Method for comparative assessment of impact of low and high FAO maize values on relative copy number of mitochondrial DNA

Abstract

FIELD: biotechnology.SUBSTANCE: method for comparatively assessing the effect of low and high FAO indicators of corn on the relative copy number of mitochondrial DNA, wherein the relative copy number of the ATP8 genes is determined using the MEK1 gene as a reference.EFFECT: determining optimal conditions for growing corn in laboratory and natural conditions used in breeding work.2 cl, 2 tbl, 1 ex

Description

[0001] The invention relates to the field of "biotechnology" and is intended for indirect evaluation of the intensity of oxidative phosphorylation processes using indicators of the relative copy number of the mitochondrial DNA Atp8 gene in relation to the nuclear reference gene MEK1 of maize using the qRT-PCR method.

[0002] A method for assessing the functional state of plant tissues and organs that do not contain chlorophyll is known (Russian Federation Patent for Invention No. 2606923, IPC A01G 7 / 00, G01N 21 / 39, published January 10, 2017). The method involves measuring optical characteristics. The flickering dynamics of speckles of coherent laser radiation reflected from or transmitted by the object are measured over a specified period of 3 seconds or more. The degree and rate of fluctuations in the intensity of a given region of the speckle pattern are used to assess the functional state of the tissues: higher fluctuations indicate a higher metabolic activity level.

[0003] The disadvantage of this method is that it measures the optical characteristics of plant tissues but is not specifically related to photosynthesis or oxidative phosphorylation. It may be useful for assessing overall functional status, but does not provide direct information on specific energy metabolism processes within the cell.

[0004] A known method for fluorimetric determination of the parameters of photosynthesis in photoautotrophic organisms includes a device for its implementation and a measuring chamber (Russian Federation Patent for Invention No. 2354958, IPC G01N 21 / 64, published May 10, 2009). In the method, which involves exposing a sample of the analyzed medium to light, the excitation light pulses have the same amplitude and variable duration, while the chlorophyll fluorescence characteristics are measured under constant background illumination simulating the irradiation intensity of the object during the study in natural conditions, and after its adaptation to the dark. The device includes a measuring chamber, an even number of light sources optically coupled to the measuring chamber, a sample fluorescence measurement module, a control unit, a light source current stabilizer, and a natural irradiance sensor.The measuring chamber contains a housing, a fluorescence recorder and an even number of light sources, which are located in pairs diametrically opposite to each other in one plane perpendicular to the axis of the housing.

[0005] Disadvantage of this method: it does not measure chlorophyll fluorescence itself and does not provide information on mitochondrial DNA or the intensity of oxidative phosphorylation. It focuses on photosynthesis and cannot be used to assess other cellular energy processes.

[0006] The closest in functionality to this method of indirectly assessing the intensity of oxidative phosphorylation is the method for assessing the breeding material of peas for the intensity of energy exchange in leaves (Patent of the Russian Federation for invention No. 2626586, IPC A01H 1 / 04, A01H 5 / 00, published July 28, 2017). The invention is a method for evaluating the intensity of leaf photosynthesis in pea breeding material, which includes measuring the intensity of absorption of carbon dioxide molecules per unit surface area of ​​the leaves of the first fruiting node in the fruiting phase, with measurements being carried out from 9:00 to 11:00 a.m. using a portable gas analyzer of the LI-6400 XT brand, which records and displays the value of the intensity of photosynthesis on a digital screen, with the measuring chamber being attached to the plant leaf and waiting for gas exchange in the measuring chamber to stabilize for 1.5-2 minutes.

[0007] The disadvantage of the prototype is that it measures the rate of carbon dioxide absorption by pea leaves to assess photosynthesis, but does not take into account the specific molecular mechanisms and genes associated with photosynthesis, and does not provide information about specific molecular processes in the cell.

[0008] The objective of our invention is to simplify the semi-quantitative assessment of the intensity of oxidative phosphorylation processes in corn leaves in order to determine the optimal conditions for its cultivation in laboratory and natural conditions, and potential use in breeding work.

[0009] The technical result of our invention is to increase the accuracy and specificity of oxidative phosphorylation assessment.

[0010] The problem is solved by comparatively assessing the impact of low and high FAO maize values ​​on relative mitochondrial DNA copy number using quantitative RT-PCR. For this purpose, leaves from ten-day-old seedlings of early (FAO 130 and 150) and late (FAO 400 and 500) maize varieties were used for genomic DNA extraction. Genomic DNA from 70-100 mg of plant tissue from each sample was extracted using a modified CTAB DNA extraction procedure. The quantitative RT-PCR reaction is carried out in a 25 μl reaction mixture consisting of 12.5 μl of the “Reagent kit for RT-PCR in the presence of EVA Green dye” (“Synthol”, Russia), 0.5 μl of dd H2O (deionized water), 1 μl of the corresponding primers (forward and reverse, 0.33 μM) and 10 μl of total DNA with a concentration of 5 ng / μl.PCR was performed using a Rotor-Gene Q 5plex Platform automated analyzer (Corbett Research, Australia) with the following program: initial denaturation at 95°C for 5 min (1 cycle), followed by 40 cycles of denaturation at 95°C for 10 sec, annealing at 58°C for 15 sec, and elongation at 72°C for 20 sec. Relative copy number of the ATP8 genes (mitochondrial DNA) was determined using the MEK1 gene (chromosomal DNA) as a reference. Algorithms were used to quantify the relative copy number of chloroplast DNA.

[0011] 2 -DCt and 2 -DDCt (Schmittgen TD, Livak KJ., 2008).

[0012] The FAO index is the FAO Early Maturity Index. This index is a conventional indicator developed by the Food and Agriculture Organization of the United Nations and is used to classify maize hybrids by maturity date.

[0013] Common features with the prototype:

[0014] - quantitative measurement of parameters related to the functional state of the cell's energy system.

[0015] Distinctive features from the prototype:

[0016] - leaves of ten-day-old seedlings of early (FAO 130 and FAO 150) and late (FAO 400 and FAO 500) maturity groups of maize were used for genomic DNA extraction;

[0017] - Genomic DNA from 70-100 mg of plant tissue of each sample was extracted using a modified CTAB DNA extraction procedure;

[0018] - to perform quantitative RT-PCR, samples of genomic DNA obtained from the leaves of ten-day-old corn seedlings are used;

[0019] - the quantitative RT-PCR reaction is carried out in 25 μl of a reaction mixture consisting of 12.5 μl of the “Reagent kit for RT-PCR in the presence of EVA Green dye” (“Synthol”, Russia), 0.5 μl of dd H2O (deionized water), 1 μl of the corresponding primers (forward and reverse, 0.33 μM) and 10 μl of total DNA;

[0020] - PCR is performed using a Rotor-Gene Q 5plex Platform “Corbett Research” automatic analyzer (Australia) using the following program: initial denaturation at 95°C for 5 min (1 cycle), then 40 cycles of denaturation at 95°C for 10 sec, annealing at 58°C for 15 sec and elongation at 72°C for 20 sec;

[0021] - Determination of the relative copy number of the Atp8 gene (mitochondrial DNA) is performed using the MEK1 gene (chromosomal DNA) as a reference. Algorithms 2 were used to quantify the relative copy number of chloroplast DNA. -DCt and 2 -DDCt .

[0022] Change in mtDNA copy number affects mitochondrial functions and plays an important role in assessing the physiological state of plants and their potential fertility.

[0023] High mtDNA copy numbers in plant cells are observed in metabolically active cells and vice versa. This potentially allows this marker to be used as an indicator of the activity of cells actively consuming energy (Fujie et al., 1993).

[0024] Quantitative PCR (qPCR) measures the copy number of mitochondrial DNA (Atp8) relative to a nuclear target gene (MEK1). We used this approach to determine changes in mitochondrial DNA copy number relative to the nuclear genome in maize seedling leaves under laboratory conditions.

[0025] The method is implemented as follows

[0026] Leaves of 10-day-old maize seedlings of early (FAO 130 and FAO 150) and late (FAO 400 and FAO 500) maturity groups grown in laboratory conditions were used for total DNA extraction. Genomic DNA from 70-100 mg of plant tissue of each sample was extracted using a modified CTAB DNA extraction procedure [Kryukov, Lavr & Vodolazhsky, Dmitry & Kamenetsky-Goldstein, Rina. (2022). Micropropagation of Grapevine and Strawberry from South Russia: Rapid Production and Genetic Uniformity. Agronomy. 12. 308. 10.3390 / agronomy12020308].

[0027] All primers were designed using the Primer-BLAST program (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). The AY506529.1 sequence was used for the Atp8 gene, and the NM_001371620.1 sequence was used for the MEK1 gene.

[0028] The quantitative indicators obtained using this method ensure the required sensitivity. The main properties of the primers are listed in Table 1.

[0029] Table 1. Characteristics of the primers used.

[0030] Primer Nucleotide sequence, 5'-3' Amplicon (b.n.) Tm (°C) Compartment Atp8_F_CNV CCATTCCTCGTGAGCCACTT 190 60 Mitochondrial DNA Atp8_R_CNV GGGAACAAGATCCGGAGCAA MEK1_F_CNV GATCCGGCTCAGAGGATGTC 209 60 Chromosomal DNA MEK1_R_CNV CAGTTGAGGAGCAGATGCCA

[0031] To carry out quantitative RT-PCR of genomic DNA, genomic DNA samples obtained from the leaves of ten-day-old maize seedlings, obtained in laboratory conditions, are used.

[0032] The quantitative RT-PCR reaction is carried out in a 25 μl reaction mixture consisting of 10 μl of the “Reagent kit for RT-PCR in the presence of EVA Green dye” mixture (“Synthol”, Russia), 0.5 μl of ddH2O (deionized water), 1 μl of the corresponding primers (forward and reverse, 0.33 μM) and 10 μl of genomic DNA.

[0033] PCR is performed using a Rotor-Gene Q5 Plex automatic analyzer "Corbett Research" (Australia) or similar ones using the following program: initial denaturation at 95 ° C for 5 min (1 cycle), then 40 cycles of denaturation at 95 ° C for 10 sec, annealing at 58 ° C for 15 sec and elongation at 72 ° C for 20 sec. Determination of the relative copy number of the Atp8 gene (mitochondrial DNA) is carried out using the MEK1 gene (chromosomal DNA) as a reference. For quantitative assessment, algorithms 2 were used -DCt and 2 -DDCt (Schmittgen, Livak, 2008).

[0034] Main advantages of the offer

[0035] Unlike older methods, a new method using the relative copy number of the mitochondrial DNA ATP8 gene allows for the assessment of the potential intensity of oxidative phosphorylation in maize leaf tissue. Based on molecular genetic methods, it provides specific information on mitochondrial function and energy processes. This allows for a more accurate study of plant energy efficiency and assessment of their physiological state.

[0036] Conducting analysis

[0037] The primary data is analyzed using the amplifier software product in the Ct dimension for each genetic locus, then the relative copy number of the mitochondrial gene Atp8 is calculated relative to the reference gene of the chromosomal localization MEK1 using algorithm 2 -DCt (Schmittgen, Livak, 2008).

[0038] This indicator, using the relative copy number of mitochondrial DNA, allows for a comparative quantitative assessment of the potential intensity of oxidative phosphorylation processes.

[0039] Example

[0040] The relative copy number of mtDNA in tissues of maize varieties with low and high FAO indices was assessed as a possible indicator of the intensity of oxidative phosphorylation processes.

[0041] 1. Experimental plants were obtained from corn seeds of various maturity groups, germinated in accordance with GOST 12038-84 "Seeds of agricultural crops. Methods for determining germination." One seed sample was laid out on two layers of moistened paper measuring 10 x 100 cm (±2 cm), embryo-side down, along a line drawn 2–3 cm from the upper edge of the sheet. The seeds were covered with a strip of moistened paper of the same size, then loosely rolled into a roll and placed vertically in a container with sterile (autoclaved) water (thermostat).

[0042] 2. Plants were incubated at a temperature of 20 ± 1 °C in a TCO-1 / 80 SPU dry-air thermostat (Russia) for 10 days. Six samples of leaf blade fragments (70–100 mg) were randomly selected from each group of plants for subsequent genomic DNA extraction using a modified CTAB method [Kryukov, LA; Vodolazhsky, DI; Kamenetsky-Goldstein, R. Micropropagation of Grapevine and Strawberry from South Russia: Rapid Production and Genetic Uniformity. Agronomy 2022, 12, 308. https: / / doi.org / 10.3390 / agronomy12020308].

[0043] 3. A quantitative RT-PCR reaction was performed with the obtained total DNA preparations in a 25 μl reaction mixture consisting of 10 μl of the “Reagent kit for RT-PCR in the presence of EVA Green dye” mixture (“Synthol”, Russia), 0.5 μl of dd H2O (deionized water), 1 μl of the corresponding primers (forward and reverse, 0.33 μM) and 10 μl of total DNA. RT-PCR was performed using a Rotor-Gene™ Q 5 Plex HRM automated analyzer "Corbett Research" (Australia) using the following program: initial denaturation at 95°C for 5 min (1 cycle), then 40 cycles of denaturation at 95°C for 10 sec, annealing at 58°C for 15 sec and elongation at 72°C for 20 sec. Determination of the relative copy number of the Atp8 gene (mitochondrial DNA) is carried out using the MEK1 gene (chromosomal DNA) as a reference. Algorithm 2 was used for quantitative assessment. -DCt (Schmittgen, Livak, 2008).

[0044] 4. Statistical analysis of the obtained data was performed using parametric and nonparametric tests in STATISTICA 10.0. The results of the statistical analysis are presented in Table 2.

[0045] Table 2. Statistical analysis data of the obtained data.

[0046] Statistical parameters K LowFAO K HighFAO Number of measurements (n) 10 10 Arithmetic mean 111,8 203,1 Median 108,55 169,94 Standard deviation 34,76 78,82 Standard error 10,99 24,92

[0047] A comparative analysis of the obtained data revealed a statistically significant (Student's t-test, p < 1%) difference in the relative mitochondrial DNA copy number in maize leaves between leaf samples with low and high FAO characteristics. The relative mitochondrial DNA copy number in maize with low FAO is almost 2 times lower, based on arithmetic mean values, than in maize with high FAO (Table 2).

[0048] K= ×100%=

[0049] where K is the coefficient of the ratio of the relative copy number indicators between corn varieties with high (K highFAO ) and low (K lowFAO ) FAO compared to that for plants with high FAO (K highFAO ), %;

[0050] K highFAO – an indicator of the relative copy number of mitochondrial DNA of high-FAO maize;

[0051] K lowFAO – an indicator of the relative copy number of mitochondrial DNA of low-FAO maize.

[0052] Using the approach of assessing the relative copy number of mtDNA allows us to identify differences between corn varieties of different maturity groups with high sensitivity and statistical reliability, which can be effectively used in breeding work.

[0053] --->

[0054] <?xml version="1.0" encoding="UTF-8"?>

[0055] <!DOCTYPE ST26SequenceListing PUBLIC "- / / WIPO / / DTD Sequence Listing

[0056] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0057] <st26sequencelisting dtdversion="V1_3" filename="Праймеры.xml"

[0058] softwarename="WIPO Sequence" softwareversion="2.3.0"

[0059] productiondate="2026-07-21">

[0060] <applicationidentification>

[0061] <ipofficecode> RU< / ipofficecode>

[0062] <applicationnumbertext> 2025117104< / applicationnumbertext>

[0063] <filingdate> 2025-06-20< / filingdate>

[0064] < / applicationidentification>

[0065] <applicantfilereference> 2026-01< / applicantfilereference>

[0066] <earliestpriorityapplicationidentification>

[0067] <ipofficecode> RU< / ipofficecode>

[0068] <applicationnumbertext> 2025117104< / applicationnumbertext>

[0069] <filingdate> 2025-06-20< / filingdate>

[0070] < / earliestpriorityapplicationidentification>

[0071] <applicantname languagecode="ru">Federal State

[0072] Budgetary scientific institution "All-Russian research

[0073] Corn Institute"< / applicantname>

[0074] <applicantnamelatin>Federalnoe gosudarstvennoe biudzhetnoe nauchnoe

[0075] Institution "All-Russian Scientific Research Institute

[0076] corn"< / applicantnamelatin>

[0077] <inventiontitle languagecode="ru">Comparative evaluation method

[0078] The impact of low and high FAO maize indicators on the indicators

[0079] relative copy number of mitochondrial DNA< / inventiontitle>

[0080] <sequencetotalquantity> 4< / sequencetotalquantity>

[0081] <sequencedata sequenceidnumber="1">

[0082] <insdseq>

[0083] <INSDSeq_length> 20< / INSDSeq_length>

[0084] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0085] <INSDSeq_division> PAT< / INSDSeq_division>

[0086] <INSDSeq_feature-table>

[0087] <insdfeature>

[0088] <INSDFeature_key>source< / INSDFeature_key>

[0089] <INSDFeature_location>1..20< / INSDFeature_location>

[0090] <INSDFeature_quals>

[0091] <insdqualifier>

[0092] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0093] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0094] < / insdqualifier>

[0095] <insdqualifier id="q10">

[0096] <INSDQualifier_name>organism< / INSDQualifier_name>

[0097] <INSDQualifier_value>Zea mays< / INSDQualifier_value>

[0098] < / insdqualifier>

[0099] < / INSDFeature_quals>

[0100] < / insdfeature>

[0101] < / INSDSeq_feature-table>

[0102] <INSDSeq_sequence> ccattcctcgtgagccactt< / INSDSeq_sequence>

[0103] < / insdseq>

[0104] < / sequencedata>

[0105] <sequencedata sequenceidnumber="2">

[0106] <insdseq>

[0107] <INSDSeq_length> 20< / INSDSeq_length>

[0108] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0109] <INSDSeq_division> PAT< / INSDSeq_division>

[0110] <INSDSeq_feature-table>

[0111] <insdfeature>

[0112] <INSDFeature_key>source< / INSDFeature_key>

[0113] <INSDFeature_location>1..20< / INSDFeature_location>

[0114] <INSDFeature_quals>

[0115] <insdqualifier>

[0116] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0117] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0118] < / insdqualifier>

[0119] <insdqualifier id="q11">

[0120] <INSDQualifier_name>organism< / INSDQualifier_name>

[0121] <INSDQualifier_value>Zea mays< / INSDQualifier_value>

[0122] < / insdqualifier>

[0123] < / INSDFeature_quals>

[0124] < / insdfeature>

[0125] < / INSDSeq_feature-table>

[0126] <INSDSeq_sequence> gggaacaagatccggagcaa< / INSDSeq_sequence>

[0127] < / insdseq>

[0128] < / sequencedata>

[0129] <sequencedata sequenceidnumber="3">

[0130] <insdseq>

[0131] <INSDSeq_length> 20< / INSDSeq_length>

[0132] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0133] <INSDSeq_division> PAT< / INSDSeq_division>

[0134] <INSDSeq_feature-table>

[0135] <insdfeature>

[0136] <INSDFeature_key>source< / INSDFeature_key>

[0137] <INSDFeature_location>1..20< / INSDFeature_location>

[0138] <INSDFeature_quals>

[0139] <insdqualifier>

[0140] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0141] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0142] < / insdqualifier>

[0143] <insdqualifier id="q12">

[0144] <INSDQualifier_name>organism< / INSDQualifier_name>

[0145] <INSDQualifier_value>Zea mays< / INSDQualifier_value>

[0146] < / insdqualifier>

[0147] < / INSDFeature_quals>

[0148] < / insdfeature>

[0149] < / INSDSeq_feature-table>

[0150] <INSDSeq_sequence> gatccggctcagaggatgtc< / INSDSeq_sequence>

[0151] < / insdseq>

[0152] < / sequencedata>

[0153] <sequencedata sequenceidnumber="4">

[0154] <insdseq>

[0155] <INSDSeq_length> 20< / INSDSeq_length>

[0156] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0157] <INSDSeq_division> PAT< / INSDSeq_division>

[0158] <INSDSeq_feature-table>

[0159] <insdfeature>

[0160] <INSDFeature_key>source< / INSDFeature_key>

[0161] <INSDFeature_location>1..20< / INSDFeature_location>

[0162] <INSDFeature_quals>

[0163] <insdqualifier>

[0164] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0165] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0166] < / insdqualifier>

[0167] <insdqualifier id="q13">

[0168] <INSDQualifier_name>organism< / INSDQualifier_name>

[0169] <INSDQualifier_value>Zea mays< / INSDQualifier_value>

[0170] < / insdqualifier>

[0171] < / INSDFeature_quals>

[0172] < / insdfeature>

[0173] < / INSDSeq_feature-table>

[0174] <INSDSeq_sequence> cagtgaggagcagatgcca< / INSDSeq_sequence>

[0175] < / insdseq>

[0176] < / sequencedata>

[0177] < / st26sequencelisting>

[0178] <---

Claims

1. A method for comparative assessment of the influence of low and high FAO values ​​of maize on the relative copy number of mitochondrial DNA, characterized by the fact that the leaves of ten-day-old maize seedlings of early and late maturity groups are used for DNA extraction, the total genomic DNA from 70-100 mg of plant tissue of each sample is extracted using a modified DNA extraction procedure by the CTAB method, the design of primers for non-overlapping genes is performed using Primer-BLAST, and the nucleotide sequences used are primers for the ATP8 and MEK1 genes: - for Atp8_F_CNV– (5') CCATTCCTCGTGAGCCACTT (3'); - for Atp8_R_CNV– (5') GGGAACAAGATCCGGAGCAA (3'); - for MEK1_F_CNV– (5') GATCCGGCTCCAGAGGATGTC (3'); - for MEK1_R_CNV– (5') CAGTTGAGGAGGAGCAGATGCCA (3'); RT-PCR is carried out in a 25 μl reaction mixture containing: 10 μl of the “Reagent kit for RT-PCR in the presence of EVA Green dye” mixture, 0.5 μl of ddH2O - deionized water, 1 μl of the corresponding primers: forward and reverse, 0.33 μM, and 10 μl of total DNA, PCR is carried out using a Rotor-Gene Q 5 Plex HRM “Corbett Research” automatic analyzer according to the program: 1 cycle of denaturation at 95°C for 5 min, then 40 cycles of denaturation at 95°C for 10 s, annealing at 58°C for 15 s and elongation at 72°C for 20 s, determination of the relative copy number of the Atp8 genes is carried out using the MEK1 gene as a reference.

2. The evaluation method according to paragraph 1, characterized in that the early maturity group corn sprouts have an FAO index of 130 and 150, and the late maturity group have an FAO index of 400 and 500.