A one-step staining method for detecting vancomycin-resistant enterococcus aureus.
Patent Information
- Application Number
- TH2303000799
- Authority / Receiving Office
- TH · TH
- Patent Type
- Utility models
- Current Assignee / Owner
- Filing Date
- 2023-03-21
- Publication Date
- 2026-09-26
- Estimated Expiration
- 2029-03-20
Smart Images
Figure 00000006_0000 
Figure 00000007_0000 
Figure 00000008_0000
Abstract
Claims
OCR09WP02 / 09 / 25691. A one-step staining method for detecting vancomycin-resistant enterococci consisting of the following components: a.The design of primers and probes specific to the DNA sequence of the vanA gene of vancomycin-resistant enterococcus aureus. Four primers were used, with backward inner primers (BIP) coated with biotin or digoxigenin. Three bases (T) were added to the forward inner primers (FIP) and backward inner primers (BIP) to increase efficiency and specificity. One probe was coated with a fluorescent substance (FITC) to track reactions occurring on a dipstick. The bases of the primers and probes used in the LAMP reaction are as follows: Forward outer primer (F3) base sequence (5'-3') ATAAAGAAAAATACGAGCCGT; Backward outer primer (B3) base sequence (5'-3') GCTGAAAATGCTACATCAACAT; Forward inner primer (FIP) base sequence (5'-3') CATTCGCGCAAGGTTTTTCG-TTT-TATACATTGGAATTACGAAATCTGG; Backward inner primer (BIP) base sequence (5'-3') Biotin / Dig-TTGCTATTCAGCTGTACTCTCGC-TTT-GGTTGATTTCATATTCATGGTTCT; Probe base sequence (5'-3') FITC-GGATAAAAAAATGCACGGATTDig=Digoxigenin.The genetic material of vancomycin-resistant Enterococcus aureus was amplified using the LAMP (Low-Action Amplification) technique. The LAMP reaction was performed using 25 μL of solution containing 0.2 μM each of forward outer primer (F3), backward outer primer (B3), and probe; 2 μM each of forward inner primer (FIP) and backward inner primer (BIP); a 1x buffer solution; 0.5 M betaine; 1.2 mmol dNTP; 6 mmol magnesium sulfate (MgSO4); 8 U of BST DNA polymerase; and the genetic material from the submitted sample. The LAMP reaction was then performed at 61°C for 60 minutes.To check the LAMP product on a dipstick, draw 5 µl of the LAMP reaction solution into a 100 µl buffer solution tube at room temperature. Then, immerse the dipstick in the buffer solution and leave it for 5-10 minutes. Read the result on the dipstick. A positive result will show a pink test line in the test band (T) and control band (C), indicating that the sample contains the DNA sequence of the vanA gene of vancomycin-resistant Enterococcus. A negative result will show a pink test line only in the control band (C).