A primer and DNA probe kit for Leptospira detection using loop-mediated isothermal amplification (LAMP) combined with a colorimetric dipstick.

TH28496UActive Publication Date: 2026-07-13SRINAKHARINWIROT UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
TH2103001638
Authority / Receiving Office
TH · TH
Patent Type
Utility models
Current Assignee / Owner
Filing Date
2021-06-14
Publication Date
2026-07-13
Estimated Expiration
2027-06-13

Smart Images

  • Figure 00000013_0000
    Figure 00000013_0000
  • Figure 00000013_0001
    Figure 00000013_0001
  • Figure 00000013_0002
    Figure 00000013_0002
Patent Text Reader

Abstract

------December 27, 2023------(OCR) Primer and DNA probe kit for Leptospira detection using loop-mediated isothermal amplification (LAMP) with a dipstick test strip. 1. A simple, convenient, and rapid test kit with results available in 1 hour and 30 minutes. 2. Sensitivity test results. (Sensitivity) In detecting Leptospira DNA using the LAMP technique with a dipstick test, the sensitivity was found to be 5.82 picograms (pg). 3. (Specificity) It is specific only to Leptospira. This was demonstrated by specificity tests against other bacteria that share the same target organs or bodily fluids as Leptospira.
Need to check novelty before this filing date? Find Prior Art

Claims

------24 / 06 / 2569------(OCR) OCR 10KL1. A primer and DNA probe set for Leptospira detection using loop-mediated isothermal amplification (LAMP) with a dipstick. It includes four primers specific to six Leptospira base sequences: Primer F3_Lep1 (base sequence (5'-3) GCGGACATGTAAGTCAGGTG), Primer B3_Lep1 (base sequence (5'-3') TATCTAATCCCGTTCACTAC, and Primer FIP_Lep1. (FIP-Lep1)Base sequence (5'-3') GCCTCTCCCAAACTCCAGACACTTTTTGAAAACTGCGGGCTCAACTPrimer BIP-Lep1 (BIP-Lep1)Base sequence (5'-3') AGTGGAATTCCAGGTGTAGCGGTTTTTTTTAGGCCAGCAAGTCGCProbe Lepto1_FITC (Probe_Lepto1 FITC)Base sequence (5'-3') FITC- TAGTTTCAAGTGCAGGCTGC2.The primer and DNA probe set for Leptospira detection in Patent 1, which has specific optimal conditions for detecting the LAMP reaction product, involves performing the LAMP reaction at 60-65°C for 45-60 minutes, after which the target DNA product is detected on a dipstick.

3. The primer and DNA probe set for Leptospira detection using the loop-mediated isothermal amplification (LAMP) reaction, combined with a dipstick, as per Patent 1, where the DNA probe for Leptospira detection on a dipstick using the LAMP technique, is designed as follows: Its characteristic feature is a DNA probe labeled at the 5' end with FITC for detecting LAMP products on a dipstick. The base sequence is as follows: 5'- FITC-TAGTTTCAAGTGCAGGCTGC -3'4.The primer and DNA probe kit for Leptospira detection using the LAMP reaction in Patent 1 consists of the following main components: inner primers, FIP-Lep1 and BIP-Lep1 primers, 0.5-3.0 micromolar each; outer primers, F3-Lep1 and B3-Lep1 primers, 0.5-3.0 micromolar each; and deoxynucleotide triphosphate. Triphosphate (dNTPs) 0.5-3.0 millimolar (mM), Betaine 0.1-3.0 molar (M), Magnesium sulfate (MgSO4) 2-6 millimolar (mM), BstDNA polymerase enzyme 1 unit (U), 10X of thermopol buffer, and distilled water.5.The primer and DNA probe set for Leptospira detection using the LAMP reaction in Patent 1 has a unique characteristic: it does not require a thermocycler like the PCR method.

6. The primer and DNA probe set for Leptospira detection using the LAMP reaction in Patent 1 is suitable for detecting Leptospira in various bodily fluid samples, including blood, urine, and cerebrospinal fluid; target organs such as the liver and kidneys; and natural water sources contaminated with Leptospira. ------------ OCR 10KL (19 / 05 / 2569) 1. A set of primers and DNA probes for detecting Chikungunya virus. Virus) using the loop-mediated isothermal amplification reaction. Amplification) or LAMP, combined with a colorimetric dipstick, consists of 4 primers. There are six specific line segments in the Chikungunya virus sequence, as follows: Primer F3 CHIKV3 (F3 CHIKV3) base sequence (5'-3') GCAGTTGAGCGAAGCACAT Primer B3 CHIKV3 (B3 CHIKV3) base sequence (5'-3') GCAGTTGAGCGAAGCACAT FIP CHIKV3 Primer Base sequence (5'-3') CAGATGCGGTATGAGCCCTGTTTTTTTGGAGAAGTCCGAATCATGC BIP CHIKV3 Primer Base sequence (5'-3') TCCGCGTCCTTTACCAAGGAAATTTTTTTTGGCGTCCTTAACTGTGAC Probe CHIKV3 Base sequence (5'-3') FITC-CCGTTTGCATAGGCAGTTAC 2. Primer and DNA probe set for detecting Leptospira. Claim 1 specifies the optimal conditions for testing the products of the LAMP reaction. This involves performing a LAMP reaction at 60-65 degrees Celsius for 45-60 minutes, and then examining the DNA product. The target is marked on a colorimetric dipstick.

3. Primer and DNA probe set for detecting Chikungunya virus. Virus) using the loop-mediated isothermal amplification reaction. Amplification) or LAMP, combined with the use of a colorimetric dipstick as per claim 1. This involves a DNA probe for detecting Leptospira on a colorimetric strip test. (Dipstick) Using the LAMP technique, the design process has specific characteristics, namely the detector (DNA). The probe (5' end) is labeled with FITC for inspection of the lamp product. The colorimetric dipstick has the following base sequence: 5'- FITC-TAGTTTCAAGTGCAGGCTGC -3' 4. Primer and DNA probe set for Leptospira detection. The LAMP reaction in Claim 1 consists of the following main components: The inner primers are FIP-Lep1 primer and BIP-Lep1 primer. 0.5-3.0 micromolar each, outer primers: F3_Lep1 primer, and... Primer B3 micromolar Lep1 (B3_Lep1) 0.5-3.0 micromolar each, deoxynucleotide triphosphate. (Deoxynucleotide triphosphate, dNTPs) 0.5-3.0 millimolar (mM), Betaine 0.1-3.0 molar. (M), magnesium sulfate (MgSO4) 2-6 millimolar (mM), BST DNA polymerase enzyme (Bst 1 unit (U) of DNA polymerase, 10X of thermopol buffer, and distilled water. (distilled water) 5. Primer and DNA probe kit for Leptospira detection. The LAMP reaction described in Patent 1 has a unique characteristic: it does not require a dosing device. A thermocycler is similar to the PCR method.

6. Primer and DNA probe set for Leptospira detection. Using the LAMP reaction in claim 1 for the detection of Leptospira in samples. Various bodily fluids include blood, urine, and cerebrospinal fluid. Target organs include the liver and kidneys, as well as water sources. Naturally contaminated with Leptospira.