and / or treatment of an allergic disease in a subject, comprising administering miR-3126 to the subject.

[0309] In one aspect, the invention provides a nutritional composition of the invention for use in reducing the risk of developing an allergic disease in a subject. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for reducing the risk of developing an allergic disease in a subject. In a related aspect, the invention provides a method for reducing the risk of developing an allergic disease in a subject, comprising administering to the subject the nutritional composition of the invention.

[0310] In one aspect, the invention provides a nutritional composition of the invention for use in the prevention and / or treatment of an allergic disease. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for the prevention and / or treatment of an allergic disease. In a related aspect, the invention provides a method for the prevention and / or treatment of an allergic disease in a subject, comprising administering to the subject a nutritional composition of the invention.

[0311] In one aspect, the invention provides the use of miR-3126 for reducing the risk of developing an allergic disease in a subject. In another aspect, the invention provides the use of a nutritional composition of the invention for reducing the risk of developing an allergic disease in a subject.

[0312] In one aspect, the invention provides the use of miR-3126 for the prevention and / or treatment of an allergic disease. In another aspect, the invention provides the use of a nutritional composition of the invention for the prevention and / or treatment of an allergic disease.

[0313] Inflammation

[0314] As described above, the present inventors demonstrated that miR-3126 significantly increased the expression of IL-32 and significantly decreased the expression of OXER1. Both IL-32 and OXER1 may play anti-inflammatory roles.

[0315] In one aspect, the invention provides the use of miR-3126 for reducing the risk of developing an inflammatory disorder in a subject. In a related aspect, the invention provides the use of miR-3126 for the preparation of a medicament for reducing the risk of developing an inflammatory disorder in a subject. In a related aspect, the invention provides a method for reducing the risk of developing an inflammatory disorder in a subject, comprising administering miR-3126 to the subject.

[0316] In one aspect, the invention provides the use of miR-3126 for the prevention and / or treatment of an inflammatory disorder. In a related aspect, the invention provides the use of miR-3126 for the preparation of a medicament for the prevention and / or treatment of an inflammatory disorder. In a related aspect, the invention provides a method for the prevention and / or treatment of an inflammatory disorder in a subject, comprising administering miR-3126 to the subject.

[0317] In one aspect, the invention provides a nutritional composition of the invention for use in reducing the risk of developing an inflammatory disorder in a subject. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for reducing the risk of developing an inflammatory disorder in a subject. In a related aspect, the invention provides a method for reducing the risk of developing an inflammatory disorder in a subject, comprising administering to the subject the nutritional composition of the invention.

[0318] In one aspect, the invention provides a nutritional composition of the invention for use in the prevention and / or treatment of an inflammatory disorder. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for the prevention and / or treatment of an inflammatory disorder. In a related aspect, the invention provides a method for the prevention and / or treatment of an inflammatory disorder in a subject, comprising administering to the subject the nutritional composition of the invention.

[0319] In one aspect, the invention provides the use of miR-3126 for reducing the risk of developing an inflammatory disorder in a subject. In another aspect, the invention provides the use of a nutritional composition of the invention for reducing the risk of developing an inflammatory disorder in a subject.

[0320] In one aspect, the invention provides the use of miR-3126 for the prevention and / or treatment of an inflammatory disorder. In another aspect, the invention provides the use of a nutritional composition of the invention for the prevention and / or treatment of an inflammatory disorder.

[0321] Intestinal barrier

[0322] As described above, the present inventors showed that miR-3126 significantly increased the expression of several tubulins and also activated the aryl hydrocarbon receptor signaling pathway and the epithelial adherens junction signaling pathway.

[0323] Such gene expression and pathway activation, as described above, play a role in promoting the development and function of the intestinal barrier (including the integrity and maintenance of the intestinal barrier). Impaired intestinal barrier function is associated with many gastrointestinal diseases, but can also be caused by extraintestinal pathological conditions, such as type 1 diabetes mellitus, allergic diseases, and autism spectrum disorders. Therefore, maintaining a healthy intestinal barrier in children is of paramount importance (Viggiano et al. Eur Rev Med Pharmacol Sci. 2015;19(6):1077-85).

[0324] Defects in the development and function of the intestinal barrier can lead to a wide range of disorders, such as: celiac disease, infectious diarrhea, inflammatory bowel disease, sepsis, necrotizing enterocolitis (NEC) or post-infectious irritable bowel syndrome (IBS).

[0325] In one aspect, the invention provides the use of miR-3126 for stimulating the integrity and function of the intestinal barrier. In a related aspect, the invention provides the use of miR-3126 for the production of a medicament for stimulating the development and function of the intestinal barrier. In a related aspect, the invention provides a method for stimulating the development and function of the intestinal barrier in a subject, comprising administering miR-3126 to the subject.

[0326] In one aspect, the invention provides a nutritional composition of the invention for use in stimulating the development and function of the intestinal barrier. In a related aspect, the invention provides a nutritional composition of the invention for the preparation of a medicament for stimulating the development and function of the intestinal barrier. In a related aspect, the invention provides a method for stimulating the development and function of the intestinal barrier in a subject, comprising administering to the subject the nutritional composition of the invention.

[0327] In one aspect, the invention provides the use of miR-3126 for stimulating the development and function of the intestinal barrier. In another aspect, the invention provides the use of a nutritional composition of the invention for stimulating the development and function of the intestinal barrier.

[0328] Subject

[0329] MiR-3126 and / or the nutritional composition of the invention can be administered to any subject in need thereof.

[0330] Preferably, the subject is an infant or young child. More preferably, the subject is an infant. Thus, miR-3126 and / or the nutritional composition of the invention can be administered to an infant.

[0331] The term "infant" refers to a child under 12 months of age. Thus, miR-3126 and / or the nutritional composition of the invention can be administered to an infant, wherein the infant is aged 0-12 months. In one embodiment, the infant is aged 0-6 months.

[0332] In one embodiment, the age of the infant is 2-12 months, preferably 2-6 months.

[0333] In one embodiment, the age of the infant is 3-12 months, preferably 3-6 months.

[0334] Accordingly, in some embodiments, miR-3126 and / or the nutritional composition of the invention is administered to an infant, wherein the infant is 3-6 months of age.

[0335] In some embodiments, the infant or young child is a premature infant or young child. "Preterm" or "preterm" means an infant or young child who was born before term. Essentially, this term refers to an infant or young child born before the 36th week of gestation.

[0336] In some embodiments, the infant or young child was delivered by cesarean section or vaginal delivery.

[0337] How to obtain

[0338] The nutritional composition of the present invention can be prepared by any suitable method known in the art.

[0339] For example, a nutritional composition can be prepared by mixing a protein source, a carbohydrate source, and a fat source in appropriate proportions. Emulsifiers, if used, can be included at this stage. Vitamins and minerals can be added at this stage, but they can also be added later to avoid thermal degradation. Any lipophilic vitamins, emulsifiers, etc., can be dissolved in the fat source before mixing. Water, preferably purified by reverse osmosis, can then be added to form a liquid mixture. The water temperature is conveniently between about 50°C and about 80°C to facilitate dispersion of the ingredients. Commercially available diluents can be used to form the liquid mixture.

[0340] At this stage, siRNA can be added, especially if the final product is to be in liquid form. If the final product is to be in powder form, these components can also be added at this stage, if desired. Alternatively, siRNA can be added later to avoid thermal degradation.

[0341] The liquid mixture can subsequently be homogenized, for example in two stages.

[0342] The liquid mixture can then be thermally treated to reduce the bacterial load by rapidly heating the liquid mixture, for example, to a temperature in the range of about 80°C to about 150°C for a period of about 5 seconds to about 5 minutes. Heating can be accomplished using steam injection, an autoclave, or a heat exchanger, such as a plate heat exchanger.

[0343] The liquid mixture can subsequently be cooled to a temperature of about 60°C to about 85°C, for example, by flash cooling. The liquid mixture can then be homogenized again, for example in two stages under a pressure of about 10 MPa to about 30 MPa in the first stage and about 2 MPa to about 10 MPa in the second stage. The homogenized mixture can then be further cooled to allow the addition of any temperature-sensitive components, such as vitamins and minerals. At this stage, the pH and solids content of the homogenized mixture are conveniently adjusted.

[0344] If the final product is to be a powder, the homogenized mixture is transferred to a suitable drying apparatus, such as a spray dryer or freeze dryer, and converted into a powder. The moisture content of the powder should be less than approximately 5% by weight. Alternatively, siRNA can be added at this stage by dry mixing or stirring and the mixture can be spray dried or freeze dried.

[0345] If ​​a liquid formulation is preferred, the homogenized mixture may be sterilized and then aseptically filled into suitable containers, or may be first filled into containers and then sterilized.

[0346] Examples

[0347] Case 1. Longitudinal profiling and analysis of miRNAs in breast milk

[0348] Sample processing

[0349] Milk samples were collected from 44 individuals at three time points: V2 corresponds to the time point approximately two weeks after birth; V4 corresponds to the time point approximately two months after birth; V5 corresponds to the time point approximately three months after birth.

[0350] Whole milk samples were first thawed on ice. miRNA profiling was performed on the HTG EdgeSeq platform using HTG EdgeSeq whole transcriptome miRNA analysis (HTG Molecular Diagnostics).

[0351] 30 μL of whole milk was added to 30 μL of plasma lysis buffer (1:1 ratio) supplemented with 6 μL of proteinase K (1 / 10). After 3 hours of incubation at 50°C with rotation speed of 600 rpm, 26 μL of the mixture was transferred to the HTG platform for miRNA capture. Specific miRNA target probes were hybridized to their corresponding miRNAs and protected from S1 nuclease digestion. Captured miRNAs were eliminated by basic digestion, and the probes were saved for indexing and sequencing during library preparation.

[0352] After completion of capture, each sample was labeled with sequencing indexes and sample-specific barcodes using a PCR step. The PCR mixture consisted of 15 µl OneTaq® Hot Start 2X Master Mix GC Buffer (NEB), 3 µl of each HTG tag primer (forward and reverse), 3 µl of sample capture, and 6 µl of nuclease-free water. After a 4-min denaturation step at 95°C, 20 PCR cycles were performed consisting of a 15-s denaturation step at 95°C, 45-s annealing step at 56°C, and 45-s extension step at 68°C. The PCR reaction was terminated with a 10-min finish step at 68°C. PCR products were purified with CleanNGS beads (1:8 ratio) on a SciClone NGS workstation (Perkin Elmer) and visualized using the LabChip GX High Sensitivity system (Perkin Elmer) to determine their nucleic acid concentrations.

[0353] Purified PCR products were pooled in 24-sample pools on a robotic liquid handling platform to achieve an equimolar concentration of 2 nM in a final volume of 100 µL. Pools were purified a second time with CleanNGS beads (1:8 ratio) and quantified with Qubit to accurately adjust the final concentration to 2 nM. A 20 pM library labeled with 5% (v / v) PhiX was loaded onto an Illumina MiSeq sequencer. Each pool was sequenced using a MiSeq 150V3 kit.

[0354] The raw sequencing data (referred to as “reads”) were analyzed using HTG software (version 2), and the mapped miRNA reads were further analyzed.

[0355] Data Analysis

[0356] Six samples fell outside the 95% confidence interval ellipse and were therefore considered outliers. Consequently, these samples were excluded from the dataset analysis.

[0357] miRNAs from more than 50 samples with levels below the detection limit were excluded. Before logarithmic transformation (log2), the expression level bias was set to 1. Based on the counts per million (CPM), we estimated the detection limit to be 7 CPM. A total of 685 miRNAs were measured.

[0358] Three analytical approaches were used to analyze the dataset. To optimize the selection of miRNA expression profiles and reduce the number of false positives, the intersections between these three analytical approaches were selected as the best miRNA profiles. These three approaches are described below.

[0359] Longitudinal model with quantile normalization

[0360] In the first approach, the dataset was normalized using the quantile method.

[0361] The dataset was modeled using a linear mixed model. Additionally, to adjust for inter-donor variability at both time points and at baseline, a random effect for donor was added to the model. To adjust for differences in gender profiles observed for some miRNAs at both time points and at baseline, a random effect for gender was added to the model. To adjust for the effect of sequencing run, a random effect for sequencing run was added to the model. Finally, because we performed over 600 tests, a correction for multiple testing was necessary. A typical false discovery rate of 5% was subsequently applied to the results.

[0362] miRNA Экспр. = Time + (Donor) + (Gender) + (Sequencing Run) + Error

[0363] Longitudinal model with TMM normalization

[0364] In the second approach, the dataset was normalized using the TMM method. The dataset was then modeled and tested with the same model as in the first approach.

[0365] Classical differential expression between V5 and V2

[0366] In the third approach, the dataset was normalized using the quantile method but modeled using a simpler generalized linear model. This method does not account for the longitudinal design of the study and the lack of correlation between samples from the same donor.

[0367] miRNA Экспр. = Time + Sequencing Run + Error

[0368] A typical false discovery rate of 5% was subsequently applied to the results.

[0369] Results

[0370] Eleven dynamic miRNAs were identified that either increased or decreased expression during lactation. They are shown below in Tables 1 and 2.

[0371] Thirty-eight miRNAs were identified that demonstrated high and stable expression during lactation. They are shown in Table 3 below.

[0372] Table 1. Seven miRNAs with increased expression during lactation Human miRNA Identifier Human miRNA sequence has-let-7d-3p CUAUACGACCUGCUGCCUUUCU has-miR-196a-5p UAGGUAGUUUCAUGUUGUUGGG has-miR-187-5p GGCUACAACACAGGACCCGGGC has-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC has-miR-92b-5p AGGGACGGGACGCGGUGCAGUG has-miR-3126-5p UGAGGGACAGAUGCCAGAAGCA has-miR-3184-3p AAAGUCUCGCUCUCUGCCCCUCA

[0373] Table 2. Four miRNAs with decreased expression during lactation Human miRNA Identifier Human miRNA sequence has-miR-34a-5p UGGCAGUGUCUUAGCUGGUUGU has-miR-125b-5p UCCCUGAGACCCUAACUUGUGA has-miR-146a-5p UGAGAACUGAAUUCCAUGGGUU has-miR-1307-3p ACUCGGCGUGGCGUCGGUCGUG

[0374] Table 3. Thirty-eight miRNAs with high and stable expression Human miRNA Identifier Human miRNA sequence has-let-7b-5p UGAGGUAGUAGGUUGUGUGGUU has-let-7c-5p UGAGGUAGUAGGUUGUAUGGUU has-miR-19b-3p UGUGCAAAUCCAUGCAAAACUGA has-miR-22-3p AAGCUGCCAGUUGAAGAACUGU has-miR-24-3p UGGCUCAGUUCAGCAGGAACAG has-miR-25-3p CAUUGCACUUGUCUCGGUCUGA has-miR-29a-3p UAGCACCAUCUGAAAUCGGUUA has-miR-30a-5p UGUAAACAUCCUCGACUGGAAG has-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU has-miR-99a-5p AACCCGUAGAUCCGAUCUUGUG has-miR-100-5p AACCCGUAGAUCCGAACUUGUG has-miR-197-3p UUCACCACCUUCUCCACCCAGC has-miR-30d-5p UGUAAACAUCCCCGACUGGAAG has-miR-181a-5p AACAUCACGCUGUGUGAGU has-miR-181b-5p AACAUUGCUGUCGGUGGGU has-miR-205-5p UPCUUCCACCGHOLD has-miR-210-3p CURRYCUTACCGGCUGA has-miR-221-3p HOW TO BECOME has-miR-125b-5p STORAGEWATERSTORAGE has-miR-125a-5p UCCCUGACCCUUUAACCUP has-miR-149-3p AGGGAGGGACGGGGGCUGUGC has-miR-193a-5p UGGCUUUGCGGGCGAGAUGA Has-miR-193a-3p ACUGGCCACAAAGUCCAGU has-miR-320a AAAAGCUGGUGAGAGGGCGA has-miR-200a-3p UAACACUECARE has-miR-99b-5p CACCCWAGAACCCACCUUGCG has-miR-130b-3p CAGUGCAAUGAAAAGGGCAU has-miR-30e-5p UGUAAACAUCCUGACUGGAAG has-miR-375 UUUCUUCCGGCUCCCCUGA has-miR-378a-3p CURRENTCUTAGGC has-miR-151a-3p CHARGGGGG has-miR-425-5p AAUGACACACUCCCUGA has-miR-484 CAGGCCUCCCUCCCCAU has-miR-146b-5p COMMUNITYAUUCCAUAGGCU has-miR-574-5p YOU YOU YOU YOU ARE has-miR-652-3p AAUGGCCACUAGGGUUGUG has-miR-320c AAAAGCUGGGUGAGGGGU has-miR-3141 GAGGGCGGGUGGAGGAGGA

[0375] Example 2. In vitro evaluation of miR-3184, miR-3126 and miR-3141

[0376] Sample processing

[0377] Cell culture and transfection

[0378] Caco2 cells were cultured in DMEM with L-glutamate (+) and pyruvate (-) supplemented with 1X nonessential amino acids, 1 mM sodium pyruvate, and 20% FBS. Cells were split three times a week without detaching cells exceeding 80% confluency. For transfection, cells were seeded in a 24-well plate (50,000 cells / well), reaching 50% confluency the following day. Transfection was performed using DharmaFect 4 reagent from Dharmacon (Cat. No. T-2004-01) according to the manufacturer's recommendations. Briefly, 1.25 µl / well of DharmaFect 4 and a final concentration of 25 nM siRNA were used. At each time point (i.e., 48 h and 72 h post-transfection), the medium was removed, and the cells were washed with 1 ml of cold phosphate-buffered saline (PBS) without calcium chloride and magnesium chloride. After aspiration of the cold PBS, the cells were frozen directly on the plate.

[0379] miRNA was purchased from Dharmacon (Horizon Discovery), see table below.

[0380] Kat. No Name C-301683-00-0020 The human miRIDIAN microRNA, hsa-miR-3141, is a mimic. C-301661-00-0020 Human microRNA miRIDIAN, hsa-miR-3126-5p - mimic. C-302745-00-0020 Human microRNA miRIDIAN, hsa-miR-3184-3p - mimic. C-301151-01-0020 Human microRNA miRIDIAN, hsa-miR-149-3p - mimic. C-301113-01-0020 Human microRNA miRIDIAN, hsa-miR-574-5p - mimic. CN-002000-01-20 Mimic negative control sample No. 2, miRIDIAN microRNA control CP-004000-01-20 Mimic endogenous positive control (miR-122)

[0381] RNA extraction

[0382] RNA was extracted using the QIAymphony robotic station (QIAGEN) and the RNA extraction kit (QIAGEN, cat. no. 931636) according to the CT400 siRNA protocol. Cells were lysed in 420 µl RLT Plus buffer, and RNA was eluted in 100 µl. RNA quality and quantity were assessed using a fragment analyzer and RiboGreen technology, respectively.

[0383] Experimentation and Sequencing with QuantSeq

[0384] The QuantSeq protocol used 50 ng of RNA starting material according to the manufacturer's recommendations (catalog #: 015.384 Lexogen). Libraries were sequenced at 65 bp unpaired ends (SR50) on the Illumina HiSeq 2500 high-throughput system using the SBS V4 kit. Samples were sequenced to a depth of 6-10 million reads.

[0385] Data Analysis

[0386] Prior to normalization and differential expression analysis, gene expression levels were filtered. Genes with reads per million (CPM) lower than 19.89 in at least nine samples were discarded. These genes were considered to have low expression levels and their numbers were below the detection level. Subsequently, gene expression levels for the remaining genes were normalized. Normalization was performed using trimmed weighted averages obtained by the logarithmic expression method (TMM), as described in Robinson and Oshlack, Genome Biology 11, 2010. To estimate differentially expressed genes, samples were grouped by treatment type and time, and expression values ​​were modeled using a negative binomial generalized log-linear quasi-likelihood model for data counts, as described in Lund and Nettleton, Statistical Applications in Genetics and Molecular Biology. 2012. The model parameters were set as follows:

[0387] Exp. gen. = group + batch

[0388] Finally, a multiple testing and significance level cutoff procedure was performed for genetic tests to prevent an increase in the false positive rate due to the multiplication of statistical tests performed.

[0389] Analyzing Biological Functions and Pathways with Ingenuity Pathway Analysis (IPA)

[0390] Functional saturation analysis was performed using the Ingenuity Pathway Analysis (IPA) application. The application examines genes in the dataset known to affect functions or pathways, compares the direction of gene changes with expectations derived from the literature, and then generates a prediction for each function or pathway based on the direction of change. The direction of change represents gene expression in experimental samples relative to control data. If the direction of change is consistent with literature data for the majority of genes, IPA will predict that the function or pathway in the experimental sample will increase. If it is largely inconsistent with literature data, IPA will predict that the function or pathway in the experimental sample will decrease. If no clear pattern related to literature data is identified, IPA will not generate any prediction.

[0391] A z-score algorithm is used to predict IPA. The z-score algorithm is designed to reduce the likelihood that meaningful predictions will be generated based on random data. For a detailed description of the algorithm, see Krämer A. et al., Bioinformatics, 2014.

[0392] Results

[0393] To evaluate the effects of miR-3184-3p, miR-3126-5p and miR-3141 on gene expression, an in vitro Caco2 cell model was used.

[0394] MiR-3184-3p, miR-3126-5p and miR-3141 significantly affected the expression of the genes shown in Table 4 below.

[0395] Table 4. In vitro assessment of miR-3184, miR-3126 and miR-3141 Human miRNA Identifier Log-scale fold change in gene expression levels of miR-treated cells compared to control cells miR-3184-3p Lipin 2 +1.54 IGF2 +1.72 miR-3126-5p Ninein +1.93 Homolog of protein unc-13 D +2.46 Sulfatase 2 +2.29 IL-32 +1.69 OXER1 -2.16 TMEM127 -3.14 Butyrophilin +2.24 ITGA2 +2.57 ITGB1 +1.28 TUBA4A +2.43 TUBB6 +0.91 TUBB2A +2.17 TUBB2B +2.31 miR-3141 Claudin-2 +4.35 SLC2A1 +1.65

[0396] Analysis of differentially expressed genes in the Caco2 model using the Ingenuity Pathway Analysis application, performed according to the procedure described above in this paper, revealed modulation of pathways and biological functions (analysis of biological functions and pathways using the Ingenuity Pathway Analysis (IPA) application). Regarding the modulation of pathways, the analysis results were as follows:

[0397] MiR-3126-5p modulates PI3K / AKT signaling, AHR signaling, and epithelial adherens junction pathway.

[0398] MiR-3141 modulates the TR / RXR pathway and the RXR pathway.

[0399] MiR-3184-3p modulates the antiproliferative role of TOB in T cell signaling.

[0400] All publications cited in the description above are incorporated herein by reference. Various modifications and variations of the described methods, cells, compositions, and uses of the invention will be apparent to those skilled in the art without departing from the spirit and scope of the invention. Although the invention has been described in terms of specific preferred embodiments, it should be understood that the claimed invention should not be unduly limited to such specific embodiments. In fact, it is intended that the scope of the following claims include various modifications of the described embodiments of the invention that are apparent to those skilled in the art.

[0401] --->

[0402] SEQUENCE LISTING

[0403] <110> Société des Produits Nestlé SA

[0404] <120> Nutritional composition

[0405] <130> 16660-EP-EPA

[0406] <160> 90

[0407] <170> BiSSAP 1.3.6

[0408] <210> 1

[0409] <211> 74

[0410] <212> RNA

[0411] <213> Homo sapiens

[0412] <400> 1

[0413] augauuauau gagggacaga ugccagaagc acugguuaug auuugcaucu ggcauccguc 60

[0414] acacagauaa uauau 74

[0415] <210> 2

[0416] <211> 22

[0417] <212> RNA

[0418] <213> Homo sapiens

[0419] <400> 2

[0420] ugagggacag augccagaag ca 22

[0421] <210> 3

[0422] <211> 22

[0423] <212> RNA

[0424] <213> Homo sapiens

[0425] <400> 3

[0426] caucuggcau ccgucacaca ga 22

[0427] <210> 4

[0428] <211> 22

[0429] <212> RNA

[0430] <213> Homo sapiens

[0431] <220>

[0432] <223> letter

[0433] <400> 4

[0434] ugagguagua gguugugugg uu 22

[0435] <210> 5

[0436] <211> 22

[0437] <212> RNA

[0438] <213> Homo sapiens

[0439] <220>

[0440] <223> let

[0441] <400> 5

[0442] Ugagguagua GUGUAUG O 22

[0443] <210> 6

[0444] <211> 23

[0445] <212> RNA

[0446] <213> Homo sapiens

[0447] <400> 6

[0448] Lift Lift Lift Lift 23

[0449] <210> 7

[0450] <211> 22

[0451] <212> RNA

[0452] <213> Homo sapiens

[0453] <400> 7

[0454] Aagcugccag uugagaacu 22

[0455] <210> 8

[0456] <211> 22

[0457] <212> RNA

[0458] <213> Homo sapiens

[0459] <400> 8

[0460] Uggcucaguu Chain Ag 22

[0461] <210> 9

[0462] <211> 22

[0463] <212> RNA

[0464] <213> Homo sapiens

[0465] <400> 9

[0466] cauugcacuu gucucggucu ga 22

[0467] <210> 10

[0468] <211> 22

[0469] <212> RNA

[0470] <213> Homo sapiens

[0471] <400> 10

[0472] uagcaccauc ugaaaucggu ua 22

[0473] <210> 11

[0474] <211> 22

[0475] <212> RNA

[0476] <213> Homo sapiens

[0477] <400> 11

[0478] uguaaacauc cucgacugga ag 22

[0479] <210> 12

[0480] <211> 22

[0481] <212> RNA

[0482] <213> Homo sapiens

[0483] <400> 12

[0484] uauugcacuu gucccggccu gu 22

[0485] <210> 13

[0486] <211> 22

[0487] <212> RNA

[0488] <213> Homo sapiens

[0489] <400> 13

[0490] aacccguaga uccgaucuug ug 22

[0491] <210> 14

[0492] <211> 22

[0493] <212> RNA

[0494] <213> Homo sapiens

[0495] <400> 14

[0496] aacccguaga uccgaacuug ug 22

[0497] <210> 15

[0498] <211> 22

[0499] <212> RNA

[0500] <213> Homo sapiens

[0501] <400> 15

[0502] uucaccaccu ucuccaccu gc 22

[0503] <210> 16

[0504] <211> 22

[0505] <212> RNA

[0506] <213> Homo sapiens

[0507] <400> 16

[0508] uguaaacauc cccgacugga ag 22

[0509] <210> 17

[0510] <211> 23

[0511] <212> RNA

[0512] <213> Homo sapiens

[0513] <400> 17

[0514] aacauucaac gcugucggug Aug 23

[0515] <210> 18

[0516] <211> 23

[0517] <212> RNA

[0518] <213> Homo sapiens

[0519] <400> 18

[0520] aacauucauu gcugucggug ggu 23

[0521] <210> 19

[0522] <211> 22

[0523] <212> RNA

[0524] <213> Homo sapiens

[0525] <400> 19

[0526] uccuucauuc caccggaguc ug 22

[0527] <210> 20

[0528] <211> 22

[0529] <212> RNA

[0530] <213> Homo sapiens

[0531] <400> 20

[0532] cugugcgugu gagcggcu ga 22

[0533] <210> 21

[0534] <211> 23

[0535] <212> RNA

[0536] <213> Homo sapiens

[0537] <400> 21

[0538] Agcuacauug ucugcugggu uuc 23

[0539] <210> 22

[0540] <211> 22

[0541] <212> RNA

[0542] <213> Homo sapiens

[0543] <400> 22

[0544] ucccugagac ccuacuugu ga 22

[0545] <210> 23

[0546] <211> 24

[0547] <212> RNA

[0548] <213> Homo sapiens

[0549] <400> 23

[0550] ucccugagac ccuuuaaccu guga 24

[0551] <210> 24

[0552] <211> 21

[0553] <212> RNA

[0554] <213> Homo sapiens

[0555] <400> 24

[0556] Agggaggac gggggcugug c 21

[0557] <210> 25

[0558] <211> 22

[0559] <212> RNA

[0560] <213> Homo sapiens

[0561] <400> 25

[0562] ugggucuuug cggggcgagau ga 22

[0563] <210> 26

[0564] <211> 22

[0565] <212> RNA

[0566] <213> Homo sapiens

[0567] <400> 26

[0568] aacuggccua caaaguccca gu 22

[0569] <210> 27

[0570] <211> 22

[0571] <212> RNA

[0572] <213> Homo sapiens

[0573] <400> 27

[0574] aaaagcuggg uugagagggc ga 22

[0575] <210> 28

[0576] <211> 22

[0577] <212> RNA

[0578] <213> Homo sapiens

[0579] <400> 28

[0580] uaacacuguc ugguaacgau gu 22

[0581] <210> 29

[0582] <211> 22

[0583] <212> RNA

[0584] <213> Homo sapiens

[0585] <400> 29

[0586] cacccguaga accgaccuug cg 22

[0587] <210> 30

[0588] <211> 22

[0589] <212> RNA

[0590] <213> Homo sapiens

[0591] <400> 30

[0592] cagugcaaug augaaagggc au 22

[0593] <210> 31

[0594] <211> 22

[0595] <212> RNA

[0596] <213> Homo sapiens

[0597] <400> 31

[0598] uguaaacauc cuugacugga ag 22

[0599] <210> 32

[0600] <211> 22

[0601] <212> RNA

[0602] <213> Homo sapiens

[0603] <400> 32

[0604] uuuguucguu cggcucgcgu ga 22

[0605] <210> 33

[0606] <211> 22

[0607] <212> RNA

[0608] <213> Homo sapiens

[0609] <400> 33

[0610] acuggacuug gagucagaag gc 22

[0611] <210> 34

[0612] <211> 21

[0613] <212> RNA

[0614] <213> Homo sapiens

[0615] <400> 34

[0616] cuagacugaa gcuccuugag g 21

[0617] <210> 35

[0618] <211> 23

[0619] <212> RNA

[0620] <213> Homo sapiens

[0621] <400> 35

[0622] aaugacacga ucacucccgu uga 23

[0623] <210> 36

[0624] <211> 22

[0625] <212> RNA

[0626] <213> Homo sapiens

[0627] <400> 36

[0628] ucaggcucag uccccuccccg au 22

[0629] <210> 37

[0630] <211> 22

[0631] <212> RNA

[0632] <213> Homo sapiens

[0633] <400> 37

[0634] Ugagacuga Auccauagg Cu 22

[0635] <210> 38

[0636] <211> 23

[0637] <212> RNA

[0638] <213> Homo sapiens

[0639] <400> 38

[0640] Grow Gog Gog 23

[0641] <210> 39

[0642] <211> 21

[0643] <212> RNA

[0644] <213> Homo sapiens

[0645] <400> 39

[0646] aauggcgcca summer g 21

[0647] <210> 40

[0648] <211> 20

[0649] <212> RNA

[0650] <213> Homo sapiens

[0651] <400> 40

[0652] aaaagcugggg ugagagggu 20

[0653] <210> 41

[0654] <211> 19

[0655] <212> RNA

[0656] <213> Homo sapiens

[0657] <400> 41

[0658] gagggcgggu ggggagga 19

[0659] <210> 42

[0660] <211> 17

[0661] <212> RNA

[0662] <213> Homo sapiens

[0663] <400> 42

[0664] gaggcugagc ugaggag 17

[0665] <210> 43

[0666] <211> 22

[0667] <212> RNA

[0668] <213> Homo sapiens

[0669] <400> 43

[0670] cuauacgacc ugcugccuuu cu 22

[0671] <210> 44

[0672] <211> 22

[0673] <212> RNA

[0674] <213> Homo sapiens

[0675] <400> 44

[0676] uagguaguuu cauguuguug gg 22

[0677] <210> 45

[0678] <211> 22

[0679] <212> RNA

[0680] <213> Homo sapiens

[0681] <400> 45

[0682] ggcuacaaca caggacccgg gc 22

[0683] <210> 46

[0684] <211> 23

[0685] <212> RNA

[0686] <213> Homo sapiens

[0687] <400> 46

[0688] uucucgagga aagaagcacu uuc 23

[0689] <210> 47

[0690] <211> 22

[0691] <212> RNA

[0692] <213> Homo sapiens

[0693] <400> 47

[0694] agggacggga cgcggugcag and 22

[0695] <210> 48

[0696] <211> 23

[0697] <212> RNA

[0698] <213> Homo sapiens

[0699] <400> 48

[0700] aaagucucgc ucucugcccc uca 23

[0701] <210> 49

[0702] <211> 22

[0703] <212> RNA

[0704] <213> Taurus boss

[0705] <220>

[0706] <223> letter

[0707] <400> 49

[0708] ugagguagua gguugugugg uu 22

[0709] <210> 50

[0710] <211> 22

[0711] <212> RNA

[0712] <213> Taurus boss

[0713] <220>

[0714] <223> letter

[0715] <400> 50

[0716] ugagguagua gguuguaugg uu 22

[0717] <210> 51

[0718] <211> 23

[0719] <212> RNA

[0720] <213> Taurus boss

[0721] <400> 51

[0722] Lift Lift Lift Lift 23

[0723] <210> 52

[0724] <211> 21

[0725] <212> RNA

[0726] <213> Taurus boss

[0727] <400> 52

[0728] aagcugccag uugagaacu g 21

[0729] <210> 53

[0730] <211> 22

[0731] <212> RNA

[0732] <213> Taurus boss

[0733] <400> 53

[0734] Uggcucaguu Chain Ag 22

[0735] <210> 54

[0736] <211> 22

[0737] <212> RNA

[0738] <213> Taurus boss

[0739] <400> 54

[0740] cauugcacuu gucucggucu ga 22

[0741] <210> 55

[0742] <211> 23

[0743] <212> RNA

[0744] <213> Taurus boss

[0745] <400> 55

[0746] Cuagcaccau Cugaaucgg Uua 23

[0747] <210> 56

[0748] <211> 24

[0749] <212> RNA

[0750] <213> Taurus boss

[0751] <400> 56

[0752] uguaacauc neighborhood agcu 24

[0753] <210> 57

[0754] <211> 22

[0755] <212> RNA

[0756] <213> Taurus boss

[0757] <400> 57

[0758] uauugcacuu gucccggccu the 22nd

[0759] <210> 58

[0760] <211> 21

[0761] <212> RNA

[0762] <213> Taurus boss

[0763] <400> 58

[0764] aacccguaga uccgaucuug u 21

[0765] <210> 59

[0766] <211> 22

[0767] <212> RNA

[0768] <213> Taurus boss

[0769] <400> 59

[0770] aacccguaga uccgacuug ug 22

[0771] <210> 60

[0772] <211> 22

[0773] <212> RNA

[0774] <213> Taurus boss

[0775] <400> 60

[0776] uucaccaccu ucuccacca gc 22

[0777] <210> 61

[0778] <211> 24

[0779] <212> RNA

[0780] <213> Taurus boss

[0781] <400> 61

[0782] uguaacauc cccgacugga agcu 24

[0783] <210> 62

[0784] <211> 24

[0785] <212> RNA

[0786] <213> Taurus boss

[0787] <400> 62

[0788] aacauucaac gcugucggug Aug 24

[0789] <210> 63

[0790] <211> 24

[0791] <212> RNA

[0792] <213> Taurus boss

[0793] <400> 63

[0794] aacauucauu gcugucggug year 24

[0795] <210> 64

[0796] <211> 22

[0797] <212> RNA

[0798] <213> Taurus boss

[0799] <400> 64

[0800] Uccuucauuc Caccggaguc UG 22

[0801] <210> 65

[0802] <211> 23

[0803] <212> RNA

[0804] <213> Taurus boss

[0805] <400> 65

[0806] acugugcgug ugacagcggc uga 23

[0807] <210> 66

[0808] <211> 22

[0809] <212> RNA

[0810] <213> Taurus boss

[0811] <400> 66

[0812] Agcuacauug ucugcugggu uu 22

[0813] <210> 67

[0814] <211> 22

[0815] <212> RNA

[0816] <213> Taurus boss

[0817] <400> 67

[0818] ucccugagac ccuacuugu ga 22

[0819] <210> 68

[0820] <211> 23

[0821] <212> RNA

[0822] <213> Taurus boss

[0823] <400> 68

[0824] ucccugagac ccuuuaaccu gug 23

[0825] <210> 69

[0826] <211> 22

[0827] <212> RNA

[0828] <213> Taurus boss

[0829] <400> 69

[0830] Gaggaggga cggggcugu gc 22

[0831] <210> 70

[0832] <211> 22

[0833] <212> RNA

[0834] <213> Taurus boss

[0835] <400> 70

[0836] ugggucuuug cggggcgagau ga 22

[0837] <210> 71

[0838] <211> 22

[0839] <212> RNA

[0840] <213> Taurus boss

[0841] <400> 71

[0842] Episode 22

[0843] <210> 72

[0844] <211> 22

[0845] <212> RNA

[0846] <213> Taurus boss

[0847] <400> 72

[0848] aaaagcuggg uugagaggggc ga 22

[0849] <210> 73

[0850] <211> 23

[0851] <212> RNA

[0852] <213> Taurus boss

[0853] <400> 73

[0854] uaacacuguc ugguaacgau guu 23

[0855] <210> 74

[0856] <211> 22

[0857] <212> RNA

[0858] <213> Taurus boss

[0859] <400> 74

[0860] caccguaga accgaccuug cg 22

[0861] <210> 75

[0862] <211> 22

[0863] <212> RNA

[0864] <213> Taurus boss

[0865] <400> 75

[0866] cagugcaaug augaaagggc au 22

[0867] <210> 76

[0868] <211> 24

[0869] <212> RNA

[0870] <213> Taurus boss

[0871] <400> 76

[0872] uguaaacauc cuugacugga agcu 24

[0873] <210> 77

[0874] <211> 23

[0875] <212> RNA

[0876] <213> Taurus boss

[0877] <400> 77

[0878] uuuuguucgu ucggcucgcg uga 23

[0879] <210> 78

[0880] <211> 22

[0881] <212> RNA

[0882] <213> Taurus boss

[0883] <400> 78

[0884] Accumulator Gaucagagag GC 22

[0885] <210> 79

[0886] <211> 21

[0887] <212> RNA

[0888] <213> Taurus boss

[0889] <400> 79

[0890] cuagacugaa gcuccuugag g 21

[0891] <210> 80

[0892] <211> 22

[0893] <212> RNA

[0894] <213> Taurus boss

[0895] <400> 80

[0896] 22

[0897] <210> 81

[0898] <211> 22

[0899] <212> RNA

[0900] <213> Taurus boss

[0901] <400> 81

[0902] ucaggcucag uccccuccccg au 22

[0903] <210> 82

[0904] <211> 24

[0905] <212> RNA

[0906] <213> Taurus boss

[0907] <400> 82

[0908] Ugagacuga Auuccauagg Cugue 24

[0909] <210> 83

[0910] <211> 24

[0911] <212> RNA

[0912] <213> Taurus boss

[0913] <400> 83

[0914] GagogogogoGgogoGGGG 24

[0915] <210> 84

[0916] <211> 21

[0917] <212> RNA

[0918] <213> Taurus boss

[0919] <400> 84

[0920] aauggcgcca summer g 21

[0921] <210> 85

[0922] <211> 20

[0923] <212> RNA

[0924] <213> Taurus boss

[0925] <400> 85

[0926] Voltage vibration 20

[0927] <210> 86

[0928] <211> 18

[0929] <212> RNA

[0930] <213> Taurus boss

[0931] <400> 86

[0932] Gagggggggggggg 18

[0933] <210> 87

[0934] <211> 22

[0935] <212> RNA

[0936] <213> Taurus boss

[0937] <220>

[0938] <223> let

[0939] <400> 87

[0940] Agagguagua Gugcauag O 22

[0941] <210> 88

[0942] <211> 22

[0943] <212> RNA

[0944] <213> Taurus boss

[0945] <400> 88

[0946] Waggugou Cauguuguug Year 22

[0947] <210> 89

[0948] <211> 22

[0949] <212> RNA

[0950] <213> Taurus boss

[0951] <400> 89

[0952] Stick Stirring cc gg 22

[0953] <210> 90

[0954] <211> 22

[0955] <212> RNA

[0956] <213> Taurus boss

[0957] <400> 90

[0958] uauugcacuc gucccggccu cc 22

[0959] <---

Claims

1. A nutritional composition for feeding a subject, comprising miR-3126-5p, wherein miR-3126-5p is present in the composition at a concentration of 0.1-10000 pmol / L, 0.1-1000 pmol / L, 1-1000 pmol / L, 10-1000 pmol / L or 100-1000 pmol / L, wherein said nutritional composition is an infant formula, fortifier or supplement.

2. The nutritional composition according to claim 1, which is an infant formula.

3. The nutritional composition according to claim 1 or 2, comprising one or more additional microRNAs selected from the list consisting of: let-7b, let-7c, miR-19b, miR-22, miR-24, miR-25, miR-29a, miR-30a, miR-92a, miR-99a, miR-100, miR-197, miR-30d, miR-181a, miR-181b, miR-205, miR-210, miR-221, miR-125b, miR-125a, miR-149, miR-193a, miR-320a, miR-200a, miR-99b, miR-130b, miR-30e, miR-375, miR-378a, miR-151a, miR-425, miR-484, miR-146b, miR-574, miR-652, miR-320c, miR-3141, let-7d, miR-196a, miR-187, miR-516a, miR-92b and miR-3184.

4. The nutritional composition according to any one of claims 1-3, containing one or more additional microRNAs selected from the list consisting of: let-7d, miR-196a, miR-187, miR-516a, miR-92b and miR-3184.

5. The nutritional composition according to any one of claims 1-4, further comprising miR-3141 and / or miR-3184.

6. Use of a nutritional composition according to any one of claims 1-5 for protecting the health of the gastrointestinal tract in a subject and / or promoting the development and function of the intestinal barrier in a subject.

7. A method for protecting gastrointestinal health in a subject and / or promoting the development and function of the intestinal barrier in a subject, comprising administering to the subject a nutritional composition according to any one of claims 1-5, thereby using MiR-3126-5p to protect gastrointestinal health in the subject.

8. Use of miR-3126-5p to protect gastrointestinal health in a subject and / or promote intestinal barrier development and function in a subject.

9. The use according to claim 8, wherein miR-3126-5p is in the nutritional composition according to any one of claims 1-5.

10. The nutritional composition of any one of claims 1-5, the use of claims 6, 8 or 9 or the method of claim 7, wherein the subject is an infant, preferably an infant aged 0-12 months, 2-12 months, 3-12 months, 0-6 months, 2-6 months or 3-6 months.