Method for high-precision editing of mammalian genomes using modified spcas9 nuclease that suppresses non-homologous DNA end joining

Abstract

FIELD: biotechnology.SUBSTANCE: method for producing a mutant Cas9 nuclease containing the amino acid substitutions D147Y, P411T, F539S, M763I, K890N, L1206P, as well as the insert 538A, introduced into the sequence of the wild-type SpCas9 nuclease. The said method includes creating a vector expressing the said mutant Cas9 nuclease in mammalian cells, transfecting the said vector and DNA oligonucleotides containing sequences for homologous recombination into a cell line, assessing the transfection based on the level of mScarlet fluorescence, and confirming the functional activity of the resulting nuclease in cell culture.EFFECT: obtaining a functionally active mutant Cas9 nuclease.1 cl, 6 dwg, 3 ex

Description

[0001] Field of technology to which the invention relates

[0002] The present invention relates to the fields of molecular biology and biotechnology, and in particular to genome editing methods. The SpCas9 nuclease is an important tool used in genome editing. Its modification, DoctorCas9, which suppresses non-homologous DNA end joining during double-strand break repair, is the subject of the invention.

[0003] Technology Level

[0004] Genome editing using the CRJSPR / Cas9 system is an important tool in biotechnology. Several systems are known for genome editing. The first such system used the homing endonuclease I-Scel to induce a double-strand break (DSB) at a unique position, which allows for sequence modification during homologous recombination (HR) (Rouet P, Smih F, Jasin M. Expression of a site-specific endonuclease stimulates homologous recombination in mammalian cells. Proc Natl Acad Sci USA. 1994 Jun 21;91(13):6064-8. doi: 10.1073 / pnas.91.13.6064). Later, genome editing was carried out using viruses. Cells obtained from the patient were isolated and transduced with a recombinant viral vector, in the genome of which the natural viral genetic elements were replaced by an expression cassette encoding a normal gene, replacing the damaged one in the patient's cells.By integrating the viral genome into the host genome, the normal gene is expressed, and the modified cells are then transplanted back into the patient. Although this approach has proven successful for treating multiple immunodeficiencies, it relies on integrating the viral vector into a random location in the host cell's genome. This approach has significant safety limitations for patients, as integration into potentially dangerous regions, such as oncogenes, can lead to uncontrolled proliferation of the modified cells and, in the long term, lead to cancer development.

[0005] In the last decade, methods for precisely modifying a patient's own cells without the use of random integration of viral vectors have become increasingly common. Precise genome modification involves both the integration of a gene expression cassette into a specific, safe location in the target genome and the precise replacement of a disease-causing mutation with a normal sequence. Both approaches are based on the delivery of an exogenous DNA fragment (the so-called donor DNA) homologous to the target and containing either the expression cassette to be integrated or the normal gene sequence to correct the underlying mutation. In recent years, considerable effort has been made to optimize platforms for creating DSBs at precise positions in the genome, resulting in approaches using zinc finger nucleases (ZFNs), TALEN nucleases - transcription activator-like effectors; nucleases of the CRISPR / Cas system - RNA-guided nucleases (RGN) (Beumer KJ, Carroll D.Targeted genome engineering techniques in Drosophila. Methods. 2014 Jun 15;68(l):29-37. doi: 10.1016 / j.ymeth.2013.12.002).

[0006] Repair of targeted DNA damage can occur either through non-homologous end joining (NHEJ) or homologous recombination (HR), also known as homology-directed repair (HDR). For many applications, such as genome editing, it is important to use HDR over NHEJ, as HDR ensures the transfer of genetic information from exogenous DNA to a precise location in the genome, rather than simply disrupting a gene, as is typically the case with NHEJ. However, there is competition between these two repair pathways during genome editing, resulting in homologous recombination (HDR) being much less efficient than NHEJ. Attempts to block NHEJ genetically or with protein and / or chemical inhibitors partially shift the balance in favor of HDR, but may lead to the risk of unwanted genomic instability.For example, NHEJ can be suppressed by inactivating the activity of the Ku70 / 80 protein complex (the product of the XRCC6 gene) (Gandia M, Xu S, Font C, Marcos JF. Disruption of ku70 involved in non-homologous end-joining facilitates homologous recombination but increases temperature sensitivity in the phytopathogenic fungus Penicillium digitatum. Fungal Biol. 2016 Mar; 120(3):317-23. doi: 10.1016 / j.funbio.2015.11.001). In another study, NHEJ levels were reduced by using mutant cells lacking DNA ligase IV, an important enzyme in the NHEJ pathway. Loss of DNA ligase IV results in a significant increase in HDR compared to NHEJ in Drosophila (Beumer KJ, Trautman JK, Bozas A, Liu JL, Rutter J, Gall JG, Carroll D. Efficient gene targeting in Drosophila by direct embryo injection with zinc-finger nucleases. Proc Natl Acad Sci USA. 2008 Dec 16;105(50):19821-6. doi: 10.1073 / pnas.0810475105). However, most protocols fail to inactivate the gene encoding DNA ligase IV.

[0007] Alternative methods for increasing HDR rates have also been described in numerous publications. For example, Han Yang (Han Yang, Shuling Ren, Siyuan Yu, Haifeng Pan, Tingdong Li, Shengxiang Ge, Jun Zhang, and Ningshao Xia. Methods favoring homology-directed repair choice in response to CRISPR / Cas9-induced double-strand breaks. Int. J. Mol. Sci. 2020, 21, 6461; doi:10.3390 / ijms21186461) indicates that strategies such as cell cycle control and Cas9 expression, cell cycle disruption, cold shock, and nuclease binding of the donor DNA template for repair, modestly improve HDR rates. However, despite these modifications to genome editing systems, NHEJ remains the predominant DSB repair pathway. Thus, one of the key challenges of genome editing by the CRISPR / Cas9 system via the HDR pathway is the downregulation of the competing NHEJ pathway.

[0008] Another approach to increase HDR efficiency and reduce NHEJ is to modify the main enzyme in the CRISPR / Cas9 system, Cas9 nuclease. In the work of Charpentier M, Khedher AHY, Menoret S, Brion A, Lambrit K, Dardillac E, Boix C, Perrouault L, Tesson L, Geny S, De Cian A, Itier JM, Anegon I, Lopez B, Giovannangeli C, Concordet JP. CtIP fusion to Cas9 enhances transgene integration by homology-dependent repair. Nat Commun. 2018;9(1):1133. doi: 10.1038 / s41467-018-03475-7) the creation of a chimeric molecule containing CtIP, a key protein in the early stages of homologous recombination, with Cas9 to enhance HDR is described. The authors showed that due to the use of this chimeric protein, a two-fold increase in HDR occurs. In patent EP 3592852 A1 (EP 3592852 A1, European Patent Office, 2020-01-15, Ignacio Anegon, Marine Charpentier, Jean-Paul Concordet, Carine Giovannangeli, Bernard Lopez.Nuclease fusions for enhancing genome editing by homology-directed transgene integration) present data showing that the rate of HDR mediated by the CRISPR / Cas9 system can be significantly improved by using a chimeric Cas9 nuclease with an N-terminal domain of the CtIP protein. Patent EP 3730610 A1 (EP 3730610 A1, European Patent Office, 2020-10-28, Claudio Mussolino, Toni Cathomen, Tatjana Cornu, Antonio Carusillo. Modified Cas9 system and its use for improved gene editing) describes the HDR-CRISPR platform. This platform refers to a modified Cas9 nuclease containing a significant portion of the Cas9 nuclease and covalently linked proteins RAD51, RAD52, RAD54, MRE11, PALB2, FANCD2, and EX01. This patent also describes chimeras of Cas9 nuclease with one or more proteins or protein domains involved in HDR.

[0009] Using directed evolution, mutant forms of SpCas9 with increased specificity were obtained: SpartaCas (D23A, T67L, Y128V and D1251G) (patent CN 110997908 A, China, 2020-04-10, Engineered CAS9 nucleases), HiFi Cas9 (R691A) (patent JP 2023002712 A, Japan, 2023-01-10, S. pyogenes cas9 mutant genes and polypeptides encoded by the same), evoCas9 (M495V, Y515N, K526E, R661Q) (patent WO 2018149888 A1, WIPO (PCT), 2018-08-23, Anna Cereseto, Antonio Casini, Gianluca Petris, Alberto Inga, Michele Olivieri. High-fidelity Cas9 variants and applications thereof), as well as those with enhanced ability to hydrolyze DNA within chromatin (iCas9) (Bao Z, Xiao H, Liang J, Zhang L, Xiong X, Sun N, Si T, Zhao H. Homology-integrated CRISPR-Cas (HI-CRISPR) system for one-step multigene disruption in Saccharomyces cerevisiae. ACS Synth. Biol. 2015; 4(5):585-94. doi: 10.1021 / sb500255k).Patent US 20230130858 A1 (US 20230130858 A1, United States, 2023-04-27, Young-Hoon Kim, Min Hee JUNG, Joonsun LEE, Eunji Shin, Kang In LEE, Seokjoong Kim, JeongJoon LEE. Target-specific crispr mutant) describes an artificially engineered CRISPR enzyme that exhibits higher target specificity. The SpCas9 variant has one or more amino acid substitutions at positions: A203D, N277H, G366S, F539S, 1601N, M763I, K890N, D965Y, F1038Y, T1 102P, and D1 127E. A protein with mutations at positions F539S, M763I, and K890N is called Sniper-Cas9. US11377645B2 (US11377645B2, United States, 2022-07-05, Luciano Marraffini, Robert Heller, David Bikard. Compositions and methods using Cas9 with enhanced spacer acquisition function) describes mutant Cas9 proteins that exhibit either an increased rate of spacer acquisition or increased target cleavage efficiency. Mutated SpCas9 proteins contain amino acid substitutions at positions 1473 (HyperCas9) and / or K500.

[0010] Thus, at present, there are a large number of patents and papers devoted to the optimization of the CRISPR / Cas9 editing system to improve the editing precision and HDR level, but despite this, the creation of an effective CRISPR / Cas9 system that can increase the HDR level and reduce the NHEJ pathway remains an urgent task.

[0011] Disclosure of the essence of the invention

[0012] The technical result of the invention is the creation of a method for high-precision editing of mammalian genomes, which consists of suppressing NHEJ using the Cas9 nuclease DoctorCas9, which is a modification of the nuclease SpCas9, as well as confirming the functional activity of the Cas9 nuclease DoctorCas9 in cell culture both during infection of cells with viruses and non-viral transfection.

[0013] The first aspect of the invention is the creation of a vector for expressing the mutant Cas9 nuclease DoctorCas9 in mammalian cells by introducing point mutations into the wild-type SpCas9 nuclease sequence and adding a nucleotide sequence encoding mScarlet, linked to the sequence encoding the nuclease via a T2A peptide.

[0014] The next aspect of the invention is transfection with a vector expressing the mutant DoctorCas9 protein and a DNA oligonucleotide containing a sequence for homologous recombination into a HEK293 cell culture line stably transfected with the eGFP-N1 vector (encodes the green fluorescent protein GFP gene) and evaluation of the transfection by the level of mScarlet fluorescence.

[0015] Another aspect of the invention is to prove the functional activity of the obtained mutant Cas9 nuclease DoctorCas9, based on determining the levels of non-homologous DNA end joining and homologous recombination during editing of the GFP gene.

[0016] In one embodiment, the invention relates to a mutant DoctorCas9 protein containing the amino acid substitutions D147Y, P411T, F539S, M763I, K890N, L1206P, ins538A.

[0017] Another embodiment of the invention relates to the creation of a nucleic acid vector for expressing a recombinant DoctorCas9 nuclease protein, as described herein.

[0018] Another embodiment of the invention is a modification of a kit for editing the genome of at least one target cell, comprising:

[0019] - one or more site-specific guide RNAs (gRNAs) or a nucleic acid vector for expressing one or more site-specific guide RNAs (gRNAs).

[0020] - mutant DNA nuclease Cas9, or a nucleic acid vector for expressing mutant DNA nuclease.

[0021] Brief description of figures and tables

[0022] Fig. 1. General scheme of high-precision genome editing using mutant DoctorCas9 protein in HEKGFP cell culture.

[0023] Fig. 2. Schematics of constructs obtained by introducing sequential mutations into the px458-mScarlet plasmid vector. The resulting vector was used to express the mutant DoctorCas9 protein in HEK GFP cell culture.

[0024] Fig. 3. Transfection efficiency of HEK cell culture with GFP plasmid carrying the sequence encoding the mutant Cas9-mScarlet protein.

[0025] Fig. 4. An example of GFP gene editing by the mutant DoctorCas9 protein in a HEK GFP cell culture. During HDR, editing of the GFP gene converts it to BFP.

[0026] Fig. 5. Determination of the functional activity of the mutant form of Cas9 nuclease DoctorCas9 in the HEK GFP cell culture using flow cytometry. (A) The level of NHEJ during genome editing of wild-type Cas9 and mutant form of DoctorCas9. (B) The level of HDR during genome editing of wild-type Cas9 and mutant form of DoctorCas9.

[0027] Fig. 6. Confirmation of the non-homologous end joining suppression function of the mutant form of DoctorCas9.

[0028] Implementation of the invention

[0029] The present invention provides a method for editing mammalian genomes using the mutant Cas9 nuclease DoctorCas9, in which the previously published amino acid substitutions D147Y, P411T, F539S, M763I, K890N are combined with new substitutions L1206P, ins538A, and also provides methods for using it to edit mammalian genomes in cell cultures.

[0030] Standard molecular cloning methods were used to create the expression vector. The target vector was constructed using the px458 vector (Addgene#48138) and a set of oligonucleotide primers using Q5 polymerase. The resulting genetic construct contained all the necessary coding sequences. A diagram of this genetic construct is shown in Fig. 2.

[0031] Next, a HEKGFP cell culture stably expressing green fluorescent protein is transfected with the resulting expression vectors (Fig. 1) and a DNA oligonucleotide containing the desired substitutions. Cells were transfected with Lipofectamin 3000 according to the manufacturer's instructions. Transfection levels were analyzed using the fluorescence of the mScarlet protein, incorporated into the expression vector via the T2A peptide. The mScarlet fluorescent protein is used due to its following properties: no overlap between its fluorescence peaks and those of the GFP and BFP proteins, which are used to assess HDR and NHEJ levels. This protein also exhibits sufficient fluorescence for reliable detection when assessing transfection levels.

[0032] The transfection result is shown in Fig. 3, which shows that the transfection level of HEK GFP cell culture with the obtained vectors reaches a high level.

[0033] Confirmation of the functional activity of the Cas9 nuclease DoctorCas9 was assessed by genome editing. A previously published system (Glaser A, McColl B, Vadolas J. GFP to BFP Conversion: A Versatile Assay for the Quantification of CRISPR / Cas9-mediated Genome Editing. Mol Ther Nucleic Acids. 2016 Jul 12;5(7):e334, DOI:https: / / doi.org / 10.1038 / mtna.2016.48) was used as a genome editing model. This system is based on a cell line stably expressing the GFP protein, in which a genetic insert was edited to replace two amino acids in the DNA sequence. This substitution converts the fluorescence of the green fluorescent protein to the blue spectrum. The percentage of non-homologous DNA end joining (NHEJ) is estimated by the number of cells with a lost green GFP fluorescence signal as a result of a frameshift during the formation of point deletions and insertions in the region of a double-stranded DNA break.The percentage of homologous recombination (HDR) was assessed by flow cytometry using a BD LSR Fortessa™ cytometer based on the conversion of green fluorescence in cells to blue, which corresponds to the HDR process with two amino acid substitutions. The editing results are shown in Fig. 4 and Fig. 5, demonstrating that DoctorCas9 promotes efficient homologous recombination and suppresses nonhomologous end joining.

[0034] The efficiency of genome editing was also assessed in an infected cell culture. It is known that inactivation of both alleles of the receptor gene used by the virus to enter the cell leads to resistance and, consequently, cell survival during viral infection. Therefore, a model of viral infection of cells can be used to determine the efficiency of genome editing. Accurate assessment of genome editing efficiency is only possible in a well-transfected cell model with homogeneous sensitivity to the viral strains used. A transfection-competent clone of the HEK293T line with a deletion of the interferon receptor type 1 (IFNAR1) gene was obtained in the cell proliferation laboratory. This line will be referred to as Lucky. This line efficiently replicates most non-pathogenic enterovirus strains and is also effectively transfected by any method.

[0035] To analyze the effectiveness of NHEJ, three target genes were selected encoding receptors that, when inactivated, provide complete resistance of cells to infection by the corresponding virus strains:

[0036] 1) PVR / CD155 - poliovirus receptor - poliovirus vaccine type 1 Sabin -19q13.31

[0037] 2) CXADR - Coxsackie virus and adenovirus receptor - Coxsackie virus BB-Schmitt -21q21.1

[0038] 3) SCARB2 - Coxsackievirus A7 - live enterovirus vaccine 8 - 4q21.1.

[0039] The genes targeted for editing are expressed at different levels and are also located on different chromosomes. Therefore, assessing editing efficiency in such a system provides an objective picture of the genome editor's performance.

[0040] The following examples illustrate the application of the method for analyzing somatic mutations in the IDH1 and IDH2 genes. These examples are intended to be illustrative and not limiting. Those skilled in the art will appreciate that the embodiments of this invention are not limited to the examples provided herein.

[0041] Example 1. Creation of a vector for expressing the mutant DoctorCas9 protein in mammalian cell culture

[0042] The DoctorCas9 construct is based on the px458 vector (Addgene #48138). First, the sequence encoding the GFP protein is removed. For this, the plasmid vector px458 (SEQ ID NO: 1) is digested with the restriction enzyme EcoRI (ThermoFischer, USA) according to the manufacturer's protocol. Next, after purification of the reaction mixture, the resulting plasmid vector and the sequence encoding the mScarlet fluorescent protein are ligated with the T2A peptide sequence at the N-terminus using T4 DNA ligase (ThermoFischer, USA) at +4°C overnight.

[0043] The resulting vector is then mutated using the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent, USA). Oligonucleotide primers containing point substitutions altering the nucleotide composition of the final construct are used. Mutations are introduced in two stages. In the first stage of mutagenesis, oligonucleotide primers represented by the sequences SEQ ID NO: 2 - SEQ ID NO: 4 are used to introduce nucleotide substitutions resulting in amino acid substitutions D147Y, P411T, and F539S.For this purpose, the following reaction mixture is prepared: 2.5 μl of 10x reaction buffer, 100 ng of px458-mScarlet plasmid vector, 100 ng of each of the oligonucleotide primers SEQ ID N: 2 - SEQ ID N: 4, 1 μl of dNTP mixture (10 μM) and 1 μl of the enzyme mixture supplied in the kit (Sh / μl), the total volume of the reaction mixture is brought to 25 μl mQ and carried out on a T100 PCR amplifier (Bio-Rad, USA) PCR in the following mode: 95°C 1 minute - primary denaturation, 95°C 1 minute denaturation in a cycle, 55°C 1 minute - primer annealing, 68°C 20 minutes - elongation. The number of PCR cycles is 30. After this, the reaction mixture is cooled on ice, 10U Dpn 1 is added, and the mixture is incubated for 1 hour at 37°C. The resulting reaction mixture is then transformed into the competent E. coli Top 10 strain (Invitrogen, USA) according to standard methods.Positive clones (clones containing all the necessary mutations) are seeded in 5 ml of liquid LB medium and incubated overnight at 37°C, after which the produced plasmid vector is isolated using a plasmid isolation kit (Eurogen, Russia) in accordance with the manufacturer's protocol.

[0044] The second stage of introducing mutations is carried out similarly to the first stage of mutagenesis, but to introduce nucleotide substitutions leading to the replacement of amino acids M763I, K890N, L1206P, oligonucleotide primers SEQ ID NO: 5 -SEQ ID NO: 7 are used. As a result, the DoctorCas9 construct (SEQ ID NO: 8) is obtained, containing nucleotide substitutions leading to the replacement of amino acids D147Y, P41 IT, F539S, M763I, K890N, L1206P. The schemes of the original and the obtained mutant construct are shown in Fig. 2.

[0045] Example 2. Functional activity of mutant DoctorCas9 protein during genome editing in stably transfected HEK293T cell culture with a vector containing the GFP gene

[0046] A previously published system (Glaser A, McColl B, Vadolas J. GFP to BFP Conversion: A Versatile Assay for the Quantification of CRISPR / Cas9-mediated Genome Editing. Mol Ther Nucleic Acids. 2016 Jul 12;5(7):e334, DOI:https: / / doi.org / 10.1038 / mtna.2016.48)), based on a cell line stably expressing the GFP protein and subsequent editing of the genetic insert to replace two amino acids in the DNA sequence, is used as a genome editing model. This replacement converts the fluorescence of the green fluorescent protein to the blue spectrum. The percentage of non-homologous DNA end joining (NHEJ) is estimated by the number of cells with a lost green GFP fluorescence signal as a result of a frameshift during the formation of point deletions and insertions in the region of a double-stranded DNA break.The percentage of homologous recombination (HDR) is estimated by the conversion of the green fluorescence signal in cells to blue, which corresponds to the HDR process with the substitution of two amino acids.

[0047] The HEK293 cell culture (hereinafter referred to as HEK GFP) stably transfected with the eGFP-N1 vector is seeded at a concentration of 10,000 cells per well of a 24-well plate in 1 ml of DMEM medium containing 10% FBS. When the cells reach 70-80% confluency, they are transfected with the Lipofectamin 3000 reagent (Invitrogen, USA) according to the manufacturer's protocol. For transfection of HEK GFP cells, 0.5 μg of plasmid DNA encoding the wild-type or mutant Cas9 protein sequence, as well as 0.5 μg of donor ssDNA carrying nucleotide substitutions for recombination with the GFP gene, are used. The transfection result is shown in Fig. 3. To assess genome editing efficiency after 7 days of culture at 37°C in a 5% CO2 atmosphere, the cells are trypsinized, and the resulting cell suspension is analyzed by flow cytometry on a BD LSR Fortessa™ cytometer. Quantitative analysis of the results is performed using Flow Jo, LLC software.The results of the DoctorCas9 protein activity determination are shown in Fig. 4 and Fig. 5. As can be seen from the figures, the mutant form of DoctorCas9 nuclease significantly suppresses the level of NHEJ compared to the wild form, and does not reduce HDR.

[0048] Example 3. Confirmation of suppression of non-homologous DNA end joining during genome editing by mutant DoctorCas9 protein in a cellular system using viruses.

[0049] Lucky cells are seeded at 200,000 cells per well of a 6-well plate in 3 ml of DMEM supplemented with 10% FBS (in duplicate). The following day, cells are transfected with the px459 plasmid, which carries the wild-type or mutant DoctorCas9 nuclease gene and the corresponding gRNA sequences, using Lipofectamine 3000 reagent (2 μg plasmid + 4 μl Plus Reagent + 5.5 μl Lipofectamine) according to the manufacturer's protocol. The medium is replaced with DMEM supplemented with 5% FBS after 48 hours, and the cells are then incubated for 2 days until a confluent monolayer is formed. During this time, the cells transfected with the plasmid undergo genome editing by the Cas9 nuclease expressed in the cells at the loci targeted by the gRNA. The cells are then trypsinized from the plate, and the number of cells per well (1–1.2 million cells) is counted in a Goryaev chamber or using a cell counter.Thirty thousand cells are seeded in 96-well plates in DMEM containing 10% FBS and 1.5 μg / ml puromycin (to select cells transfected with the px459 plasmid) in six replicates. These cells are used to normalize transfection efficiency. The remaining cells are seeded at 200 thousand cells per well of a 6-well plate in DMEM containing 10% FBS. After three days of incubation at 37°C in an atmosphere of 5% CO2, the cells are infected with the appropriate viruses and incubated at 37°C in an atmosphere of 5% CO2 for another three days, after which cell viability is assessed. For this purpose, cells are stained with resazurin (1% W / V) for 3 hours and the fluorescence level is measured on a multifunctional plate reader (TECAN Spark (Tecan Trading AG, Switzerland)).Cells in which both receptor gene alleles were edited via NHEJ and the corresponding receptor sequence was disrupted survived infection, while cells in which NHEJ did not occur or occurred only on one allele did not. The results of determining the activity of the DoctorCas9 protein during viral receptor editing are shown in Fig. 6. These data indicate that the mutant form of the Cas9 nuclease DoctorCas9 significantly suppresses NHEJ during cell editing compared to wild-type Cas9.

[0050] Thus, the method for high-precision editing of mammalian genomes using a modified SpCas9 nuclease can be applied to optimize the genome editing of eukaryotic cells. It has been shown that the modified enzyme: Cas9 nuclease DoctorCas9 allows genome editing with high-precision replacement of required DNA regions and reduces the number of editing by-products in the form of deletions and insertions at the DNA double-strand break site - NHEJ. Significant suppression of NHEJ during genome editing using this enzyme substantially increases the specificity and efficiency of HDR.

[0051] --->

[0052] <?xml version="1.0" encoding="UTF-8"?>

[0053] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0054] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0055] <ST26SequenceListing dtdVersion="V1_3" fileName="Method

[0056] for high-precision editing of mammalian genomes using

[0057] modified SpCas9 nuclease that suppresses non-homologous

[0058] DNA end joining.xml" softwareName="WIPO Sequence"

[0059] softwareVersion="2.3.0" productionDate="2024-07-31">

[0060] <applicationidentification>

[0061] <ipofficecode>RU< / ipofficecode>

[0062] <applicationnumbertext>< / applicationnumbertext>

[0063] <filingdate>< / filingdate>

[0064] < / applicationidentification>

[0065] <applicantfilereference> 01.06.2024< / applicantfilereference>

[0066] <applicantname languagecode="ru">Federal State

[0067] Budgetary scientific institution Institute of Molecular Biology named after V.A.

[0068] Engelhardt Institute of Molecular Biology of the Russian Academy of Sciences (IMB RAS)< / applicantname>

[0069] <applicantnamelatin>Engelhardt Institute of Molecular Biology,

[0070] Russian Academy of Sciences< / applicantnamelatin>

[0071] <inventiontitle languagecode="ru">High precision method

[0072] Editing mammalian genomes using modified

[0073] SpCas9 non-homologous end joining repressor nuclease

[0074] DNA< / inventiontitle>

[0075] <sequencetotalquantity> 8< / sequencetotalquantity>

[0076] <sequencedata sequenceidnumber="1">

[0077] <insdseq>

[0078] <INSDSeq_length> 9282< / INSDSeq_length>

[0079] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0080] <INSDSeq_division> PAT< / INSDSeq_division>

[0081] <INSDSeq_feature-table>

[0082] <insdfeature>

[0083] <INSDFeature_key>source< / INSDFeature_key>

[0084] <INSDFeature_location>1..9282< / INSDFeature_location>

[0085] <INSDFeature_quals>

[0086] <insdqualifier>

[0087] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0088] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0089] < / insdqualifier>

[0090] <insdqualifier id="q2">

[0091] <INSDQualifier_name>organism< / INSDQualifier_name>

[0092] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0093] < / insdqualifier>

[0094] < / INSDFeature_quals>

[0095] < / insdfeature>

[0096] < / INSDSeq_feature-table>

[0097] <INSDSeq_sequence> gagggcctatttcccatgattccttcatatttgcatatacgatacaagg

[0098] ctgttagagagataattggaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtag

[0099] aaagtaataatttcttgggtagtttgcagttttaaaaattatgttttaaaatggactatcatatgcttacc

[0100] gtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgggtcttcga

[0101] gaagacctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtgg

[0102] caccgagtcggtgcttttttgttttagagctagaaatagcaagttaaaataaggctagtccgtttttagc

[0103] gcgtgcgccaattctgcagacaaatggctctagaggtacccgttacataacttacggtaaatggcccgcc

[0104] tggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgt

[0105] caatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgc

[0106] cccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactt

[0107] tcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgc

[0108] ttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtg

[0109] cagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcgg

[0110] ggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgagg

[0111] cggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgcgctgccttcgcc

[0112] ccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggt

[0113] gagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatgg

[0114] ttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttggac

[0115] cggtgccaccatggactataaggaccacgacggagactacaaggatcatgatattgattacaaagacgat

[0116] gacgataagatggccccaaagaagaagcggaaggtcggtatccacggagtcccagcagccgacaagaagt

[0117] acagcatcggcctggacatcggcaccaactctgtgggctgggccgtgatcaccgacgagtacaaggtgcc

[0118] cagcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggagccctg

[0119] ctgttcgacagcggcgaaacagccgaggccacccggctgaagagaaccgccagaagaagatacaccagac

[0120] ggaagaaccggatctgctatctgcaagagatcttcagcaacgagatggccaaggtggacgacagcttctt

[0121] ccacagactggaagagtccttcctggtggaagaggataagaagcacgagcggcaccccatcttcggcaac

[0122] atcgtggacgaggtggcctaccacgagaagtaccccaccatctaccacctgagaaagaaactggtggaca

[0123] gcaccgacaaggccgacctgcggctgatctatctggccctggcccacatgatcaagttccggggccactt

[0124] cctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatccagctggtgcagacc

[0125] tacaaccagctgttcgaggaaaaccccatcaacgccagcggcgtggacgccaaggccatcctgtctgcca

[0126] gactgagcaagagcagacggctggaaaatctgatcgcccagctgcccggcgagaagaagaatggcctgtt

[0127] cggaaacctgattgccctgagcctgggcctgacccccaacttcaagagcaacttcgacctggccgaggat

[0128] gccaaactgcagctgagcaaggacacctacgacgacgacctggacaacctgctggcccagatcggcgacc

[0129] agtacgccgacctgtttctggccgccaagaacctgtccgacgccatcctgctgagcgacatcctgagagt

[0130] gaacaccgagatcaccaaggcccccctgagcgcctctatgatcaagagatacgacgagcaccaccaggac

[0131] ctgaccctgctgaaagctctcgtgcggcagcagctgcctgagaagtacaaagagattttcttcgaccaga

[0132] gcaagaacggctacgccggctacattgacggcggagccagccaggaagagttctacaagttcatcaagcc

[0133] catcctggaaaagatggacggcaccgaggaactgctcgtgaagctgaacagagaggacctgctgcggaag

[0134] cagcggaccttcgacaacggcagcatcccccaccagatccacctgggagagctgcacgccattctgcggc

[0135] ggcaggaagatttttacccattcctgaaggacaaccgggaaaagatcgagaagatcctgaccttccgcat

[0136] cccctactacgtgggccctctggccaggggaaacagcagattcgcctggatgaccagaaagagcgaggaa

[0137] accatcaccccctggaacttcgaggaagtggtggacaagggcgcttccgcccagagcttcatcgagcgga

[0138] tgaccaacttcgataagaacctgcccaacgagaaggtgctgcccaagcacagcctgctgtacgagtactt

[0139] caccgtgtataacgagctgaccaaagtgaaatacgtgaccgagggaatgagaaaagcccgcttcctgagc

[0140] ggcgagcagaaaaaggccatcgtggacctgctgttcaagaccaaccggaaagtgaccgtgaagcagctga

[0141] aagaggaactacttcaagaaaatcgagtgcttcgactccgtggaaatctccggcgtggagaatcggttcaa (0142) 0143

[0144] ggctgaaaacctatgcccacctgttcgacgacaaagtgaatgaagcagctgaagcggcggagatacaccgg

[0145] ctggggcaggctgagccggaagctgatcaacggcatccgggacaagcagtccggcaagacaatcctggat

[0146] ttcctgaagtccgacggcttcgccaacagaaacttcatgcagctgatccacgacgacagcctgaccttta

[0147] aaggagacatccagaaagcccaggtgtccggccagggcgatagcctgcacgagcacattgccaatctggc

[0148] cggcagccccgccattaagaagggcatcctgcagacagtgaaggtggtggacgagctcgtgaaagtgatg

[0149] ggccggcacaagcccgagaacatcgtgatcgaaatggccagagagaaccagaccacccagaagggacaga

[0150] agaacagccgcgagagaatgaagcggatcgaagagggcatcaaagagctgggcagccagatcctgaaaga

[0151] acaccccgtggaaaacacccagctgcagaacgagaagctgtacctgtactacctgcagaatgggcgggat

[0152] atgtacgtggaccaggaactggacatcaaccggctgtccgactacgatgtggaccatatcgtgcctcaga

[0153] gctttctgaaggacgactccatcgacaacaaggtgctgaccagaagcgacaagaaccggggcaagagcga

[0154] caacgtgccctccgaagaggtcgtgaagaagatgaagaactactggcggcagctgctgaacgccaagctg

[0155] attacccagagaaagttcgacaatctgaccaaggccgagagaggcggcctgagcgaactggataaggccg

[0156] gcttcatcaagagacagctggtggaaacccggcagatcacaaagcacgtggcacagatcctggactcccg

[0157] gatgaacactaagtacgacgagaatgacaagctgatccgggaagtgaaagtgatcaccctgaagtccaag

[0158] ctggtgtccgatttccggaaggatttccagttttacaaagtgcgcgagatcaacaactaccaccaccacgccc

[0159] acgacgcctacctgaacgccgtcgtgggaaccgccctgatcaaaaagtaccctaagctggaaagcgagtt

[0160] cgtgtacggcgactacaaggtgtacgacgtgcggaagatgatcgccaagagcgagcaggaaatcggcaag

[0161] gctaccgccaagtacttcttctacagcaacatcatgaactttttcaagaccgagattaccctggccaacg

[0162] gcgagatccggaagcggcctctgatcgagacaaacggcgaaaccggggagatcgtgtgggataagggccg

[0163] ggattttgccaccgtgcggaaagtgctgagcatgccccaagtgaatatcgtgaaaaagaccgaggtgcag

[0164] acaggcggcttcagcaaagagtctatcctgcccaagaggaacagcgataagctgatcgccagaaagaagg

[0165] actgggaccctaagaagtacggcggcttcgacagccccaccgtggcctattctgtgctggtggtggccaa

[0166] agtggaaaagggcaagtccaagaaactgaagagtgtgaaagagctgctggggatcaccatcatggaaaga

[0167] agcagcttcgagaagaatcccatcgactttctggaagccaagggctacaaagaagtgaaaaaggacctga

[0168] tcatcaagctgcctaagtactccctgttcgagctggaaaacggccggaagagaatgctggcctctgccgg

[0169] cgaactgcagaagggaaacgaactggccctgccctccaaatatgtgaacttcctgtacctggccagccac

[0170] tatgagaagctgaagggctcccccgaggataatgagcagaaacagctgtttgtggaacagcacaagcact

[0171] acctggacgagatcatcgagcagatcagcgagttctccaagagagtgatcctggccgacgctaatctgga

[0172] caaagtgctgtccgcctacaacaagcaccgggataagcccatcagagagcaggccgagaatatcatccac

[0173] ctgtttaccctgaccaatctgggagcccctgccgccttcaagtactttgacaccaccatcgaccggaaga

[0174] ggtacaccagcaccaaagaggtgctggacgccaccctgatccaccagagcatcaccggcctgtacgagac

[0175] acggatcgacctgtctcagctgggaggcgacaaaaggccggcggccacgaaaaaggccggccaggcaaaa

[0176] aagaaaaagggatccggctccggcgagggcaggggaagtctgctaacatgcggggacgtggaggaaaatc

[0177] ccggcccaggatccatggtgagcaagggcgaggcagtgatcaaggagttcatgcggttcaaggtgcacat

[0178] ggagggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacc

[0179] cagaccgccaagctgaaggtgaccaagggtggccccctgcccttctcctgggacatcctgtcccctcagt

[0180] tcatgtacggctccagggccttcaccaagcaccccgccgacatccccgactactataagcagtccttccc

[0181] cgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgccgtgaccgtgacccaggacacc

[0182] tccctggaggacggcaccctgatctacaaggtgaagctccgcggcaccaacttccctcctgacggccccg

[0183] taatgcagaagaaaacaatgggctgggaagcgtccaccgagcggttgtaccccgaggacggcgtgctgaa

[0184] gggcgacattaagatggccctgcgcctgaaggacggcggccgctacctggcggacttcaagaccacctac

[0185] aaggccaagaagcccgtgcagatgcccggcgcctacaacgtcgaccgcaagttggacatcacctcccaca

[0186] acgaggactacaccgtggtggaacagtacgaacgctccgagggccgccactccaccggcggcatggacga

[0187] gctgtacaagtaagttgaattctaactagagctcgctgatcagcctcgactgtgccttctagttgccagc

[0188] catctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttccta

[0189] ataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcag

[0190] gacagcaagggggaggattgggaagagaatagcaggcatgctggggagcggccgcaggaacccctagtga

[0191] tggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacg

[0192] cccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgcctgatgcgg

[0193] tattttctccttacgcatctgtgcggtatttcacaccgcatacgtcaaagcaaccatagtacgcgccctg

[0194] tagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgcctta

[0195] gcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaa

[0196] atcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgatttggg

[0197] tgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttc

[0198] tttaatagtggactcttgttccaaactggaacaacactcaactctatctcgggctattcttttgatttat

[0199] aagggattttgccgatttcggtctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattt

[0200] taacaaaatattaacgtttacaattttatggtgcactctcagtacaatctgctctgatgccgcatagtta

[0201] agccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgctt

[0202] acagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgc

[0203] gagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacg

[0204] tcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaata

[0205] tgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtat

[0206] tcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaa

[0207] acgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctca

[0208] acagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttct

[0209] gctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattct

[0210] cagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaat

[0211] tatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggacc

[0212] gaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggag

[0213] ctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgca

[0214] aactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataa

[0215] agttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggt

[0216] gagcgtggaagccgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatct

[0217] acacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgat

[0218] taagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaa

[0219] tttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgt

[0220] tccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaat

[0221] ctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaact

[0222] ctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagt

[0223] taggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggc

[0224] tgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcag

[0225] cggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagat

[0226] acctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaag

[0227] cggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcct

[0228] gtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatgga

[0229] aaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgt< / INSDS

[0230] eq_sequence>

[0231] < / insdseq>

[0232] < / sequencedata>

[0233] <sequencedata sequenceidnumber="2">

[0234] <insdseq>

[0235] <INSDSeq_length> 22< / INSDSeq_length>

[0236] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0237] <INSDSeq_division> PAT< / INSDSeq_division>

[0238] <INSDSeq_feature-table>

[0239] <insdfeature>

[0240] <INSDFeature_key>source< / INSDFeature_key>

[0241] <INSDFeature_location>1..22< / INSDFeature_location>

[0242] <INSDFeature_quals>

[0243] <insdqualifier>

[0244] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0245] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0246] < / insdqualifier>

[0247] <insdqualifier id="q4">

[0248] <INSDQualifier_name>organism< / INSDQualifier_name>

[0249] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0250] < / insdqualifier>

[0251] < / INSDFeature_quals>

[0252] < / insdfeature>

[0253] < / INSDSeq_feature-table>

[0254] <INSDSeq_sequence> cacctataaggccgacctgcgg< / INSDSeq_sequence>

[0255] < / insdseq>

[0256] < / sequencedata>

[0257] <sequencedata sequenceidnumber="3">

[0258] <insdseq>

[0259] <INSDSeq_length>19< / INSDSeq_length>

[0260] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0261] <INSDSeq_division>PAT< / INSDSeq_division>

[0262] <INSDSeq_feature-table>

[0263] <insdfeature>

[0264] <INSDFeature_key>source< / INSDFeature_key>

[0265] <INSDFeature_location>1..19< / INSDFeature_location>

[0266] <INSDFeature_quals>

[0267] <insdqualifier>

[0268] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0269] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0270] < / insdqualifier>

[0271] <insdqualifier id="q6">

[0272] <INSDQualifier_name>organism< / INSDQualifier_name>

[0273] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0274] < / insdqualifier>

[0275] < / INSDFeature_quals>

[0276] < / insdfeature>

[0277] < / INSDSeq_feature-table>

[0278] <INSDSeq_sequence>acccaccagatccacctgg< / INSDSeq_sequence>

[0279] < / insdseq>

[0280] < / sequencedata>

[0281] <sequencedata sequenceidnumber="4">

[0282] <insdseq>

[0283] <INSDSeq_length> 21< / INSDSeq_length>

[0284] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0285] <INSDSeq_division> PAT< / INSDSeq_division>

[0286] <INSDSeq_feature-table>

[0287] <insdfeature>

[0288] <INSDFeature_key>source< / INSDFeature_key>

[0289] <INSDFeature_location>1..21< / INSDFeature_location>

[0290] <INSDFeature_quals>

[0291] <insdqualifier>

[0292] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0293] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0294] < / insdqualifier>

[0295] <insdqualifier id="q9">

[0296] <INSDQualifier_name>organism< / INSDQualifier_name>

[0297] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0298] < / insdqualifier>

[0299] < / INSDFeature_quals>

[0300] < / insdfeature>

[0301] < / INSDSeq_feature-table>

[0302] <INSDSeq_sequence> agcctgagcggcgagcagaaa< / INSDSeq_sequence>

[0303] < / insdseq>

[0304] < / sequencedata>

[0305] <sequencedata sequenceidnumber="5">

[0306] <insdseq>

[0307] <INSDSeq_length>24< / INSDSeq_length>

[0308] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0309] <INSDSeq_division>PAT< / INSDSeq_division>

[0310] <INSDSeq_feature-table>

[0311] <insdfeature>

[0312] <INSDFeature_key>source< / INSDFeature_key>

[0313] <INSDFeature_location>1..24< / INSDFeature_location>

[0314] <INSDFeature_quals>

[0315] <insdqualifier>

[0316] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0317] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0318] < / insdqualifier>

[0319] <insdqualifier id="q11">

[0320] <INSDQualifier_name>organism< / INSDQualifier_name>

[0321] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0322] < / insdqualifier>

[0323] < / INSDFeature_quals>

[0324] < / insdfeature>

[0325] < / INSDSeq_feature-table>

[0326] <INSDSeq_sequence>atcgccagagagaaccagaccacc< / INSDSeq_sequence>

[0327] < / insdseq>

[0328] < / sequencedata>

[0329] <sequencedata sequenceidnumber="6">

[0330] <insdseq>

[0331] <INSDSeq_length>27< / INSDSeq_length>

[0332] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0333] <INSDSeq_division>PAT< / INSDSeq_division>

[0334] <INSDSeq_feature-table>

[0335] <insdfeature>

[0336] <INSDFeature_key>source< / INSDFeature_key>

[0337] <INSDFeature_location>1..27< / INSDFeature_location>

[0338] <INSDFeature_quals>

[0339] <insdqualifier>

[0340] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0341] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0342] < / insdqualifier>

[0343] <insdqualifier id="q13">

[0344] <INSDQualifier_name>organism< / INSDQualifier_name>

[0345] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0346] < / insdqualifier>

[0347] < / INSDFeature_quals>

[0348] < / insdfeature>

[0349] < / INSDSeq_feature-table>

[0350] <INSDSeq_sequence>gctgaacgccaacctgattacccagag< / INSDSeq_sequence>

[0351] < / insdseq>

[0352] < / sequencedata>

[0353] <sequencedata sequenceidnumber="7">

[0354] <insdseq>

[0355] <INSDSeq_length> 24< / INSDSeq_length>

[0356] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0357] <INSDSeq_division> PAT< / INSDSeq_division>

[0358] <INSDSeq_feature-table>

[0359] <insdfeature>

[0360] <INSDFeature_key>source< / INSDFeature_key>

[0361] <INSDFeature_location>1..24< / INSDFeature_location>

[0362] <INSDFeature_quals>

[0363] <insdqualifier>

[0364] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0365] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0366] < / insdqualifier>

[0367] <insdqualifier id="q15">

[0368] <INSDQualifier_name>organism< / INSDQualifier_name>

[0369] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0370] < / insdqualifier>

[0371] < / INSDFeature_quals>

[0372] < / insdfeature>

[0373] < / INSDSeq_feature-table>

[0374] <INSDSeq_sequence> cctgaaaacggccggaagagaatg< / INSDSeq_sequence>

[0375] < / insdseq>

[0376] < / sequencedata>

[0377] <sequencedata sequenceidnumber="8">

[0378] <insdseq>

[0379] <INSDSeq_length> 9282< / INSDSeq_length>

[0380] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0381] <INSDSeq_division> PAT< / INSDSeq_division>

[0382] <INSDSeq_feature-table>

[0383] <insdfeature>

[0384] <INSDFeature_key>source< / INSDFeature_key>

[0385] <INSDFeature_location>1..9282< / INSDFeature_location>

[0386] <INSDFeature_quals>

[0387] <insdqualifier>

[0388] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0389] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0390] < / insdqualifier>

[0391] <insdqualifier id="q17">

[0392] <INSDQualifier_name>organism< / INSDQualifier_name>

[0393] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0394] < / insdqualifier>

[0395] < / INSDFeature_quals>

[0396] < / insdfeature>

[0397] < / INSDSeq_feature-table>

[0398] <INSDSeq_sequence> gagggcctatttcccatgattccttcatatttgcatatacgatacaagg

[0399] ctgttagagagataattggaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtag

[0400] aaagtaataatttcttgggtagtttgcagttttaaaaattatgttttaaaatggactatcatatgcttacc

[0401] gtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgggtcttcga

[0402] gaagacctgttttatagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtgg

[0403] caccgagtcggtgcttttttgttttagagctagaaatagcaagttaaaataaggctagtccgtttttagc

[0404] gcgtgcgccaattctgcagacaaatggctctagaggtacccgttacataacttacggtaaatggcccgcc

[0405] tggctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgt

[0406] caatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgc

[0407] cccctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactt

[0408] tcctacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgc

[0409] ttcactctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtg

[0410] cagcgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcgg

[0411] ggcgaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgagg

[0412] cggcggcggcggcggccctataaaaagcgaagcgcgcggcgggcgggagtcgctgcgcgctgccttcgcc

[0413] ccgtgccccgctccgccgccgcctcgcgccgcccgccccggctctgactgaccgcgttactcccacaggt

[0414] gagcgggcgggacggcccttctcctccgggctgtaattagctgagcaagaggtaagggtttaagggatgg

[0415] ttggttggtggggtattaatgtttaattacctggagcacctgcctgaaatcactttttttcaggttggac

[0416] cggtgccaccatggactataaggaccacgacggagactacaaggatcatgatattgattacaaagacgat

[0417] gacgataagatggccccaaagaagaagcggaaggtcggtatccacggagtcccagcagccgacaagaagt

[0418] acagcatcggcctggacatcggcaccaactctgtgggctgggccgtgatcaccgacgagtacaaggtgcc

[0419] cagcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggagccctg

[0420] ctgttcgacagcggcgaaacagccgaggccacccggctgaagagaaccgccagaagaagatacaccagac

[0421] ggaagaaccggatctgctatctgcaagagatcttcagcaacgagatggccaaggtggacgacagcttctt

[0422] ccacagactggaagagtccttcctggtggaagaggataagaagcacgagcggcaccccatcttcggcaac

[0423] atcgtggacgaggtggcctaccacgagaagtaccccaccatctaccacctgagaaagaaactggtggaca

[0424] gcacctataaggccgacctgcggctgatctatctggccctggcccacatgatcaagttccggggccactt

[0425] cctgatcgagggcgacctgaaccccgacaacagcgacgtggacaagctgttcatccagctggtgcagacc

[0426] tacaaccagctgttcgaggaaaaccccatcaacgccagcggcgtggacgccaaggccatcctgtctgcca

[0427] gactgagcaagagcagacggctggaaaatctgatcgcccagctgcccggcgagaagaagaatggcctgtt

[0428] cggaaacctgattgccctgagcctgggcctgacccccaacttcaagagcaacttcgacctggccgaggat

[0429] gccaaactgcagctgagcaaggacacctacgacgacgacctggacaacctgctggcccagatcggcgacc

[0430] agtacgccgacctgtttctggccgccaagaacctgtccgacgccatcctgctgagcgacatcctgagagt

[0431] gaacaccgagatcaccaaggcccccctgagcgcctctatgatcaagagatacgacgagcaccaccaggac

[0432] ctgaccctgctgaaagctctcgtgcggcagcagctgcctgagaagtacaaagagattttcttcgaccaga

[0433] gcaagaacggctacgccggctacattgacggcggagccagccaggaagagttctacaagttcatcaagcc

[0434] catcctggaaaagatggacggcaccgaggaactgctcgtgaagctgaacagagaggacctgctgcggaag

[0435] cagcggaccttcgacaacggcagcatcacccaccagatccacctgggagagctgcacgccattctgcggc

[0436] ggcaggaagatttttacccattcctgaaggacaaccgggaaaagatcgagaagatcctgaccttccgcat

[0437] cccctactacgtgggccctctggccaggggaaacagcagattcgcctggatgaccagaaagagcgaggaa

[0438] accatcaccccctggaacttcgaggaagtggtggacaagggcgcttccgcccagagcttcatcgagcgga

[0439] tgaccaacttcgataagaacctgcccaacgagaaggtgctgcccaagcacagcctgctgtacgagtactt

[0440] caccgtgtataacgagctgaccaaagtgaaatacgtgaccgagggaatgaagaaagcccgccagcctgagc

[0441] ggcgagcagaaaaaggccatcgtggacctgctgttcaagaccaaccggaaagtgaccgtgaagcagctga

[0442] aaggactacttcaagaaaatcgagtgcttcgactccgtggaaatctccggctggagatcggttcaa (0443) 0444

[0445] ggctgaaaacctatgcccacctgttcgacgacaaagtgaatgaagcagctgaagcggcggagatacaccgg

[0446] ctggggcaggctgagccggaagctgatcaacggcatccgggacaagcagtccggcaagacaatcctggat

[0447] ttcctgaagtccgacggcttcgccaacagaaacttcatgcagctgatccacgacgacagcctgaccttta

[0448] aaggagacatccagaaagcccaggtgtccggccagggcgatagcctgcacgagcacattgccaatctggc

[0449] cggcagccccgccattaagaagggcatcctgcagacagtgaaggtggtggacgagctcgtgaaagtgatg

[0450] ggccggcacaagcccgagaacatcgtgatcgaaatcgccagagagaaccagaccacccagaagggacaga

[0451] agaacagccgcgagagaatgaagcggatcgaagagggcatcaaagagctgggcagccagatcctgaaaga

[0452] acaccccgtggaaaacacccagctgcagaacgagaagctgtacctgtactacctgcagaatgggcgggat

[0453] atgtacgtggaccaggaactggacatcaaccggctgtccgactacgatgtggaccatatcgtgcctcaga

[0454] gctttctgaaggacgactccatcgacaacaaggtgctgaccagaagcgacaagaaccggggcaagagcga

[0455] caacgtgccctccgaagaggtcgtgaagaagatgaagaactactggcggcagctgctgaacgccaacctg

[0456] attacccagagaaagttcgacaatctgaccaaggccgagagaggcggcctgagcgaactggataaggccg

[0457] gcttcatcaagagacagctggtggaaacccggcagatcacaaagcacgtggcacagatcctggactcccg

[0458] gatgaacactaagtacgacgagaatgacaagctgatccgggaagtgaaagtgatcaccctgaagtccaag

[0459] ctggtgtccgatttccggaaggatttccagttttacaaagtgcgcgagatcaacaactaccaccaccacgccc

[0460] acgacgcctacctgaacgccgtcgtgggaaccgccctgatcaaaaagtaccctaagctggaaagcgagtt

[0461] cgtgtacggcgactacaaggtgtacgacgtgcggaagatgatcgccaagagcgagcaggaaatcggcaag

[0462] gctaccgccaagtacttcttctacagcaacatcatgaactttttcaagaccgagattaccctggccaacg

[0463] gcgagatccggaagcggcctctgatcgagacaaacggcgaaaccggggagatcgtgtgggataagggccg

[0464] ggattttgccaccgtgcggaaagtgctgagcatgccccaagtgaatatcgtgaaaaagaccgaggtgcag

[0465] acaggcggcttcagcaaagagtctatcctgcccaagaggaacagcgataagctgatcgccagaaagaagg

[0466] actgggaccctaagaagtacggcggcttcgacagccccaccgtggcctattctgtgctggtggtggccaa

[0467] agtggaaaagggcaagtccaagaaactgaagagtgtgaaagagctgctggggatcaccatcatggaaaga

[0468] agcagcttcgagaagaatcccatcgactttctggaagccaagggctacaaagaagtgaaaaaggacctga

[0469] tcatcaagctgcctaagtactccctgttcgagcctgaaaacggccggaagagaatgctggcctctgccgg

[0470] cgaactgcagaagggaaacgaactggccctgccctccaaatatgtgaacttcctgtacctggccagccac

[0471] tatgagaagctgaagggctcccccgaggataatgagcagaaacagctgtttgtggaacagcacaagcact

[0472] acctggacgagatcatcgagcagatcagcgagttctccaagagagtgatcctggccgacgctaatctgga

[0473] caaagtgctgtccgcctacaacaagcaccgggataagcccatcagagagcaggccgagaatatcatccac

[0474] ctgtttaccctgaccaatctgggagcccctgccgccttcaagtactttgacaccaccatcgaccggaaga

[0475] ggtacaccagcaccaaagaggtgctggacgccaccctgatccaccagagcatcaccggcctgtacgagac

[0476] acggatcgacctgtctcagctgggaggcgacaaaaggccggcggccacgaaaaaggccggccaggcaaaa

[0477] aagaaaaagggatccggctccggcgagggcaggggaagtctgctaacatgcggggacgtggaggaaaatc

[0478] ccggcccaggatccatggtgagcaagggcgaggcagtgatcaaggagttcatgcggttcaaggtgcacat

[0479] ggagggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacc

[0480] cagaccgccaagctgaaggtgaccaagggtggccccctgcccttctcctgggacatcctgtcccctcagt

[0481] tcatgtacggctccagggccttcaccaagcaccccgccgacatccccgactactataagcagtccttccc

[0482] cgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgccgtgaccgtgacccaggacacc

[0483] tccctggaggacggcaccctgatctacaaggtgaagctccgcggcaccaacttccctcctgacggccccg

[0484] taatgcagaagaaaacaatgggctgggaagcgtccaccgagcggttgtaccccgaggacggcgtgctgaa

[0485] gggcgacattaagatggccctgcgcctgaaggacggcggccgctacctggcggacttcaagaccacctac

[0486] aaggccaagaagcccgtgcagatgcccggcgcctacaacgtcgaccgcaagttggacatcacctcccaca

[0487] acgaggactacaccgtggtggaacagtacgaacgctccgagggccgccactccaccggcggcatggacga

[0488] gctgtacaagtaagttgaattctaactagagctcgctgatcagcctcgactgtgccttctagttgccagc

[0489] catctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttccta

[0490] ataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcag

[0491] gacagcaagggggaggattgggaagagaatagcaggcatgctggggagcggccgcaggaacccctagtga

[0492] tggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcgcccgacg

[0493] cccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcaggggcgcctgatgcgg

[0494] tattttctccttacgcatctgtgcggtatttcacaccgcatacgtcaaagcaaccatagtacgcgccctg

[0495] tagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgcctta

[0496] gcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaa

[0497] atcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgatttggg

[0498] tgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttc

[0499] tttaatagtggactcttgttccaaactggaacaacactcaactctatctcgggctattcttttgatttat

[0500] aagggattttgccgatttcggtctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattt

[0501] taacaaaatattaacgtttacaattttatggtgcactctcagtacaatctgctctgatgccgcatagtta

[0502] agccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgctt

[0503] acagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgc

[0504] gagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacg

[0505] tcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaata

[0506] tgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtat

[0507] tcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaa

[0508] acgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctca

[0509] acagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttct

[0510] gctatgtggcgcggtattatcccgtattgacgccgggcaagagcaactcggtcgccgcatacactattct

[0511] cagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaat

[0512] tatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggacc

[0513] gaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggag

[0514] ctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagcaatggcaacaacgttgcgca

[0515] aactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataa

[0516] agttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggt

[0517] gagcgtggaagccgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatct

[0518] acacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgat

[0519] taagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaa

[0520] tttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgt

[0521] tccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaat

[0522] ctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaact

[0523] ctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagt

[0524] taggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggc

[0525] tgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcag

[0526] cggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagat

[0527] acctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaag

[0528] cggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcct

[0529] gtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatgga

[0530] aaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgt< / INSDS

[0531] eq_sequence>

[0532] < / insdseq>

[0533] < / sequencedata>

[0534]

[0535] <---

Claims

1. A method for producing a mutant Cas9 nuclease containing the amino acid substitutions D147Y, P411T, F539S, M763I, K890N, L1206P, as well as the 538A insert, introduced into the sequence of the wild-type SpCas9 nuclease, comprising: a) creating a vector expressing said mutant Cas9 nuclease in mammalian cells, containing said point mutations relative to the sequence of the wild-type SpCas9 nuclease; b) transfection of a vector expressing a mutant Cas9 protein and DNA oligonucleotides containing sequences for homologous recombination into a cell line; c) assessment of transfection by the level of mScarlet fluorescence; d) confirmation of the functional activity of the said mutant Cas9 nuclease in cell culture.

2. The method according to claim 1, characterized in that transfection with a vector expressing a mutant Cas9 protein is carried out in a cell culture in which non-pathogenic enterovirus strains are effectively replicated.

Images