A set of primers and DNA probes designed from the oxacillinase-23 gene (Oxa-23) for the detection of antimicrobial-resistant Acinetobacter baumannii bacteria, using loop-mediated isothermal amplification (LAMP) and a dipstick test strip.

Abstract

Invention details;

Claims

------21 / 05 / 2569------(OCR)OCR10KL1. A primer and DNA probe designed from the oxacillinase-23 gene (Oxa-23) for detecting antimicrobial-resistant Acinetobacter baumannii bacteria using loop-mediated isothermal amplification (LAMP) combined with a dipstick test strip. The test strip contains four primers specific to the base sequence of antimicrobial-resistant Acinetobacter baumannii bacteria. The primers are 6 positions and 1 line detector as follows: Primer F3OxA-23 (F3Oxa-23) base sequence (5'-3')GGAGAACCAGAAAACGGATA; Primer B3OxA-23 (B3Oxa-23) base sequence (5'-3')GCATTACCGAAACCAATACG; Primer FIPOxA-23 (FIPOxa-23) base sequence (5'-3') ')AGTGTCATGTCTTTTTCCCAAGCTTTTTATGAAATATTTAAATGGAAGGGCprimerBIPOxa-23(BIPOxa-23)base sequence(5'-3')AAGCCATGAAGCTTTCTGCAGTTTTTTTTTACTTCTTTTTGCATGAGATCprobeOxa-23(ProbeOxa-23)base sequence(5'-3')5'-FITC-GGTAAATGACCTTTTCTCTC-3'2.A primer and DNA probe designed from the oxacillinase-23 gene (Oxa-23) for the detection of antimicrobial-resistant Acinetobacter baumannii bacteria using loop-mediated isothermal amplification (LAMP) in conjunction with a dipstick test strip, as per Patent 1, in which the DNA probe for the detection of antimicrobial-resistant Acinetobacter baumannii is characterized by being labeled with FI.

1. A method for detecting antimicrobial-resistant Acinetobacter baumannii bacteria using loop-mediated isothermal amplification (LAMP) with the use of a dipstick, employing a primer and DNA probe as per Patent 1 or 2, consisting of the following steps: a.The DNA of the pathogen in a sample of bodily fluid under the LAMP reaction is amplified using a primer kit. The optimal conditions for detecting the LAMP product are: a. The LAMP reaction is performed at 60-65 degrees Celsius for 45-60 minutes. b. To detect the LAMP product, the DNA probe is mixed in, then hybridized at 60-65 degrees Celsius for 5-15 minutes. The solution is then transferred to a tube containing buffer solution kept at room temperature, and a dipstick is immersed in the tube.

4. The method for detecting antimicrobial-resistant Acinetobacter baumannii bacteria using the loop-mediated isothermal amplification (LAMP) reaction combined with the use of a dipstick test strip as per claim 3. The LAMP reaction 25 µL (µL) consists of the following main components: inner primers, FIPOxa-23 primer and BIPOxa-23 primer, 0.5-3 ...0.5-3.0 micromolar (micromolar), outer primers: F3Oxa-23 and B3Oxa-23, each 0.5-3.0 micromolar (micromolar), deoxynucleotide triphosphate (dNTPs) 0.5-3.0 millimolar (millimolar), betaine 0.1-3.0 molar (M), magnesium sulfate (MgSO4) 2-6 millimolar (millimolar), BST DNA polymerase enzyme (BstDNApolymer).

5. A method for detecting antimicrobial-resistant Acinetobacter baumannii bacteria using loop-mediated isothermal amplification (LAMP) combined with the use of a dipstick test strip as per claims 3 and 4, where the sample materials are sputum, blood, and urine. ------------OCR09WP12 / 12 / 25681.A primer and DNA probe set designed from the oxacillinase-23 gene (Oxa-23) for detecting antimicrobial-resistant Acinetobacter baumannii bacteria using loop-mediated isothermal amplification (LAMP) reaction, combined with the use of a dipstick test strip consisting of 4 primers specific to 6 base sequence loci of antimicrobial-resistant Acinetobacter baumannii and a probe... The following single-line detection is performed: Primer F3Oxa-23 (F3Oxa-23) base sequence (5'-3')GGAGAACCAGAAAACGGATA; Primer B3Oxa-23 (B3Oxa-23) base sequence (5'-3')GCATTACCGAAACCAATACG; Primer FIPOxa-23 (FIPOxa-23) base sequence (5'-3')AGTGTCATGTCTTTTTCCCAAGCTTTTTATGAAATATTTAAATGGAAGGGC; Primer BIPoxa-23 (BIPOxa-23) base sequence (5'-3')AAGCCATGAAGCTTTCTGCAGTTTTTTTTTACTTCCTTTTTGCATGAGATC; ProbeOxa-23 (ProbeOxa-23) base sequence (5'-3')5'-FITC-GGTAAATGACCTTTTCTCTC-3'2.A primer and DNA probe designed from the oxacillinase-23 gene (Oxa-23) for the detection of antimicrobial-resistant Acinetobacter baumannii bacteria using loop-mediated isothermal amplification (LAMP) in conjunction with a dipstick test strip, as per Patent 1, in which the DNA probe for the detection of antimicrobial-resistant Acinetobacter baumannii is characterized by being labeled with an FI substance.

1. A FITC (Fixed-Intensity Contactor) at the 5' end for detection of LAMP product on a dipstick using a DNA probe with the following base sequence: 5'-FITC-GGTAAATGACCTTT????-3'.

2. A method for detecting antimicrobial-resistant Acinetobacter baumannii using loop-mediated isothermal amplification (LAMP) combined with the use of a dipstick, employing a primer and DNA probe as per Patent 1 or 2, consisting of the following steps: a.The DNA of the pathogen in a sample of bodily fluid under the LAMP reaction is amplified using a primer kit. The optimal conditions for detecting the LAMP product are: a. The LAMP reaction is performed at 60-65 degrees Celsius for 45-60 minutes. b. To detect the LAMP product, the DNA probe is mixed in, then hybridized at 60-65 degrees Celsius for 5-15 minutes. The solution is then transferred to a tube containing buffer solution kept at room temperature, and a dipstick is immersed in the tube.

4. The method for detecting antimicrobial-resistant Acinetobacter baumannii bacteria using the loop-mediated isothermal amplification (LAMP) reaction combined with the use of a dipstick test strip as per claim 3. The LAMP reaction 25 µL (µL) consists of the following main components: inner primers, FIPOxa-23 primer and BIPOxa-23 primer, 0.5-3 ...0.5-3.0 micromolar (mM) each of outer primers F3Oxa-23 and B3Oxa-23, deoxynucleotide triphosphate (dNTPs) 0.5-3.0 millimolar (mM), betaine 0.1-3.0 molar (M), magnesium sulfate (MgSO4) 2-6 millimolar (mM), BstDNAp enzyme.

5. A method for detecting antimicrobial-resistant Acinetobacter baumannii bacteria using the loop-mediated isothermal amplification (LAMP) reaction combined with the use of a dipstick test strip as per claims 3 and 4, where various bodily fluid samples such as sputum, blood, and urine are collected.