A primer and DNA probe kit for the detection of Porcine epidemic diarrhea virus (PEDV), along with a detection method using loop-mediated isothermal amplification (LAMP) combined with a dipstick test strip.
Patent Information
- Application Number
- TH2203003017
- Authority / Receiving Office
- TH · TH
- Patent Type
- Utility models
- Current Assignee / Owner
- Filing Date
- 2022-11-03
- Publication Date
- 2026-09-30
- Estimated Expiration
- 2028-11-02
Abstract
Claims
------11 / 12 / 2568------(OCR)OCR10KL1. Primer and DNA probe set for the detection of Porcineepidemicdiarrheavirus (PEDV) using loop-mediated isothermal amplification (LAMP) reaction, combined with the use of a dipstick containing 4 primers specific to the base sequence of Porcineepidemicdiarrheavirus (PEDV). Up to 6 positions and 1 detector line as follows: Primer F3_PEDV (F3_PEDV) base sequence (5'-3')CTTGAAGGTGTCACGGAC Primer B3_PEDV (B3_PEDV) base sequence (5'-3')CAGAATAAACAGCACCACTAG Primer FIP_PEDV (FIP-PEDV) base sequence (5'-3')ATGATACCCTCACCTTTAAAGCCTTTTTTTTTATGACTCTGGATGTGTG Primer BIP_PEDV (BIP-PEDV) base sequence (5'-3')CCTTACAAATTCTAGCTTTTTGGCATTTTTACATTCTTAAAGGCTAACAACT Probe_PEDV_FITC (Probe_PEDV_FITC) base sequence (5'-3')FITC-GAATCAGATGTGTAATAAAC2.A primer and DNA probe set for the detection of Porcineepidemicdiarrheavirus (PEDV) using loop-mediated isothermal amplification (LAMP) reaction combined with the use of a dipstick test strip, as per Patent 1, in which the DNA probe is used for the detection of Porcineepidemicdiarrheavirus (PEDV). It is characterized by a labeled FITC detector at the 5' end for the detection of LAMP product on a dipstick using a DNA probe.
3. A method for the detection of Porcini epidermic diarrheavirus (PEDV) using the LAMP reaction combined with the use of a dipstick with a primer and DNA probe as per Patent 1 or 2, consisting of the following steps: a.a. DNA amplification of the sample under the LAMP reaction using a primer set. The optimal conditions for detecting the LAMP product are: a. LAMP reaction at 60-65°C for 45-60 minutes. b. Detection of the LAMP product by mixing the DNA probe, then hybridizing at 60-65°C for 5-15 minutes. The solution is then transferred to a tube containing buffer solution kept at room temperature, and the strip test strip is dipped into it.
4. Method for detecting Porcini epidermic diarrheavirus (PEDV) using the LAMP reaction combined with the use of a dipstick test strip, using a primer and DNA probe set according to claim 3, where 25 microliters (µL) of LAMP reaction contains the following main components: inner primers, FIP-PEDV primer, and BIP-PEDV primer, 0% each.5-3 micromolar (µm), outer primers F3_PEDV and B3_PEDV each 0.5-3 micromolar (µm), deoxynucleotide triphosphate (dNTPs) 0.5-3 millimolar (mM), betaine 0.1-3 molar (M), magnesium sulfate (MgSO4) 2-6 millimolar (mM), BstDNApolymerase enzyme 1 unit (U), 10X of buffer, and...
5. A method for detecting Porcini epidermic diarrheavirus (PEDV) using the LAMP reaction combined with the use of a dipstick test strip with a primer and DNA probe set as per claim 3 or 4, where the samples are various secretions, target organ tissues of pigs, and water sources from pig farms suspected of being contaminated with PEDV.