Method for molecular genetic identification of soybean varieties based on multiplex microsatellite analysis

Abstract

FIELD: biotechnology.SUBSTANCE: method for molecular genetic identification of soybean varieties based on multiplex microsatellite analysis. The specified method involves carrying out two multiplex PCRs using mixtures of primers amplifying the trinucleotide microsatellite loci Satt507, Satt681, Satt149, Satt532, Satt141, Satt614, Satt442, Satt263, Satt309, Satt359, Satt286 in the first multiplex system, and primers amplifying the trinucleotide microsatellite loci CSSR531, Satt596, Satt287, Satt197, AW277661, Satt181, Satt168, Satt549, Satt353, Satt292, Soyprp1 in the second multiplex system.EFFECT: fast and accurate method for identifying soybean varieties, ensuring the formation of informative DNA profiles based on the analysis of individual plants of the variety.1 cl, 5 dwg, 2 tbl, 1 ex

Description

[0001] The technical field to which the invention relates.

[0002] The invention relates to the field of plant breeding, seed production and biotechnology and can be used for molecular genetic certification and identification of soybean varieties, identification of biotypes, as well as assessment of the typicality and genetic purity of seed lots.

[0003] Technique level.

[0004] In modern conditions, with the existing diversity of agricultural crop varieties, it is important to have a reliable method for quickly and accurately identifying a variety when submitting it to State Variety Testing to determine its distinctiveness from other known varieties, homogeneity and stability (OOS criterion), DNA certification, as well as in the event of controversial issues to protect the rights of originators.

[0005] Microsatellite markers (SSR – Simple Sequence Repeats) are markers that amplify microsatellite DNA loci that contain simple repeating sequences (motifs) 1-6 bp in length. These loci have a high level of polymorphism, consisting of differences in the number of such motifs in different individuals. The advantages of microsatellite markers also include a codominant type of inheritance, reproducibility of analysis results, and relative ease of detection. They are effectively used for genotyping agricultural crops for their identification, certification, assessment of the degree of genetic relationship, and genetic mapping. [Vieira MLC, Santini L., Diniz AL, Munhoz CDF Microsatellite markers: what they mean and why they are so useful / / Genetics and molecular biology. – 2016. – No. 39. – P. 312-328].Using 25 microsatellite markers, a genetic collection of 100 soybean accessions was differentiated [Zatybekov A., Moldir Yermagambetova M., Genievskaya Y., Didorenko S., Abugalieva S. Genetic diversity analysis of soybean collection using simple sequence repeat markers / / Plants. - 2023. - No. 12. - P. 3445. DOI: 10.3390 / plants12193445]. Twenty-eight sunflower lines were identified and their genetic diversity was studied using 18 microsatellite markers [Golovatskaya A.V., Guchetl S.Z. Evaluation of genetic diversity of sunflower lines bred at VNIIMK based on multiplex microsatellite analysis / / Agrarian science. – 2024. – No. 11. – P. 117-121. DOI: 10.32634 / 0869-8155-2024-388-11-117-121]. The polymorphism of 40 pea varieties and lines was studied using 5 microsatellite markers [Gainullina K.P., Kuluev B.R., Davletov F.A. Evaluation of genetic diversity of pea varieties and lines using SSR analysis. Transactions on applied botany, genetics and breeding. – 2020. – No. 181 (3). – P. 70-80. DOI: 10.30901 / 2227-8834-2020-3-70-80].

[0006] A known method for identifying soybean varieties based on microsatellite markers involves using 9 microsatellite markers to obtain a DNA profile of the variety [Patent No. 2388828 C1 Russian Federation, IPC C12Q 1 / 68, A01H 1 / 04. Method for identifying soybean varieties based on microsatellite (SSR) markers: No. 2008142788 / 13: declared 28.10.2008: published 10.05.2010 / T.S. Antonova, S.A. Ramazanova, S.Z. Guchetl, T.A. Chelyustnikova; applicant State Scientific Institution All-Russian Research Institute of Oil Crops named after V.S. Pustovoit of the Russian Academy of Agricultural Sciences]. The disadvantages of the known method are: the duration and labor intensity of the analysis, which consists of the stage of seed germination, polymerase chain reactions (PCR) and subsequent separation of PCR products for each microsatellite marker separately.The method has low accuracy due to the insufficient number of microsatellite markers to form a unique DNA profile of the variety and the separation of PCR products by electrophoresis in agarose gel, which has low resolution.

[0007] The use of multiplex systems allows for the amplification of DNA fragments by several markers within a single PCR, which significantly reduces the duration and labor intensity of variety identification. Multiplex systems consisting of 2-5 microsatellite markers have been developed for soybean [Deo S., James A., Singh SK, Singh CB, Rana MK Development of multiplex microsatellite marker sets in soybean [Glycine max (L.) Merr.] / / Int. J. Curr. Microbiol. App. Sci. - 2020. - V. 9. - No. 10. - P. 2272-2280]. The disadvantage of this method is the separation of PCR products in a 3% agarose gel, which has low resolution, as well as the difficulty of interpreting the electrophoresis results.

[0008] The technical solution closest to the claimed method is the use of multiplex systems of microsatellite markers for the identification of soybeans with the separation of their PCR products by capillary electrophoresis [Patent No. 2839697 C1 Russian Federation, IPC C12Q 1 / 68. Method for molecular genetic identification of soybean varieties and lines: declared 01.11.2024: published 12.05.2025 / M. G. Divashuk, P. Yu. Krupin, G. I. Karlov [et al.]; applicant Federal State Budgetary Scientific Institution All-Russian Research Institute of Agricultural Biotechnology]. This method involves isolating DNA, performing two multiplex PCRs containing 8 and 7 pairs of oligonucleotide primers, respectively, and visualizing the PCR products using capillary electrophoresis.However, the use of a seed mixture for DNA extraction in this method, and consequently in subsequent analysis, does not allow for the consideration of intravarietal genetic heterogeneity (intravarietal polymorphism). This analysis produces an average DNA profile for the variety, which does not reflect the presence of individual biotypes, precludes the detection of atypical genotypes, and reduces the reliability of certification and identification of soybean varieties. The proposed number of microsatellite markers (15) may be insufficient for variety differentiation. Furthermore, this method uses dinucleotide markers alongside microsatellite loci with trinucleotide motifs, which make electrophoresis results difficult to interpret due to the appearance of artifactual amplification products differing by two nucleotides, which can lead to analytical errors.

[0009] Thus, known technical solutions do not allow for the precise identification of soybean varieties in a way that would simultaneously ensure the accuracy and speed of analysis, and also allow for the formation of DNA profiles of the variety taking into account intravarietal polymorphism, which is only fully possible through the analysis of individual DNA profiles of each plant in the sample.

[0010] The essence of the invention.

[0011] The problem solved by the invention consists in eliminating the limitations of known methods for identifying soybean varieties, caused by the high labor intensity of the analysis procedures performed, the insufficient accuracy of the methods used and the averaging of genetic information during the formation of DNA profiles, which together complicates varietal identification.

[0012] The aim of the claimed invention is to develop a fast and accurate method for identifying soybean varieties, ensuring the formation of informative DNA profiles based on the analysis of individual plants of the variety using multiplex systems of microsatellite markers and applicable for assessing the typicality and genetic purity of seed lots.

[0013] The technical result is achieved in that the method for molecular genetic identification of soybean varieties based on multiplex microsatellite analysis includes: preparing plant material, isolating DNA from individual plants, conducting two multiplex PCR using primer mixtures with the nucleotide sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, amplifying the trinucleotide microsatellite loci Satt507, Satt681, Satt149, Satt532, Satt141, Satt614, Satt442, Satt263, Satt309, Satt359, Satt286 in the first multiplex system and SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31,SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44 - CSSR531, Satt596, Satt287, Satt197, AW277661, Satt181, Satt168, Satt549, Satt353, Satt292, Soyprp1, amplifying trinucleotide microsatellite loci CSSR531, Satt596, Satt287, Satt197, AW277661, Satt181, Satt168, Satt549, Satt353, Satt292, and Soyprp1 in a second multiplex system, separation of PCR products by two capillary electrophoresis runs, and determination of DNA fragment sizes. A DNA profile for a variety is formed based on analysis of a sample of individual plants using 22 microsatellite markers. Variety identification is performed by comparing the DNA profiles of different varieties or batches of a single variety.

[0014] To accomplish the task, multiplex systems of soybean microsatellite markers were developed, for the formation of which new sequences of flanking primers to known microsatellite loci with trinucleotide motifs were designed (URL: https: / / soybase.org / ): Satt681 (SEQ ID NO: 3, 4), Satt149 (SEQ ID NO: 5, 6), Satt141 (SEQ ID NO: 9, 10), Satt614 (SEQ ID NO: 11, 12), Satt442 (SEQ ID NO: 13, 14), Satt263 (SEQ ID NO: 15, 16), Satt309 (SEQ ID NO: 17, 18), Satt359 (SEQ ID NO: 19, 20), Satt286 (SEQ ID NO: 21, 22), CSSR531 (SEQ ID NO: 23, 24), Satt596 (SEQ ID NO: 25, 26), Satt287 (SEQ ID NO: 27, 28), Satt197 (SEQ ID NO: 29, 30), AW277661 (SEQ ID NO: 31, 32), Satt181 (SEQ ID NO: 33, 34), Satt549 (SEQ ID NO: 37, 38), Satt353 (SEQ ID NO: 39, 40), Satt292 (SEQ ID NO: 41, 42), Soyprp1 (SEQ ID NO: 43, 44), using the Primer-Blast tool (URL: https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) and soybean reference genome Glycine_max_v4.0 (Williams 82 variety).The primer sequences for the Satt507 (SEQ ID NOs: 1, 2), Satt532 (SEQ ID NOs: 7, 8), and Satt168 (SEQ ID NOs: 35, 36) loci were not reconstructed. The following parameters were taken into account when selecting primer pairs for multiplex PCR: similar annealing temperatures, the absence of nonspecific annealing between primer pairs, and a range of amplified DNA fragment sizes to determine detection channels accordingly, such that the peaks of one marker do not overlap those of another in electropherograms.

[0015] A comparative analysis of the claimed invention with the known technical solution allows us to conclude that the claimed method for molecular genetic identification of soybean varieties based on multiplex microsatellite analysis differs from the known one in the following ways:

[0016] - DNA extraction from individual plants,

[0017] - a set of microsatellite markers,

[0018] - the substances used are primers,

[0019] - by carrying out two capillary electrophoresis,

[0020] - formation of a DNA profile of a variety based on the analysis of individual plants of the variety,

[0021] - determination of biotypes in the variety, if any,

[0022] - comparison of DNA profiles of varieties, formed based on data from a sample of individual plants.

[0023] All of the above features confirm the novelty of the claimed invention.

[0024] Brief description of drawings

[0025] Fig. 1. Electropherogram of the separation of PCR products of multiplex system 1 using the example of the soybean plant of the Lira variety.

[0026] Fig. 2. Electropherogram of the separation of PCR products of multiplex system 2 using the example of the soybean plant of the Lira variety.

[0027] Fig. 3. DNA profile of the soybean variety Lira using 22 microsatellite markers.

[0028] Fig. 4. DNA profile of the soybean variety Svoya using 22 microsatellite markers.

[0029] Fig. 5. DNA profile of the soybean variety Lyubava using 22 microsatellite markers

[0030] Implementation of the invention.

[0031] Preparation of plant material, including the selection and grinding of plant tissues from individual plants, is carried out depending on the type (seeds, leaves and other plant parts) and the subsequent method of DNA extraction. DNA is extracted by known methods (using reagents for extraction with sorption on magnetic particles or using CTAB - cetyltrimethylammonium bromide). Multiplex PCR is carried out in a thermal cycler in reaction mixtures including reagents (PCR buffer, MgCl2, deoxynucleoside triphosphates, DNA polymerase) and mixtures of synthesized oligonucleotide primers, the sequences of which are presented in Table 1 and the Sequence Listing: SEQ ID NO: 1–SEQ ID NO: 22 for multiplex system 1 and SEQ ID NO: 23–SEQ ID NO: 44 for multiplex system 2.One of each pair of oligonucleotide primers is modified with a fluorophore, such as FAM, R6G, TAMRA, ROX (Table 1), or others detectable in the corresponding channels of the PCR product separation device used. To obtain a DNA profile, fragment analysis is used, with PCR product separation by capillary electrophoresis under denaturing conditions on a genetic analyzer. PCR products from each of the two multiplex systems are analyzed separately. The DNA fragment size is calculated relative to a size standard using software. From the dataset of DNA fragment sizes for all markers, a DNA profile is generated, which is used for certification and identification of the soybean variety.

[0032] Table 1 – Multiplex microsatellite marker systems for identification of soybean varieties

[0033] Microsatellite marker Chromosome Motive SEQ ID NO: Oligonucleotide primer sequences with fluorophores indicated, 5`-3` Range of DNA fragment sizes, bp Multiplex System 1 Satt507 1 (ATT)n 1 (FAM)GCGCTCAGCCTTGTTAAATCACTT 196-217 2 GCGCTACTCTCGTGTCGTTAGTTA Satt681 6 (TTA)n 3 (FAM)GGACCCTCGTGGAAACCTAC 327-360 4 ATATTGCATGTAACCAAAGTCCCTCT Satt149 13 (ATT)n 5 (FAM)GCTACAGTCACAGTACTTACCCTTT 398-425 6 CGAGTTGGAGGCCATAGTCAC Satt532 1 (ATT)n 7 (R6G)GCGCCAATATTATCATGCTTTATGT 162-177 8 GCGTGTAAAAATCTTTGAATCTTGA Satt141 2 (ATA)n 9 (R6G)ACACGATCAGGACTCTTTCGT 277-331 10 GCCGTCATAAAAAGTCCCTCAGA Satt614 20 (TTA)n 11 (R6G)ACCCAATCATAAGTTTCTCCCCT 415-553 12 TGAGCTCAACTGAGTCACGTC Satt442 12 (TAA)n 13 (TAMRA)ACCTGGACTTGTTTGCTCATCA 174-210 14 GCGTGTAATTATGCATTCGAGTGTT Satt263 15 (TTA)n 15 (TAMRA)TGCACCCAATCATGATAGCATTT 308-353 16 ATATGGTCTTAAGAGACCGACCCA Satt309 18 (ATT)n 17 (ROX)TCGAGTCCTTCAAATTGGCGT 255-276 18 GGCTAGATTCAAGAAACAAAAGGT Satt359 11 (TAT)n 19 (ROX)TGATCATTGACTACTCGAATGTGAT 348-378 20 TCTCAAATCCAAGCTGCCGT Satt286 6 (ATT)n 21 (ROX)TGGCATGGTATCCTTGCTACATA 451-469 22 TCATCTTGTTTGGAGGGAATAGC Multiplex system 2 CSSR531 7 (TAA)n 23 (FAM)GTGTGAAATGGCTAACCCGC 95-116 24 GGCCATGCACCTGCTACTT Satt596 16 (AAT)n 25 (FAM)CCGTCGATTCCGTACAAGATAG 237-285 26 CCCTTCGTCCACCAAATATTCAA Satt287 16 (ATA)n 27 (FAM)GCCAATTCCATTGTGTGTCAG 360-399 28 GGTTTGTTCAGTGGTGGGAGA Satt197 11 (ATT)n 29 (R6G)AAATTGACAACCGAAGAATTACGTG 151-211 30 GCCACCTAATCCAATGGGCA AW277661 4 (TAT)n 31 (R6G)CCCGAAAGAAAGACAGAAAACCC 257-284 32 ATATGAAAGTAGGTGACCATGGAGC Satt181 12 (ATT)n 33 (R6G)ACTAGCCAAGGGAGAGAGGAG 331-385 34 CCCAACAAAAATTTGAACCCCGT Satt168 14 (ATA)n 35 (TAMRA)CGCTTGCCAAAAATTAATAGTA 199-235 36 CCATTCTCCAACCTCAATCTTATAT Satt549 3 (TAT)n 37 (TAMRA)CGCAACAATCACTAGTACGGG 284-320 38 CCAGCAGGCCCAAGGTTTAT Satt353 12 (TTA)n 39 (ROX)ATACACGCATTGCCTTTCCTG 221-254 40 GCTCAAAAGCCCTATCTTAACCAAA Satt292 20 (ATA)n 41 (ROX)AAGGCTAACTTCTTTGGGTTGAGA 294-339 42 GAAGGCCAACATTGAAAAGTCGT Soyprp1 9 (TAT)n 43 (ROX)AGATCGAAGAGGTACGTGCCAA 360-393 44 ATGGCTGCCAGCTGCATATT

[0034] The claimed method is further illustrated in detail using a specific example representing preferred embodiments of the invention. However, the invention is not limited to the described method, but includes any alternatives and modifications that are possible given the essence of the invention, such as using leaf fragments and other plant parts rather than seeds as plant material, replacing fluorophores or redistributing them between microsatellite markers, varying the concentrations of primers and other reagents added to the reaction mixture, changing the number of plants of a variety analyzed, and amplification conditions.

[0035] Example.

[0036] Preparation of plant material for analysis.

[0037] To identify the soybean varieties Lira, Svoya, Lyubava (originator FGBNU FNC VNIIMK), 30 seeds were selected from each variety and each plant (seed) was analyzed separately, since our studies have established that soybean varieties have intravarietal polymorphism [Savichenko V.G., Savichenko D.L., Ramazanova S.A., Guchetl S.Z. Genetic polymorphism of soybean varieties bred at VNIIMK / / Achievements of science and technology of the agro-industrial complex. - 2024. - Vol. 38. - No. 10. - P. 5-10. DOI: 10.53859 / 02352451_2024_38_10_5]. Therefore, for accurate identification, it is necessary to analyze a sample of individual plants (not in a mixture) of the variety in order to take into account intravarietal polymorphism. The axial organs of the embryo (the embryo) were excised from each seed using a scalpel. The embryos were placed in a separate, capped test tube, each with a metal homogenizing ball, and ground to a powder using a KZ-III-FP homogenizer (Servicebio, China).

[0038] DNA extraction. DNA extraction was performed using the MagnoPrime FITO DNA extraction reagent kit (NextBio LLC, Russia) on an Auto-Pure 96 automated nucleic acid extraction and purification station (Allsheng, China) according to the manufacturer's instructions. The concentration of the extracted DNA was measured using a Micro Spectrophotometer Nano-300 spectrophotometer (Allsheng, China).

[0040] Conducting multiplex PCR.

[0041] For each multiplex PCR, a reaction mixture was prepared separately based on the following: 1 reaction with a volume of 10 μl (of which 2 μl were allocated for DNA with a concentration of 25 ng / μl) contained: 1 μl of 10x PCR buffer B, 25 mM MgCl2, a mixture of deoxynucleoside triphosphates (with a concentration of each 50 μM), 0.25 μl of 5 U / μl SynTaq DNA polymerase (Synthol, Russia) and deionized water, for the first multiplex system, 0.010 μl of each primer of the microsatellite marker Satt149 were added, 0.015 μl of Satt507, Satt141, Satt532, 0.035 μl of Satt681, 0.040 µl – Satt309, 0.045 each – Satt442, 0.080 µl each – Satt263, Satt359, 0.090 µl each – Satt614, 0.095 each – Satt286; For the second multiplex system, 0.005 μl of CSSR531, 0.010 μl of AW277661, 0.015 μl of Satt596, Satt287, Satt197, Satt181, 0.035 μl of Satt353, 0.055 μl of Satt168, Satt549, 0.060 μl of Satt292, and 0.065 μl of Soyprp1 were added (the working concentrations of all primers were 50 pmol / μl).In addition to the DNA of plants of each variety, one positive control sample (PCS) was analyzed for each multiplex system to check the specificity of amplification and exclude the assignment of erroneous values ​​of allelic states to the analyzed samples, and one negative control sample (NCS) to exclude sample contamination. DNA of the Lira soybean variety (originator: FSBSI FSC VNIIMK) was used as the PCS, and deionized water was used as the NCS. Amplification in both multiplex systems was carried out under the same conditions in a GeneExplorer thermal cycler (Bioer, China): initial denaturation at 95 °C for 2 min; then 35 cycles: denaturation at 95 °C for 5 sec, annealing at 62 °C for 1 min. 30 sec; then final elongation at 65 °C for 30 min.

[0042] Separation of PCR products and determination of DNA fragment sizes.

[0043] PCR products were separated by capillary electrophoresis under denaturing conditions using fragment analysis on a Nanofor 05 genetic analyzer (Institute of Analytical Problems of the Russian Academy of Sciences, Russian Federation) for each multiplex system separately. Fragment analysis was prepared and run according to the user manual. SD-600 (Synthol, Russia) was used as a size standard. After capillary electrophoresis, the DNA fragment sizes were determined using GeneMarker version 3.0.1 software. The resulting electropherograms for each detection channel for all microsatellite markers were checked for compliance with the determined DNA fragment sizes of the positive control sample (PCS) and the absence of peaks in the yield range of the target fragments for the negative control sample.

[0044] Table 2 – Values ​​of the sizes of PKO fragments

[0045] Channel Detection Microsatellite marker DNA fragment size, bp Multiplex System 1 Blue (FAM) Satt507 211 Satt681 333 Satt149 407 Green (R6G) Satt532 165 Satt141 319 Satt614 433 Yellow (TAMRA) Satt442 192 Satt263 338 Red (ROX) Satt309 261 Satt359 348 Satt286 466 Multiplex System 2 Blue (FAM) CSSR531 110 Satt596 237 Satt287 360 Green (R6G) Satt197 202 AW277661 275 Satt181 364 Yellow (TAMRA) Satt168 199 Satt549 299 Red (ROX) Satt353 251 Satt292 336 Soyprp1 360

[0046] Next, on electropherograms for each detection channel, plants of the varieties were analyzed for all microsatellite markers of multiplex system 1 (Fig. 1) and multiplex system 2 (Fig. 2).

[0047] Formation of the DNA profile of the variety.

[0048] The DNA profile of a variety is a data set with DNA fragment sizes for all 22 microsatellite markers obtained for each analyzed plant of the variety. Since 30 plants of each variety were analyzed, the DNA profiles of each of these plants were compared with each other. Differing plants indicate the presence of intravarietal polymorphism. All analyzed soybean varieties consist of two biotypes that differ in microsatellite markers: Lira - Satt596 (Fig. 3), Svoya - Satt141 (Fig. 4), Lyubava - Soyprp1 (Fig. 5). The obtained DNA profiles of the varieties were used for their certification and identification.

[0049] During variety certification, original seeds (category OS) were analyzed. The resulting DNA profile was used as the variety's passport. The DNA profiles (passports) of the varieties were compared to each other to establish differences between them. The analyzed soybean varieties Svoya, Lira, and Lyubava have unique DNA profiles and, therefore, differ from each other. Further variety identification was conducted by comparing the DNA profiles of the analyzed seed lot with the passport.

[0050] Using the proposed method, a soybean variety's DNA profile can be generated using 22 microsatellite markers, using only two multiplex PCR reactions and two capillary electrophoresis runs on a genetic analyzer. This reduces the labor intensity and duration of the analysis and improves identification accuracy by using a high-resolution method—capillary electrophoresis—to separate PCR products. Conducting analysis on a sample of individual plants allows for the consideration of intravarietal genetic heterogeneity, identifying individual biotypes, and generating an informative DNA profile suitable for both precise varietal identification and subsequent assessment of the genetic purity of seed lots.

[0051] --->

[0052] <?xml version="1.0" encoding="UTF-8"?>

[0053] <!DOCTYPE ST26SequenceListing PUBLIC"- / / WIPO / / DTD Sequence Listing

[0054] 1.3 / / EN" "ST26SequenceListing_V1_3.dtd">

[0055] <ST26SequenceListing originalFreeTextLanguageCode="ru"

[0056] dtdVersion="V1_3" fileName="Molecular-genetic method

[0057] Identification of soybean varieties based on multiplex microsatellite

[0058] analiza.xml" softwareName="WIPO Sequence" softwareVersion="3.1.2"

[0059] productionDate="2026-07-23">

[0060] <applicationidentification>

[0061] <ipofficecode> UK< / ipofficecode>

[0062] <applicationnumbertext> 2025138755< / applicationnumbertext>

[0063] <filingdate> 2025-12-26< / filingdate>

[0064] < / applicationidentification>

[0065] <applicantname languagecode="ru">Federal State

[0066] Budgetary scientific institution "Federal Scientific Center

[0067] All-Russian Research Institute of Oil Crops

[0068] named after V.S. Pustovoit"< / applicantname>

[0069] <applicantnamelatin>V.S. Pustovoit All-Russia Research Institute of

[0070] Oil Crops< / applicantnamelatin>

[0071] <inventorname languagecode="ru">Savichenko Violetta

[0072] Georgievna< / inventorname>

[0073] <inventornamelatin>Savichenko Violetta

[0074] Georgievna< / inventornamelatin>

[0075] <inventiontitle languagecode="ru">Method of molecular genetic

[0076] Identification of soybean varieties based on multiplex microsatellite

[0077] analysis< / inventiontitle>

[0078] <sequencetotalquantity> 44< / sequencetotalquantity>

[0079] <sequencedata sequenceidnumber="1">

[0080] <insdseq>

[0081] <INSDSeq_length> 24< / INSDSeq_length>

[0082] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0083] <INSDSeq_division> PAT< / INSDSeq_division>

[0084] <INSDSeq_feature-table>

[0085] <insdfeature>

[0086] <INSDFeature_key>source< / INSDFeature_key>

[0087] <INSDFeature_location>1..24< / INSDFeature_location>

[0088] <INSDFeature_quals>

[0089] <insdqualifier>

[0090] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0091] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0092] < / insdqualifier>

[0093] <insdqualifier id="q2">

[0094] <INSDQualifier_name>organism< / INSDQualifier_name>

[0095] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0096] < / insdqualifier>

[0097] < / INSDFeature_quals>

[0098] < / insdfeature>

[0099] < / INSDSeq_feature-table>

[0100] <INSDSeq_sequence> gcgctcagccttgttaaatcactt< / INSDSeq_sequence>

[0101] < / insdseq>

[0102] < / sequencedata>

[0103] <sequencedata sequenceidnumber="2">

[0104] <insdseq>

[0105] <INSDSeq_length>24< / INSDSeq_length>

[0106] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0107] <INSDSeq_division>PAT< / INSDSeq_division>

[0108] <INSDSeq_feature-table>

[0109] <insdfeature>

[0110] <INSDFeature_key>source< / INSDFeature_key>

[0111] <INSDFeature_location>1..24< / INSDFeature_location>

[0112] <INSDFeature_quals>

[0113] <insdqualifier>

[0114] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0115] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0116] < / insdqualifier>

[0117] <insdqualifier id="q4">

[0118] <INSDQualifier_name>organism< / INSDQualifier_name>

[0119] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0120] < / insdqualifier>

[0121] < / INSDFeature_quals>

[0122] < / insdfeature>

[0123] < / INSDSeq_feature-table>

[0124] <INSDSeq_sequence>gcgctactctcgtgtcgttagtta< / INSDSeq_sequence>

[0125] < / insdseq>

[0126] < / sequencedata>

[0127] <sequencedata sequenceidnumber="3">

[0128] <insdseq>

[0129] <INSDSeq_length> 20< / INSDSeq_length>

[0130] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0131] <INSDSeq_division> PAT< / INSDSeq_division>

[0132] <INSDSeq_feature-table>

[0133] <insdfeature>

[0134] <INSDFeature_key>source< / INSDFeature_key>

[0135] <INSDFeature_location>1..20< / INSDFeature_location>

[0136] <INSDFeature_quals>

[0137] <insdqualifier>

[0138] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0139] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0140] < / insdqualifier>

[0141] <insdqualifier id="q6">

[0142] <INSDQualifier_name>organism< / INSDQualifier_name>

[0143] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0144] < / insdqualifier>

[0145] < / INSDFeature_quals>

[0146] < / insdfeature>

[0147] < / INSDSeq_feature-table>

[0148] <INSDSeq_sequence> ggaccctcgtggaaacctac< / INSDSeq_sequence>

[0149] < / insdseq>

[0150] < / sequencedata>

[0151] <sequencedata sequenceidnumber="4">

[0152] <insdseq>

[0153] <INSDSeq_length> 26< / INSDSeq_length>

[0154] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0155] <INSDSeq_division> PAT< / INSDSeq_division>

[0156] <INSDSeq_feature-table>

[0157] <insdfeature>

[0158] <INSDFeature_key>source< / INSDFeature_key>

[0159] <INSDFeature_location>1..26< / INSDFeature_location>

[0160] <INSDFeature_quals>

[0161] <insdqualifier>

[0162] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0163] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0164] < / insdqualifier>

[0165] <insdqualifier id="q8">

[0166] <INSDQualifier_name>organism< / INSDQualifier_name>

[0167] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0168] < / insdqualifier>

[0169] < / INSDFeature_quals>

[0170] < / insdfeature>

[0171] < / INSDSeq_feature-table>

[0172] <INSDSeq_sequence> atattgcatgtaaccaaagtccctct< / INSDSeq_sequence>

[0173] < / insdseq>

[0174] < / sequencedata>

[0175] <sequencedata sequenceidnumber="5">

[0176] <insdseq>

[0177] <INSDSeq_length>25< / INSDSeq_length>

[0178] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0179] <INSDSeq_division>PAT< / INSDSeq_division>

[0180] <INSDSeq_feature-table>

[0181] <insdfeature>

[0182] <INSDFeature_key>source< / INSDFeature_key>

[0183] <INSDFeature_location>1..25< / INSDFeature_location>

[0184] <INSDFeature_quals>

[0185] <insdqualifier>

[0186] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0187] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0188] < / insdqualifier>

[0189] <insdqualifier id="q10">

[0190] <INSDQualifier_name>organism< / INSDQualifier_name>

[0191] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0192] < / insdqualifier>

[0193] < / INSDFeature_quals>

[0194] < / insdfeature>

[0195] < / INSDSeq_feature-table>

[0196] <INSDSeq_sequence>gctacagtcacagtacttacccttt< / INSDSeq_sequence>

[0197] < / insdseq>

[0198] < / sequencedata>

[0199] <sequencedata sequenceidnumber="6">

[0200] <insdseq>

[0201] <INSDSeq_length> 21< / INSDSeq_length>

[0202] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0203] <INSDSeq_division> PAT< / INSDSeq_division>

[0204] <INSDSeq_feature-table>

[0205] <insdfeature>

[0206] <INSDFeature_key>source< / INSDFeature_key>

[0207] <INSDFeature_location>1..21< / INSDFeature_location>

[0208] <INSDFeature_quals>

[0209] <insdqualifier>

[0210] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0211] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0212] < / insdqualifier>

[0213] <insdqualifier id="q12">

[0214] <INSDQualifier_name>organism< / INSDQualifier_name>

[0215] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0216] < / insdqualifier>

[0217] < / INSDFeature_quals>

[0218] < / insdfeature>

[0219] < / INSDSeq_feature-table>

[0220] <INSDSeq_sequence> cgagttggaggccatagtcac< / INSDSeq_sequence>

[0221] < / insdseq>

[0222] < / sequencedata>

[0223] <sequencedata sequenceidnumber="7">

[0224] <insdseq>

[0225] <INSDSeq_length> 25< / INSDSeq_length>

[0226] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0227] <INSDSeq_division> PAT< / INSDSeq_division>

[0228] <INSDSeq_feature-table>

[0229] <insdfeature>

[0230] <INSDFeature_key>source< / INSDFeature_key>

[0231] <INSDFeature_location>1..25< / INSDFeature_location>

[0232] <INSDFeature_quals>

[0233] <insdqualifier>

[0234] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0235] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0236] < / insdqualifier>

[0237] <insdqualifier id="q14">

[0238] <INSDQualifier_name>organism< / INSDQualifier_name>

[0239] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0240] < / insdqualifier>

[0241] < / INSDFeature_quals>

[0242] < / insdfeature>

[0243] < / INSDSeq_feature-table>

[0244] <INSDSeq_sequence> gcgccaatattatcatgctttatgt< / INSDSeq_sequence>

[0245] < / insdseq>

[0246] < / sequencedata>

[0247] <sequencedata sequenceidnumber="8">

[0248] <insdseq>

[0249] <INSDSeq_length> 25< / INSDSeq_length>

[0250] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0251] <INSDSeq_division> PAT< / INSDSeq_division>

[0252] <INSDSeq_feature-table>

[0253] <insdfeature>

[0254] <INSDFeature_key>source< / INSDFeature_key>

[0255] <INSDFeature_location>1..25< / INSDFeature_location>

[0256] <INSDFeature_quals>

[0257] <insdqualifier>

[0258] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0259] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0260] < / insdqualifier>

[0261] <insdqualifier id="q16">

[0262] <INSDQualifier_name>organism< / INSDQualifier_name>

[0263] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0264] < / insdqualifier>

[0265] < / INSDFeature_quals>

[0266] < / insdfeature>

[0267] < / INSDSeq_feature-table>

[0268] <INSDSeq_sequence> gcgtgtaaaaatctttgaatcttga< / INSDSeq_sequence>

[0269] < / insdseq>

[0270] < / sequencedata>

[0271] <sequencedata sequenceidnumber="9">

[0272] <insdseq>

[0273] <INSDSeq_length>21< / INSDSeq_length>

[0274] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0275] <INSDSeq_division>PAT< / INSDSeq_division>

[0276] <INSDSeq_feature-table>

[0277] <insdfeature>

[0278] <INSDFeature_key>source< / INSDFeature_key>

[0279] <INSDFeature_location>1..21< / INSDFeature_location>

[0280] <INSDFeature_quals>

[0281] <insdqualifier>

[0282] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0283] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0284] < / insdqualifier>

[0285] <insdqualifier id="q18">

[0286] <INSDQualifier_name>organism< / INSDQualifier_name>

[0287] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0288] < / insdqualifier>

[0289] < / INSDFeature_quals>

[0290] < / insdfeature>

[0291] < / INSDSeq_feature-table>

[0292] <INSDSeq_sequence>acacgatcaggactctttcgt< / INSDSeq_sequence>

[0293] < / insdseq>

[0294] < / sequencedata>

[0295] <sequencedata sequenceidnumber="10">

[0296] <insdseq>

[0297] <INSDSeq_length> 23< / INSDSeq_length>

[0298] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0299] <INSDSeq_division> PAT< / INSDSeq_division>

[0300] <INSDSeq_feature-table>

[0301] <insdfeature>

[0302] <INSDFeature_key>source< / INSDFeature_key>

[0303] <INSDFeature_location>1..23< / INSDFeature_location>

[0304] <INSDFeature_quals>

[0305] <insdqualifier>

[0306] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0307] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0308] < / insdqualifier>

[0309] <insdqualifier id="q20">

[0310] <INSDQualifier_name>organism< / INSDQualifier_name>

[0311] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0312] < / insdqualifier>

[0313] < / INSDFeature_quals>

[0314] < / insdfeature>

[0315] < / INSDSeq_feature-table>

[0316] <INSDSeq_sequence> gccgtcataaaaagtccctcaga< / INSDSeq_sequence>

[0317] < / insdseq>

[0318] < / sequencedata>

[0319] <sequencedata sequenceidnumber="11">

[0320] <insdseq>

[0321] <INSDSeq_length> 23< / INSDSeq_length>

[0322] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0323] <INSDSeq_division> PAT< / INSDSeq_division>

[0324] <INSDSeq_feature-table>

[0325] <insdfeature>

[0326] <INSDFeature_key>source< / INSDFeature_key>

[0327] <INSDFeature_location>1..23< / INSDFeature_location>

[0328] <INSDFeature_quals>

[0329] <insdqualifier>

[0330] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0331] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0332] < / insdqualifier>

[0333] <insdqualifier id="q22">

[0334] <INSDQualifier_name>organism< / INSDQualifier_name>

[0335] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0336] < / insdqualifier>

[0337] < / INSDFeature_quals>

[0338] < / insdfeature>

[0339] < / INSDSeq_feature-table>

[0340] <INSDSeq_sequence> acccaatcataagttttctcccct< / INSDSeq_sequence>

[0341] < / insdseq>

[0342] < / sequencedata>

[0343] <sequencedata sequenceidnumber="12">

[0344] <insdseq>

[0345] <INSDSeq_length>21< / INSDSeq_length>

[0346] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0347] <INSDSeq_division>PAT< / INSDSeq_division>

[0348] <INSDSeq_feature-table>

[0349] <insdfeature>

[0350] <INSDFeature_key>source< / INSDFeature_key>

[0351] <INSDFeature_location>1..21< / INSDFeature_location>

[0352] <INSDFeature_quals>

[0353] <insdqualifier>

[0354] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0355] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0356] < / insdqualifier>

[0357] <insdqualifier id="q24">

[0358] <INSDQualifier_name>organism< / INSDQualifier_name>

[0359] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0360] < / insdqualifier>

[0361] < / INSDFeature_quals>

[0362] < / insdfeature>

[0363] < / INSDSeq_feature-table>

[0364] <INSDSeq_sequence>tgagctcaactgagtcacgtc< / INSDSeq_sequence>

[0365] < / insdseq>

[0366] < / sequencedata>

[0367] <sequencedata sequenceidnumber="13">

[0368] <insdseq>

[0369] <INSDSeq_length>22< / INSDSeq_length>

[0370] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0371] <INSDSeq_division>PAT< / INSDSeq_division>

[0372] <INSDSeq_feature-table>

[0373] <insdfeature>

[0374] <INSDFeature_key>source< / INSDFeature_key>

[0375] <INSDFeature_location>1..22< / INSDFeature_location>

[0376] <INSDFeature_quals>

[0377] <insdqualifier>

[0378] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0379] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0380] < / insdqualifier>

[0381] <insdqualifier id="q26">

[0382] <INSDQualifier_name>organism< / INSDQualifier_name>

[0383] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0384] < / insdqualifier>

[0385] < / INSDFeature_quals>

[0386] < / insdfeature>

[0387] < / INSDSeq_feature-table>

[0388] <INSDSeq_sequence>acctggacttgtttgctcatca< / INSDSeq_sequence>

[0389] < / insdseq>

[0390] < / sequencedata>

[0391] <sequencedata sequenceidnumber="14">

[0392] <insdseq>

[0393] <INSDSeq_length> 25< / INSDSeq_length>

[0394] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0395] <INSDSeq_division> PAT< / INSDSeq_division>

[0396] <INSDSeq_feature-table>

[0397] <insdfeature>

[0398] <INSDFeature_key>source< / INSDFeature_key>

[0399] <INSDFeature_location>1..25< / INSDFeature_location>

[0400] <INSDFeature_quals>

[0401] <insdqualifier>

[0402] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0403] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0404] < / insdqualifier>

[0405] <insdqualifier id="q28">

[0406] <INSDQualifier_name>organism< / INSDQualifier_name>

[0407] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0408] < / insdqualifier>

[0409] < / INSDFeature_quals>

[0410] < / insdfeature>

[0411] < / INSDSeq_feature-table>

[0412] <INSDSeq_sequence> gcgtgtaattatgcattcgagtgtt< / INSDSeq_sequence>

[0413] < / insdseq>

[0414] < / sequencedata>

[0415] <sequencedata sequenceidnumber="15">

[0416] <insdseq>

[0417] <INSDSeq_length> 23< / INSDSeq_length>

[0418] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0419] <INSDSeq_division> PAT< / INSDSeq_division>

[0420] <INSDSeq_feature-table>

[0421] <insdfeature>

[0422] <INSDFeature_key>source< / INSDFeature_key>

[0423] <INSDFeature_location>1..23< / INSDFeature_location>

[0424] <INSDFeature_quals>

[0425] <insdqualifier>

[0426] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0427] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0428] < / insdqualifier>

[0429] <insdqualifier id="q30">

[0430] <INSDQualifier_name>organism< / INSDQualifier_name>

[0431] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0432] < / insdqualifier>

[0433] < / INSDFeature_quals>

[0434] < / insdfeature>

[0435] < / INSDSeq_feature-table>

[0436] <INSDSeq_sequence> tgcaccccaatcatgatagcattt< / INSDSeq_sequence>

[0437] < / insdseq>

[0438] < / sequencedata>

[0439] <sequencedata sequenceidnumber="16">

[0440] <insdseq>

[0441] <INSDSeq_length> 24< / INSDSeq_length>

[0442] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0443] <INSDSeq_division> PAT< / INSDSeq_division>

[0444] <INSDSeq_feature-table>

[0445] <insdfeature>

[0446] <INSDFeature_key>source< / INSDFeature_key>

[0447] <INSDFeature_location>1..24< / INSDFeature_location>

[0448] <INSDFeature_quals>

[0449] <insdqualifier>

[0450] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0451] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0452] < / insdqualifier>

[0453] <insdqualifier id="q32">

[0454] <INSDQualifier_name>organism< / INSDQualifier_name>

[0455] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0456] < / insdqualifier>

[0457] < / INSDFeature_quals>

[0458] < / insdfeature>

[0459] < / INSDSeq_feature-table>

[0460] <INSDSeq_sequence> atatggtcttaagagaccgaccca< / INSDSeq_sequence>

[0461] < / insdseq>

[0462] < / sequencedata>

[0463] <sequencedata sequenceidnumber="17">

[0464] <insdseq>

[0465] <INSDSeq_length> 21< / INSDSeq_length>

[0466] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0467] <INSDSeq_division> PAT< / INSDSeq_division>

[0468] <INSDSeq_feature-table>

[0469] <insdfeature>

[0470] <INSDFeature_key>source< / INSDFeature_key>

[0471] <INSDFeature_location>1..21< / INSDFeature_location>

[0472] <INSDFeature_quals>

[0473] <insdqualifier>

[0474] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0475] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0476] < / insdqualifier>

[0477] <insdqualifier id="q34">

[0478] <INSDQualifier_name>organism< / INSDQualifier_name>

[0479] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0480] < / insdqualifier>

[0481] < / INSDFeature_quals>

[0482] < / insdfeature>

[0483] < / INSDSeq_feature-table>

[0484] <INSDSeq_sequence> tcgagtccttcaaattggcgt< / INSDSeq_sequence>

[0485] < / insdseq>

[0486] < / sequencedata>

[0487] <sequencedata sequenceidnumber="18">

[0488] <insdseq>

[0489] <INSDSeq_length> 24< / INSDSeq_length>

[0490] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0491] <INSDSeq_division> PAT< / INSDSeq_division>

[0492] <INSDSeq_feature-table>

[0493] <insdfeature>

[0494] <INSDFeature_key>source< / INSDFeature_key>

[0495] <INSDFeature_location>1..24< / INSDFeature_location>

[0496] <INSDFeature_quals>

[0497] <insdqualifier>

[0498] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0499] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0500] < / insdqualifier>

[0501] <insdqualifier id="q36">

[0502] <INSDQualifier_name>organism< / INSDQualifier_name>

[0503] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0504] < / insdqualifier>

[0505] < / INSDFeature_quals>

[0506] < / insdfeature>

[0507] < / INSDSeq_feature-table>

[0508] <INSDSeq_sequence> ggctagattcaagaaaaaaggt< / INSDSeq_sequence>

[0509] < / insdseq>

[0510] < / sequencedata>

[0511] <sequencedata sequenceidnumber="19">

[0512] <insdseq>

[0513] <INSDSeq_length> 25< / INSDSeq_length>

[0514] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0515] <INSDSeq_division> PAT< / INSDSeq_division>

[0516] <INSDSeq_feature-table>

[0517] <insdfeature>

[0518] <INSDFeature_key>source< / INSDFeature_key>

[0519] <INSDFeature_location>1..25< / INSDFeature_location>

[0520] <INSDFeature_quals>

[0521] <insdqualifier>

[0522] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0523] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0524] < / insdqualifier>

[0525] <insdqualifier id="q38">

[0526] <INSDQualifier_name>organism< / INSDQualifier_name>

[0527] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0528] < / insdqualifier>

[0529] < / INSDFeature_quals>

[0530] < / insdfeature>

[0531] < / INSDSeq_feature-table>

[0532] <INSDSeq_sequence> tgatcattgactactcgaatgtgat< / INSDSeq_sequence>

[0533] < / insdseq>

[0534] < / sequencedata>

[0535] <sequencedata sequenceidnumber="20">

[0536] <insdseq>

[0537] <INSDSeq_length> 20< / INSDSeq_length>

[0538] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0539] <INSDSeq_division> PAT< / INSDSeq_division>

[0540] <INSDSeq_feature-table>

[0541] <insdfeature>

[0542] <INSDFeature_key>source< / INSDFeature_key>

[0543] <INSDFeature_location>1..20< / INSDFeature_location>

[0544] <INSDFeature_quals>

[0545] <insdqualifier>

[0546] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0547] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0548] < / insdqualifier>

[0549] <insdqualifier id="q40">

[0550] <INSDQualifier_name>organism< / INSDQualifier_name>

[0551] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0552] < / insdqualifier>

[0553] < / INSDFeature_quals>

[0554] < / insdfeature>

[0555] < / INSDSeq_feature-table>

[0556] <INSDSeq_sequence> tctcaaatccaagctgccgt< / INSDSeq_sequence>

[0557] < / insdseq>

[0558] < / sequencedata>

[0559] <sequencedata sequenceidnumber="21">

[0560] <insdseq>

[0561] <INSDSeq_length> 23< / INSDSeq_length>

[0562] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0563] <INSDSeq_division> PAT< / INSDSeq_division>

[0564] <INSDSeq_feature-table>

[0565] <insdfeature>

[0566] <INSDFeature_key>source< / INSDFeature_key>

[0567] <INSDFeature_location>1..23< / INSDFeature_location>

[0568] <INSDFeature_quals>

[0569] <insdqualifier>

[0570] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0571] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0572] < / insdqualifier>

[0573] <insdqualifier id="q42">

[0574] <INSDQualifier_name>organism< / INSDQualifier_name>

[0575] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0576] < / insdqualifier>

[0577] < / INSDFeature_quals>

[0578] < / insdfeature>

[0579] < / INSDSeq_feature-table>

[0580] <INSDSeq_sequence> tggcatggtatccttgctacata< / INSDSeq_sequence>

[0581] < / insdseq>

[0582] < / sequencedata>

[0583] <sequencedata sequenceidnumber="22">

[0584] <insdseq>

[0585] <INSDSeq_length> 23< / INSDSeq_length>

[0586] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0587] <INSDSeq_division> PAT< / INSDSeq_division>

[0588] <INSDSeq_feature-table>

[0589] <insdfeature>

[0590] <INSDFeature_key>source< / INSDFeature_key>

[0591] <INSDFeature_location>1..23< / INSDFeature_location>

[0592] <INSDFeature_quals>

[0593] <insdqualifier>

[0594] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0595] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0596] < / insdqualifier>

[0597] <insdqualifier id="q44">

[0598] <INSDQualifier_name>organism< / INSDQualifier_name>

[0599] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0600] < / insdqualifier>

[0601] < / INSDFeature_quals>

[0602] < / insdfeature>

[0603] < / INSDSeq_feature-table>

[0604] <INSDSeq_sequence> tcatcttgtggggggaatagc< / INSDSeq_sequence>

[0605] < / insdseq>

[0606] < / sequencedata>

[0607] <sequencedata sequenceidnumber="23">

[0608] <insdseq>

[0609] <INSDSeq_length>20< / INSDSeq_length>

[0610] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0611] <INSDSeq_division>PAT< / INSDSeq_division>

[0612] <INSDSeq_feature-table>

[0613] <insdfeature>

[0614] <INSDFeature_key>source< / INSDFeature_key>

[0615] <INSDFeature_location>1..20< / INSDFeature_location>

[0616] <INSDFeature_quals>

[0617] <insdqualifier>

[0618] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0619] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0620] < / insdqualifier>

[0621] <insdqualifier id="q46">

[0622] <INSDQualifier_name>organism< / INSDQualifier_name>

[0623] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0624] < / insdqualifier>

[0625] < / INSDFeature_quals>

[0626] < / insdfeature>

[0627] < / INSDSeq_feature-table>

[0628] <INSDSeq_sequence>gtgtgaaatggctaacccgc< / INSDSeq_sequence>

[0629] < / insdseq>

[0630] < / sequencedata>

[0631] <sequencedata sequenceidnumber="24">

[0632] <insdseq>

[0633] <INSDSeq_length> 19< / INSDSeq_length>

[0634] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0635] <INSDSeq_division> PAT< / INSDSeq_division>

[0636] <INSDSeq_feature-table>

[0637] <insdfeature>

[0638] <INSDFeature_key>source< / INSDFeature_key>

[0639] <INSDFeature_location>1..19< / INSDFeature_location>

[0640] <INSDFeature_quals>

[0641] <insdqualifier>

[0642] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0643] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0644] < / insdqualifier>

[0645] <insdqualifier id="q48">

[0646] <INSDQualifier_name>organism< / INSDQualifier_name>

[0647] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0648] < / insdqualifier>

[0649] < / INSDFeature_quals>

[0650] < / insdfeature>

[0651] < / INSDSeq_feature-table>

[0652] <INSDSeq_sequence> ggccatgcacctgctactt< / INSDSeq_sequence>

[0653] < / insdseq>

[0654] < / sequencedata>

[0655] <sequencedata sequenceidnumber="25">

[0656] <insdseq>

[0657] <INSDSeq_length>22< / INSDSeq_length>

[0658] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0659] <INSDSeq_division>PAT< / INSDSeq_division>

[0660] <INSDSeq_feature-table>

[0661] <insdfeature>

[0662] <INSDFeature_key>source< / INSDFeature_key>

[0663] <INSDFeature_location>1..22< / INSDFeature_location>

[0664] <INSDFeature_quals>

[0665] <insdqualifier>

[0666] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0667] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0668] < / insdqualifier>

[0669] <insdqualifier id="q50">

[0670] <INSDQualifier_name>organism< / INSDQualifier_name>

[0671] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0672] < / insdqualifier>

[0673] < / INSDFeature_quals>

[0674] < / insdfeature>

[0675] < / INSDSeq_feature-table>

[0676] <INSDSeq_sequence>ccgtcgattccgtacaagatag< / INSDSeq_sequence>

[0677] < / insdseq>

[0678] < / sequencedata>

[0679] <sequencedata sequenceidnumber="26">

[0680] <insdseq>

[0681] <INSDSeq_length> 23< / INSDSeq_length>

[0682] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0683] <INSDSeq_division> PAT< / INSDSeq_division>

[0684] <INSDSeq_feature-table>

[0685] <insdfeature>

[0686] <INSDFeature_key>source< / INSDFeature_key>

[0687] <INSDFeature_location>1..23< / INSDFeature_location>

[0688] <INSDFeature_quals>

[0689] <insdqualifier>

[0690] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0691] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0692] < / insdqualifier>

[0693] <insdqualifier id="q52">

[0694] <INSDQualifier_name>organism< / INSDQualifier_name>

[0695] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0696] < / insdqualifier>

[0697] < / INSDFeature_quals>

[0698] < / insdfeature>

[0699] < / INSDSeq_feature-table>

[0700] <INSDSeq_sequence> cccttcgtccaccaaatattcaa< / INSDSeq_sequence>

[0701] < / insdseq>

[0702] < / sequencedata>

[0703] <sequencedata sequenceidnumber="27">

[0704] <insdseq>

[0705] <INSDSeq_length> 21< / INSDSeq_length>

[0706] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0707] <INSDSeq_division> PAT< / INSDSeq_division>

[0708] <INSDSeq_feature-table>

[0709] <insdfeature>

[0710] <INSDFeature_key>source< / INSDFeature_key>

[0711] <INSDFeature_location>1..21< / INSDFeature_location>

[0712] <INSDFeature_quals>

[0713] <insdqualifier>

[0714] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0715] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0716] < / insdqualifier>

[0717] <insdqualifier id="q54">

[0718] <INSDQualifier_name>organism< / INSDQualifier_name>

[0719] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0720] < / insdqualifier>

[0721] < / INSDFeature_quals>

[0722] < / insdfeature>

[0723] < / INSDSeq_feature-table>

[0724] <INSDSeq_sequence> gccaattccattgtgtgtcag< / INSDSeq_sequence>

[0725] < / insdseq>

[0726] < / sequencedata>

[0727] <sequencedata sequenceidnumber="28">

[0728] <insdseq>

[0729] <INSDSeq_length> 21< / INSDSeq_length>

[0730] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0731] <INSDSeq_division> PAT< / INSDSeq_division>

[0732] <INSDSeq_feature-table>

[0733] <insdfeature>

[0734] <INSDFeature_key>source< / INSDFeature_key>

[0735] <INSDFeature_location>1..21< / INSDFeature_location>

[0736] <INSDFeature_quals>

[0737] <insdqualifier>

[0738] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0739] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0740] < / insdqualifier>

[0741] <insdqualifier id="q56">

[0742] <INSDQualifier_name>organism< / INSDQualifier_name>

[0743] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0744] < / insdqualifier>

[0745] < / INSDFeature_quals>

[0746] < / insdfeature>

[0747] < / INSDSeq_feature-table>

[0748] <INSDSeq_sequence> ggtttgttcagtggtgggaga< / INSDSeq_sequence>

[0749] < / insdseq>

[0750] < / sequencedata>

[0751] <sequencedata sequenceidnumber="29">

[0752] <insdseq>

[0753] <INSDSeq_length> 25< / INSDSeq_length>

[0754] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0755] <INSDSeq_division> PAT< / INSDSeq_division>

[0756] <INSDSeq_feature-table>

[0757] <insdfeature>

[0758] <INSDFeature_key>source< / INSDFeature_key>

[0759] <INSDFeature_location>1..25< / INSDFeature_location>

[0760] <INSDFeature_quals>

[0761] <insdqualifier>

[0762] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0763] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0764] < / insdqualifier>

[0765] <insdqualifier id="q58">

[0766] <INSDQualifier_name>organism< / INSDQualifier_name>

[0767] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0768] < / insdqualifier>

[0769] < / INSDFeature_quals>

[0770] < / insdfeature>

[0771] < / INSDSeq_feature-table>

[0772] <INSDSeq_sequence> aaattgacaaccgaagaattacgtg< / INSDSeq_sequence>

[0773] < / insdseq>

[0774] < / sequencedata>

[0775] <sequencedata sequenceidnumber="30">

[0776] <insdseq>

[0777] <INSDSeq_length> 20< / INSDSeq_length>

[0778] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0779] <INSDSeq_division> PAT< / INSDSeq_division>

[0780] <INSDSeq_feature-table>

[0781] <insdfeature>

[0782] <INSDFeature_key>source< / INSDFeature_key>

[0783] <INSDFeature_location>1..20< / INSDFeature_location>

[0784] <INSDFeature_quals>

[0785] <insdqualifier>

[0786] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0787] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0788] < / insdqualifier>

[0789] <insdqualifier id="q60">

[0790] <INSDQualifier_name>organism< / INSDQualifier_name>

[0791] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0792] < / insdqualifier>

[0793] < / INSDFeature_quals>

[0794] < / insdfeature>

[0795] < / INSDSeq_feature-table>

[0796] <INSDSeq_sequence> gccacctaatccaatggggca< / INSDSeq_sequence>

[0797] < / insdseq>

[0798] < / sequencedata>

[0799] <sequencedata sequenceidnumber="31">

[0800] <insdseq>

[0801] <INSDSeq_length> 23< / INSDSeq_length>

[0802] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0803] <INSDSeq_division> PAT< / INSDSeq_division>

[0804] <INSDSeq_feature-table>

[0805] <insdfeature>

[0806] <INSDFeature_key>source< / INSDFeature_key>

[0807] <INSDFeature_location>1..23< / INSDFeature_location>

[0808] <INSDFeature_quals>

[0809] <insdqualifier>

[0810] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0811] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0812] < / insdqualifier>

[0813] <insdqualifier id="q62">

[0814] <INSDQualifier_name>organism< / INSDQualifier_name>

[0815] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0816] < / insdqualifier>

[0817] < / INSDFeature_quals>

[0818] < / insdfeature>

[0819] < / INSDSeq_feature-table>

[0820] <INSDSeq_sequence> cccgaaagaaagacagaaaaccc< / INSDSeq_sequence>

[0821] < / insdseq>

[0822] < / sequencedata>

[0823] <sequencedata sequenceidnumber="32">

[0824] <insdseq>

[0825] <INSDSeq_length> 25< / INSDSeq_length>

[0826] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0827] <INSDSeq_division> PAT< / INSDSeq_division>

[0828] <INSDSeq_feature-table>

[0829] <insdfeature>

[0830] <INSDFeature_key>source< / INSDFeature_key>

[0831] <INSDFeature_location>1..25< / INSDFeature_location>

[0832] <INSDFeature_quals>

[0833] <insdqualifier>

[0834] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0835] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0836] < / insdqualifier>

[0837] <insdqualifier id="q64">

[0838] <INSDQualifier_name>organism< / INSDQualifier_name>

[0839] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0840] < / insdqualifier>

[0841] < / INSDFeature_quals>

[0842] < / insdfeature>

[0843] < / INSDSeq_feature-table>

[0844] <INSDSeq_sequence> atatgaaagtaggtgaccatggagc< / INSDSeq_sequence>

[0845] < / insdseq>

[0846] < / sequencedata>

[0847] <sequencedata sequenceidnumber="33">

[0848] <insdseq>

[0849] <INSDSeq_length> 21< / INSDSeq_length>

[0850] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0851] <INSDSeq_division> PAT< / INSDSeq_division>

[0852] <INSDSeq_feature-table>

[0853] <insdfeature>

[0854] <INSDFeature_key>source< / INSDFeature_key>

[0855] <INSDFeature_location>1..21< / INSDFeature_location>

[0856] <INSDFeature_quals>

[0857] <insdqualifier>

[0858] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0859] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0860] < / insdqualifier>

[0861] <insdqualifier id="q66">

[0862] <INSDQualifier_name>organism< / INSDQualifier_name>

[0863] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0864] < / insdqualifier>

[0865] < / INSDFeature_quals>

[0866] < / insdfeature>

[0867] < / INSDSeq_feature-table>

[0868] <INSDSeq_sequence> actagccaagggagagaggag< / INSDSeq_sequence>

[0869] < / insdseq>

[0870] < / sequencedata>

[0871] <sequencedata sequenceidnumber="34">

[0872] <insdseq>

[0873] <INSDSeq_length> 23< / INSDSeq_length>

[0874] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0875] <INSDSeq_division> PAT< / INSDSeq_division>

[0876] <INSDSeq_feature-table>

[0877] <insdfeature>

[0878] <INSDFeature_key>source< / INSDFeature_key>

[0879] <INSDFeature_location>1..23< / INSDFeature_location>

[0880] <INSDFeature_quals>

[0881] <insdqualifier>

[0882] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0883] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0884] < / insdqualifier>

[0885] <insdqualifier id="q68">

[0886] <INSDQualifier_name>organism< / INSDQualifier_name>

[0887] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0888] < / insdqualifier>

[0889] < / INSDFeature_quals>

[0890] < / insdfeature>

[0891] < / INSDSeq_feature-table>

[0892] <INSDSeq_sequence> ccaacaaaaatttgaaccccgt< / INSDSeq_sequence>

[0893] < / insdseq>

[0894] < / sequencedata>

[0895] <sequencedata sequenceidnumber="35">

[0896] <insdseq>

[0897] <INSDSeq_length> 23< / INSDSeq_length>

[0898] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0899] <INSDSeq_division> PAT< / INSDSeq_division>

[0900] <INSDSeq_feature-table>

[0901] <insdfeature>

[0902] <INSDFeature_key>source< / INSDFeature_key>

[0903] <INSDFeature_location>1..23< / INSDFeature_location>

[0904] <INSDFeature_quals>

[0905] <insdqualifier>

[0906] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0907] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0908] < / insdqualifier>

[0909] <insdqualifier id="q70">

[0910] <INSDQualifier_name>organism< / INSDQualifier_name>

[0911] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0912] < / insdqualifier>

[0913] < / INSDFeature_quals>

[0914] < / insdfeature>

[0915] < / INSDSeq_feature-table>

[0916] <INSDSeq_sequence> cgcttgcccaaaataatagta< / INSDSeq_sequence>

[0917] < / insdseq>

[0918] < / sequencedata>

[0919] <sequencedata sequenceidnumber="36">

[0920] <insdseq>

[0921] <INSDSeq_length> 25< / INSDSeq_length>

[0922] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0923] <INSDSeq_division> PAT< / INSDSeq_division>

[0924] <INSDSeq_feature-table>

[0925] <insdfeature>

[0926] <INSDFeature_key>source< / INSDFeature_key>

[0927] <INSDFeature_location>1..25< / INSDFeature_location>

[0928] <INSDFeature_quals>

[0929] <insdqualifier>

[0930] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0931] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0932] < / insdqualifier>

[0933] <insdqualifier id="q72">

[0934] <INSDQualifier_name>organism< / INSDQualifier_name>

[0935] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0936] < / insdqualifier>

[0937] < / INSDFeature_quals>

[0938] < / insdfeature>

[0939] < / INSDSeq_feature-table>

[0940] <INSDSeq_sequence> ccattctccaacctcaatctttatat< / INSDSeq_sequence>

[0941] < / insdseq>

[0942] < / sequencedata>

[0943] <sequencedata sequenceidnumber="37">

[0944] <insdseq>

[0945] <INSDSeq_length>21< / INSDSeq_length>

[0946] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0947] <INSDSeq_division>PAT< / INSDSeq_division>

[0948] <INSDSeq_feature-table>

[0949] <insdfeature>

[0950] <INSDFeature_key>source< / INSDFeature_key>

[0951] <INSDFeature_location>1..21< / INSDFeature_location>

[0952] <INSDFeature_quals>

[0953] <insdqualifier>

[0954] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0955] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0956] < / insdqualifier>

[0957] <insdqualifier id="q74">

[0958] <INSDQualifier_name>organism< / INSDQualifier_name>

[0959] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0960] < / insdqualifier>

[0961] < / INSDFeature_quals>

[0962] < / insdfeature>

[0963] < / INSDSeq_feature-table>

[0964] <INSDSeq_sequence>cgcaacaatcactagtacggg< / INSDSeq_sequence>

[0965] < / insdseq>

[0966] < / sequencedata>

[0967] <sequencedata sequenceidnumber="38">

[0968] <insdseq>

[0969] <INSDSeq_length> 20< / INSDSeq_length>

[0970] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[0971] <INSDSeq_division> PAT< / INSDSeq_division>

[0972] <INSDSeq_feature-table>

[0973] <insdfeature>

[0974] <INSDFeature_key>source< / INSDFeature_key>

[0975] <INSDFeature_location>1..20< / INSDFeature_location>

[0976] <INSDFeature_quals>

[0977] <insdqualifier>

[0978] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[0979] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[0980] < / insdqualifier>

[0981] <insdqualifier id="q76">

[0982] <INSDQualifier_name>organism< / INSDQualifier_name>

[0983] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[0984] < / insdqualifier>

[0985] < / INSDFeature_quals>

[0986] < / insdfeature>

[0987] < / INSDSeq_feature-table>

[0988] <INSDSeq_sequence> ccagcaggcccaagtttat< / INSDSeq_sequence>

[0989] < / insdseq>

[0990] < / sequencedata>

[0991] <sequencedata sequenceidnumber="39">

[0992] <insdseq>

[0993] <INSDSeq_length>21< / INSDSeq_length>

[0994] <INSDSeq_moltype>DNA< / INSDSeq_moltype>

[0995] <INSDSeq_division>PAT< / INSDSeq_division>

[0996] <INSDSeq_feature-table>

[0997] <insdfeature>

[0998] <INSDFeature_key>source< / INSDFeature_key>

[0999] <INSDFeature_location>1..21< / INSDFeature_location>

[1000] <INSDFeature_quals>

[1001] <insdqualifier>

[1002] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1003] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[1004] < / insdqualifier>

[1005] <insdqualifier id="q78">

[1006] <INSDQualifier_name>organism< / INSDQualifier_name>

[1007] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[1008] < / insdqualifier>

[1009] < / INSDFeature_quals>

[1010] < / insdfeature>

[1011] < / INSDSeq_feature-table>

[1012] <INSDSeq_sequence>atacacgcattgcctttcctg< / INSDSeq_sequence>

[1013] < / insdseq>

[1014] < / sequencedata>

[1015] <sequencedata sequenceidnumber="40">

[1016] <insdseq>

[1017] <INSDSeq_length> 24< / INSDSeq_length>

[1018] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1019] <INSDSeq_division> PAT< / INSDSeq_division>

[1020] <INSDSeq_feature-table>

[1021] <insdfeature>

[1022] <INSDFeature_key>source< / INSDFeature_key>

[1023] <INSDFeature_location>1..24< / INSDFeature_location>

[1024] <INSDFeature_quals>

[1025] <insdqualifier>

[1026] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1027] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[1028] < / insdqualifier>

[1029] <insdqualifier id="q80">

[1030] <INSDQualifier_name>organism< / INSDQualifier_name>

[1031] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[1032] < / insdqualifier>

[1033] < / INSDFeature_quals>

[1034] < / insdfeature>

[1035] < / INSDSeq_feature-table>

[1036] <INSDSeq_sequence> gctcaaaagcctatcttaaccaaa< / INSDSeq_sequence>

[1037] < / insdseq>

[1038] < / sequencedata>

[1039] <sequencedata sequenceidnumber="41">

[1040] <insdseq>

[1041] <INSDSeq_length> 24< / INSDSeq_length>

[1042] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1043] <INSDSeq_division> PAT< / INSDSeq_division>

[1044] <INSDSeq_feature-table>

[1045] <insdfeature>

[1046] <INSDFeature_key>source< / INSDFeature_key>

[1047] <INSDFeature_location>1..24< / INSDFeature_location>

[1048] <INSDFeature_quals>

[1049] <insdqualifier>

[1050] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1051] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[1052] < / insdqualifier>

[1053] <insdqualifier id="q82">

[1054] <INSDQualifier_name>organism< / INSDQualifier_name>

[1055] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[1056] < / insdqualifier>

[1057] < / INSDFeature_quals>

[1058] < / insdfeature>

[1059] < / INSDSeq_feature-table>

[1060] <INSDSeq_sequence> aaggctaacttctttgggttgaga< / INSDSeq_sequence>

[1061] < / insdseq>

[1062] < / sequencedata>

[1063] <sequencedata sequenceidnumber="42">

[1064] <insdseq>

[1065] <INSDSeq_length> 23< / INSDSeq_length>

[1066] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1067] <INSDSeq_division> PAT< / INSDSeq_division>

[1068] <INSDSeq_feature-table>

[1069] <insdfeature>

[1070] <INSDFeature_key>source< / INSDFeature_key>

[1071] <INSDFeature_location>1..23< / INSDFeature_location>

[1072] <INSDFeature_quals>

[1073] <insdqualifier>

[1074] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1075] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[1076] < / insdqualifier>

[1077] <insdqualifier id="q84">

[1078] <INSDQualifier_name>organism< / INSDQualifier_name>

[1079] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[1080] < / insdqualifier>

[1081] < / INSDFeature_quals>

[1082] < / insdfeature>

[1083] < / INSDSeq_feature-table>

[1084] <INSDSeq_sequence> gaaggccacattgaaaagtcgt< / INSDSeq_sequence>

[1085] < / insdseq>

[1086] < / sequencedata>

[1087] <sequencedata sequenceidnumber="43">

[1088] <insdseq>

[1089] <INSDSeq_length> 22< / INSDSeq_length>

[1090] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1091] <INSDSeq_division> PAT< / INSDSeq_division>

[1092] <INSDSeq_feature-table>

[1093] <insdfeature>

[1094] <INSDFeature_key>source< / INSDFeature_key>

[1095] <INSDFeature_location>1..22< / INSDFeature_location>

[1096] <INSDFeature_quals>

[1097] <insdqualifier>

[1098] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1099] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[1100] < / insdqualifier>

[1101] <insdqualifier id="q86">

[1102] <INSDQualifier_name>organism< / INSDQualifier_name>

[1103] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[1104] < / insdqualifier>

[1105] < / INSDFeature_quals>

[1106] < / insdfeature>

[1107] < / INSDSeq_feature-table>

[1108] <INSDSeq_sequence> agatcgaagaggtacgtgccaa< / INSDSeq_sequence>

[1109] < / insdseq>

[1110] < / sequencedata>

[1111] <sequencedata sequenceidnumber="44">

[1112] <insdseq>

[1113] <INSDSeq_length> 20< / INSDSeq_length>

[1114] <INSDSeq_moltype> DNA< / INSDSeq_moltype>

[1115] <INSDSeq_division> PAT< / INSDSeq_division>

[1116] <INSDSeq_feature-table>

[1117] <insdfeature>

[1118] <INSDFeature_key>source< / INSDFeature_key>

[1119] <INSDFeature_location>1..20< / INSDFeature_location>

[1120] <INSDFeature_quals>

[1121] <insdqualifier>

[1122] <INSDQualifier_name>mol_type< / INSDQualifier_name>

[1123] <INSDQualifier_value>other DNA< / INSDQualifier_value>

[1124] < / insdqualifier>

[1125] <insdqualifier id="q88">

[1126] <INSDQualifier_name>organism< / INSDQualifier_name>

[1127] <INSDQualifier_value>synthetic construct< / INSDQualifier_value>

[1128] < / insdqualifier>

[1129] < / INSDFeature_quals>

[1130] < / insdfeature>

[1131] < / INSDSeq_feature-table>

[1132] <INSDSeq_sequence> atggctgccagctgcatatt< / INSDSeq_sequence>

[1133] < / insdseq>

[1134] < / sequencedata>

[1135]

[1136] <---

Images