Methods and compositions for improving plant characteristics.

TR201800432BActive Publication Date: 2026-06-22PIVOT BIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
TR201800432
Authority / Receiving Office
TR · TR
Patent Type
Patents
Current Assignee / Owner
Priority Date
2015-09-02
Filing Date
2016-07-13
Publication Date
2026-06-22
Estimated Expiration
2036-07-13

Smart Images

  • Figure 00000184_0000
    Figure 00000184_0000
  • Figure 00000184_0001
    Figure 00000184_0001
  • Figure 00000185_0000
    Figure 00000185_0000
Patent Text Reader

Abstract

This invention describes methods for increasing nitrogen fixation in a non-legume plant. The methods may involve exposing the plant to a large number of bacteria. Each member of the multiples comprises one or more genetic variations inserted into one or more genes or non-coding polynucleotides of the bacteria's nitrogen fixation or assimilation genetic regulatory network, such that the bacteria can fix atmospheric nitrogen in the presence of exogenous nitrogen. The bacteria are not intergenous microorganisms. In addition, the bacteria produce 1% or more of the nitrogen fixed in the plant.
Need to check novelty before this filing date? Find Prior Art

Description

1 TARIFF METHODS AND COMPOSITIONS FOR IMPROVING PLANT CHARACTERISTICS CROSS-REFERENCE This application, each of which is included in full reference, was submitted on July 3, 2015. US Provisional Patent Application No. 62 / 192,009 was filed on September 2, 2015. Priority protection for U.S. Provisional Patent Application No. 62 / 213,567. is requesting. DECLARED AS A FEDERALLY FUNDED RESEARCH STUDY This invention was developed by the United States under SBIR grant 1520545 awarded by the National Science Foundation. This was done with the support of the government. The government has certain rights regarding the issues that have been announced. It has. 15 THE INFRASTRUCTURE OF THE INVENTION Plants are connected to the microbiome through a shared metabolome. A specific The multidimensional relationship between crop characteristics and the associated metabolome involves numerous local 20 It is characterized by a landscape with a microbiome maxima. The microbiome's influence on the metabolome by altering its effect, one inferior local maxima exhibits a better characteristic than the other. Optimization is desired for various reasons, such as crop optimization. It is possible to meet the needs of the growing global population through economic, environmental and Socially sustainable approaches to agriculture and food production are necessary. 25 by 2050 The United Nations Food and Agriculture Organization is addressing the needs of a growing population. To meet this demand, total food production needs to increase by 70%, which The depletion of freshwater resources, increasing competition for arable land, and rising energy demands. prices, rising input costs, and crops in drier, hotter, and more extreme conditions a 30% increase exacerbated by various factors, including the need to adapt to global climate pressures. He stated that there was a problem. One related field is the development of nitrogen fixation. Nitrogen gas (N2) is a component of the Earth's atmosphere. It is an important component. In addition, the element nitrogen (N) forms part of living organisms. It is an important component of many chemical compounds. However, many organisms, 35 2 to synthesize chemicals used in physiological processes such as growth and reproduction You cannot use N2 directly. To use N2, it must be combined with hydrogen. The combination of hydrogen with N2 is called nitrogen fixation. Nitrogen fixation, large quantities, whether achieved chemically or biologically. It requires energy investment. In biological systems, 5 resulting in nitrogen fixation. The reaction is catalyzed by an enzyme known as nitrogenase. Nitrogen fixation. A key objective of their research is to investigate this phenotype in non-legume plants, particularly wheat. It extends to important agronomic grasses such as rice and maize. Rhizobi ​​and legumes. The enormous gains in understanding the development of nitrogen fixation symbiosis between them Despite the improvements, nitrogen fixation nodules are induced on non-legume crops. It is still unclear how this information will be used to achieve this. In the meantime, sufficient amounts of fertilizer, for example... The demand for supplying nitrogen sources is increasing as the need for increased food production grows. It will continue. BRIEF DESCRIPTION OF THE INVENTION 15 In light of the above, improving plant characteristics acquired through an associated microbiome. There is a need for this. The current statement addresses this need and also includes additional information. It also provides advantages. In some cases, the species that make up the microbiome and their components genetics forming the basis of modulation of microbial influence on the metabolome 20 These are the goals. In one respect, the present invention aims to enhance nitrogen fixation in a non-legume plant. A method is presented that involves exposing the plant to a large number of bacteria. It includes, each member of the multiple numbers, a 25 that is included in one or more genes. or further genetic variation or nitrogen fixation in bacteria or Assimilation involves non-coding polynucleotides of the genetic regulatory network, Specifically, bacteria can fix atmospheric nitrogen in the presence of exogenous nitrogen; here Bacteria are not intergeneric microorganisms; and here, bacteria, in planta, in the plant It produces 1% or more of the fixed nitrogen. 30 In some applications, bacteria, in planta, fix 5% or more of the nitrogen fixed in the plant. It produces more than that. In some applications, bacteria, in planta, fix 10% of the nitrogen in the plant. It produces more than that. 35 3 In some applications, one or more genetic variations are required for nitrogen fixation or Assimilation is the functional assimilation of one or more genes mentioned in the genetic regulatory network. It includes an included control sequence that is linked as such. In other applications, the control The sequence is a promoter. In other applications, the promoter is an inducible promoter. In some applications, bacteria utilize nitrogen fixation or assimilation genetic regulatory networks. 5 It does not contain a functionally linked agent promoter to its gene. In some applications, bacteria, The nif gene cluster does not contain a constitutive promoter that is functionally linked to a gene. In some applications, bacteria, in plants, fix nitrogen-containing products of nitrogen. It expels it. In some applications, the large number of bacteria exposed to the plant releases atmospheric 10 It does not stimulate an increase in the uptake of exogenous nitrogen that is not present. In some applications, the plant is treated with fertilizer containing approximately 50 lbs of nitrogen per acre. It is grown in soil in a field where nitrogen-containing fertilizer is applied at least 5% by weight. It contains nitrogen. In other applications, nitrogen-containing fertilizers contain ammonium or ammonium-containing 15. a molecule is found. In some applications, exogenous nitrogen glutamine, ammonium, ammonium, urea, nitrate, nitrite, ammonium-containing molecules, nitrate-containing molecules, and nitrite-containing molecules It is selected from fertilizers containing one or more of these molecules. In some applications, a large number of bacteria includes at least two different types of bacteria. Some 20 In applications, numerous bacteria include at least two different strains of the same bacterial species. Some Many bacteria used in applications belong to the Enterobacter genus. In some applications, too many... The bacteria are numerous, endophytic, epiphytic, or rhizospheric. In some applications, a large number are used. Bacteria colonize the plant in such a way that the bacteria in the plant are present per gram of fresh plant weight. It is found to be at least 105 cfu. 25 In some applications, bacteria act as genetic regulators through nitrogen fixation or assimilation. a network consisting of one or more genes or non-coding polynucleotides, including the following: selected from the group: nifA, nifL, ntrB, ntrC, polynucleotide glnA encoding glutamine synthetase, glnB, glnK, drat, amtB, glutaminase-encoding polynucleotide glnD, glnE, nifJ, nifH, nifD, 30 nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB, and nifQ. Some One or more genetic variations in the applications: increased NifA or glutaminase expression or activity of; NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, Decreased expression or activity of AmtB; decreased adenylyl adhesion of GlnE removal activity; or a 35% decrease in uridyyl-removal activity of GlnD. 4 It may be a mutation that provides one or more. In some applications, one or more Excessive genetic variation is (A) a knockout mutation; (B) a mutation of a target gene. modifyes or destroys the regulatory sequence; or (C) a heterologous regulatory sequence It includes the insertion. In some applications, the plant is an agricultural crop. In other applications, it is an agricultural plant. The plant is selected from among sorghum, canola, tomatoes, strawberries, barley, rice, corn, and wheat. In other applications, the plant is a genetically modified organism. In other words... In some applications, the plant is not a genetically modified organism. The plant has been genetically engineered or bred for efficient nitrogen utilization. 10 In one respect, the present invention explores how bacteria can genetically modify or assimilate nitrogen fixation or nitrogen. to one or more genes or non-coding polynucleotides of the regulatory network a bacterium containing bacteria with one or more added genetic variations It maintains its population; that is, bacteria convert atmospheric nitrogen into 15% nitrogen in the presence of exogenous nitrogen. They can fixate; here the bacteria are not intergenous microorganisms; and the bacteria, in planta, fixed in a plant grown in the presence of a bacterial population It produces 1% or more of nitrogen. In some applications, bacteria fix 5% or more of the nitrogen fixed in the plant. It produces more than that. In some applications, bacteria, in planta, fix 10% of the nitrogen in the plant. It produces more than that. In some applications, one or more genetic variations are required for nitrogen fixation or Assimilation is the functional integration of one or more genes of the aforementioned genetic regulatory network. 25 It includes an included control sequence that is linked as such. In other applications, the control The sequence is a promoter. In other applications, the promoter is an inducible promoter. In some applications, bacteria are used in nitrogen fixation or assimilation genetic regulatory networks. It does not contain a functionally linked agent promoter to its gene. In some applications, bacteria, nif does not contain a constitutive promoter that is functionally linked to a gene in the gene cluster. 30 In some applications, bacteria, in planta, utilize nitrogen-containing products of nitrogen fixation. It expels it. In some applications, the large number of bacteria exposed to the plant release atmospheric substances. It does not stimulate an increase in the uptake of exogenous nitrogen that is not present in some applications. Nitrogen; glutamine, ammonia, ammonium, urea, nitrate, nitrite, ammonium-containing molecules, nitrate 35 from molecules containing nitrite and fertilizer containing one or more nitrite-containing molecules is selected. In some applications, the bacterial population contains at least two different bacterial species. Some In these applications, the bacterial population contains at least two different strains of the same bacterial species. 5 In some applications, numerous bacteria belong to the genus Enterobacter. In some applications... Many bacteria are endophytic, epiphytic, or rhizospheric. In some applications, a large number are used. Bacteria colonize the plant, so the bacteria on the plant are present per gram of fresh plant weight. It is found to be at least 105 cfu. In some applications, bacterial nitrogen fixation or assimilation genetic regulatory networks are used. one or more genes or non-coding polynucleotides within it, of the following: It is selected from the group formed: nifA, nifL, ntrB, ntrC, polynucleotide encoding glutamine synthetase. glnA, glnB, glnK, drat, amtB, polynucleotide glnD, glnE, nifJ, nifH, encoding glutaminase nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB, and nifQ. some 15 One or more genetic variations in the applications: increased NifA or glutaminase expression or activity of; NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, Decreased expression or activity of AmtB; decreased adenylyl adhesion of GlnE a reduction in uridyyl-clearing activity; or a decrease in the uridyyl-clearing activity of GlnD It is a mutation that provides one or more. In some applications, one or more 20 Excessive genetic variation is (A) a knockout mutation; (B) a mutation of a target gene. modifyes or destroys the regulatory sequence; or (C) a heterologous regulatory sequence It includes the insertion. In some applications, the plant is an agricultural crop. In other applications, it is an agricultural 25 The plant is selected from among sorghum, canola, tomatoes, strawberries, barley, rice, corn, and wheat. In other applications, the plant is a genetically modified organism. In other words... In some applications, the plant is not a genetically modified organism. The plant has been genetically engineered or bred for efficient nitrogen utilization. The present invention, in one aspect, is a composition containing a bacterial population. In some applications, the compound is a bacteria coated onto the surface of a seed. It includes the population. In some applications, the composition is formulated as a liquid or powder. It is done. 35 6 In one respect, the present invention has ATCC Access Registration No. PTA-122293 or PTA-122294 An isolated bacterium is provided, which is recorded as such. In one respect, the present invention explores how bacteria can genetically modify or assimilate nitrogen fixation or nitrogen. 5 to one or more genes or non-coding polynucleotides of the regulatory network a non-intergenic bacterium containing one or more included genetic variations This allows bacteria to fix atmospheric nitrogen in the presence of exogenous nitrogen. In some applications, one or more genetic variations are required for nitrogen fixation or Assimilation is the functional integration of one or more genes of the aforementioned genetic regulatory network. It includes a control sequence that is linked and included. In other applications, the control... The sequence is a promoter. In other applications, the promoter is an inducible promoter. In some applications, bacteria are used in nitrogen fixation or assimilation genetic regulatory networks. It does not contain a functionally linked agent promoter to its gene. In some applications, bacteria, nif does not contain a constitutive promoter that is functionally linked to a gene in the gene cluster. 15 In some applications, bacterial nitrogen fixation or assimilation genetic regulatory networks are used. one or more genes or non-coding polynucleotides within it are among the following: It is selected from the group formed: nifA, nifL, ntrB, ntrC, polynucleotide encoding glutamine synthetase. glnA, glnB, glnK, drat, amtB, polynucleotide encoding glutaminase glnD, glnE, nifJ, nifH, 20 nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB, and nifQ. Some One or more genetic variations in the applications: increased NifA or glutaminase expression or activity of; NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, Decreased expression or activity of AmtB; decreased adenylyl adhesion of GlnE the removal activity; or the decreased uridyyl-removal activity of GlnD is a 25 It is a mutation that provides one or more. In some applications, one or more Excessive genetic variation is (A) a knockout mutation; (B) a mutation of a target gene. modifyes or destroys the regulatory sequence; or (C) a heterologous regulatory sequence It includes the insertion. In some applications, the bacteria are of the Enterobacter genus. In other applications, the bacteria... endophytic, epiphytic or rhizospheric. In one aspect, the present invention provides a method for producing one or more bacteria. In practice, the method involves (a) bacteria from the tissue or soil of a primary plant 35 7 (b) to isolate one or more variant bacteria; (b) to produce one or more variant bacteria a genetic variation (for example, one or more genetic variations) into a bacterium (c) the inclusion of numerous plants; (d) isolating bacteria from the tissue or soil of one of a large number of plants; The plant from which the bacteria were isolated is among 5 other plants in a large group. It has an improved feature when compared with the bacteria isolated in step (d) (e). This involves repeating steps (b) through (d). The advanced feature is where bacteria are isolated. It may have improved nitrogen fixation in plants and / or plants exposed to bacteria. Genetic variation is a variation in a gene selected from a group consisting of the following: may be: nifA, nifL, ntrB, ntrC, glnA, glnB, glnK, draT, amtB, glnD, glnE, nifJ, nifH, nifD, 10 nifK, nifE, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB and nifQ. Genetic variation, glutamine synthetase, glutaminase, glutamine synthetase adenillytransferase, transcriptional activator, anti-transcriptional activator, pyruvate flavodoxin oxidoreductase, flavodoxin or NAD+-dinitrogen-reductase ADP-D-ribosyltransferase a variation of a gene encoding a protein with selected functionality from a group such as 15 It is possible. Genetic variation in some applications: Increased NifA or glutaminase. expression or activity of; NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, Decreased expression or activity of AmtB; decreased adenylyl adhesion of GlnE uridyyl-clearing activity; or a decrease in the uridyyl-clearing activity of GlnD. It is a mutation that provides one or more of these. Genetic variation, a knockout 20 It could be a mutation, the elimination or absence of activity of a protein domain. This involves altering or eliminating a regulatory sequence of a target gene and / or It involves the insertion of a heterologous regulatory sequence. In some applications, genetics Variation is a bacterial term that refers to bacteria in which genetic variation is involved. It involves the insertion of a regulatory sequence found in the genome of a species or genus. 25 A regulatory sequence arbitrarily controls the expression of a gene in a bacterial culture. It can be selected according to the level or plant tissue. Genetic variation is random. a random mutation at location, a random mutation in a target region, or a target a predetermined genetic makeup specifically included in the region Variation may occur. Genetic variation is the presence of variation in one or more nucleotides or 30 of them. This may include the insertion, deletion, or modification of any combination thereof. Genetic variation can be produced through chemical mutagenesis. In some applications, the method... It also involves exposing plants to biotic or abiotic stress factors. Some In applications, after one or more steps (b) through (d) are repeated The isolated bacteria were found on a second plant of the same species as the first plant, or on plants exposed to the bacteria. 35 8 a remaining plant contains 1% or more (e.g., at least 2%, 5%) or 10% or more nitrogen. It produces. This type of production involves the second plant producing glutamine, ammonium, or another nitrogen chemical. This can be achieved when the source is grown with supplementary fertilizer. Some In applications, isolate after repeating steps (b) through (d) one or more times. The bacteria obtained were compared with the bacteria isolated from the first plant, resulting in nitrogen 5. It shows at least a twofold increase in fixation (e.g., at least a fivefold increase). First plant or multiple Plants within a number of plants, barley, rice, corn, wheat, sorghum, sweet corn, sugar a plant chosen from among cane, onion, tomato, strawberry or asparagus It can be an agricultural plant. The first plant or plants within a large group of plants, Setaria. It could be a model plant, such as a plant selected from Brachypodium or Arabidopsis. Some 10 In the applications, step (a) also involves the genetic analysis of isolated bacteria. It involves the implementation. In some applications, step (b) also involves genetic variation. enriching the bacteria containing and bacterial isolation depending on the selected pressure It involves applying a selected pressure to achieve the desired result. The selected pressure is a target. 15 It may include; where binding occurs within 100 nucleotides of the target region. Binding is a Zinc Finger nuclease, a CRISPR nuclease, a TALE nuclease, or a a region-specific nuclease, such as a nuclease selected from a group of meganucleases It can be managed by a nuclease. In some cases, a CRISPR nuclease may be preferred. After repeating steps (b) through (d) one or more times, the isolated bacteria, 20 They are endophytic, epiphytic, or rhizospheric. Bacteria originate from plant tissue (e.g., seeds). They can be isolated. Bacteria can include numerous different bacterial taxa. Some In the applications, the bacteria isolated in step (a) were taken from a seed of the first plant. It involves isolating bacteria. In one sense, the present invention offers a method for increasing nitrogen fixation in a plant. In one application, the method provides one or more ways to regulate the nitrogen fixation of the plant. containing one or more genetic variations incorporated into more genes This involves exposing the plant to bacteria, where the bacteria constitute 1% or more of the plant. (e.g., at least 2%, 5%, 10% or more) produces nitrogen. Bacteria produce glutamine, ammonium 30 or in the presence of fertilization supplemented with another chemical source of additional nitrogen It can produce nitrogen. In some applications, genetic variation, nifA, nifL, ntrB, ntrC, glutamine are used. synthetase, glnA, glnB, glnK, draT, amtB, glutaminase, glnD, glnE, nifD, nifK, nifY, nifE, A selected one from the group containing nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB and nifQ It is a variation in the gene. The genetic variation is an increased level of NifA or glutaminase. 9 expression or activity of; NifL, NtrB, glutamine synthetase, glnB, glnK, draT, Decreased expression or activity of amtB; decreased adenylyl amplification of GlnE a reduction in uridyyl-clearing activity; or a decrease in the uridyyl-clearing activity of GlnD It is a mutation that provides one or more of these. Genetic variation in some applications. (a) is a knockout mutation; (b) alters a regulatory sequence of a target gene or 5 (c) destroys; or involves the insertion of a heterologous regulatory sequence. Bacteria They can be endophytic, epiphytic, or rhizospheric. In some cases, the bacteria are Enterobacter or It belongs to the genus Rahnella. The bacteria can include numerous different bacterial taxa. Some The plants used in applications include sorghum, canola, tomatoes, strawberries, barley, rice, corn, and wheat. It is an agricultural crop plant, like a plant selected from among others. The plant is a non-legume plant. 10 It is possible. The plant is a genetically modified organism (a GMO, for example, a heterologous gene). a plant with a genetically modified genome (to carry) It can be an unprocessed organism (non-GMO) or for efficient nitrogen utilization. They may be genetically engineered or bred. In one respect, the present invention provides a bacterial population. Bacteria in an application. population, incorporated into one or more genes regulating nitrogen fixation includes bacteria containing one or more genetic variations; where bacteria are bacteria 1% or more (e.g., at least 2%, 5%) in a plant growing within the population Bacteria produce nitrogen (10% or more) from glutamine, ammonium, or additional nitrogen. It can produce nitrogen in the presence of fertilization supplemented with other chemical sources. Some Genetic variation in applications refers to a gene selected from a group consisting of the following: variation: nifA, nifL, ntrB, ntrC, glutamine synthetase, glnA, glnB, glnK, draT, amtB, glutaminase, glnD, glnE, nifJ, nifH , nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB, and nifQ. Genetic variation nifA or increased expression of glutaminase 25 or decreased activity of nifL, ntrB, glutamine synthetase, glnB, glnK, draT, amtB expression or activity; decreased adenylyl elimination activity of GlnE; or one or more of the decreased uridyyl-clearing activity of GlnD It is a mutation that provides a knockout. In some applications, genetic variation (a) is a knockout. (b) a mutation; (b) alters or deletes a regulatory sequence of a target gene; or 30 (c) involves the insertion of a heterologous regulatory sequence. Bacteria are endophytic, epiphytic or They can be rhizospheric. In some cases, the bacteria are of the Enterobacter or Rahnella genera. Bacteria can include numerous different bacterial taxa. In one aspect, the present invention is a bacterium such as the bacterial population described here. It provides a composition that includes the population. The composition is placed on one surface of a seed. It may contain a coated bacterial population. In some applications, the composition is a liquid or a powder. It is formulated as follows. In one respect, the present invention involves a bacterium with registration number ATCC PTA-122293. is provided. In one respect, the present invention has the registration number ATCC PTA-122294. A bacteria that has this is provided. COMBINING REFERENCES 10 All publications, patents, and patent applications mentioned in this specification are the property of each individual owner. publication, patent or patent application, as if taken as a specific and individual reference. It has been taken as a reference to the same extent. BRIEF DESCRIPTION OF THE FIGURES The unique features of the invention are specifically set forth in the attached claims. This invention... a better understanding of its features and advantages, examples where the principles of the invention are used 20 will be obtained: Figure 1A-B shows the enrichment and isolation of nitrogen-fixing bacteria. (A) Nfb agar plate, isolates single colonies of nitrogen fixation bacteria. It was used for this purpose. (B) Semi-solid Nfb agar poured into a Balch tube. Ok, 25 It indicates the pellicle of nitrogen-enriched fixation bacteria. Figure 2 shows a representative nifH PCR screen. In this screen, ~350 for two colonies. Positive bands were observed at bp. Lower bands represent primary dimers. Figure 3 shows a PCR of colonies obtained from mutagenesis selected by CRISPR-Cas. It shows an example of the screen. CI006 colonies are primers specific to the nifL locus. It was screened with. While the wild-type PCR product is expected to be ~2.2kb, the mutant's It is expected to be around 1.1kb. Seven out of ten colonies scanned performed the desired deletion process. It clearly shows. 35 11 Figures 4A-D show the in vitro phenotypes of various strains. With 0-10 mM glutamine. Mutants of the CI010 strain (Figure 4A) grown in nitrogen-supplemented fixation medium Acetylene Reduction Test (ARA) activities and reinforcement of CI006 strain mutants (Figure 4B). The ARA activities of the strains are shown in Figure 4C, and the time difference of two strains is shown in Figure 5. The ammonium excretion profile is shown in Figure 4D. Figure 5 shows the culture of 9 different genes in CI006 strains involved in diazaotropic nitrogen fixation. This shows the expression profile. The numbers represent the number of each transcript. Various conditions (0, 1, 10 mM Glutamine and 0%, 10%, 20% atmospheric air in N2) 10 It is shown. Figure 6 shows the colonization of maize roots with CI006. Maize seedlings are treated with an RFP. They were vaccinated with CI006, which contains the expression plasmid. Two weeks of growth and suitability After plasmid treatment with antibiotics via irrigation, the roots were harvested and 15 Visualized with a fluorescence microscope. Colonization of the stem cell-intracellular space. is being observed. Figure 7 shows the microbial levels derived from the WT (CI050) and optimized (CM002) strains. It shows nitrogen. 20 Figure 8 shows an experimental setup for a Micro-Tom fruit mass assay. Figure 9 shows a screen of 10 strains for Micro-Tom plant fruit mass increase. This shows the results for six replications. For column 3, p = 0.07. For column 25... For 7, p = 0.05. Figures 10A-C show nitrogen fixation medium supplemented with 0 to 10 mM glutamine. Additional tests for ARA activities of cultured candidate microbes and corresponding candidate mutants This shows the results. 30 Figure 11 shows a pair exhibiting higher ammonium excretion than the single mutant from which it was derived. It shows the mutant. 12 Figure 12 shows the measurement of NDFA in maize plants under fertilized conditions using 15N gas. Extrapolate NDFA obtained from the uptake experiment (using the number of days exposed). (has been done) shows. Figure 13 shows the measurement of NDFA in Setaria plants under fertilized conditions using 15N Gas 5. NDFA values ​​obtained from the uptake experiment (using the number of days exposed) (extrapolated) shows. Figure 14A shows the incorporation rate of 15N gas. Inoculated with evolved strain. The inoculated plants showed an increase of 10 when compared to uninoculated plants with the inclusion of 15N gas. has shown. Figure 14B shows the nitrogen levels in plants inoculated with a developing strain, 4 weeks after sowing. Up to 7% is derived from microbially fixed nitrogen. Figure 14C shows the comparison of ungrafted or wild-type grafted plants with wild-type plants. leaf area (and other biomass measurements) in plants inoculated with a developing strain, (data not shown) indicates an increase. Figure 15A shows a significant 20 in root tissue as measured in the in planta transcriptomic study. This shows that the developing strains exhibit significantly higher nifH production. Figure 15B shows the amount of fixed nitrogen found in plant tissue, and how this affects the plant in question. Home was correlated with the speed at which it was colonized by the optimized strain. It shows. 25 Figure 16A shows a soil texture of various field soils tested for colonization. It shows the map of the soils where several microbes originally originated. They are shown as stars. Figure 16B shows Strains 1 and 5 tested among four different soil types (circles). This indicates the colonization rate. Both strains are relatively robust in various soils. It has shown a colonization profile. 13 Figure 16C shows Strain 1 tested in a field study over one growing season. It shows colonization. Strain 1 colonized corn up to the 12th week after planting. It remains in the tissue and then shows a decline in colonization. begins. DETAILED DESCRIPTION OF THE INVENTION The terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid" and "oligonucleotide" They are used interchangeably. These are polymeric nucleotides of any length. in the form of deoxyribonucleotides or ribonucleotides or their analogs 10 This means that polynucleotides can have any three-dimensional structure and are known to have no specific type. or they may perform any unknown function. The following are polynucleotides These are non-limiting examples: a gene or gene fragment that codes for or non-coding regions, loci (identified from linkage analysis), exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interference 15 RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, any isolated DNA of a sequence, isolated RNA of any sequence, nucleic acid Probes and primers. A polynucleotide, methylated nucleotides, and nucleotide analogs. It may contain one or more modified nucleotides, such as nucleotide 20. If present, nucleotide 20 The structural changes can be given before or after the polymerization. Nucleotide The sequence can be interfered with by non-nucleotide components. A polynucleotide after polymerization, for example via conjugation with a labeling component It can be modified. "Hybridization" is the process by which hydrogen is bonded between the bases of nucleotide residues. one or more polynucleotides to form a stabilized complex It indicates a reaction in which it reacts. Hydrogen bonds, Watson-Crick base pairing, Hoogstein binding or any other set of specific base complementarities It can be formed in a complex way. Two twists forming a duplex structure, a multi-twist 30 a complex formed by three or more twists, a single twist that self-hybrids or may include any combination of these. A hybridization reaction, PCR initiation or enzymatic reduction of a polynucleotide by an endonuclease. It can be a step in a broader process like bonding. A first sequence A second sequence that completes the first sequence means it is the "complement" of the first sequence. A 35 14 The term "hybridable" applied to a polynucleotide means that the polynucleotide is capable of hybridization. in the reaction through the bonding of hydrogen between the bases of nucleotide residues It indicates the ability to form a balanced complex. "Complementarity" refers to a nucleic acid's compatibility with traditional Watson-Crick or other conventional 5-core nucleic acids. forming hydrogen bond(s) with another nucleic acid sequence via non-native species It indicates the ability. A percentage of complementarity, a second nucleic acid sequence (for example, Out of 10, which are 50%, 60%, 70%, 80%, 90% and 100% complementary respectively, 10, 5, 6, residues in a nucleic acid molecule that can form hydrogen bonds with (7, 8, 9, 10) It shows the percentage (e.g., Watson-Crick base pairing). "Perfect complement" is a 10 All adjacent residues of a nucleic acid sequence are within a second nucleic acid sequence. This means there will be hydrogen bonds with the same number of adjacent residues. Used here The term "substantially complementary" as it appears in pages 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50 on a region, at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% or more nucleotides 15 It refers to two nucleic acids that contain or hybridize under harsh conditions. Series identity, as well as for evaluating the percentage of complementarity value. including but not limited to the Needleman-Wunsch algorithm (see EMBOSS can be found at www.ebi.ac.uk / Tools / psa / emboss_needle / nucleotide.html Needle adjuster (optional, with default settings), BLAST 20 algorithm (BLAST tuning tool located at blast.ncbi.nlm.nih.gov / Blast.cgi) (optionally available with default settings) or Smith-Waterman algorithm (see www.ebi.ac.uk / Tools / psa / emboss_water / nucleotide.html) The included EMBOSS water regulator comes with default settings as an option. any suitable adjustment including but not limited to (found) 25 This can be measured using the algorithm. Optimal alignment, including default parameters. using any suitable parameter of a chosen algorithm assessable. In general, "hard conditions" for hybridization refer to a nucleic acid sequence that is complementary to a target sequence. where the acid hybridizes predominantly with a target sequence and primarily with non-target sequences. It specifies the conditions under which the sequences do not hybridize. Harsh conditions are usually sequence-dependent and It varies depending on several factors. In general, the longer the series, the better the rating of the episode. Specifically, the temperature at which it hybridizes to the target sequence also increases. Hard Examples of non-limiting conditions, Tijssen (1993), Laboratory Technniques In 35 Biochemistry And Molecular Biology-Hybridization With Nucleic Acid Probes Part I, Second Chapter “Overview of principles of hybridization and the strategy of nucleic The "acid probe assay" is described in detail in Elsevier, NY. As used here, "expression" refers to the number of times a polynucleotide is transferred from a DNA template to a specific location. (e.g., into mRNA or other RNA transcript) and / or subject to transcription The captured mRNA is subject to a process of conversion into peptides, polypeptides, or proteins. It refers to the process by which it is stored. Transcripts and encoded polypeptides are collectively called "genes". It can be called a "product". If the polynucleotide is derived from genomic DNA, Expression may involve the addition of mucosal material to a eukaryotic cell. 10 The terms "polypeptide," "peptide," and "protein" here refer to any length of amino acids. They are used interchangeably to refer to polymers. Polymer is linear or For example, it can be branched, contain modified amino acids, and non-amino acids. It can be interfered with. The terms also include a modified amino acid polymer; 15 disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or a Any other manipulation, such as conjugation with the labeling component. Here The term "amino acid," as used, refers to glycine and both its D and L optical isomers. amino acids containing natural and / or unnatural or synthetic amino acids It includes analogs and peptidomimetics. 20 As used here, the term "approximately" is synonymous with the term "approximately". It is used. For example, the term "approximately" is used in relation to a quantity, indicating values. It deviates slightly from the specified values, for example, between plus or minus 0.1% and 10%. This shows that it is. 25 The term "biologically pure culture" or "largely pure culture" refers to what is described here, techniques that can interfere with culture growth or be detected by normal bacteriological techniques. a culture from one bacterial species that does not contain an adequate amount of other bacterial species It corresponds to 30. "Plant productivity" generally refers to a plant's ability to perform well, which is a reason for cultivating the plant. It relates to any aspect of growth or development of food, such as grains or vegetables. For crops, "plant yield" refers to the amount of grain or fruit harvested from a particular crop. It can mean increased yield. As used here, improved plant productivity refers to various 35 16 in the yield of grains, fruits, flowers or other plant parts harvested for purposes recovery, in the growth of plant parts including stems, leaves and roots improvements, promoting plant growth, enhancing plant growth Increasing the number of fruits or seeds, increasing the weight of fruits or seeds, Reduction in NO2 emissions due to reduced nitrogen fertilizer use and 5 This means achieving similar improvements in the growth and development of plants. Microorganisms found in and around food products determine the characteristics of these products. It can affect plant characteristics that can be affected by microbes, including: yield (e.g., grain). production, biomass production, fruit development, flower clustering); nutrition (e.g., nitrogen, 10 phosphorus, potassium, iron, micronutrient intake); abiotic stress management (e.g. drought tolerance, salt tolerance, heat tolerance); and biotic stress management (e.g., pest, (weeds, insects, fungi and bacteria) are found. They can alter crop characteristics. Strategies include: increasing key metabolite concentrations; key altering the temporal dynamics of microbial action on metabolites; microbial 15 Associate the production / degradation of metabolites with novel environmental cues; negative reduction of metabolites; and balance of metabolites or underlying proteins improvement. As used here, a "control sequence" is a sequence consisting of an operator, promoter, suppressor, or 20 It means terminator. As used here, "in planta" means located in the plant, and in this case, the plant It also includes leaves, roots, stems, seeds, ovules, pollen, flowers, fruits, etc. In some applications, natural or endogenous control sequences of genes belonging to the current invention are used as a or replaced with more intrageneric control arrays. As used here, "included" is a naturally occurring inclusion. No, it means inclusion through modern biotechnology. 30 In some applications, the bacteria in the current invention will not be naturally occurring bacteria. It has been modified in this way. 17 In some applications, bacteria belonging to the present invention can affect the plant's fresh or dried plant weight. at least 103 cfu, 104 cfu, 105 cfu, 106 cfu, 107 cfu, 108 cfu, 109 cfu, 1010 cfu per gram It is found in quantities of 10¹¹ cfu, or 10¹². In some applications, the bacteria related to the present invention, in the plant, at least approximately 103 cfu per gram of fresh or dried plant weight, approximately 104 cfu, approximately 105 cfu, approximately 106 cfu, approximately 107 cfu, approximately 108 cfu, approximately 5 It is found in amounts of 10⁹ cfu, approximately 10¹⁰ cfu, approximately 10¹¹ cfu, or approximately 10¹² cfu. In some applications, the bacteria described in the current description are found in plants, whether fresh or dried. at least 103 to 109, 103 to 107, 103 to 105, 105 to 109, 105 to 107 per gram of weight, It is found in amounts ranging from 10⁶ to 10¹⁰, and 10⁶ to 10⁷. Fertilizers and exogenous nitrogen, as described in the current explanation, include the following nitrogen-containing molecules: May contain: ammonium, nitrate, nitrite, ammonium glutamine, etc. Nitrogen related to the present invention. Sources include anhydrous ammonium, ammonium sulfate, urea, diammonium phosphate, and urea form. monoammonium phosphate, ammonium nitrate, nitrogen solutions, calcium nitrate, potassium nitrate, May contain sodium nitrate, etc. 15 As used here, "exogenous nitrogen" refers to ammonium, ammonium nitrate, nitrite, urea, uric acid. under nitrogen-free limiting conditions, including acids, ammonium acids, etc. non-atmospheric nitrogen that is readily available in soil, field, or growing medium It indicates. 20 As used herein, "nitrogen-free limiting conditions" refers to Kant et al. (2010. J. Exp. Biol. higher than approximately 4 mM nitrogen as described by 62(4):1499-1509). It indicates the concentrations of non-atmospheric nitrogen present in the soil, field, and environment. (2010. J. Exp. Biol., 62 (4): 1499-1509), contributed to this invention by reference. 25 The term "intergeneric microorganism" used here refers to microorganisms that originally belonged to different taxonomic genera. formed by the planned combination of genetic material isolated from organisms It is a microorganism. An "intergeneric mutant" is a microorganism that interacts with another "intergeneric microorganism". It can be used in place of "intergeneric microorganism". An example is recipient 30 first within a microorganism of a different genus than another microorganism It encompasses a microorganism containing a defined motile genetic element. In addition to the other explanations, further explanations can be found in 40 CFR § 725.3. 18 As used here, "intrageneric microorganism" refers to the same taxonomic genus. by planned combination of genetic material isolated from organisms It is a microorganism created. An "intrageneric mutant" is an "intrageneric". It can be used interchangeably with "microorganism". As used here, the term "included genetic material" refers to the recipient's genome. It refers to genetic material that is added and remains as a component of this genome. In some applications, nitrogen fixation and assimilation genetic regulatory networks are used in microbial processes. 10 that direct, modulate and / or regulate nitrogen fixation and / or assimilation It includes the polynucleotides that encode the genes and the non-coding sequences, and the nif cluster. polynucleotide sequences (e.g., nifA, nifB, nifC, ... nifZ), nitrogen regulatory protein C. polynucleotides encoding nitrogen regulatory protein B, gln polynucleotide sequences of the cluster (e.g., glnA and glnD), draT and ammonium May contain carriers / permeases. 15 In some applications, the fertilizer content of the present invention must be at least 5%, 6%, 7%, 8%, 9% by weight. 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24% 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 34%, 35%, 36%, 37%, 38% 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 20 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 67%, 68%, 69% 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84% 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% It contains nitrogen. In some applications, the fertilizer derived from the present invention should contain at least approximately 5% by weight, approximately 6%, approximately 7%, approximately 8%, approximately 9%, approximately 10%, approximately 11%, approximately 12%, approximately 13%, approximately 14%, approximately 15%, approximately 16%, approximately 17%, approximately 18%, approximately 19%, approximately 20%, approximately 21%, approximately 22%, approximately 23%, approximately 24%, approximately 25%, approximately 26%, approximately 27%, approximately 28%, approximately 29%, 30% approximately 30%, approximately 31%, approximately 32%, approximately 33%, approximately 34%, approximately 35%, approximately 36%, approximately 37%, approximately 38%, approximately 39%, approximately 40%, approximately 41%, approximately 42%, approximately 43%, approximately 44%, approximately 45%, approximately 46%, approximately 47%, approximately 48%, approximately 49%, approximately 50%, approximately 51%, approximately 52%, approximately 53%, approximately 54%, approximately 55%, approximately 56%, approximately 57%, approximately 58%, approximately 59%, 35 19 approximately 60%, approximately 61%, approximately 62%, approximately 63%, approximately 64%, approximately 65%, approximately 66%, approximately 67%, approximately 68%, approximately 69%, approximately 70%, approximately 71%, approximately 72%, approximately 73%, approximately 74%, approximately 75%, approximately 76%, approximately 77%, approximately 78%, approximately 79%, approximately 80%, approximately 81%, approximately 82%, approximately 83%, Approximately 84%, approximately 85%, approximately 86%, approximately 87%, approximately 88%. Weight: 5 90%, 89%, approximately 90%, approximately 91%, approximately 92%, approximately 93%, approximately 94%, approximately 95%, approximately 96%, approximately 97%, approximately 98%, or approximately 99% nitrogen includes. In some applications, the fertilizer derived from the present invention constitutes approximately 5% to 50% by weight. approximately 5% to 75%, approximately 10% to 50%, approximately 10% to 75%, approximately 15% to 50%, approximately 15% 75% to 75%, approximately 20% to 50%, approximately 20% to 75%, approximately 25% to 50%, approximately 25% to 75%, approximately 30% to 50%, approximately 30% to 75%, approximately 50% to 50%, approximately 35% to 75%, approximately 40% to 50%, approximately 40% to 75%, approximately 45% to 50%, approximately 45% to 75%, or approximately 50% to 75% nitrogen 15 includes. In some applications, increasing nitrogen fixation and / or reducing the nitrogen content in the plant to 1% or more is necessary. production of more than that controlled without exposure to bacteria of the existing invention It is measured according to the plants. All increases or decreases in bacteria are compared to control bacteria 20 All increases or decreases in plants are measured relative to control plants. As used here, a "constructive promoter" refers to most conditions and / or most developments. It is a promoter that is active during this stage. Expression used in biotechnology. There are several advantages to using constructive promoters in vectors: transgenic 25 high levels of proteins used to select cells or organisms production; reporter proteins or High levels of expression of quantifiable markers; a regulatory transcription factor. high levels of production of a transcription factor that is part of the system; Production of compounds requiring widespread activity in the organism; and all 30 of development Production of the necessary compounds in the stages. Non-limiting, exemplary. promoters include CaMV 35S promoter, opin promoters, ubiquitin promoter, and alcohol. dehydrogenase promoter, etc. are included. As used here, a "non-constructive promoter" is one that, under certain conditions, engages in certain activities. It is a promoter that is active in certain cell types and / or developmental stages. For example, tissue-specific, tissue preference; cell type-specific, cell type preference. inducible promoters and promoters under developmental control are non-structural. They are promoters. Examples of promoters under developmental control are found in specific tissues. They preferably contain transcription-initiating promoters. As used here, an "inducible" or "repressible" promoter is a chemical It is a promoter that is under the control of environmental factors or is inducible. Examples of environmental conditions that can affect transcription by promoters: 10 among them are anaerobic conditions, certain chemicals, and the presence of mild, acidic, or basic conditions. etc. are included. As used here, a "tissue-specific" promoter is one that is only used in certain tissues. It is a promoter that initiates transcription. Unlike the constitutive expression of genes, 15 Tissue-specific expression is the result of several interacting gene regulation. Therefore, Sometimes, in technology, transgenes can be effectively and reliably introduced into specific tissues. promoters from homologous or closely related species to obtain its expression It is preferable to use this. This is because large quantities of tissue-specific promoters are used both scientifically and... also the basic principle of isolating specific tissues found in patent literature 20 This is one of the reasons. As used here, the term "functionally linked" refers to a single nucleic acid. the assembly of nucleic acid sequences on a piece of paper, thus forming one's This means that one function is regulated by another. For example, a promoter, 25 when the encoding sequence can modify the expression of the promoter (i.e., the encoding sequence promoter) (when under transcriptional control) functionally with a coding sequence They are related. Encoding sequences are modifier sequences in a sense or antisense direction. They can be functionally linked. In another example, complementary RNA regions of the invention. directly or indirectly to the target mRNA 5' or to the target mRNA 3' or to the target mRNA 30 It can functionally bind into mRNA or the first complement region 5' and Its complement binds to the target mRNA at the 3' position. One characteristic that could be a target for regulation using the methods described here is nitrogen. It is the fixation. Nitrogen fertilizer is the largest operating expense in a field and is used for corn and wheat 35 21 It is the biggest driving factor in achieving high yields in row crops, such as those mentioned. Here, Microbial products that can provide renewable forms of nitrogen in non-legume plants. It is explained that in some endophytes, nitrogen fixation in pure culture is necessary. Although their genetic makeup is known, the main technical challenge lies in the wild type of cereals and grasses. It is the action of endophytes to stop the fixation of nitrogen in fertilized areas. Chemical 5 Application of fertilizers and residual nitrogen levels to field soils, nitrogen fixation. It gives a microbial signal to shut down the biochemical pathway. A fertilizer that can fix and activate the nitrogen in corn in the presence of a fertilizer. To develop microbes, transcriptional and post-10 of the nitrogen fixation regulatory network are required. Changes are needed at the translation levels. For this purpose, regulatory networks Host-Microbe Evolution (HoME) fully developed and introduced new phenotypes. The technology is explained. Also, different environmental conditions such as nitrogen stress and excess are discussed. with comprehensive omics data including the interaction of microbes and the host plant 15 unique, proprietary nitrogen-fixing endophytes isolated from crossbred corn. The libraries are also explained. This actively uses nitrogen even in field fertilization. the precise genetic regulatory network of endophytes to produce fixative microbes It makes evolution possible. Nitrogen for plants that colonize and fertilize corn root tissues. Evaluation of the technical potential of microorganisms that produce nitrogen and the use of microorganisms in modern nitrogen production. To determine the feasibility of the interaction of endophytes with management strategies, standard 20 formulation applications and evaluation of compatibility with various soils It is explained here. To use elemental nitrogen (N) for chemical synthesis, living forms undergo nitrogen fixation. In a process known as hydrogen sulfide, they combine nitrogen gas (N2) found in the atmosphere with hydrogen. 25 Due to the energy-intensive nature of biological nitrogen fixation, diazotrophs (atmospheric Bacteria and archaea that fix nitrogen gas in response to environmental oxygen and available nitrogen. Nif has developed a sophisticated and tightly regulated gene cluster. Nif genes regulate nitrogen. enzymes involved in fixation (such as nitrogenase complex) and nitrogen fixation encodes regulatory proteins. Shamseldin (2013. Global J. Biotechnol. Biochem. 8 (4): 30 (84-94) describes detailed descriptions of nif genes and their products, and references are provided herein. It is included. Here, the isolation of bacteria from a primary plant, isolated The insertion of a genetic variation into a nymph gene in bacteria results in a second plant. Exposure to variant bacteria resulted in an improved characteristic compared to the first plant. 22 by isolating bacteria from the second plant, with bacteria isolated from the second plant repetition of the steps. Regulation of nitrogen fixation in proteobacteria, positive nif cluster NifA 5 enhancer-binding protein, which is coupled to the transcriptional regulator σ54. It is located around. Intracellular levels of active NifA are controlled by two key factors. This is achieved through: transcription of the nifLA operon and protein-protein interaction with nifL. Inhibition of NifA activity. Both of these processes involve PII protein signaling. It is a cascade of responses to intracellular glutamine levels. This cascade regulates glutamine... directly senses and responds to the presence or absence of bound glutamine, respectively, in two PII 10 regulatory proteins - GlnB and GlnK - catalyze uridylation or deuridylation Under nitrogen excess conditions, unmodified GlnB inhibits the nifLA promoter. This indicates that it should be deactivated. However, under nitrogen-limiting conditions, GlnB is inhibited by a post-intervention that leads to the transcription of the nifLA operon. Translation has been modified. In this way, nifLA transcription affects PII protein signaling. 15 It is tightly controlled in response to environmental nitrogen through a cascade. NifA At the post-translational level of its regulation, GlnK is converted into free GlnK within the cell. It inhibits the NifL / NifA interaction in a substance that is dependent on its level. NifA, its promoter, is phosphorylated NtrC20, another σ54-dependent regulator. It is transcribed from the nifLA operon, which is activated by phosphorylation of NtrC. in its state, interacting with uridylylated GlnB interacting with deidylylated GlnB Non-influencing histidine kinase NtrB mediates this. Under nitrogen excess conditions, high intrasulfacial levels are observed. At this level, glutamine causes deuridylation of GlnB, which then progresses to NtrB. By interacting, it deactivates phosphorylation activity and activates phosphatase activity. 25 It dephosphorylates NtrC and deactivates the nifLA promoter. However, nitrogen Under limiting conditions, low intracellular glutamine levels affect its interaction with NtrB. inhibiting phosphorylation of NtrC and allowing transcription of the nifLA operon. This leads to uridylylation of GlnB. In this way, nifLA expression affects the PII protein. It is tightly controlled in response to environmental nitrogen via a signaling cascade. nifA, 30 ntrB, ntrC, and glnB are genes that can be mutated using the methods described here. NifA activity is in response to post-translational nitrogen, most typically the activity of NifA as shown. It is regulated by NifA-mediated inhibition. Typically, this occurs between GlnK and NifL / NifA. Although the nature of interactions differs significantly among diazotrophs, 35 23 The interaction of NifL and NifA is part of the PII protein signaling cascade via the GlnK pathway. Both forms of GlnK in Klebsiella pneumoniae are affected by the NifL / NifA interaction. It inhibits the interaction between GlnK and NifL / NifA, and free GlnK within the cell. It is determined by the level. Under nitrogen excess conditions, deididyylated GlnK amide The carrier interacts with AmtB and blocks the uptake of ammonium by AmtB, and 5 It cleaves GlnK to the membrane and allows NifA to be inhibited by NifL. Other On the other hand, in Azotobacter vinelandii, for NifL / NifA interaction and NifA inhibition. Interaction with deuridylated GlnK is required; conversely, uridyllation of GlnK, It inhibits interaction with NifL. In diazotrophs lacking the NifL gene, NifA activity is reduced. Under conditions of direct nitrogen excess, both the deuridylated forms of GlnK and GlnB are 10 There is evidence that it is inhibited through interaction with other substances. Whatever the mechanism, Post-translation inhibition of nifA is a key component of the nif cluster in many known diazotrophs. It is a regulator. In addition, nifL, amtB and glnK are used in the methods described here. These are genes that can be mutated. In addition to regulating the transcription of the nif gene cluster, many diazotrophs, Direct post-translational action of the nitrosase enzyme, known as nitrogenase closure. It has developed a mechanism for modification and inhibition. This is called nitrogen excess. Under these conditions, ADP-ribosylation of Fe protein (NifH) is mediated and MoFe protein It disrupts its interaction with the NifDK complex and eliminates nitrogen activity. DraT, 20 AD protein catalyzes ADP-ribosylation and nitrogenase elimination. DraG removes ADP-ribose and reactivates nitrogenase. It catalyzes nitrogenase, as in nifLA transcription and nifA inhibition. Its shutdown is also regulated by the PII protein signaling cascade. Under nitrogen excess conditions Below, deuridylated GlnB interacts with and activates DraT, while deuridylated 25 GlnK interacts with both DraG and AmtB to form a complex and enters the membrane. It separates DraG. Under nitrogen-limiting conditions, uridylated GlnB and GlnK. The forms do not interact with DraT and DraG respectively, inactivating DraT and Diffusion of DraG into Fe protein eliminates ADP-ribose and activates nitrogenase. The methods described here involve genetic modification of the nifH, nifD, nifK, and draT genes. This also suggests including variation. Although some endophytes have in vitro nitrogen fixation capabilities, their levels are high. Genetic differentiation occurs at the level of exogenous chemical fertilizers. Field To facilitate nitrogen-based fixation, nitrogenase 35 detects exogenous nitrogen. 24 It is possible to separate it from the enzyme's expression. Nitrogen activity over time Increasing its integrity serves to increase nitrogen production for plant use. Here to facilitate field-based nitrogen fixation using the described methods specific targets of genetic variation, nifA, nifL, ntrB, ntrC, glnA, glnB, glnK, draT, amtB, glnD, glnE, nifJ, nifH, nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, 5 It contains one or more genes selected from the group including nifF, nifB, and nifQ. To facilitate field-based nitrogen fixation using the methods described here. An additional target for genetic variation is the NifA protein. The NifA protein typically targets nitrogen. It is an activator for the expression of fixation genes. Increasing NifA production (or 10 (structural or under high ammonium conditions) natural ammonium detection pathway It neutralizes it. It also inhibits the production of NifL proteins, which are a known NifA inhibitor. Reducing this leads to an increase in the level of free active NifA. In addition to this... In other words, increasing the transcription level of the nifAL operon (either structurally or otherwise). (under high ammonium conditions) also generally a higher NifA protein 15 This leads to an increased level of nifAL expression, which in turn increases the promoter's level. This is achieved by altering itself or by reducing the expression of NtrB (ntrB and ntrC). Part of the signaling cascade occurs under high nitrogen conditions with the nifAL operon. (which will cause it to close). This specification or any other described herein The high NifA levels obtained by this method increased the nitrogen fixation activity of endophytes by 20 It increases. To facilitate area-based nitrogen fixation using the methods described here. Another target for genetic diversity is the GlnD / GlnB / GlnK PII signaling cascade. Intracellular glutamine levels are detected via the GlnD / GlnB / GlnK PII signaling cascade. 25 In GlnD, active site mutations that abolish GlnD's uridylyl elimination activity, It disrupts the nitrogen-sensitive cascade. In addition, GlnB concentration... Reducing this short-circuits the glutamine-sensing cascade. These mutations cause the cells to... It "tricks" the perception of a nitrogen-limiting state, thereby increasing the nitrogen fixation level activity. increases. 30 amtB protein performs domain-based nitrogen fixation using the methods described here. Genetic variation is a target for facilitating ammonium uptake from the environment. This can be reduced by decreasing the expression level of amtB protein. Intracellular ammonium In this case, the endophyte cannot detect high levels of ammonium and nitrogen fixation 35 It cannot prevent the downregulation of its genes. It manages to enter the intracellular compartment. Any ammonium is converted to glutamine. Intracellular glutamine levels are determined by nitrogen. It is a primary indicator in perception. Reducing intracellular glutamine levels, It prevents cells from detecting high levels of ammonium in the environment. This affects glutaminase. The expression level of glutaminase, an enzyme that converts glutamate, is 5 This can be done by increasing it. In addition, intracellular glutamine, glutamine synthase (which converts ammonia) (an enzyme that converts glutamine) can be reduced by decreasing it. In diazotrophs, it is fixed. Ammonia is rapidly assimilated into glutamine and glutamate, which are then used for cellular processes. Disruptions in ammonia assimilation mean that fixed nitrogen cannot be expelled from the cell as ammonia. It can facilitate its excretion. The fixed ammonia is mostly absorbed by glutamine synthetase (GS) 10 glutamine, encoded by glnA, is assimilated, and then glutamine Glutamine is assimilated by oxooglutarate aminotransferase (GOGAT). In some examples, glnS encodes a glutamine synthetase. GS is associated with adenylyl-transferase (AT) and adenylyl- Through the activity of the elimination (AR) domains, both GS's adenylization and GS 15 is a bifunctional enzyme encoded by glnE that catalyzes de-adenylation. It is regulated post-translationally by adenylyltransferase (GlnE). Nitrogen limiting. Under these conditions, glnA is expressed and the AR region of GlnE degeneratively affects GS. It activates it. Under nitrogen excess conditions, glnA expression is shut down and GlnE's AT is activated. The domain is allosterically activated by glutamine, and GS adenylyllation and This causes deactivation. 20 Furthermore, the draT gene can be used to induce field-based nitrogen utilization using the methods described here. It may be a target for genetic variation to facilitate fixation. Nitrogen After fixation enzymes are produced by the cell, nitrogenase shuts down the cell. Another 25 that downregulates fixation activity under high nitrogen conditions This represents the level. This shutdown results in a reduction in DraT expression level. It can be resolved. Methods for providing information about novel microbial phenotypes, This can be performed at transcriptional, translational, and post-translational levels. 30 Transcriptional level, changes in the promoter (e.g., the entire promoter) sigma for transcription factors, including deletion of a portion of it. (changing factor affinity or binding sites) or transcription It involves modifying terminators and attenuators. Translational level ribosomes. This includes changes in binding sites and altered mRNA degradation signals. 35 26 Post-translation level, protein-to-protein alteration of the enzyme's active site. It involves changing their interactions. These changes can be achieved in many ways. Reducing (or completely eliminating) the expression level of natural ribosomes lower strength / efficiency of the binding site (RBS) or promoter This can be achieved by modifying the ATG launch sites, GTG, TTG or CTG 5. It can be changed to a start codon, which affects the translation activity of the coding region. This results in a decrease. Complete elimination of expression occurs when a gene codes for... This can be done by knocking out (deletion) the region. The open reading frame (ORF) frame This shift will most likely result in an early stop codon along the ORF, and Therefore, it will create a non-functional trunk product. Frame stop 10 The insertion of codons similarly results in a non-functional trunkate product. This will create a degradation tag at the N or C terminus of a particular gene. It can also be done to reduce the effective concentration. Conversely, the expression level of the genes described here is higher with a stronger promoter. 15 This can be achieved using high nitrogen level conditions (or any other method). (under these conditions) to ensure high promoter activity, all at high nitrogen levels A transcription profile of the genome can be obtained and a desired transcriptional profile can be identified. Active promoters with a certain level of activity are used to replace weaker promoters in the dataset. It is selectable. Weak start codons provide a 20 for higher translation initiation efficiency. The ATG start codon can be traded for weak ribosomal binding sites (RBS). It can be swapped with a different RBS with higher translation initiation efficiency. In addition Similarly, site-specific mutagenesis involves altering the activity of an enzyme. applicable. Increasing the level of nitrogen fixation occurring in a plant improves crop production. a reduction in the amount of chemical fertilizers needed and greenhouse gas emissions This can lead to a reduction (e.g., nitrous oxide). Serial transition 30 Bacterial production for improving plant characteristics (e.g., nitrogen fixation) through serial transitions. This can be achieved by adding one or more improved methods to one or more plants. In addition to identifying bacteria and / or compounds that can confer specific characteristics, This can be done by selecting plants with specific advanced characteristics that are influenced by the microbial flora. 35 27 One method of producing bacteria to improve the characteristics of a plant is as follows: The steps include: (a) removing bacteria from the tissue or soil of a primary plant (b) to isolate one or more variant bacteria; (b) to produce one or more variant bacteria (c) the introduction of a genetic variation into the bacteria; variants of numerous plants (d) exposure to bacteria; bacteria from the tissue of one of many plants 5 or isolation from the soil; the plant from which these bacteria were isolated, numerous It possesses an advanced characteristic when compared with other plants within the plant; and (e) step (b) to give ila (d) an enhanced characteristic with bacteria isolated from the plant (step (d)) Repeating steps (b) through (d) to develop an improved characteristic in a plant, a desired This can be repeated any number of times until the level is reached (e.g., one, two, three, four, five, ten, 10). (or more times). Also, a large number of plants, 10 to 20 plants, or 20 or more, 50 or more, 100 or more, 300 or more, 500 or more Or there may be more than two plants, such as 1000 or more plants. In addition to obtaining a plant with an improved characteristic, one or more 15 one or more genes (for example, genes regulating nitrogen fixation) are included in A bacterial population containing bacteria with significant genetic variation is obtained. By repeating the steps described above, you can identify a plant characteristic of interest. A bacterial population containing the most suitable members of the population can be obtained. This Bacteria in the population can be identified, for example, by genetic and / or phenotypic analysis, and 20 Beneficial properties can be determined. Genetic analysis of bacteria isolated in step (a). This may occur. Phenotypic and / or genotypic information on chemical components of plant origin. High-throughput screening, high-throughput sequencing of genetic material, differential Sequencing techniques, such as imaging techniques (including DDRT-PCR and DD-PCR), analyze nucleic acid. microarray techniques, RNA-seq (Complete Transcriptome Scatter Sequencing) and qRT-PCR (quantitative 25 This information can be obtained using real-time PCR. The obtained data can then be used for phylogenetic analysis. or nucleic acids encoding components of rRNA operons or other taxonomic Identification of existing bacteria, such as microarray-based scans of informative loci, and It can be used to obtain community profiling information about the activity. Taxonomic Informative locus examples include the 16S rRNA gene, the 23S rRNA gene, the 5S rRNA gene, and the 5.8S 30 rRNA gene, 12S rRNA gene, 18S rRNA gene, 28S rRNA gene, gyrB gene, rpoB gene, fusA These are the genes: recA gene, coxl gene, and nifD gene. They are used to identify taxa in a population. Examples of taxonomic profiling processes are described in US20140155283. Bacterial identification involves one or more genes, such as those linked to the nitrogen fixation pathway. 35 characterization of the activity of a gene or one or more signaling pathways 28 It may include synergistic interactions (a desirable combination of two components). between different types of bacteria (if it increases the effect by more than an additional amount) It can also be found in bacterial populations. Genetic variation can be a gene selected from a group consisting of: nifA, nifL, 5 ntrB, ntrC, glnA, glnB, glnK, draT, amtB, glnD, glnE, nifJ, nifH, nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB and nifQ. Genetic variation, glutamine synthetase, glutaminase, glutamine synthetase, adenillytransferase, transcriptional activator, anti-transcriptional activator, pyruvate flavodoxine oxidoreductase, flavodoxine or Selected functionality from a group such as NAD+-dinitrogen-reductase and aDP-D-ribosyltransferase 10 It may be a variation of a gene that codes for a protein. The genetic variation is NifA. or increased expression or activity of glutaminase; NifL, NtrB, glutamine synthetase, Decreased expression or activity of GlnB, GlnK, DraT, AmtB; decreased GlnE decreased adenyl-clearing activity; or decreased uridyyl-clearing activity of GlnD It may be a mutation that enables one or more of its activities. A genetic 15 Inclusion of variation, for example 1, 2, 3, 4, 5, 10, 25, 50, 100, 250, 500 or more Insertion of one or more nucleotides into a target region as an extra nucleotide. and / or deletion may be included. One or more of the methods described herein. The genetic variation introduced into the bacterium may be a knockout mutation (for example, a Deletion of the promoter, insertion or deletion to produce an early stop codon, 20 deletion of an entire gene or elimination of a protein domain activity or elimination (e.g., point mutation affecting an active site, or protein) (This could be a deletion of a section of a gene that codes for the relevant part of the product) or It can alter or eliminate a regulatory sequence of the target gene. Genetics a 25 of a bacterial species or genus corresponding to the bacteria in which the variation is included including heterologous regulatory sequences and regulatory sequences found in the genome One or more regulatory arrays can also be inserted. Furthermore, regulatory arrays, the expression level of a gene in a bacterial culture or plant tissue It can be selected based on genetic variation, especially that which is included in a target region. There may be a predetermined genetic variation. The genetic variation is 30 in the target region. It could be a random mutation. Genetic variation involves one or more nucleotides. It may involve insertion or deletion. In some cases, there is a development in the feature. to evaluate, bacteria were isolated before being exposed to plants. different genetic variations in one or more bacteria (e.g., 2, 3, 4, 5, 10 (or more) are included. Numerous genetic variations arise from the types above, all within the same 35 29 Or it could be any of different types and any combination thereof. Some In these cases, numerous different genetic variations are detected after an initial isolation step. a first genetic variation, a second genetic variation after a second isolation step Variations and similar patterns are included in series, so that a large number Donor genetic variations in bacteria are accumulated and then applied in stages on the corresponding plants. Information is provided about the characteristics that develop over time. Generally, the term "genetic variation" refers to a reference genome or a part of it. or relative to a reference polynucleotide, such as a reference gene or a part thereof. It is related to any change incorporated into a polynucleotide sequence. A genetic 10 A variation is called a "mutation," a set or organism containing a genetic variation. They can be called "genetic variants" or "mutants". Genetic variations affect gene expression, some biological activities including metabolism and cell signaling It can have several effects, such as increasing or decreasing [the effect]. Genetics Variations can be specifically included in a target region or used randomly. 15 Various molecular tools and methods for incorporating genetic variation. It exists. For example, genetic variation, polymerase chain reaction mutagenesis, oligonucleotide directed mutagenesis, saturation mutagenesis, fragment mixing mutagenesis, homologous recombination, CRISPR / Cas9 systems, chemical mutagenesis and These can be included through combinations. The inclusion of genetic variation is 20 Chemical methods for this purpose include, for example, the exposure of DNA to chemical mutagens. ethyl metasulfonate (EMS), methyl methanesulfonate (MMS), N-nitrosourea (EN U), N-methyl-N- nitro-N'-nitrosoguanidine, 4-nitroquinoline N-oxide, diethylsulfate, benzopyrene, cyclophosphamide, bleomycin, triethylmelamine, acrylamide monomer, nitrogen mustard, vincristine, diepoxyalkanes (e.g., diepoxybutane), ICR-170, formaldehyde, procarbazine hydrochloride, ethylene oxide, 25 dimethylnitrosamine, 7,12 dimethylbenz(a)anthracene, chlorambucil, hexamethylphosphoramide, Bisulfane and similar agents are included. Radiation mutation-inducing agents are ultraviolet. Radiation includes γ-irradiation, X-rays, and fast neutron bombardment. Genetic variation, For example, using trimethylpsoralen, which has ultraviolet light, it can also be incorporated into a nucleic acid. This is possible. A mobile DNA element, for example a transposable element, can be randomly selected from 30 different types. or another suitable method to produce genetic variation through targeted insertion. This is a method. Genetic variations, for example, in a polymerase chain such as PCR, which is prone to errors. using the PCR reaction technique, in a cell-free in vitro system Genetic variations can be incorporated into a nucleic acid during amplification. 35 using hybrid techniques (e.g., exon mixing, domain swapping, and the like). Genetic variations can be incorporated into nucleic acid in vitro. Genetic variations are DNA variations within a cell. It can also be incorporated into a nucleic acid as a result of a deficiency in its repair enzyme, for example. The presence of a mutant gene in a cell that encodes a mutant DNA repair enzyme, It is expected to produce a high frequency in the cell's genome (in other words, approximately 1 (mutation / 100 genes - 1 mutation / 10,000 genes). 5 of the genes encoding DNA repair enzymes. Examples include, but are not limited to, Mut H, Mut S, Mut L, and Mut U. other homologs of the species (e.g., MSH 16, PMS 1 2, MLH 1, GTBP, ERCC -1 and (similar) is found. Various methods for applying genetic variations. Example explanations include, for instance, Stemple (2004) Nature 5: 1-7; Chiang et al. (1993) PCR. Methods Appl 2 (3): 210-217; Stemmer (1994) Proc. Natl. Acad. Sci. USA 91: 10747-10 It is available at 10751; and US Pat. 6,033,861 and 6,773,900. As a cyclic amplification technique, polymerase chain reaction (PCR) mutagenesis. PCR uses mutagenic primers to include the desired mutations. This is achieved through denaturation, annealing, and extension cycles. PCR is used for 15 Post-amplification selection of mutated DNA and parental plasmid DNA removal can be achieved in two ways: 1) During PCR. Replacement of dCTP with hydroxymethylated-dCTP, followed by hydroxymethylation. Digestion with restriction enzymes to eliminate unprocessed parental DNA; 2) both an antibiotic resistance gene and the plasmid of the gene under investigation are different 20 Simultaneous mutagenesis that leads to antibiotic resistance, after which the desired outcome is achieved. 3) novel antibiotic resistance that facilitates mutation selection; a desirable mutation After inclusion, the parent methylation template DNA contains only the methylated part. Digestion of DNA by the restriction enzyme DPNL; as a result of Mutagenized methylated strands recover; or 4) 25 of mutated DNA To increase transformation efficiency, mutation is added in an additional ligation reaction. Circularization of PCR products. Other exemplary methods. Examples of descriptions: US7132265, US6713285, US6673610, US6391548, US5789166, It can be found at US5780270, US5354670, US5071743 and US20100267147. Oligonucleotide-directed mutagenesis, also known as site-directed mutagenesis. It is called, and typically uses a synthetic DNA primer. This synthetic primer is the desired It includes the mutation and the mutation region must be able to hybridize with the DNA in the relevant gene. It is complementary to the template DNA around it. Mutation is a change of a single base (a point). (mutation), multiple base changes, deletions or insertions, or a combination of these. 35 31 It could be a combination of two. A single-stranded primer is then used to copy the rest of the gene. It is extended using a DNA polymerase. The gene copied in this way is mutated. It includes the region and can then be incorporated into a host cell as a vector, and They can be cloned. Finally, to check that the mutants contain the desired mutation. Selectable via DNA sequencing. 5 Genetic variations can be incorporated using error-prone PCR. This technique is relevant to... gene, non-identical sequence replication using a DNA polymerase amplified under certain conditions. The result is that the amplification products have at least one error in the sequence. It involves a gene being amplified and the resulting product(s) are template 10. when compared to the molecule, it contains one or more changes within the sequence, The resulting products are mutagenic when compared to the template. Random Another way to incorporate mutations is with nitrosoguanidine or ethyl methanesulfonate. These are cells that have been exposed to a chemical mutagen (Nestmann, Mutat Res 1975). June; 28 (3): 323-30) and the vector containing the gene is then isolated from the host. 15 Saturation mutagenesis is another form of random mutagenesis, where a gene is modified absolute or probable mutations in a specific area or narrow region It attempts to produce all or almost all of it. In general terms, saturation. mutagenesis, mutagenic 20 in the defined polynucleotide sequence to be mutagenated. a complete set of cassettes (where each cassette is, for example, 1-500 bases long) It consists of mutagenization (where the sequence to be mutagenated is, for example, 15 to 100,000). (is base-length). Thus, a group of mutations is placed in each cassette to be mutagenized. (e.g., ranging from 1 to 100 mutations) are included. A cassette will be included. The mutation group, 25, was included in a second cassette during one round of saturated mutagenesis. This second grouping of mutations may be different from or the same as the first. Such groupings, Deletions, insertions, groupings of specific codons, and specific nucleotide cassettes. This is exemplified by their groupings. Fragment mixed mutagenesis, also called DNA hashing, produces beneficial mutations. 30 It is a way to replicate rapidly. In an example of a hashing operation, DNAse, a series It is used to split the parental gene, e.g., into pieces approximately 50-100 bp long. Subsequently, a polymerase chain reaction (PCR) occurs without primers – a large DNA fragments with overlapping homologous sequences link together and more Then it is extended with DNA polymerase. This extension takes several rounds of PCR, some DNA 35 32 this occurs after the molecules reach the size of their parental genes This allows the genes to be amplified again with another PCR test, this time... Primers are added that are designed to complete the ends of the helices. The primers are a Restriction enzyme recognition sites required for ligation to the cloning vector It can include sequences in the form of 5' ends, with additional sequences added. 5 related to mixed techniques. Other examples are provided in US20050266541. Homologous recombination mutagenesis is a process that targets a fragment of exogenous DNA. It involves recombination between polynucleotide sequences. A double helix break. After this occurs, the DNA sections around the 5' end of the break are resected in a process called 10 procedures. It is cut by a process. During the subsequent helical invasion phase, the broken DNA a dangling 3' end of the molecule then breaks off, similar or identical DNA It "attacks" the molecule. The method involves deleting a gene, destroying exons, inserting a gene, and It can be used to initiate point mutations. Homologous recombination mutagenesis It can be permanent or conditional. Typically, a recombination template is also provided. A 15 A recombination template can be a component of one vector belonging to another vector, or It can be supplied as a separate polynucleotide. In some applications, a recombination is used. a template, a target sequence that is notched or cleaved by a region-specific nuclease. to serve as a template in or near homologous recombination It is designed. A template polynucleotide consists of approximately 10, 15, 20, 25, 50, 75, 100, 150, 200, 20 Any suitable length in the form of nucleotides of 500, 1000 or more. It is possible. In some applications, the template polynucleotide is one that contains the target sequence. It is the complement of a portion of a polynucleotide. When optimally aligned, it forms a A template polynucleotide can overlap with one or more nucleotides of a target sequence. (for example, approximately 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 or 25) (more nucleotides). In some applications, a template sequence and a target sequence are used. When the polynucleotide is optimally aligned, the closest polynucleotide to the template polynucleotide The number of nucleotides is approximately 1, 5, 10, 15, 20, 25, 50, 75, 100, 200, 300, 400, 500, 1000, 5000. It contains 10,000 or more nucleotides. In homologous recombination methods. Among the non-limiting examples of useful, site-directed nucleases are 30 zinc finger nucleases, CRISPR nucleases, TALE nucleases, and meganucleases It is found. For a further explanation of the use of such nucleases, see US8795965 and US20140301990. 33 CRISPR / Cas9 (Clustered regularly spaced short palindromic (repeats) / CRISPR-related (Cas) systems, silencing attacking nucleic acids using CRISPR RNAs (crRNAs) to guide viruses and plasmids It provides bacteria and archaea that confer adaptive immunity against it. Cas9 protein (or its equivalent) functional equivalent and / or variant, i.e. Cas9-like protein) naturally occurs in crRNA 5 and two naturally occurring or synthetic RNAs called tracrRNA that make up the protein. based on its association with molecules (also called guide RNAs) It involves DNA endonuclease activity. In some cases, two molecules become one molecule. It binds covalently to form a single guide RNA ("sgRNA") (also known as Cas9). Thus, Cas9 or Cas9-like protein binds to DNA-targeting RNA in 10 seconds. is related (this term refers to bimolecular guide RNA configuration and unimolecular (includes guide RNA configuration) and activates Cas9 or Cas9-like protein. and directs the protein to a target nucleic acid sequence. Cas9 or Cas9-like protein If it retains its natural enzymatic functions, it can alter the genome (i.e., Modification: deletion, insertion (when there is a donor polynucleotide), substitution, etc.) 15 creating a double helix break that can lead to and thus alter gene expression It will cleave the target DNA. Cas9 (variants also include the term Cas9-like) reduced. It has been modified to have DNA binding activity (in some cases the target Instead of both strands of DNA breaking, only one strand is breaking; in other cases, the DNA... (binding activity was severely reduced). 20 for the inclusion of genetic variation. Other exemplary descriptions of CRISPR systems can be found, e.g., in US8795965. Primarily point mutations and short deletions, insertions, and transversions. and / or transmissions created by chemical mutagens or radiation, among others Mutagens can be used to create genetic variations. Mutagens are limited to these 25 ethyl methanesulfonate, methylmethanesulfonate, N-ethyl-N-nitrous urea, triethylmelamine, N-methyl-N-nitrous urea, procarbazine, chlorambusil, cyclophosphamide, diethyl sulfate, acrylamide monomer, melphalan, nitrogen mustard, vincristine, dimethylnitrosamine, N-methyl-N'-nitro- Nitrosoguanidine, nitrosoguanidine, 2-aminopurine, 7,12 dimethyl-benz(a)anthracene, ethylene oxide, hexamethylphosphoramide, bisulfane, diepoxyalkanes (diepoxyoctane, diepoxybutane 30 and so on) 2-methoxy-6-chloro-9[3-(ethyl-2-chloro-ethyl)aminopropylamino]-acridine It contains dihydrochloride and formaldehyde. The inclusion of genetic variation may be an incomplete process; therefore While some bacteria in the bacterial population possess a desirable mutation, others 35 34 It does not possess it. In some cases, bacteria carrying the desired genetic variation. It is desirable to apply a selected pressure to enrich the product. Traditionally, Selection of successful genetic variants, insertion of antibiotic resistance genes, or lethal a metabolic compound that can be converted from a non-existent compound into a lethal metabolite such as the elimination of activity, gained or lost through genetic variation. 5 It is related to the selection or exclusion of certain functionalities. A polynucleotide It is also possible to apply a selected pressure based on the sequence itself, as follows: only a desired genetic variation (e.g., a selectable marker) (without requiring) inclusion. In this case, the selected pressure is applied to a target area. This involves dividing genomes that lack the included genetic variant, such as selection 10. effectively against the desired reference sequence in which genetic variation will be introduced It is directed. Typically, binding occurs within 100 nucleotides of the target region. income (e.g., including connection in the target region or in the target region) (between 75, 50, 25, 10 or fewer nucleotides from the target region). Binding is a Zinc Finger nuclease, a CRISPR nuclease, a TALE nuclease (TALEN), or a 15 with a site-specific nuclease selected from a group of meganucleases It can be directed. This type of process does not require any template for homologous recombination. except in the case where homologous recombination in a target region is not achieved These processes are similar to those used to increase genetic material. As a result, the desired genetic material is achieved. Bacteria that do not have variation are more likely to bind, thus 20 The remaining damage is irreparable and leads to cell death. After that, depending on the choice... The surviving bacteria are being evaluated to assess their potential for acquiring an enhanced characteristic. It can be isolated for use in exposure to plants. A CRISPR nuclease uses a site-specific 25 to direct binding to a target region. It can be used as a nuclease. To kill unmutated cells, it can be used to kill mutated cells. An improved selection of infected microbes can be achieved using Cas9. Subsequently, plants; to reaffirm symbiosis and evolutionarily select for fertile symbionts. They are inoculated with mutated microbes designed to create pressure. The microbes are more They can then be isolated again from plant tissues. 30 for selection against non-variant variants. The CRISPR nuclease systems used do not have any template for homologous recombination. except in cases where it is not provided, with regard to the inclusion of genetic variation. It can use elements similar to those described above. Directed towards the target area. Binding increases the death of affected cells. 35 35 Zinc finger nucleases, such as TALE nuclease (TALEN) systems and meganucleases. Other options for inducing binding specifically in a target region They exist. Zinc finger nucleases (ZFNs) bind to a zinc finger DNA. Artificial DNA produced by binding to a DNA cleavage site. They are endonucleases. ZFNs can be designed to target desired DNA sequences and 5 This enables the binding of zinc finger nucleases to unique target sequences. A When incorporated into the cell, ZFNs induce double helix breaks, targeting the cell's internal molecules. It can be used to edit DNA (for example, the cell's genome). Transcription Activator-like effector nucleases (TALENs) are a type of TAL (Transcription activator). (similar to) produced by fusing the effector DNA binding domain to a DNA cleavage domain. TALENs are artificial DNA endonucleases. They can practically sequence the desired DNA sequence. They can be designed to bind and, when incorporated into a cell, TALENs form a double helix. by inducing breaks in the target DNA (e.g., the cell's genome) It can be used to regulate. Meganucleases (homing endonucleases) have a wide definition. 15 characterized by its FIELD (12 to 40 base pair double-stranded DNA sequences). These are endodeoxyribonucleases. Meganucleases are highly targeted sequences. They can be used to change, eliminate, or modify proteins. By modifying the recognition sequence through engineering, the targeted sequence can be altered. Bacterial, Meganucleases are used to modify all genome types, whether in plants or animals. available and generally divided into four families: LAGLIDADG family, GIY-YIG 20 families, His-Cyst box family and HNH family. Examples of homology endonucleases. between, I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I- SceIII, I-CreI, I-Tevl, Ben-Tevll and Ben-TevlI. The methods of the present invention provide one or more of the desired features. 25 or can be used to improve. Examples of features that can be included or improved. These include: root biomass, root length, height, shoot length, leaf number, and water content. utilization efficiency, overall biomass, yield, fruit size, seed size, photosynthesis rate, drought tolerance, temperature tolerance, salt tolerance, nematode stress resistance, fungal pathogen resistance, resistance to a bacterial pathogen, resistance to a viral pathogen, a 30 Metabolite level and proteome expression. Height, overall biomass, stem and / or shoot biomass, seed germination, seedling viability, photosynthetic efficiency, transpiration ratio, seed / fruit number or mass, plant seed or fruit yield, leaf chlorophyll content, photosynthetic rate, rate of photosynthesis, root length, or any of these The combination can be used to measure growth, and 35 grown under identical conditions. 36 growth of reference agricultural plants (e.g., plants without improved characteristics) It is comparable to the rate. A preferred feature included or enhanced is shown here. It is nitrogen fixation as described. In some cases, one of the methods described here may be used. a plant provided is a reference agricultural plant grown in the same soil under the same conditions. at least approximately 5% more, for example, at least approximately 5%, at least approximately 8%, at least 5 approximately 10%, at least approximately 15%, at least approximately 20%, at least approximately 25%, at least approximately 30%, at least approximately 40%, at least approximately 50%, at least approximately 60%, at least approximately 75%, at least approximately 80%, at least approximately 80%, at least approximately 90%, or at least 100%, at least approximately 200%, at least approximately 300%, at least approximately 400% or more It exhibits a significant difference in features. 10 The feature to be developed will be based on one or more conditions that create biotic or abiotic stress. This can be evaluated within this context. Examples of stress include abitotic stresses (heat stress, salt stress). biotic stresses (such as drought stress, low nutrient stresses) and biotic stresses (nematode stress, (insect herbivore stress, fungal pathogen stress, bacterial pathogen stress and viral pathogen stress) 15 It can be given. The improved properties of the present invention, through its methods and composition, allow for greater nitrogen fixation. Nitrogen fixation can occur even in a plant that hasn't been treated. In some cases, Bacteria isolated according to the method described here, any genetic 20 Compared to bacteria isolated from the first plant before variation, 1% or more (e.g., 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20% or more) plants It can produce nitrogen, which results in at least a 2-fold (e.g., 3-fold, 4-fold, 5-fold) increase in nitrogen fixation capacity. (6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 50 times, 100 times, 1000 times or more) This can represent an increase. In some cases, bacteria can increase plant nitrogen by 5% or more. It produces. The desired level of nitrogen fixation is achieved by the inclusion of genetic variation, exposure to numerous plants and one or more (e.g., 1, 2, 3, 4, 5, Isolation of bacteria from plants with improved characteristics (10, 15, 25 or more times) It can be obtained after repeating the steps. In some cases, glucamine, In fertilization supplemented with ammonia or other nitrogen chemical sources, the increased nitrogen level is 30. Fixation levels are obtained. Regarding the evaluation of nitrogen fixation degree. The methods are known and examples are described here. 35 37 Nitrogen Fixation Here, to increase nitrogen fixation in a plant, we can determine the plant's nitrogen fixation rate. one or more genetic materials that regulate one or more genes that are incorporated into one or more genes Methods involving exposure to bacteria with variations are described; 5 Here, bacteria produce 1% or more nitrogen in the plant (e.g., 2%, 5%, 10%). (or more), which, compared to the plant in the absence of bacteria, is at least 2 This can represent a multiple of nitrogen fixation capacity. Bacteria, with glutamine or ammonium. It can produce nitrogen in the presence of supplemented fertilizer. Genetic variations are given above. Including examples, any number and any 10 as described herein. In combination, any genetic variation may be present. Genetic variation includes nifA, nifL, ntrB, ntrC, glutamine synthetase, glnA, glnB, glnK, draT, amtB, glutaminase, glnD, glnE, nifJ, nifH, nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB and A gene consisting of nifQ can be incorporated. Genetic variation can be one of the following: or it may be a mutation causing more than one of the following: increased nifA or glutaminase 15 expression or activity of nifL, ntrB, glutamine synthetase, glnB, glnK, draT, amtB decreased expression or activity of GlnE in adenylyl elimination activity decrease; or decreased uridyyl-clearing activity of GlnD. as described here. Genetic variation introduced into one or more bacteria by the methods, a knockout It can cause a mutation or delete a regulatory sequence of a target gene, or 20 It may involve the insertion of a heterologous regulatory sequence, for example, from the same bacterium. A regulatory sequence found in the genome of a species or genus. A regulatory sequence is a the expression level of a gene in bacterial culture or in plant tissue It can be selected based on. Genetic variation can be produced by chemical mutagenesis. (c) Plants grown in this stage may be exposed to biotic or abiotic stress factors. 25 The amount of nitrogen fixation that occurs in the plants described here can be achieved in various ways, for example, by Acetylene reduction (AR) can be measured using an assay. Acetylene reduction assay can be performed in vitro or... This can be done in vivo. It can be shown that a particular bacterium provides nitrogen that is fixed to a plant. Evidence may include: 1) total plant N, preferably N concentration in the plant 30 1) Increases significantly during inoculation with a simultaneous increase; 2) N- upon vaccination Under limiting conditions, nitrogen deficiency symptoms are alleviated (increase in dry matter). 3) N2 fixation, using the 15N approach (isotope dilution experiments, 15N2 (reduction experiments or 15N natural abundance experiments) are documented; 4) fixed N, a 38 5) all of these effects are incorporated into the plant protein or metabolite; and 6) the inoculum strain It is not observed in plants that have not been inoculated with a mutant or in grafted plants. Natural type nitrogen fixation regulator stepped series, a NOR of O2 and NH4+ inputs. It is passed through a gateway, and its output is a digital 5 that enters an AND gate in addition to ATP. It can be represented as a logic circuit. In some applications, as described here... The methods involve NH4+ being present in this circuit at multiple points in the regulation loop. By disrupting its effect, it enables microbes to produce nitrogen even in fertilized areas. However, the methods described here do not affect the effect of ATP or O2 on the circuit. to change or modify the circuit with other regulatory steps in the cell or 10 It involves the transposition of genetic circuits other than nitrogen fixation. Genetics clusters produce functional products under the control of a heterologous regulatory system. It can be redesigned accordingly. Natural regulators outside the code sequences of gene clusters. by eliminating its elements and replacing them with alternative regulatory systems by modifying the functional 15 of complex genetic operons and other gene clusters. products of different species other than those from which controlled and / or natural genes are derived It can be transferred to heterologous cells, including cellular cells. When redesigned, synthetic gene clusters, genetic circuits, or other inducible regulatory systems This allows for control over the expression of the products as desired. It can be done. Expression cassettes include logic gates, pulse generators, oscillators, 20 They can be designed to act as switches or memory devices. Control The expression cassette can be connected to a promoter, so that the expression cassette can deliver oxygen, an environmental sensor such as temperature, touch, osmotic stress, membrane stress or redox sensor. It acts as a sensor. As an example, the nifL, nifA, nifT, and nifX genes can be eliminated from the nif gene cluster. Synthetic genes randomize the DNA that codes for each amino acid sequence, creating codons. It can be designed with the help of. The selection of the codon is derived from the codon usage of the natural gene. The codon selection is made on the condition that it is as different as possible. The suggested sequences are: Restriction enzyme recognition sites, transposon recognition sites, repetitive sequences, 30 Sigma 54 and Sigma 70 promoters, cryptic ribosome binding sites, and rho-independent It is screened for undesirable features such as terminators. Synthetic ribosome binding. The domains are a 150 bp (-60 to +90) range surrounding the start codon of a gene. such as creating a fluorescence reporter plasmid that fuses to the fluorescence gene, in response Each of the incoming natural ribosome binding sites is selected to match its strength. These 35 39 It can be expressed under the control of the chimeric Ptac promoter and fluorescence, flow It is measured with a cytometer. To create synthetic ribosome binding sites, 150 bp (-60 a reporter plasmid library using synthetic expression cassettes (to +90) It is created. Briefly, a synthetic expression cassette, a random DNA spacer, an RBS a degenerate sequence encoding the library and 5 from the coding sequence for each synthetic gene This can occur. Synthetic ribosome binding that best matches the natural ribosome binding site. Multiple clones are scanned to define the domain. This way, the same operons as the natural operons are identified. Synthetic operons composed of genes are structured and tested for functional complementarity. Another exemplary description of synthetic operons is found in US20140329326. is provided. 10 Bacterial Species The methods and compositions described here involve beneficial microbes from native plants. 15 to isolate microbes by removing them from surfaces or tissues ground seeds; sowing seeds in various soil samples and microbes from tissues collection; or inoculation of plants with exogenous microbes and which in plant tissues This can be achieved by determining when microbes will emerge. Limiting plant tissues. Examples that are not present include a seed, seedling, leaf, cutting, plant, bulb, or tuber. It is found. In some cases, the bacteria are separated from the seed. 20 for processing the samples. parameters, different combined microorganisms such as rhizospheric, epiphytic or endophytic. They can be modified to isolate different types. Bacteria are first isolated from a plant. Alternatively, they can also be obtained from a repository such as environmental strain collections. The microbes are isolated. sequencing of the genomes of cultured microbes; composition of plant communities Profiling; the transcriptomic functionality of populations or isolated microbes 25 characterization; or selective or phenotypic environment (e.g., nitrogen fixation or by screening microbial characteristics using phosphate solubility phenotypes They can be genotyped and phenotyped. Selected candidate strains or populations are sequenced. data; phenotypic data; plant data (e.g., genome, phenotype and / or yield data); soil data (e.g., pH, N / P / K content and / or aggregate soil biotic communities); or 30 It can be obtained through any combination of these. The bacteria and production methods described here induce a harmful plant defense reaction. spontaneously within leaf surfaces, root surfaces, or plant tissues without induction. It can be applied to bacteria that can multiply or bacteria that are resistant to plant defenses. 35 40 The bacteria described here were cultured in a nitrogen-free medium from a plant tissue extract or The bacteria can be isolated by leaf surface washing culture. It may not be cultured, in other words, using standard methods known in the technique. It is difficult to cultivate or its culturability is not known. Described here... Bacteria are either an endophyte or an epiphyte that lives inside the plant root zone (rhizospheric bacteria). Or it could be a bacterium. The introduction of genetic variation exposes a large number of plants to it. and one or more times (e.g., 1, 2, 3, 4, 5, 10, 15, 25, 25, or more) repeating the steps of isolating plants with similar characteristics (more than once) They can be endophytic, epiphytic, or rhizospheric. Endophytes cause disease symptoms. without entering the interior of plants or causing the formation of symbiotic structures 10 They are non-organisms and can enhance plant growth and improve plant nutrition. They are of agronomic interest because they can improve conditions (e.g., through nitrogen fixation). Bacteria can be a seed-borne endophyte. Seed-borne endophytes are mature, dry, undamaged (e.g., no cracks, visible fungal infection, or premature germination) A seed-derived bacterial endophyte found in seeds of a grass or plant 15 It includes bacteria associated with or derived from the seed. Seed-derived bacterial endophyte. It may be related to the surface of the seed or derived from the surface of the seed; alternatively or additionally, with an internal seed compartment (e.g., with a surface-sterilized seed) It can be related to or derived from it. In some cases, a seed-derived bacterial It can reproduce in endophytic plant tissue, for example, inside the seed. Also, some 20 In some cases, seed-borne bacterial endophytes can withstand desiccation. According to the methods used in the invention, the isolated bacteria can form numerous different combinations. It may include bacterial taxa. For example, bacteria such as Proteobacteria (e.g. Pseudomonas, Enterobacter, Stenotrophomonas, Burkholderia, Rhizobium, 25 Herbaspirillum, Pantoea, Serratia, Rahnella, Azospirillum, Azorizobium, Azotobacter, Duganella, Delftia, Bradyrhizobiun, Sinorhizobium and Halomonas), Firmicutes (e.g. Bacillus, Paenibacillus, Lactobacillus, Mycoplasma and Acetabacterium) and Actinobacteria (e.g. Streptomyces, Rhodacoccus, Microbacterium and It may contain Curtobacterium. The bacteria that can be produced using the methods described here are 30 Consisting of Azotobacter sp., Bradyrhizobium sp., Klebsiella sp., and Sinorhizobium sp. Bacteria can be selected from the following group: Azotobacter vinelandii, Bradyrhizobium japonicum, Klebsiella pneumoniae and Sinorhizobium Meliloti. The bacteria may be of the Enterobacter and Rahnella genera. 35 41 Bacteria are found in soil, plants, fungi, animals (including invertebrates), and including sediments of lakes and rivers, water and other biota. from any general terrestrial environment; marine environment, biota and sediments (e.g., sea water, sea muds, marine plants, marine invertebrates (e.g., sponges), sea vertebrates (e.g., fish); terrestrial and marine geospheres (regolith and rock, e.g., 5 crushed underground rocks, sand and clays); cryosphere and meltwater; atmosphere (e.g. filtered air (dust, clouds and raindrops); urban, industrial and other from man-made environments (e.g., concrete, roadside gutters, roof surfaces and roads) (organic and mineral matter accumulated on their surfaces) can be obtained. The plants from which the bacteria are obtained possess one or more desirable characteristics. a plant, for example, one that grows naturally in a particular environment or under specific conditions of interest It could be a plant. For example, a particular plant naturally thrives in sandy soil with high salinity. It can grow in soil or sand, and can thrive under extreme temperatures or with insufficient water. or it may be resistant to some pests or diseases found in the environment and a commercial 15 If the only condition that exists for the crop is specifically in a particular geographic region, then these kinds of conditions It is desirable to cultivate them under such conditions. In another example, bacteria thrive in such environments. from commercially grown plants or, more specifically, in any particular environment an individual crop that exhibits a characteristic of particular interest among cultivated plants It can be collected from plants: for example, salt-limiting 20 among the fastest growing plants. plants grown in soils or exposed to heavy insect damage or disease outbreaks the least damaged plants in the remaining crops or their fiber content, oil content and desired amounts of certain metabolites and other compounds, including their analogues. Plants that possess or have the desired color, taste, or smell. Bacteria, As previously mentioned, fungi and other animal and plant biota, soil, water, 25 sediments and other environmental elements, from a related plant or any It can be collected from the material. Bacteria can be isolated from plant tissue. This isolation can be done, for example, from roots, stems, and 30 from any suitable tissue on the plant, including leaves and plant reproductive tissues. This can occur. For example, conventional methods for isolation from plants typically involve: sterile excision of plant material (e.g., root or root lengths, leaves), Afterwards, the plant material was placed on a nutrient medium for microbial growth. This involves surface sterilization with a suitable solution (e.g., 2% sodium hypochlorite). Alternatively, surface-sterilized plant material can be immersed in a sterile liquid (usually water) for 35 minutes. 42 liquid including small pieces of crushed and crushed plant matter the suspension is placed on the surface of a suitable solid agar medium or selectively, or onto a medium that does not contain (for example, it should only contain phytic acid as a phosphorus source) It can spread. This approach is especially true for bacteria that form isolated colonies. It is useful and can be collected separately in separate plates of nutrient medium and the well-known 5 They can also be purified into a single genus using various methods. Alternatively, plant roots or foliage can be used. The samples may not be surface sterilized but only lightly washed, so Surface-dwelling epiphysis microorganisms can also be included in the isolation process. or epiphytic microbes, plant roots, stems or leaves on the surface of the agar medium They can be individually isolated by marking and removing them, and then as individual 10 as above. Colonies are isolated. This approach is particularly useful for bacteria, for example. Alternative Thus, the roots, without needing to wash away the small amount of soil clinging to them. It can be processed, thus including microbes that colonize plant stem cells. Other Various types of soil adhering to the roots can be removed, thinned, and rhizospheric. 15 suitable selective and non-selective methods for isolating individual colonies of bacteria It can spread to the agar of the environments. Biologically pure cultures of Rahnella aquatilis and Enterobacter sacchari, 14 In July 2015, the American Type Culture Collection (ATCC, International) The document is registered in Manassas, VA, USA, and is held at ATTC Patent Repository 20. The registration numbers have been assigned as PTA-122293 and PTA-122294, respectively. records, International Deposit of Microorganisms for Patent Proceedings According to the provisions of the Budapest Agreement on its acceptance (Budapest Agreement) It has been accomplished. Compositions Bacteria produced with the characteristics described herein and / or as described herein. or compositions containing bacterial populations are also used to improve plant characteristics. It can be used. Compositions containing bacterial populations are applied to the surface of a seed at 30°C. It can be coated and exist in liquid form. The compounds are used in commercially important agricultural plants, For example, seeds for sorghum, canola, tomatoes, strawberries, barley, rice, corn, and wheat. It includes coatings. The compositions can also be sprayed onto the aerial parts of the plant or where plant seeds are sown, soil is watered, or the composition of the roots It can be applied to the roots by inserting it into the grooves where it is immersed in the suspension. Compositions, 35 43 to improve cell viability and to artificially inoculate and colonize host plants It can be appropriately dehydrated. Bacterial species are present in compositions of 108-1010 CFU / ml. It may be present in a concentration between [a certain range]. The compounds include molybdenum ions and iron. trace metal ions such as manganese ions or combinations of these ions It can be supplemented with. The ion concentration in the compositions described here is approximately 0.1 5 The concentration can range from approximately 50 mM to 50 mM. The compounds also include beta-glucan and carboxylmethyl. cellulose (CMC), bacterial extracellular polymeric substance (EPS), sugar, animal milk, or It can be formulated with a carrier such as peat or other suitable carriers. Alternatively, peat or The planting agents can be used as a carrier or the compound is embedded into the biopolymer. A biopolymer can be used as a carrier. The bacteria described here are 10. compositions containing populations, promoting plant growth, in leaves maintaining high chlorophyll content, increasing the number of fruits or seeds increasing plant characteristics such as increasing fruit or seed weight It can improve. The compositions containing the bacterial populations described here are applied to the surface of a seed. It can be coated. Therefore, a coated surface containing one or more of the bacteria described herein Seed-containing compositions are also being considered. Seed coating, bacteria. by mixing the population with a porous, chemically inert granular carrier can be created. Alternatively, the compositions are planted on the plant leaves or 20 The mixture can be inserted directly into the grooves where it is sprayed, or the roots can be mixed with the composition. It can be applied by soaking in the suspension. An effective amount of the composition is applied to the roots of the plant. to fill the adjacent subsoil area with viable bacterial growth or It can be used to infuse the leaves with vibrant bacterial growth. Overall, it's effective. a certain amount is sufficient for plants with improved characteristics to emerge. This is the quantity (e.g., the desired nitrogen fixation level). The bacterial compounds described here constitute an agriculturally acceptable carrier. It can be formulated using [method]. The formulation that is useful for these applications is: tackifier, microbial stabilizer, fungicide, antibacterial agent, herbicide, a 30 Nematid is an insecticide, a plant growth regulator, a fertilizer, and a plant growth enhancer. a regulator consisting of a fertilizer, an odenticide, a desicant and a nutrient It may include at least one member selected from the group. For example, the compositions described here any agriculturally acceptable carrier (e.g., naturally) non-forming fertilizers, a naturally occurring adhesive agent such as a non-forming adhesive agent 35 44 and may contain a pesticide (like a pesticide) that does not occur naturally. an adhesive that does not form, for example a polymer, copolymer or synthetic wax It could be. For example, any of the coated seeds, seedlings, or plants described here. The seed coating may contain such an agriculturally acceptable carrier. Here agriculturally acceptable in any of the described compositions or methods 5 a carrier, a compound that does not occur naturally (for example, a compound that does not occur naturally) fertilizer, for example, a polymer, copolymer or synthetic wax, such as a naturally occurring one. (can be an adhesive substance that does not form, or a pesticide that does not occur naturally) or may contain this compound. Non-limiting of agriculturally accepted carriers. Examples are described below. An additional 10 agriculturally acceptable carriers. Examples are known in the field of technology. In some cases, bacteria are mixed with an agriculturally acceptable carrier. The carrier can be a solid carrier or a liquid carrier, and can be microspheres, powders, It can take various forms, including emulsions and the like. The carrier, increasing 15 any that confers various properties such as stability, wettability, or dispersibility or there may be more than one carrier. Non-ionic or ionic surfactants. wetting agents such as natural or synthetic surfactants, or one of these The combination can be included in the composition. A composition containing isolated bacteria. Water-in-oil emulsions can also be used to formulate (see, for example, US 20). (Patent No. 7,485,451). Suitable formulations that can be prepared include wettable powders, granules, gels, agar strips or pellets, thickeners and the like, microencapsulated particles and similar substances, aqueous fluids, aqueous suspensions, oils It contains liquids such as water emulsions, etc. The formulation is for grain or legume products. It may contain, for example, ground grain or beans, water derived from grain or beans 25 or flour, starch, sugar or fat. In some applications, it may be agricultural carrier soil or a plant growing medium. Other agricultural carriers that can be used include water, fertilizers, plant-based oils, and humectants. or combinations thereof. Alternatively, the agricultural carrier contains diatomaceous earth 30. soil, loam, silica, alginate, clay, bentonite, vermiculite, seed-containing fruits, other plants and animal products or including granules, pellets or suspensions It can be a solid substance, such as a combination of these. Any of the aforementioned components a mixture of one, including but not limited to, pesta (flour and kaolin clay), mud, sand or as carriers such as agar or flour-based pellets in clay, etc. 35 45 Formulations are being considered that may include barley, rice or seeds, plant parts, or sugarcane. pulp, stems or stalks from grain processing methods, ground plant small pieces obtained from recycling of material or construction site waste, sawdust or paper. Like other biological materials such as fibers, bacteria may be present in fabric or wood. For example, to provide nutrients for a seed, seedling, or plant, or to promote growth. A fertilizer can be used to support this. Examples of non-limiting fertilizers include: among them are nitrogen, phosphorus, potassium, calcium, sulfur, magnesium, boron, chloride, manganese, iron, zinc, copper, molybdenum, and selenium (or a salt thereof) Examples of fertilizer additives include one or more amino acids, salts, 10 carbohydrates, vitamins, glucose, NaCl, yeast extract, NH4H2PO4, (NH4)2SO4, glycerol, valine, L-leucine, lactic acid, propionic acid, succinic acid, malic acid, citric acid, carbohydrate tartrate, xylose, It contains lyxose and lecithin. In one application, the formulation may contain one substance along with other active ingredients. a fastener or to help it attach (for example, the surface of a seed) It may contain an adhesive (called an adhesive agent). These agents trap bacteria in a 15 to produce coating compositions other compounds (e.g., non-biological control) It is useful to combine them with carriers that may contain (substances). Such compositions are plant-based. or to maintain contact between the plant part and microbes and other agents, plant or It helps to create coatings around the seed. In one application, it acts as an adhesive. alginate, gums, starches, lecithins, formononetin, polyvinyl alcohol, alkaline formononetinate, 20 Hesperetin, polyvinyl acetate, cephalins, gum arabic, xanthan gum, mineral oil. Polyethylene Glycol (PEG), Polyvinylpyrrolidone (PVP), Arabino-galactan, Methyl Cellulose, PEG 400, Chitosan, Polyacrylamide, Polyacrylate, Polyacrylonitrile, Glycerol, Triethylene glycol, Vinyl Acetate, Gellan Gum, Polystyrene, Polyvinyl, Carboxymethyl cellulose, Gum Ghatti and 25 polyoxyethylene-polyoxybutylene block copolymers and their mixtures They are selected from the group. In some applications, adhesives are used, e.g., carnauba wax, beeswax, Chinese wax, shellac wax, spermaceti wax, candelilla wax, castor wax, Mary's wax, and rice bran wax, a polysaccharide (e.g., starch, dextrins, maltodextrins, alginate and 30 a wax (such as chitosans); a solid fat, an oil, a protein (e.g., gelatin and zeins), gum These can be arabels and shellacs. Adhesive agents are those that occur unnaturally. Compounds include, for example, polymers, copolymers, and waxes. For example, an adhesive. Examples of non-limiting polymers that can be used in the material include: polyvinyl acetates, polyvinyl acetate copolymers, ethylene vinyl acetate (EVA) copolymers, polyvinyl 35 46 alcohols, polyvinyl alcohol copolymers, celluloses (e.g., ethylcelluloses, methylcelluloses, hydroxymethylcelluloses, hydroxypropylcelluloses, and carboxymethylcelluloses), polyvinylpyrrolidones, vinyl chloride, vinylidene chloride copolymers, calcium lignosulfonates, Acrylic copolymers, polyvinylcrylates, polyethylene oxide, acylamide polymers and copolymers, Polyhydroxyethyl acrylate, methylacrylamide monomers, and polychloroprene. 5 In some cases, adhesive agents, antifungal agents, growth one or more of the regulatory agents and pesticides (e.g., insecticides), These are compounds that do not occur naturally (for example, in any combination). Additional examples of agriculturally accepted carriers include dispersion 10. ingredients (e.g., polyvinylpyrrolidone / vinyl acetate PVPIVA S-630), surfactants, binders and fillers are included. The formulation may also include a surfactant. Non-limiting surfactants Examples include Prefer 28 (Cenex), Surf-N (US), Inhance (Brandt), P-28 (Wilfarm) and 15 It contains nitrogen surfactant blends such as Patrol (Helena); esterified seed oils, Sun-II (AmCy), MSO (UAP), Kürek (Agsco), Hasten (Wilfarm) and Mes-100 (Drexel) It contains; and organo-silicon surfactants Silwet L77 (UAP), Silikin (Terra), Dyne-Amic Includes (Helena), Kinetic (Helena), Sylgard 309 (Wilbur-Ellis), and Century (Precision). In practice, surfactant is present at a concentration between 0.01% v / v and 10% v / v. 20 In another application, the surfactant is used at a concentration between 0.1% v / v and 1% v / v. It is found. In certain cases, the formulation includes a microbial stabilizer. This type of agent is a compound. or compounds that actually have a drying effect on a liquid inoculant 25 as a desiccant, regardless of whether it is used in high concentrations or not. a desiccant that may contain any compound or mixture of compounds that can be classified It may contain substances. Such drying agents are ideal for the bacterial population used. It is compatible in this way and the microbial population's applicability and drying in seeds It should increase its resistance capability. Examples of suitable desiccant include 30 It contains one or more of trehalose, sucrose, glycerol, and methylene glycol. Others Suitable drying agents include, but are not limited to, reducing agents. It contains non-sugars and sugar alcohols (for example, mannitol or sorbitol). The amount of desiccant included in the formulation is approximately 5% to 5% by weight / volume. approximately 50%, for example, approximately 10% to approximately 40%, approximately 15% 35 47 It can range from approximately 35% to approximately 20% to approximately 30%. In some cases, the formulation may be a fungicide, an antibacterial agent, a herbicide, a nematid is an insecticide, a plant growth regulator, a rodenticide, or a nutrient. It is advantageous that it contains substances such as these. Limiting factors of growth regulators. Examples that are not present include bracinosteroids, cytokinins (e.g., kinetin and zeatin), 5 auxins (e.g., indoleacetic acid and indoleacetyl aspartate), flavonoids, and isoflavonoids (e.g., formononetin and diosmetin), phytokines (e.g., glycolin) and phytoalexins (e.g., pectin, chitin, chitosan, polygalacturonic acid and oligogalacturonic acid) and gibberellins These agents are found in an ideal environment with the agricultural seed or seedling to which the formulation will be applied. It is compatible in this way (e.g., it should not be harmful to the growth or health of the plant). Also, 10 This agent is ideally suited for safety purposes in humans, animals, or for industrial use. It is a compound that does not cause problems (e.g., there is no safety issue or the compound, plant-derived commodities contain negligible amounts of compounds, therefore they are large. (It is unstable to a certain extent). In liquid form, for example solutions or suspensions, bacterial populations, in water or They can be mixed or suspended in aqueous solutions. Suitable liquid diluents or Carriers include water, aqueous solutions, petroleum distillates, or other liquid carriers. Solid compositions include peat, wheat, bran, vermiculite, clay, talc, bentonite, diatomaceous earth, 20 a suitably divided solid such as fertile soil, pasteurized soil and the like It can be prepared by dispersing it within and onto the carrier. Such formulations When used as moisturizable powders, non-ionic, anionic, amphoteric or biologically, as cationic dispersing and emulsifying agents. Compatible dispersing agents may be used. 25 Post-formulation solid carriers, such as kaolin clay, pyrophyllite, bentonite, Minerals such as montmorillonite, diatomaceous earth, acidic white earth, vermiculite, and perlite. carriers and ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, ammonium chloride It contains inorganic salts such as calcium carbonate. It also contains wheat flour, wheat bran, and 30... Organic fine powders such as rice bran can also be used. Liquid carriers include soybean oil. and cottonseed oil, glycerol, ethylene glycol, polyethylene glycol, propylene glycol, It contains vegetable oils, polypropylene glycol, etc. 35 48 Plant species The methods and bacteria described here belong to the 5 species Hordeum, Oryza, Zea, and Triticeae. Suitable for any of a variety of plants, such as those mentioned above. Limiting the list of suitable plants. Other examples that are not present include mosses, lichens, and algae. Some in these situations plants, food products, fiber plants, oilseeds, forestry or paper. plants in industry, raw materials for biofuel production and / or ornamental plants, etc. It has economic, social and / or environmental value. The limiting 10 of crop plants. Examples that are not included are corn, rice, wheat, barley, sorghum, millet, oats, and rye. These include triticale, wheat, sweet corn, sugarcane, onions, tomatoes, strawberries, and asparagus. Can be obtained or improved using the methods and composition described here. Plants also include pineapple, banana, coconut, lily, and grass; for example, peas, clover, tomatillo, melon, chickpeas, hemp, lentils, soybeans, tobacco, potatoes, sweet 15 potatoes, radishes, cabbage, rapeseed, apple trees, grapes, cotton, sunflowers, peanut seeds, canola, citrus fruits (orange, tangerine, kumquat, lemon, lime, grapefruit, mandarin, (including tangelo, citron and pomelo), peppers, beans and lettuce, etc. It includes dicotyledonous plants. In some cases, the plant to be developed does not easily adapt to the experimental conditions. For example, serially improving a crop plant's trait over multiple iterations. It may take a very long time for it to grow enough to be considered as such. Accordingly, a primary plant from which the bacteria were initially isolated and / or genetically modified Numerous plants treated with bacteria were evaluated under the desired conditions. It could be a model plant, like a more suitable plant. Model plants have non-limiting features. Examples include Setaria, Brachypodium, and Arabidopsis. Then, a model plant... The ability of bacteria isolated according to a method described using improved to confirm that the characteristic has been imparted to another plant (for example, a crop) (plant) is applicable. 30 Features that can be improved using the methods described here include, for example, growth. ratio, height, weight, color, taste, smell, one or more compounds of plants changes in production (metabolites, proteins, drugs, carbohydrates, fats and any observable characteristic of the plant, including (other compounds) 35 49 It is also envisioned that plants will be selected based on genotypic information. (for example, plant gene expression in response to bacteria or increased nitrogen) (including determining the presence of genetic markers in relation to fixation). Plants, the existence of a certain characteristic or characteristics (such as a desirable trait or quality) conversely, the absence, suppression, or inhibition of a particular characteristic or quality. 5 It can be selected based on (such as an undesirable characteristic or quality). EXAMPLES The examples given here include bacterial isolation, bacterial and plant analysis, and plant characteristics. It describes development methods. Examples are for illustrative purposes only and do not include any This should not be interpreted as restrictive. Example 1: Isolation of Microbes from Plant Tissue The surface soil was obtained from various agricultural areas in central California. It is heavy clay. Twenty soil samples were collected, each exhibiting diverse textural characteristics such as peat clay, silty clay, and sandy loam. As shown in Table 1, various field corn, sweet corn, heritage corn, and tomato varieties were used. The seeds were planted in each plot of land. 25 35 50 Table 1. Types and varieties of crops planted in soil with different characteristics. Crop type Field Mısırı Tatlı Mısır Heritage Mısır Domates Çeşitler Mo17 Ferry-Morse 'Golden Cross Bantam T-51' Victory Seeds 'Moseby Prolific' Ferry-Morse Roma VF B73 Ferry-Morse 'Silver Queen Hybrid' Victory Seeds 'Reid's Yellow Dent' Stover Roma DKC 66- 40 Ferry-Morse 'Sugar Dots' Victory Seeds 'Hickory King' Totally Tomatoes ‘Micro Tom Hybrid’ DKC 67- 07 Heinz 1015 DKC 70- 01 Heinz 2401 Heinz 3402 Heinz 5508 Heinz 5608 Heinz 8504 The plants were removed after 2-4 weeks of growth, and excess soil was removed from the root surfaces. It was removed with deionized water. After the soil was removed, the plants The surface was sterilized with bleach and rinsed vigorously in sterile water. Cleaned 1 5 A 3 cm section of root was excised from the plant and a tube containing 3 mm steel beads was inserted. It was placed in a phosphate-buffered saline solution. The solution was then treated with a Qiagen TissueLyser II. By shaking it vigorously, a slurry was formed. Root and saline slurry were diluted and 10 rhizospheric, endophytic, epiphytic and other plant-related species were analyzed. To isolate the microbes, they were inoculated onto various growth media. Single colonies were obtained. R2A and Nfb agar media were used for this purpose, and nitrogen fixation bacteria were applied. Semi-solid Nfb medium slopes were used to obtain the populations. Semi-solid Nfb After incubation for 2-4 weeks at ambient slopes, as shown in Figure 1A-B, Antimicrobial populations were collected and single colonies were obtained on R2A agar 15 They were striped accordingly. Single colonies were placed into a mixture of R2A and glycerol. 51 It was resuspended, subjected to PCR analysis, and then stored at -80°C for further analysis. They were frozen. Approximately 1,000 individual colonies were obtained and referred to as "isolated microbes". He was appointed. The isolates were then tested to detect the presence of the nifH gene in order to identify diazotrophs. A colony was then subjected to a PCR screen. As previously described and displayed on the screens... The Ueda 19F / 388R primer set has been shown to detect more than 90% of diazotrophs, in each isolate (Ueda et al. 1995; J. Bacteriol. 177:1414-1417) the nif cluster It was used to investigate its presence. Single colonies of purified isolates. collected, resuspended in PBS, and colony PCR 10 as shown in Figure 2. It was used as a template. Colonies of isolates giving positive PCR bands were re-analyzed. The colony was drawn and redrawing resulted in false positives of diazotrophs after PCR and redrawing. This process was repeated twice to prevent identification. The purified isolates were then... They were designated as "candidate microbes". Example 2: Characterization of Isolated Microorganisms Sequencing, Analysis, and Phylogenetic Characterization 16S 20 for generating preliminary phylogenetic identities for isolated and candidate microbes. Sequencing of rDNA with the 515f-806r primer set is used (see, e.g., Vernon et al.; BMC). Microbiol. 2002 Dec 23;2:39). The microbes are Enterobacter, as shown in Table 2. Burkholderia, Klebsiella, Bradyrhizobium, Rahnella, Xanthomonas, Raoultella, Including Pantoea, Pseudomonas, Brevundimonas, Agrobacterium, and Paenibacillus. It includes various species. 25 52 Table 2. Isolated from tomato plants as determined by deep 16S rDNA sequencing. the diversity of microbes detected Then, the genomes of 39 candidate microbes were analyzed using the Illumina Miseq platform in 5 Genomic DNA obtained from pure cultures is sequenced using the QIAmp DNA mini kit (QIAGEN). DNA libraries were extracted and sequenced using a third party. It was prepared via the vendor (SeqMatic, Hayward). Genome assembly was then done on A5. This was done via pipeline (Tritt et al. 2012; PLoS One 7 (9):e42304). Genes The regulation and expression of nitrogen fixation were defined and explained. 10 Those related to it were recorded as targets for mutagenesis. Transcriptomic Profiling of Candidate Microbes C1010 15 for the identification of promoters that are active in the presence of ambient nitrogen. Transcriptomic profiling of the strain was performed. Strain CI010 was analyzed with 10 mM glutamine. Cultured in a supplemented, nitrogen-free, defined medium. Total RNA extracted from these cultures (QIAGEN RNeasy kit) and Illumina HiSeq (SeqMatic, The data was subjected to RNAseq sequencing via Fremont (CA). The sequencing reads were analyzed by Geneious Used to match with CI010 genome data, proximal transcription 20 Genes that were highly expressed under the control of their promoters were identified. 53 Table 3A-C shows the relative percentages of genes and total RNA as measured by RNASeq sequencing. It lists the expression levels. Sequences of proximal promoters, nif pathways, nitrogen pathways dependent on its use or other genes with desired expression levels It was recorded for use in mutagenesis. Genetic Solubility Assessment Candidate microorganisms are characterized based on transformability and genetic resolvability. Firstly, optimal carbon source utilization was determined in a small panel of the relevant environment. Growth was determined by a growth curve in both nitrogen-deficient and nitrogen-rich environments. The second 10 Thus, the innate antibiotic resistance of each strain serves as a selective marker for mutagenesis. spot-coating and growth in liquid culture containing an antibiotic panel used was identified. Thirdly, each strain was electroporated from a collection of plasmids. It was tested for its transformability through the plasmid collection, seven replication origin, in other words p15a, pSC101, CloDF, kolA, RK2, pBBR1 and 15 pRO1600 and four antibiotic resistance markers, namely CmR, KmR, SpecR and It involves the combinatorial expansion of TetR. Origin and resistance marker. Systematic evaluation of compatibility, plasmid-based in candidate microbes It has been used to identify vectors for mutagenesis. Example 3: Mutagenesis of Candidate Microbes Lambda-Red-mediated knockouts Several mutants of candidate microbes were tested for the pKD46 plasmid or a kanamycin resistance marker 25 It was produced using a derivative containing (Datsenko et al. 2000; PNAS 97 (12): 6640-6645). Knockout cassettes contain a 250bp overlap extension surrounding the target gene, generated by PCR. Designed using homology. Candidate microbes were transformed with pKD46, Lambda-Red It was cultured in the presence of arabinose to induce the expression of its enzyme, Prepared for electroporation and 30 knockout cassettes to generate candidate mutant strains. They were transformed. As shown in Table 4, four candidate microbes and one laboratory strain. The nitrogen fixation regulatory genes nifL, glnB and in Klebsiella oxytoca M5A1 amtB was used to generate thirteen candidate mutants. 54 Table 4. Mutants of single knockouts created via lambda-red mutagenesis. list Oligo-Directed Mutagenesis via Cas9 Selection 5 Oligo-directed mutagenesis causes genomic alterations in the rpoB gene in E. coli DH10B. It was used to target and mutants were selected with a CRISPR-Cas system. A mutagenic oligo (ss1283: “G*T*T*G*ATCAGACCGATGTTCGGACCTTCcaagGTTTCGATCGGACATACGCGAC10 CGTAGTGGGTCGGGTGTACGTCTCGAACTTCAAAGCC", Here * indicates the photospherotioate linkage) via a 4 bp mutation in the rpoB gene. It is designed to confer resistance to rifampicin. It is a plasmid encoding Cas9. Cells containing Cas9 expression were induced, prepared for electroporation, and then a guideline 15 targeting the Cas9 cleavage of the mutagenic oligo and the WT rpoB sequence. The sample was subjected to electroporation with a plasmid encoding the constitutive expression of RNA (gRNA). To allow for sufficient separation of the resulting mutant chromosomes. Electroporated cells were collected overnight in a non-selective environment. GRNA After plating upon selection for the encoding plasmid, among the ten colonies screened Two of them were shown to contain the desired mutation, while the remaining 20 were in the gRNA plasmid. or escap mutants produced via protospacer mutation in Cas9 plasmid loss It was shown that. Lambda-Red Mutagenesis via Cas9 Selection Mutants of candidate microbes CI006 and CI010 were selected using CRISPR-Cas. Lambda-red was generated via mutagenesis. Knockout cassettes were used for transcriptional profiling. an endogenous (as described in Example 2 and depicted in Table 3) 55 It contains ~250bp homology regions surrounding the promoter and deletion target. CI006 and CI010 were an arabinose inducible promoter and an IPTG. Cas9 Lambda-red recombination system under the control of an inducible promoter Transformed with plasmids encoding (exo, beta, gamma genes). Red recombination. Cas9 systems were induced in the resulting transformers and strains were electroporated 5 It was prepared for this. Knockout cassettes and a plasmid-encoded select gRNA were then used. Transform into competent cells. Selective for both Cas9 plasmid and gRNA plasmid. After coating with the antibiotics, 7 out of 10 colonies screened were shown in Figure 3. As shown, it exhibited the intended knockout mutation. Example 4: In Vitro Phenotyping of Candidate Molecules The effects of exogenous nitrogen on nitrogenase biosynthesis and activity in various mutants The effect was evaluated. Acetylene was used to measure nitrogen activity under pure culture conditions. Reduction Assay (RA) (Temme et al. 2012; 109 (18): 7085-7090) was used. Strains 15 Grown in airtight test tubes and reduced acetylene to ethylene using Agilent 6890 Quantification was performed by gas chromatography in nitrogen fixation medium supplemented with 0-10 mM glutamine. ARA activities of cultured candidate microbes and counter-candidate mutants are shown in Figures 4A-B and This is shown in Figures 10A-C. The effect on nitrogen fixation activity under anaerobic culture conditions A range of glutamine and ammonium concentrations were tested to quantify them. Wild In this type of cell, activity decreased rapidly as glutamine concentrations increased. together, in a series of first knockout mutations, otherwise wild-type activity Under glutamine concentrations that would stop nitrogen fixation genes, 25 A class of mutations that enables its expression has been validated. This profile is shown in Figure... As seen in 4C, it was produced in four different types of diazotrophs. In addition, the following were identified: By reconnecting the regulatory network using genetic fragments, nitrogen fixation activity The level was adjusted in a predictable manner. This applies to CM023, CM021, CM015 and CI006. The strains are shown in Figure 4B. Strain CM023 is a low-evolved 30 strains; strain CM021 is a highly evolved strain; strain CM015 is a moderately evolved strain. It is a species; species CI006 belongs to a wild species (strain 2). It was discarded into culture supernatants. Ammonium was tested using an enzymatic-based assay (MEGAZYME). The experiment involved 340 The experiment measures the amount of NADPH consumed in nm of absorption. The experiment is based on the initial concentration. 35 bacterial cultures grown in an anaerobic environment without nitrogen, with a concentration of 1E9 CFU / ml. 56 This was carried out. A panel of six improved strains is shown in Figure 4D. As observed, one strain exhibited 100 μM ammonium excretion over a 48-hour period. Furthermore, a pair of mutants is more potent than the single mutant from which it was derived, as shown in Figure 11. It exhibited high ammonium excretion. This is ammonium exceeding its physiological needs. This shows that it has a microbial capacity to produce. 5 Transcription Profiling of Pure Cultures The transcriptional activity of CI006 was investigated using the Nanostring Elements platform. The cells were measured. The cells were grown in a nitrogen-free environment and after 4 hours of incubation, 10 10E8 cells were collected. Total RNA was extracted using the Qiagen RNeasy kit. Purified RNA was analyzed using probe hybridization and a digital analyzer, as shown in Figure 5. It was sent to Core Diagnostics in Palo Alto, CA for analysis. Example 5: Planta Phenotyping of Candidate Microbes 15 Colonization of Plants by Candidate Microbes Colonization of desired host plants with a candidate microorganism is a short-term plant protection measure. Growth experiments were quantified. Maize plants were either fed a plasmid or a Tn5-20 Plants were inoculated with RFP-expressing strains from an integrated RFP expression cassette. It was grown in both sterilized sand and non-moist peat media, and three weeks before germination After a few days, 1 mL of cell culture was directly applied upon the formation of plant coleoptiles. Inoculation was performed using a pipette. Plasmids were delivered to the plants by watering them with a solution containing the appropriate antibiotic. It was preserved. Three weeks later, the plant roots were collected, removing the visible soil. 25 To remove it, it was rinsed three times in sterile water and divided into two samples. One root sample, Fluorescence microscopy to characterize localization patterns of candidate microbes was analyzed. Microscopy revealed that the most robust plant roots were intact, as shown in Figure 6. It was carried out with a length of mm. A second quantitative method was developed for evaluating colonization: endophytes. Quantitative PCR on DNA preparations from the roots of inoculated plants. The experiment was carried out. Corn seeds (Dekalb DKC-66-40) were pre-autoclaved. The seeds were germinated in sand in a 2.5 inch x 2.5 inch x 10 inch container. One day after sowing, the seeds... In its location, 1 ml of endophyte overnight culture (SOB medium) was moistened. This lasted for 35 minutes. 57 1 mL of culture is roughly equivalent to approximately 10^9 cfu, depending on which strain is used. Depending on the situation, the amount varies by three times. Each seedling requires 2.5 mL or 0.25 mM ammonium. Fertilization was performed three times a week with 50 mL of modified Hoagland solution supplemented with nitrate. Root samples were collected for DNA extraction within four weeks after October. Soil residue was washed away using a pressurized water spray. These tissue samples were then 5 The DNA was homogenized using the QIAGEN Tissuelyzer, and then the DNA was analyzed as suggested. Extraction was performed using the QIAmp DNA Mini Kit (QIAGEN) according to the protocol. qPCR the experiment was designed to be specific to one locus in each endophyte genome. Using primers (with NCBI's Primer BLAST) on these DNA extracts This was performed using Stratagene Mx3005P RT-PCR. Endophyte genomes 10 The existence of copies has been digitized. To further confirm the identity of endophytes, PCR amplification products were sequenced and confirmed to have the correct sequence. Candidate A summary of the colonization profile of microbial strains CI006 and CI008 is given in Table 5. It is presented that the CI008 strain exhibits a high colonization rate of up to 10^7x cfu / g fw at the root. shown. 15 Table 5. Corn colonization measured by qPCR. Strain colonization rate (CFU / g fw) CI006 1.45 x 10^5 CI008 1.24 x 10^7 Plant RNA Profile Biosynthesis of In planta nif pathway components is investigated by measuring the transcription of nif genes. Total RNA was estimated from root plant tissue of CI006 inoculated plants. performed (culturing methods as previously described). RNA extraction, as proposed This was carried out according to the protocol (QIAGEN) using the RNEasy Mini Kit. This plant Total RNA obtained from the tissues was then analyzed for nif 25 in the genome of the CI006 strain. Nanostring Elements kits (NanoString Technologies) use probes specific to genes. Tested using (In planta nif Inc.). In planta nif gene expression data are shown in Table 6. The expression of nifH genes is summarized and detected in plants inoculated with CM013 strains. During this process, nifH expression was not detected in CI006-inoculated plants. Strain CM013, It is a derivative of the CI006 strain in which the nifL gene has been deactivated. 30 58 Transcript graded per kilobase million (TPM) to indicate high levels of expression. The genes of CM011, obtained under fertilized conditions, were measured in plants. This high promoters control the expression of some of the genes expressed at the level, 5 for homologous recombination to targeted nitrogen fixation and assimilation loci They were used as templates. RNA samples from CM011 inoculated plants grown in a greenhouse. extracted rRNA, Ribo-Zero kit sequenced using the Illumina Truseq platform It was extracted using and mapped to the CM011 genome. High percentage of CM011 The expressed genes are listed in Table 7. Table 6. NifH expression in planta. Strains Relative Transcript Expression CI006 9.4 CM013 103.25 Table 7. Genes that are highly expressed in CM011. Gene Name Gene Location Direction Reading the Cam Census TPM (Million) Per Kilogram (Transcripts) rpsH CDS 18196 - 18588 back 4841.5 27206.4 rplQ CDS 11650 - 12039 back 4333 24536.2 rpsJ CDS 25013 - 25324 back 3423 24229 rplV CDS 21946 - 22278 back 3367.5 22333 rpsN CDS 18622 - 18927 back 2792 20150.1 rplN CDS 19820 - 20191 back 3317 19691.8 rplF CDS 17649 - 18182 back 4504.5 18628.9 rpsD CDS 13095 - 13715 back 5091.5 18106.6 rpmF CDS 8326 - 8493 forward 1363.5 17923.8 rplW CDS 23429 - 23731 back 2252 16413.8 rpsM CDS 14153 - 14509 back 2269 14036.2 rplR CDS 17286 - 17639 back 2243.5 13996.1 rplC CDS 24350 - 24979 back 3985 13969.2 59 Gene Name Gene Location Direction Reading the Cam Census TPM (Million) Per Kilogram (Transcripts) rplK CDS 25526 - 25954 back 2648.5 13634.1 rplP CDS 20807 - 21217 back 2423 13019.5 rplX CDS 19495 - 19809 back 1824 12787.8 rpsQ CDS 20362 - 20616 back 1460.5 12648.7 bhsA 3 CDS 79720 - 79977 back 1464 12531.5 rpmC CDS 20616 - 20807 back 998.5 11485 rpoA CDS 12080 - 13069 back 4855 10830.2 rplD CDS 23728 - 24333 back 2916.5 10628.5 bhsA 1 CDS 78883 - 79140 back 1068 9141.9 rpsS CDS 22293 - 22571 back 1138.5 9011.8 rpmA CDS 2210 - 2467 forward 1028.5 8803.7 rpmD CDS 16585 - 16764 back 694.5 8520.8 rplB CDS 22586 - 23410 back 3132 8384 rpsC CDS 21230 - 21928 back 2574.5 8133.9 rplE CDS 18941 - 19480 back 1972.5 8066.9 rplO CDS 16147 - 16581 back 1551 7874.2 preprotein translocase sub Unit SecY CDS 14808 - 16139 back 4657 7721.2 rpsE CDS 16771 - 17271 back 1671.5 7368 rpsK CDS 13746 - 14135 back 1223.5 6928.2 tufA CDS 27318 - 28229 back 2850 6901.3 rpmI CDS 38574 - 38771 forward 615 6859.5 rplU CDS 1880 - 2191 forward 935.5 6621.7 rplT CDS 38814 - 39170 forward 1045 6464.4 bhsA 2 CDS 79293 - 79550 back 754 6454.1 rpmB CDS 8391 - 8627 back 682 6355.1 rplJ CDS 23983 - 24480 back 1408 6243.9 fusA 2 CDS 481 - 2595 back 5832 6089.6 rpsA CDS 25062 - 26771 back 4613 5957.6 rpmJ CDS 14658 - 14774 back 314 5926.9 60 Gene Name Gene Location Direction Reading the Cam Census TPM (Million) Per Kilogram (Transcripts) rpsR CDS 52990 - 53217 forward 603 5840.7 rpsG CDS 2692 - 3162 back 1243 5828.2 RPSI CDS 11354 - 11746 back 980.5 5509.8 cspC 1 CDS 8091 - 8300 back 509 5352.8 rpsF CDS 52270 - 52662 forward 916 5147.4 rpsT CDS 55208 - 55471 back 602 5035.9 infC CDS 38128 - 38478 forward 755 4750.3 cspG CDS 30148 - 30360 forward 446 4624.2 15N Experiment The primary method for demonstrating fixation is 5 at a rate adjusted to 14N. It uses the nitrogen isotope 15N found in the atmosphere. Fertilizer or atmosphere 15N by supplementing with enriched levels, directly supported with 15N2 gas. with increased amounts of 15N fixed from one atmosphere (Yoshida 1980) or conversely, by diluting the enriched fertilizer with atmospheric N2 gas within plant tissues. we can (Iniguez 2004). The thinning method provides a cumulative constant of 10 throughout plant growth. While allowing for the observation of nitrogen, the 15N2 gas method allows for the observation of a substance contained within a plant. It is limited to measuring fixation within the short range in which it can be grown in the atmosphere. (velocity measurement). Therefore, the gas method is superior in terms of specificity (atmospheric). Increased 15N2 levels in the plant above the specified speed can be definitively associated with fixation. However, it cannot show cumulative activity. 15 Both types of experiments showed improved results compared to wild-type and uninoculated maize plants. This was carried out to measure the fixation activity of the strains, and several of the improved strains were included. High fixation rates were observed for the plant (Figure 12, Figure 14A and Figure 14B). These analyses show that the activity of strains observed in vitro translates to in vivo results. It is a tool for demonstrating. Furthermore, these experiments show the effect of fertilizer on strain activity. It allows for the measurement of its impact and appropriate functionality in an agricultural environment. It suggests that Setaria plants show similar results when inoculated with wild-type and improved strains. The results were observed (Figure 13). In planta fixation is shown in Figures 14A-14C. 61 Its activity is further backed by transcriptomic data. Evolved strains, wild-type strains According to their counterparts, this shows an increase in nifH transcript levels. Also, in planta microbes The nitrogen level from the source is also related to the colonization level on a plant. are related. These results (Figure 12, Figure 13, Figures 14A-14C, Figure 15A, and Figure 15B) are related to nif 5 through improved regulation of the gene cluster, the microbe is seen in plant tissue This supports the hypothesis that the increase in atmospheric derivative nitrogen is a likely cause. In addition to directly measuring fixation, in a nitrogen-stressed plant biomass experiment The effect of plants inoculated with improved strains has been measured. Plant biomass and potential effects of the plant have been assessed. Although it can be associated with many microbial interactions, nitrogen fixation occurs when nitrogen is low. This suggests that the addition will affect the plant phenotype. Inoculated plants, in the absence of nitrogen, 10 Significant increases in leaf area were observed in both cultivated and uncultivated plants, fresh and dried. Weight yield and root fresh and dry weight were observed (Figure 14C). These differences were only Although associated with nitrogen fixation, improved strains actively affect the plant. This supports the conclusion that it provides nitrogen. Maize and setaria plants, as described above. It was grown and vaccinated as instructed. Fertilizer containing 1.2% 15N was regularly applied through irrigation. It was given to plants as a result. Nitrogen fixation by microorganisms occurs in plant tissue. The 15N level was measured and digitized. The fourth leaf tissue was collected and 4 hours after planting. They were dried after a week. The dried leaf samples were made into beads (QIAGEN Tissuelyzer). homogenized using and separated into tin capsules for IRMS (MBL Stable Isotope Laboratory at The Ecosystems Center, Woods Hole, MA). 20 from the atmosphere The derived nitrogen (NDFA) was calculated, and nitrogen production with CI050 and CM002 is shown in Figure 7. It was shown. Phytohormone Production Experiment The dwarf tomato (Solanum lycopersicum) variety 'Micro-Tom' was previously developed in vitro. to investigate the effect of indole-3-acetic acid on fruit ripening through experiments Candidate microorganisms were used (Cohen 1996; J Am Soc Hort Sci Sci 121: 520-524). To evaluate the production and secretion of phytohormones by immature organisms. A plate-based screening test was developed using the Micro-Tom fruit. 30 twelve-well plates. tissue culture test plates, wells filled with agar medium to be left to solidify. by filling and applying 10 µL to the agar surface overnight as shown in Figure 8. It was prepared by fixing microbial cultures. Increased amounts of gibberellic acid (GA) agars containing bacterial cultures are used as positive controls and standards. Not used. 35 separated from Micro-Tom plants that grew one day after anthesis. 62 Flowers were inserted into agar at the bacterial spot culture point. These flowers were kept for 2-3 weeks. It was monitored throughout, then the fruits were harvested and weighed. The plant was replicated in several copies. An increase in fruit mass occurs with the inoculating microorganism in the plant, as shown in Figure 9. This indicates that the hormone is being produced. Example 6: Cyclic House Host-Microbe Development Maize plants were inoculated with CM013 and reached approximately V5 growth stage in 4 weeks. It was enlarged to that extent. Increased nitrogen accumulation via 15N analysis from microbial sources. The demonstrators were uprooted and pressurized water was used to remove the mounds of soil. The roots were washed using a special solution. A 0.25 g section of the root was cut and fine soil particles were removed. and rinsed with PBS solution to remove non-sticky microbes. tissue Samples were homogenized using 3mm steel beads in a QIAGEN TissueLyser II. The homogenate was diluted and plated on SOB agar medium. Single colonies were removed from the liquid. resuspended in medium and 16s rDNA PCR analysis and vaccination strain 15 They were subjected to specific mutations. Microbial isolation, mutagenesis, inoculation, and repetition. The isolation process analyzes microbial characteristics, plant characteristics, and microbial colonization. It can be repeated to improve its ability. Example 7: Geographical Compatibility 20 The ability of the improved microbes to colonize an inoculated plant has been tested under field conditions. This is critically important for the success of the plant. The described isolation methods are suitable for plants like corn. to be selected from soil microbes that may have a close relationship with crop plants Although designed, many strains vary depending on a range of plant genotypes, environment, soil type, or inoculation methods. 25 It may not be able to colonize effectively under these conditions. Colonization is a process by which a microbial strain... Because it is a complex process requiring a series of interactions between the host plant and the host plant, Screening for colonization adequacy to select priority strains for further development. It has become a central method in evaluating colonization. In the studies, 30 effective but time-consuming methods that cannot be scaled on a strain basis were identified. It used fluorescent labeling of the strains. Colonization activity was directly observed. Since they are not suitable for improvement, potential product candidates are natural colonizers. It is essential to select from the available strains. 63 qPCR can be performed on any given plant stem cell and strain-specific PCR in a population sample. Using primers designed to be robust, wild-type strains were obtained. An experiment was designed to test its colonization. This experiment involved corn tissue. to quickly measure the colonization rate of microbes from samples It has been designed. Using fluorescence microscopy and plate-based techniques, possible 5 Initial tests using strains considered as colonizers were a qPCR. This showed that the approach could be quantitative and scalable. A typical experiment is conducted as follows: Plants, mostly corn and wheat. The varieties were grown in a peat pot mixture inside a greenhouse, with six copies per strain (10). It is cultivated. Four or five days after sowing, on the developing coleoptile. Early stationary values ​​of bacteria diluted to an OD590 of 0.6-1.0 (approximately 5E+O8 CFU / mL) 1 mL was taken from the phase cultures using a pipette. The plants are watered only with tap water and It is allowed to grow for four weeks before sampling; during this time The plants are uprooted, and the roots are thoroughly washed to remove most of the peat residue. 15 Clean root samples are excised and the plant cell debris and associated bacterial cells are separated. It is homogenized to form a slurry. Efficient material to be used as a template for QPCR. a high-throughput DNA extraction protocol that produces a mixture of plant and bacterial DNA We developed this DNA extraction method based on bacterial cell proliferation experiments. The process provides a quantitative bacterial DNA sample based on the fresh weight of the roots. Every 20 strain, strain-specific primers designed using Primer BLAST (Ye 2012). It is evaluated using and background amplification from uninoculated plants. They are compared. Some primers exhibit off-target amplification in uninoculated plants. as exhibited, the presence of colonization amplification or increased correct product Its amplification is determined by the background level. 25 This experiment was designed to measure the compatibility of the microbial product across different soil geographies. Field soil characteristics and field conditions were used to determine the effect of a microbial crop. It can have a major impact on soil pH, water retention capacity, and competition. Microbes can affect inoculum survival and colonization ability in soil. These are just a few of the factors. Colonization experiments use a plant growth medium. Using three different soil types sampled from agricultural areas in California This was carried out (Figure 16A). An intermediate inoculation was performed to approximate realistic agricultural conditions. The concentration used was 1E+O6 to 1E+O7 CFU / g FW on all plants within 3 weeks of strain 3. It colonized among them. After 7 weeks of plant growth, Strain 1 evolved into 35 64 version, high colonization rates in all soil types (1E+06 CFU / g FW) displayed. (Figure 16B). In addition, to assess colonization within the complexity of site conditions, In June 2015, in San Luis Obispo, seven wild 5-year-old plants were found in two different types of field corn. A 1-acre field experiment to evaluate the effects and colonization of the strain. The agricultural design and execution of the experiment was initiated through a field research project. This was carried out by Pacific Ag Research, an organization specializing in vaccination. The same peat culture seed coating technique was tested in the inoculation methods experiment. It has been used. During the growing season, colonization within the roots and stem is 10 Plant samples were collected for evaluation. Three copies were made of each treatment. from the plot four and eight weeks after planting and six weeks after each treatment was performed Samples were collected 16 weeks after the clone, shortly before harvest. Strain 1 and Strain 2. From six replicate plots of treatment inoculated with 2, and also untreated Additional samples were collected 12 weeks after the initial checks. The fresh weight of the washed roots was 15. cell count per gram, qPCR and other methods using soy-specific primers. It was evaluated as a colonization experiment. Two strains, Strain 1 and Strain 2, peaked at 12 weeks. It showed consistent and widespread root colonization, which then rapidly decreased (Figure 16C). Strain 2 has a lower numerical ranking than Strain 1, while the crop More consistent numbers were found in the plant. 20 to effectively colonize the root interior. It was observed that no strains were present. In support of qPCR colonization data, both The strain was identified using coating and 16S sequencing to determine the isolates of the matching sequence. It was successfully re-isolated from the samples. In the context of describing the invention (particularly in the context of the following claims), "one" and "this" and 25 The use of similar guiding terms is permitted herein unless otherwise specified and / or otherwise. In both singular and plural forms, as long as it does not clearly contradict the content. The terms "containing," "having," "including," and "encompassing" will be interpreted otherwise. Unless otherwise specified, open-ended terms (in other words, "including, but not limited to") (meaning "not to be") will be interpreted as such. The value ranges here are 30 Unless otherwise stated herein, reading refers to each individual value falling within the range. It is designed to be used as an abbreviation method and each separate The value is included in the specification as if it were read individually. For example, 10-15 If the range is to be explained, it also includes 11, 12, 13 and 14. All of what is described here. methods, unless otherwise specified herein or otherwise manifestly contradictory to the content 35 65 It can be carried out in any order suitable for the process. Any of the arrangements presented here or the use of all examples and exemplary language (e.g., "like"), solely for the invention This information is provided for better clarification and, unless otherwise stated, the scope of the invention. It does not impose any limitations on the invention. Any term in this specification may not be interpreted as a separate, infringing effect. 5 Any element for which no request has been made that forms the basis for its implementation It should be interpreted as a statement. The preferred applications of the present invention are shown and described herein. together, experts in a technique where such applications are provided only through sampling. It will be understood by individuals. Various 10 experts in the field, without separating them from the invention, will understand it. Changes, variations, and substitutions may be made. The invention described herein various alternatives to its applications can be used in the implementation of the invention It should be understood that the following claims define the scope of the invention and that these claims... The methods and structures included within this invention and their equivalents are covered by this invention. It is intended to enter. 15 Table 3A. Relative values ​​of genes and total RNA as measured by RNASeq sequencing. List of expression levels Name Minimum Maximum Length Direction Murein Lipoprotein CDS 2,929,898 2,930,134 237 forward membrane protein CDS 5,217,517 5,217,843 327 forward zinc / cadmium- binding Protein CDS 3,479,979 3,480,626 648 forward emergency carrier Protein CDS 4,563,344 4,563,580 237 back ompX CDS 4,251,002 4,251,514 513 forward DNA-binding protein HU-beta CDS 375,156 375,428 273 forward sspA CDS 629,998 630,636 639 reverse 66 tatE CDS 3,199,435 3,199,638 204 reverse LexA repressor CDS 1,850,457 1,851,065 609 forward hisS CDS <3999979> 4,001,223 >1245 forward Table 3B. List of relative expression levels of genes and total RNA measured Differential Expression Absolute Confidence Differential Expression Ratio RNASeq_ni fL - Raw Read Count RNASeq_ni fL - Raw Transcript Count RNASeq_W T - Raw Read Count RNASeq_W T - Raw Transcript Census Murein lipoprotein CDS 1000 -1.8 12950.5 10078.9 5151.5 4106.8 membrane protein CDS 1000 -1.3 9522.5 5371.3 5400 3120 zinc / cadmium -binding protein CDS 3.3 1.1 6461 1839.1 5318 1550.6 urgent carrier protein CDS 25.6 1.6 1230.5 957.6 1473.5 1174.7 ompX CDS 1.7 1.1 2042 734.2 1687.5 621.5 DNA- binding protein HU-beta CDS 6.9 -1.3 1305 881.7 725 501.8 sspA CDS 0.2 1 654 188.8 504.5 149.2 tatE CDS 1.4 1.3 131 118.4 125 115.8 67 LexA suppressor CDS 0.1 -1.1 248 75.1 164 50.9 hisS CDS 0 -1.1 467 69.2 325 49.3 Table 3C. RNASeq digestion of genes and total RNA measured by List of expression levels Name Prm (Forward, - 250 to +10 sections) Expressly edited Dizi Neighbor Dizzy murine lipoprotein CDS GCCTCTCGGGGCG CTTTTTTTTATTCC GGCACTAGCCGCT ATTAATAAAATGC AAATCGGAATTTAC TATTTAACGCGAGA TTATCTAAGATGAA TCCGATGGAAGCG CGCTGTTTTCACTC GCCTTTTTAAAGTT ACGTGATGATTTCG ATGCTTCTTTGAGC GAACGATCAAAAAT AAGCGTATTCAGGT AAAAAATATTCTC ATCACAAAAAAGTT TGTGTAATACTTGT AACGCT--- ACATGGAGATTAAC TC ATGAATCGTACTAA ACTGGTACTGGGC GCGGTAATCCTGG GTTCTACTCTGCTG GCTGGTTGCTCCA GCAATGCTAAAATC GATCAGCTGTCTTC TGACGTTCAGACTC TGAACGCTAAAGTT GACCAGCTGAGCA ACGACGTGAACGC AATGCGTTCCGAC GTTCAGGCTGCTA AAGATGACGCAGC TCGCGCTAACCAG CGTCTGGACAACG CAGCTACTAAATAC CGTAAGTAA ATGAAAAAGACCAA AATTGTTTGCACCA TCGGTCCGAAAAC CGAATCCGAAGAG ATGTTGACCAAAAT GCTGGACGCGGGC ATGAACGTTATGCG TCTGAACTTCTCTC ACGGTGACTATGC GGAACACGGTCAG CGCATCCAGAATCT GCGCAATGTGATG AGTAAAACCGGTA AGAAAGCGGCAAT CCTGCTGGACACC AAAGGTCCGGAAA TCCGTACCATTAAG CTGGAAGGCGGCA ACGACGTCTCCCT GAAAGCGGGCCAG ACCTTCACCTTCAC CACCGATAAATCC GTTGTCGGTAATAA CGAAATCGTTGCG GTGACCTATGAAG GCTTCACCAGCGA 68 CCTGAGCGTTGGC AACACGGTACTGG TTGACGATGGTCT GATCGGTATGGAA GTGACCGCTATCG AAGGCAACAAAGT TGTTTGTAAAGTGC TGAACAACGGCGA CCTCGGCGAGAAC AAAGGCGTTAACCT GCCGGGCGTATCT ATCGCGCTGCCGG CGCTGGCTGAAAA AGACAAACAGGAT CTGATCTTCGGTTG CGAACAGGGCGTT GACTTTGTTGCGG CATCCTTTATCCGT AAGCGTTCTGACG TTGTTGAAATCCGT GAGCACCTGAAAG CCCACGGCGGCGA GAAGATCCAGATC ATCTCCAAAATCGA AAACCAGGAAGGC CTGAACAACTTCGA CGAAATCCTCGAA GCCTCTGACGGCA TCATGGTAGCCCG TGGCGACCTGGGC GTTGAAATCCCGG TTGAAGAAGTTATC TTCGCGCAGAAGA TGATGATCGAGAAA TGTATCCGCGCGC 69 GTAAAGTCGTTATC ACCGCGACCCAGA TGCTGGATTCCATG ATCAAAAAACCCGC GTCCGACCCGTGC GGAAGCAGGCGAC GTGGCCAACGCCA TCCTCGACGGCAC CGACGCAGTTATG CTGTCCGGCGAAT CCGCGAAAGGTAA ATACCCGCTGGAA GCGGTCACCATCA TGGCGACCATCTG CGAACGTACCGAC CGCGTCATGACCA GCCGTCTTGAGTA CAACAACGACAAC CGTAAGCTGCGCA TCACCGAAGCGGT GTGCCGCGGTGCG GTAGAAACGGCTG AAAAAACTGGAAGC GCCGCTGATCGTT GTGGCAACCCAGG GCGGTAAATCCG GCGCGCCGTACG AAATACTTCCCGGA TGCCACTATCCTG GCGCTGACCACCA ACGAAACCACCGC GCGTCAGCTGGTG CTGAGCAAAGGCG TTGTGGCACAGCT GGTTGAAGATATCT 70 CCCTCACCGATGC GTTCTACATCCAGG GTAAAGAACTGGC GCTGCAGAGCGGTT CTGGCGCGTAAAG GCGACGTGGTTGT TATGGTTTCCGGC GCGTTAGTCCCGA GCGGAACCACCAA TACCGCTTCCGTG CACGTGCTGTAA membrane protein CDS GGTTCACATAAACA TAATTATCGCCACG GCGATAGCCGTAC GCTTTTTGCGTCAC AACATCCATGGTGA AGCCGGCTTTTTCA AGAACACGCGCCA CCTCATCGGGTCTT AAATACATACTCAT TCCTCATTATCTTT TACCGCACGTTAAC CTTACCTTATTCAT TAAAGGCAACGCTT TCGGAATATTCCAT AAAGGGCTATTTAC AGCATAATTCAAAA TCTTGTCCTACACT TATAGACTCAATGG ATTAAGGGA ATGGCCAACCGAG CAAACCGCAACAA CGTAGAAGAGAGC GCTGAAGATATCCA TAACGATGTCAGC CAATTAGCGGATAC GCTGGAAGAGGTG CTGAAATCGTGGG GCAGCGACGCCAA AGACGAAGCGGAG GCCGCGCGCAAAA AAGCGCAGGCGCT GCTGAAAGAGACC CGCGCCCGGCTTA ACGGCAACAACCG CGTCCAGCAGGCG GCGTGCGACGCCA TGGGCTGCGCTGA CAGCTACGTGCGC GACAAACCGTGGC AAAGCGTCGGCGC CGCAGCAGCCGTT GGGGTATTTATTGG CGTATTACTGAATT ATGTATTTAAGACC CGATGAGGTGGCG CGTGTTCTTGAAAA AGCCGGCTTCACC ATGGATGTTGTGAC GCAAAAAGCGTAC GGCTATCGCCGTG GCGATAATTATGTT TATGTGAACCGTGA AGCTCGTATGGGG CGTACCGCGTTAAT TATTCATCCGGCTT TAAAAGAGCGCAG CACAACGCTTGCG GAGCCCGCGTCGG ATATCAAAACCTGC GATCATTATGAGCA GTTCCCGCTCTATT TAGCGGGGGATGC TCAACAGCATTATG GTATTCCACACGG GTTCAGTTCGCGA ATGGCGCTTGAGC GTTTTCTGAGTGGC 71 TACGTCGATAA CTGTTTGGCGAAA CGCAGTATAGCTG A chinco / cadmium- binding protein CDS GCGCGGAAAATCG ACGCATAGCGCAT TCTCAGAAGCCGG CCTGGTCTCGGTG GAAAAGCGAATCTT TCCCACGACCGCC GGGCCTTTAACAAA AGAATCAATGACCT GATTAATGTCGCTA TCCATTCTCTCTCC GCGTAATGCGATC TTTTTTCATCATAC CTAACAACTGGCA GAGGGAAAAGCCG CGCGGTTTTTCTGC GAAGTGTATTGTAA GATTTGTTTGATAT GTTATATCGTAACA TATTATTGCAAACA T GIVEAWAYS TTCCGCCCTAGCG TTTGGCATTGGCAT GGTAATGGCGAGC AGCCAGGCTTTTG CCCACGGTCACCA TAGTCATGGCCCG GCGCTGACCGAAG CGGAACAAAAGGC GAGTGAAGGCATT TTTGCTGACCAGG ACGTAAAGGACAG GGCGCTGAGCGAC TGGGAGGGGATCT GGCAGTCGGTTAA CCCCTATCTGCTGA ACGGGGATTTAGA TCCGGTTCTGGAG CAGAAGGCCAAAA AGGCCGGTAAAAG CGTGGCGGAATAT CGGGAATATTATAA GAAGGGCTACGCT ACCGATGTCGACC AGATTGGTATCGA GGATAACGTCATG GAGTTTCACGTCG GGAAAACCGTCAA CGCCTGTAAGTAC AGCTATTCCGGTTA CAAAATTCTGACCT ACGCATCCGGTAA ATGGATAGCGACA TTAATCAGGTCATT GATTCTTTTGTTAA AGGCCCGGCGGTC GTGGGAAAGATTC GCTTTTCCACCGA GACCAGGCCGGCT TCTGAGAATGCGC TATGCGTCGATTTT CCGCGCCTCGAAA TCATGCTTGCGGG TCAGCTTCACGATC CGGCGATTAAAGC CGATCGCGCCCAG CTCATGCCGCACG ATGTGCTGTATATT CCCGCTGGCGGAT GGAATGACCCGCA ATGGCTGGCGCCC TCCACTCTGCTCAC TATCTTATTTGGTA AACAGCAGCTGGA ATTCGTCCTGCGC CACTGGGACGGCA GCGCGCTTAACGT GCTGGATAAACAG CAGGTTCCGCGCC GCGGTCCCCGGGT CGGCTCTTTTCTGC TGCAGGCGCTGAA TGAAATGCAGATG CAGCCGCGGGAGC 72 AAAAGGCGTGCGC TACCTGTTCGAATG CCAGCAGGCGGAT TCAAAAGCGCCGA AGTTTGTTCAGTTT AGCGATCACACCA TCGCGCCACGCAA GTCCCAGCATTTCC ACATCTTTATGGGC AATGAGTCCCAGG AAGCGCTGCTGAA AGAGATGGATAACT GGCCAACCTACTAT CCTTATGCGCTGC ATAAAGAGCAGATT GTCGACGAAATGC TGCACCACTAA AGCACACGGCCCG CTTTATTGTCACCA GCCTGCTCAGCCA CTGTGCCGATCTG CTGGGCAGCCAGG TACAAACCTCATCG CGCAGCCAGGCGC TTTTTGAAGCCGATT CGTAAGCATATTGA CGCCCACTTTGCC GACCCGTTAACCC GGGAGTCGGTGGC GCAGGCGTTTTAC CTCTCGCCAAACTA TCTATCCCACCTGT TCCAGAAATGCGG GCCAATGGGCTTT AACGAGTATCTGAA TCACATCCGCCTG GAGCAGGCCAGAA TGCTGTTAAAAGGC CACGATATGAAAGT GAAAGATATCGCC CACGCCTGCGGTT TCGCCGACAGCAA CTACTTCTGCCGC CTGTTTCGCAAAAA CACCGAACGCTCG CCGTCGGAGTATC GCCGTCAATATCAC AGCCAGCTGACGG AAAAAACAGCCCC GGCAAAAAACTAG acyl transporter protein CTGACGAAGCGAG ATGAGCACTATCGA ATGAGTTTTGAAGG 73 CDS TTACATCACCGGTG AAACTCTGCACGTC AACGGCGGAATGT ATATGGTCTGACC GAGATTTGCGCAA AACGCTCAGGAAC CGCGCAGTCTGTG CGGTTCACTGTAAT GTTTTGTACAAAAT GATTTGCGTTATGA GGGCAAACAGCCG CAAAATAGCGTAAA ATCGTGGTAAGAC CTGCCGGGATTTA GTTGCAAATTTTTC AACATTTTATACAC TACGAAAACCATCG CGAAAGCGAGTTTT GA AGAACGCGTTAAG AAAATTATCGGCGA ACAGCTGGGCGTT AAGCAGGAAGAAG TTACCAACAATGCT TCCTTCGTTGAAGA CCTGGGCGCTGAT TCTCTTGACACCGT TGAGCTGGTAATG GCTCTGGAAGAAG AGTTTGATACTGAG ATTCCGGACGAAG AAGCTGAGAAAAT CACTACTGTTCAGG CTGCCATTGATTAC ATCAACGGCCACC AGGCGTAA AAAAATCGCGCTG GTTACCGGTGCAA GTCGCGGGATTGG CCGCGCAATCGCT GAAACGCTCGTTG CCCGTGGCGCGAA AGTTATCGGGACT GCGACCAGCGAAA GCGGCGCGCAGG CGATCAGCGATTAT TTAGGTGCTAACG GTAAAGGTCTGCT GCTGAATGTGACC GATCCTGCATCTAT TGAATCTGTTCTGG GAAATATTCGCGCA GAATTTGGTGAAGT TGATATCCTGGTGA ACAATGCCGGGAT CACTCGTGATAACC TGTTAATGCGCATG AAAGATGATGAGT GGAACGATATTATC GAAACCAACCTGT CATCTGTTTTCCGT CTGTCAAAAGCGG TAATGCGCGCTAT GATGAAAAAGCGT CATGGACGTATTAT CACTATCGGTTCTG TGGTTGGTACCAT GGGAAATGCGGGT CAGGCCAACTACG CTGCGGCGAAAGC GGGTCTGATTGGC 74 TTCAGTAAATCACT GGCTCGCGAAGTT GCGTCCCGCGGTA TTACTGTAAACGTT GTTGCTCCGGGCT TTATTGAAACGGAC ATGACGCGTGCGC TGACCGATGAGCA GCGTGCGGGTACG CTGGCGGCAGTTC CTGCGGGGCGCCT CGGCTCTCCAAAT GAAATCGCCAGTG CGGTGGCATTTTTA GCCTCTGACGAAG CGAGTTACATCACC GGTGAAACTCTGC ACGTCAACGGCGG AATGTATATGGTCT GA ompX CDS ACGCCTGGGGCGC CGACCAGCGGGAA GAGTGATTTGGCC AACGAGGCGCCGC TCTGAATGGAAATC ATGGCGATTAAAAT AACCAGTATCGGC AACCATGCCGGTA CCTTACGAGACGA GCCGGGCATCCTT TCTCCTGTCAATTT TGTCAAATGCGGTA AAGGTTCCAGTGTA ATTGAATTACCCCG CGCCGGTTGAGCT ATGAATAAAATTGC ACGTTTTTCAGCAC TGGCCGTTGTTCT GGCTGCATCCGTA GGTACCACTGCTTT CGCTGCGACTTCT ACCGTTACCGGTG GCTACGCGCAGAG CGACATGCAGGGT GAAGCGAACAAAG CTGGCGGTTTCAA CCTGAAGTACCGC TACGAGCAAGACA ACAACCCGCTGGG TGTTATCGGTTCTT ATGCCCGGCTCGT CTCGTAAGGTACC GGCATGGTTGCCG ATACTGGTTATTTT AATCGCCATGATTT CCAT 75 AATGTTGAAAAAAA GGGTCTTAAAAGC AGTACAATAGGGC GGGTCTGAAGATA ATTTCA TCACCTACACCGAA AAAGATCGTTCTGA ATCTGGCGTTTACA AAAAAGGCCAGTA CTACGGCATCACC GCAGGTCCGGCTT ACCGTCTGAACGA CTGGGCTAGCATC TACGGCGTAGTGG GTGTTGGTTACGG TAAATTCCAGGACA ACAGCTACCCGAA CAAATCTGATATGA GCGACTACGGTTT CTCTTACGGCGCT GGTCTGCAGTTCA ACCCGATCGAAAA CGTTGCCCTGGAC TTCTCCTACGAGCA GTCTCGCATTCGTA ACGTTGACGTTGG CACCTGGATTGCT GGCGTAGGTTACC GCTTCTAA DNA-binding protein HU-beta CDS TCTGATTCCTGATG AAAATAAACGCGA CCTTGAAGAATTC CGGATAACGTTATC GCCGATTTAGATAT CCATCCGGTGAAAA CGAATCGAGGAAG TTCTGGCACTTGC GCTACAGAACGAA CCGTTTGGAAATGG AAGTCGTCACGGC GTGAATAAATCTCA ACTGATTGACAAAA TTGCTGCCGGTGC GGACATTTCTAAAG CCGCAGCTGGACG TGCGTTAGATGCTT TAATCGCTTCTGTT ACTGAATCTCTGCA GGCTGGAGATGAC GTTGCGCTGGTAG GGTTTGGTACTTTT ATGAATCCTGAGC GTTCTGAACGCATT GAAATCCCGTATT GCCGTTGCCGAGAT GTGGTGGTTTATCC GCACATGGTCATA CCCCTGTTTGTAG GGCGGGAAAAAATC TATCCGTTGTCTCG AAGCAGCCATGGA CCATGATAAAAAAA 76 AAAATAGTGATTTC GCGCAAATAGCGC TAAGAAAAATAGG GCTGGTAAAGTAAT TCGTACTTGCCAG CCTTTTTTTGTGTA GCTAACTTAGATCG CTGGCAGGGGGGT CAATT GCTGTTAAAGAGC GCGCTGCCCGTAC TGGTCGCAATCCG CAAACAGGCAAAG AAATCACCATTGCT GCTGCTAAAGTTCC GGGTTTCCGCGCA GGTAAAGCGCTGA AAGACGCGGTAAA CTGA TCATGCTGGTTGC GCAGAAAGAAGCC TCGACGGATGAGC CGGGTGTAAACGA TCTTTTCACCGTCG GGACCGTGGCGTC TATTTTGCAAATGC TGAAGCTACCGGA CGGTACTGTTAAAG TGCTGGTCGAAGG TTTGCAGCGCGCG CGCATCTCTGCGC TGTCTGATAATGGC GAACATTTTTCGGC GAAGGCGGAATAC CTTGAATCGCCGG CGATTGACGAACG CGAGCAGGAAGTG CTGGTTCGTACCG CTATCAGCCAGTTT GAAGGCTACATCA AGCTGAACAAAAAA ATCCCTCCGGAAG TGCTGACGTCGCT GAATAGCATCGAC GATCCGGCCGTC TGGCGGATACCAT CGCTGCGCATATG CCGCTGAAGCTGG CGGACAAACAGTC CGTGCTGGAGATG TCCGACGTTAACG AGCGTCTGGAATAT CTGATGCGATGA TGGAGTCGGAAAT 77 CGATCTGCTGCAG GTGGGAGAAGCGTA TTCGCAACCGCGT GAAAAAAGCAGATG GAGAAAATCTCAGC GCGAGTACTATCT GAATGAGCAAATG AAAGCCATTCAAAA AGAGCTCGGCGAG ATGGACGACGCCCC CGGACGAGAACGA AGCGCTGAAGCGT AAGATCGACGCGGG CGAAAATGCCGAA AGAGGCAAAAGAG AAAACCGAAGCGG AACTGCAAAACTG AAAATGATGTCCCCC GATGTCGGCGGAA GCGACCGTCGTTC GCGGCTACATCGA CTGGATGGTGCAG GTACCGTGGAACG CTCGCAGCAAGGT TAAAAAAGACCTGC GTCAGGTCCAGGGA GATCCTCGATACC GATCACTACGGCC TTGAGCGCGTGAA GGATCGCATTCTTG AGTACCTCGCGGT GCAGAGCCGTGTT AACAAGCTCAAAG GGCCGATCCTGTG CCTGGTTGGGCCT 78 CCGGGGGTAGGTA AAACCTCTCTCGG CCAATCCATCGCC AAAGCAACTGGAC GCAAATATGTGCGT ATGGCGCTGGGCG GCGTGCGTGATGA AGCGGAAATCCGC GGTCACCGCCGTA CCTATATTGGCTCA ATGCCGGGCAAAC TGATCCAGAAAATG GCTAAAGTGGGCG TTAAAAACCCGCTG TTCTTGCTGGATGA GATCGACAAGATG TCTTCTGACATGCG CGGCGATCCGGCC TCGGCGCTGCTGG AGGTGTTGGATCC GGAACAGAACGTG GCCTTTAACGACCA CTATCTGGAAGTG GATTACGATCTCAG CGACGTGATGTTC GTTGCGACCTCTAA CTCCATGAACATCC CGGCGCCGCTGCT GGATCGTATGGAA GTGATCCGCCTCT CCGGCTATACCGA AGATGAGAAGCTA AACATCGCCAAAC GCCATCTGCTGTC AAAACAGATTGAG 79 CGTAACGCGCTCCA AGAAAGGCGAGCT GACGGTGGATGAC AGCGCGATTATCG GCATCATTCGCTAC TACACCCGTGAAG CAGGCGTGCGTGG TCTGGAGCGTGAA ATCTCGAAACTGTG CCGCAAAGCGGTG AAACAGCTGCTGC TGGATAAGTCGCT GAAACACATCGAG ATTAACGGCGACA ACCTGCACGATTTC CTTGGGCGTGCAGC GCTACGACTATGG TCGTGCGGATAGC GAAAACCGCGTAG GTCAGGTGACCG ACTGGCTGGACG GAAGTGGGCGGCG ATCTGCTGACCATT GAAACCGCCTGC TTCCGGGAAAGG CAAACTGACCTACA CCGGTTCACTGGG TGAAGTCATGCAG GAATCCATCCAGG CGGCGCTGACGGT GGTTCGTTCACGT GCGGATAAGCTGG GTATTAACTCAGAC TTTTACGAAAAACG TGATATTCACGTTC 80 ACGTGCCGGAAGG CGCGACGCCGAAG GATGGTCCAAGCG CCGGTATCGCGAT GTGCACCGCGCTG GTTTCCTGTCTGAC GGGTAATCCGGTA CGCGCCGACGTGG CGATGACCGGTGA GATTACCCTCCGT GGCCAGGTATTGC CGATTGGTGGTCT GAAGGAAAAACTG TTGGCCGCGCATC GCGGCGGCATTAA GACTGTTCTGATTC CTGATGAAAATAAA CGCGACCTTGAAG AATTCCGGATAAC GTTATCGCCGATTT AGATATCCATCCG GTGAAACGAATCG AGGAAGTTCTGGC ACTTGCGCTACAG AACGAACCGTTTG GAATGGAAGTCGT CACGGCAAAATAG sspA CDS GTAAGAAAGTCGG CCTGCGTAAAGCA CGTCGTCGTCCTC AGTTCTCCAAACGT TAATTGTTTTCTGC TCACGCGAACAAT TTGCGAAAAAACCC GCTTCGGCGGGTT ATGGCTGTCGCTG CCAACAAACGTTC GGTAATGACGCTG TTTTCTGGTCCTAC TGACATCTATAGCC ATCAGGTCCGCAT CGTGCTGGCCGAA AAAGGTGTTAGTTT ATGGCTGAAAATCA ATACTACGGCACC GGTCGCCGCAAAA GTTCCGCAGCTCG CGTTTTCATCAAAC CGGGCAACGGTAA AATCGTTATCAACC AGCGTTCTCTGGA 81 TTTTTATGGATAAA TTTGCCATTTTCCC TCTACAAACGCCC CATTGTTACCACTT TTTCAGCATTTCCA GAATCCCCTCACC ACAACGTCTTCAAA ATCTGGTAAACTAT CATCCAATTTTCTG CCCAAATGCAGGT GATTGTTCATTTTT TGAGATAGAGCAC GTGGAGAAGGACA ACCCGCCTCAGGA TCTGATTGACCTCA ACCCGAATCAAAG CGTACCGACGCTT GTGGATCGTGAGC TCACTCTGTGGGA ATCTCGCATCATTA TGGAATATCTGGAT GAGCGTTTCCCGCC ATCCGCGCCTCAT GCCGGTTTACCCG GTGGCGCGTGGGGG AAAGCCGTCTGTAT ATGCAGCGTATCG AAAAGGACTGGTAT TCGTTGATGAATAC CATTCAGACCGGT ACCGCTGCGCAGG CTGATACTGCCGCG TAAGCAGCTGCGT GAAGACACTACGG CGATTGCGCCAGT TTTCACCCAGAAGC CCTACTTCCTGAGC GATGAGTTCAGCC TGGTGGACTGCTA CCTGGACCACTG CTGTGGCGTCTGC CGGTTCTCGGCGT AGAGCTGGTCGGC GCTGGCGCGAAAG AGCTTAAAGGCTAT ATGACTCGCGTATT ACAGTACTTCGGTC GTGAAACTGCCCG CATGGTAGTTCGTC AGCCGCTGGAACT GGTCGACATGGTT GAGAAATAGATCT GTACATCACCGTTA AAGGTGGTGGTAT CTCTGGTCAGGCT GGTGCGATCCGTC ACGGTATCACCCG CGCTCTGATGGAG TACGACGAGTCCC TGCGTGGCGAACT GCGTAAAGCTGGT TTCGTTACTCGTGA TGCTCGTCAGGTT GAACGTAAGAAAG TCGGCCTGCGTAA AGCACGTCGTCGT CCTCAGTTCTCCAA ACGTTAA 82 TGAGCGCGACTCT TTCCTCGCTTCTTT AACTGAAGCCGAA CGTGAAATGCGTC TCGGTCGGGGCTA A tatE CDS GTCAAAGCCGTATT ATCGACCCCTTAG GGACAACGCTTGC CGGGGCGGGAGA GCGGCCGCAGTTG ATTTTTGCCGAACT TTCAGCTGATTATA TTCAGCAGGTACG CGAGCGCCTGCCG GTGTTGCGCAATC GCCGCTTTGCGCC ACCGCAATTATTAT GACGTTTTTTTAAA CAAGGCTTGATTCA CCTTGTTACAGATT GCTATTGTGTCCG CGCGTCAAATAGC CGTTAATTGTATGC GTGTATGATGGCG TATTCG ATGGGTGAGATTA GTATTACCAAACTG CTGGTAGTCGCAG CGCTGATTATCCTG GTGTTTGGTACCAA AAAGTTACGCACG CTGGGTGGAGACC TGGGCTCGGCTAT CAAAGGCTTTAAAA AAGCCATGAGCGA TGACGATGACAGT GCGAAGAAGACCA GTGCTGAAGAAGC GCCGGCACAGAAG CTCTCTCATAAAGA GTAA ATGTTTGTTGCTGC CGGACAATTTGCC GTAACGCCGGACT GGACGGGAAACGC GCAGACCTGCGTC AGCATGATGCGCC AGGCCGCGGAGCG GGGGGCGTCGCTT CTGGTTCTGCCTG AGGCGTTGCTGGC GCGAGACGATAAC GATGCGGATTTATC GGTTAAATCCGCC CAGCAGCTGGATG GCGGCTTCTTACA GCTCTTGCTGGCG GAGAGCGAAAACA GCGCTTTGACGAC GGTGCTGACCCTG CATATCCCTTCCGG CGAAGGTCGAGCG ACGAATACGCTGG TGGCCCTGCGTCA GGGGAAGATTGTG GCGCAATATCAGA AACTGCATCTCTAT GATGCGTTCAATAT CCAGGAATCCAGG CTGGTCGATGCCG 83 GGCGGCAAATTCC GCCGCTGATCGAA GTCGACGGGATGC GCGTCGGGCTGAT GACCTGCTACGATT TACGTTTCCCTGAG CTGGCGCTGTCGT TAGCGCTCAGCGG CGCGCAGCTCATA GTGTTGCCTGCCG CGTGGGTAAAAGG GCCGCTGAAGGAA CATCACTGGGCGA CGCTGCTGGCGGC GCGGGCGCTGGAT ACAACCTGCTATAT TGTCGCCGCAGGA GAGTGCGGGACGC GTAATATCGGTCAA AGCCGTATTATCGA CCCCTTAGGGACA ACGCTTGCCGGGG CGGGAGAGCGGCC GCAGTTGATTTTTG CCGAACTTTCAGCT GATTATATTCAGCA GGTACGCGAGCGC CTGCCGGTGTTGC GCAATCGCCGCTT TGCGCCACCGCAA TTATTATGA LexA suppressor CDS GAGGCGGTGGTTG ACCGTATCGGTCC CGAGCATCATGAG CTTTCGGGGCGAG ATGAAAGCGTTAAC GACCAGGCAGCAA GAGGTGTTTGATCT CATTCGGGATCATA ATGGCCAATAATAC CACTGGGTTAACC CGAATTATTAAGC GGCCGGGTATTCC 84 CGAAAGATATGGG ATCGGCGGCGGTA CTGCTGGCGATTAT CATCCGCGCTGATC GCGTGGGGAACGC TGCTGTGGGCGAA CTACCCGCTAAGTCT TGTCGTAGCTGCT CGCAAAACGGAAA GAAACTCCTGATTT TTGTGTGAAATGTG GTTCAAAATCACC GTTAGCTGTATATA CTCACAGCATAACT GTATACACCCAG GGGGC TCAGCCAGACGGG CATGCCGCCGACG CGTGCGGAGATTG CTCAGCGCTTGGG GTTTCGCTCCCCAA ACGCGGCGGAAGA GCATCTGAAAGCG CTGGCGCGTAAAG GCGCAATCGAGAT CGTTTCCGGCCC TCCCGCGGTATTC GTCTGCTGACGGGA AGAGAAACCGGT CTGCCCGCTTATTG GCCGCGTCGCGGC AGGTGAGCCGCTG CTAGCGCAGCAGCAGC ACATTGAAGGCCA CTACCAGGTGGAC CCGGCCATGTTTAA GCCGAACGCCGAT TTTCTGCTGCGTGT TAGCGGTATGTCG ATGAAGGATATCG GTATTCTCGATGGC GACCTGCTGGCTG TCCATAAAACGCAG GATGTGCGCAATG GTCAGGTGGTTTGT GGCGCGTATCGAC GAAAAGTGACCG TGAAGCGTCTGAA AAAACAGGGTAAC GTCGTGGAATTGC TGCCGGAAACAG TGGAAAGGATTCC GTGCGGCGTGGGT CAATGAGGCCGCA TTTCGTCAGGAAAG GCATCGCGGCCGT TATTGCCGTGGCG ATCGCCTGCTGGT TGGACGTCGATGC CATCACGCGGGTG CTGCTCATTAGCTC GGTCCTGTTAGTG ATGATAGTTGAAAT TATCAATAGCGCGA TTGAGGCGGGTGGT TGACCGTATCGGT CCCGAGCATCATG AGCTTTCGGGGCG AGCGAAAGATATG GGATCGGCGGCGG TACTGCTGGCGATT ATCATCGCGCTGAT CGCGTGGGGAACG CTGCTGTGGGCGGA ACTACCGCTAAA 85 CGAATTCTCGCCG ATCGTGGTCGACCC TTCGCGAACAAAG CTTTACTATTGAAG GCCTGGCCGTCGG CGTTATCCGCAAC GGCAACTGGCAAT AA hisS CDS TAAGAAAGCGGC CTGTACGAAGACG GCGTACGTAAGA CAGGCTGGATAAC GACGATATGATCG ATCAGCTGGAAGC GCGTATTCGCGCT AAAGCATCGATGCT GGATGAGGCGCGGT CGTATCGATATCCA GCAGGTTGAAGCG AAATAACGTGTTGG GAAGCGATACGCT TCCCGTGTATGATT GAACCTGCGGCG CGAGGCGCCGGGG GTTCATTTTTGTAT ATATAAAGAGAATA AACGTGGCAAAGA ACATTCAA ...ATGAACGATTATC TGCCGGGCGAAAC CGCTCTCTGGCAG CGCATTGAAGGCT CACTGAAGCAGGT GCTTGGTAGCTAC GGTTACAGCGAAA TCCGTTTGCCGATT GTAGAGCAGACCC CGTTATTCAAACGC GCTATCGGCGAAG TGACCGACGTGGT TGAAAAAGAGATGT ACACCTTTGAGGA CCGTAACGGCGAT AGCCTGACTCTAC GTCCGGAAGGCAC GGCTGGCTGCGTA CGCGCCGGTATCG AACATGGTCTCCTG TACAATCAAGAACA GCGCCTGTGGTAC ATTGGGCCGATGT TCCGCCACGAACG TCCGCAAAAAGGC CGCTACCGTCAGT TCCACCAGATTGG ATGCATAACCAGG CTCCGATTCAACGT AGAAAATCAAAACG AATTTACGTTGGGA ATGTGCCGATTGG CGATGGCGCCCCC ATCGCCGTACAGT CGATGACAAACAC GCGCACCACCGAT GTGGCGGCGACGG TAAATCAAATTAAA GCCCTCGAGCGCG TTGGCGCGGATAT CGTGCGCGTTTCG GTGCCGACGATGG ATGCGGCGGAAGC GTTCAAACTTATCA AACAGCAGGTTAA CGTCCCGCTGGTT GCCGATATCCACTT CGATTACCGCATTG CGCTGAAGGTAGC GGAATACGGCGTT GATTGCCTGCGTAT TAACCCGGGCAAT ATCGGCAACGAAG AGCGTATCCGCAT 86 CGCCGAAGCGTTT GGCCTGCAGGGGC CGGATATCGATGC CGAGCTGATTATG CTGACCGCCCGCT GGTGGCGCGAGCT GGGCATCTCCGGC CACGTTGCGCTGG AGCTGAACTCTATC GGTTCGCTGGAGG CTCGCGCTAACTAT CGCGACGCGCTGG TGGCCTATCTTGAG CAGTTTAAAGATAA GCTGGACGAAGAC TGCAAACGCCGCA TGTACACCAACCC GCTGCGCGTGCTG GATTCTAAAAACCC GGACGTCCAGGCG CTGCTGAACGACG CCCCGACGCTGGG CGACTATCTTGATG AAGAGTCCAAAAC GCATTTTGCCGGG CTGTGCGCGCTGC TGGATGATGCCGG TATTCGCTATACCG TGAATCAGCGTCT GGTACGCGGTCTC GACTACTACAACC GCACCGTGTTTGA GTGGGTCACCACC AGCCTCGGTTCCC AGGGCACCGTCTG GGTGGTGGACTGC GCTCGCGATAAAA ATATTCCTATCCGT ATCGGGGTAAACG CCGGTTCTCTGGA AAAAGATCTCCAG GAAAAATACGGCG AACCGACTCCGCA GGCGCTGCTGGAA TCGGCAATGCGCC ATGTTGATCATCTC GATCGTCTCAACTT CGATCAGTTTAAAG TCAGCGTAAAAGC CTCCGATGTGTTCC TCGCGGTTGAATC CTATCGCCTGTTG GCGAAACAGATCG ATCAGCCTCTGCA CCTCGGGATCACC GAAGCGGGCGGC GCGCGCAGCGGC GCGGTGAAGTCCG CGATCGGCCTCGG CCTGCTGCTGTCT GAAGGGATTGGCG ATACGCTGCGCGT CTCTCTGGCGGCG GATCCCGTTGAAG AGATCAAAGTGGG CTTCGATATTCTCA AGTCGCTGCGTATT CGCTCTCGCGGGA TCAACTTTATTGCC TGCCCGACCTGTT 87 CGCCGGAGGCCGT TACGATGGTCTGG TTGAGCAGCTTGG CGGTCGCGCTACC CCTGGCGTCGGCT TTGCGATGGGGCT GGAACGTCTTGTTT TACTGGTTCAGGC AGTGAATCCGGAA TTTAAAGCCGATCC TGTTGTCGATATAT ACCTGGTAGCCTC CGGAACTGACACC CAGTCCGCAGCAA TGCGTCTGGCTGA ACAGGTACGCGAT GCGTTACCCGGCG TTAAGCTGATGACC AACCATGGCGGCG GCAACTTTAAGAAG CAGTTTGCGCGCG CTGATAAATGGGG CGCTCGCGTTGCG CTGGTGCTGGGCG AATCAGAAATCGCC GACGGAAACGTGG TAGTGAAAGATTTA CGCTCAGGTGAGC AAACTACCGTAACG CAGGATAGCGTTG CTGCGCATTTGCG CACACTTCTGGGTT AA CACGTCAGGAGTT TGACGTTATCGGTA CCGTTAACGCGCT GGAGCAGGCCTG GAAGATATCATTAC GCCGATGGATATTT CGATCATTGGCTG CGTGGTAAACGGT CCCGGCGAGGCGC TGGTTTCCACCCTC GGCGTAACCGGCG GCAATAAGAAAAG CGGCCTGTACGAA GACGGCGTACGTA AAGACAGGCTGGA TAACGACGATATGA TCGATCAGCTGGA AGCGCGTATTCGC GCTAAAGCATCGAT GCTGGATGAGGCG CGTCGTATCGATAT CCAGCAGGTTGAA GCGAAATAA 88 Table 8. Sush table Row First References Dead Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation 1 Application text CI006 CI006 Enterobacter isolated in terms of strain produced No WT 2 Applications text CI008 CI008 Burkholderia isolated in terms of strain produced No WT 3 Applications text CI010 CI010 Klebsiella isolated in terms of strain produced No WT 4 Applications text CI019 CI019 Rahnella isolated in terms of strain produced No WT APPLICATION text CI028 CI028 Enterobacter isolated in terms of strain produced No WT 6 Applications text CI050 CI050 Klebsiella isolated from the sex edilen sush No WT 7 Apps text CM002 CM002 CI050 Mutants Girilen aminoglycoside O- phosphotransferase fire code a kanamycin details The expression cassette (KanR) and nifL genin violation. ΔnifL::KanR ATGAGCCATATTCAACGGGA AACGTTCTTGCTCCAGGCCGC GATTAAAATTCCAACATGGATG CTGATTTATATGGGTATAAAT GGGCTCGCGATAATGTCGGG CAATCAGGTGCGACAATCTAT CGATTGTATGGGAAGCCCCGA TGCGCCAGAGTTGTTTCTGA AACATGGCAAAGGTAGCGTT GCCAATGATGTTACAGATGA GATGGTCAGACTAAACTGGC TGACGGAATTTATGCCTCTTC CGACCATCAAGCATTTTATCC GTACTCCTGATGATGCATGG TTACTCACCACTGCGATCCC CGGGAAAACAGCATTCCAGG TATTAGAAGAATATCCTGATT CAGGTGAAAATATTGTTGATG CGCTGGCAGTGTTCCTGCGC CGGTTGCATTCGATTCCTGTT TGTAATTGTCCTTTTAACAGC 89 Row First References Dead Name Universal Name I am a DNA Mutagen Disclosure Genotype Gen 1 mutation GATCGCGTATTTCGTCTCGCT CAGGCGCAATCACGAATGAA TAACGGTTTGGTTGATGCGA GTGATTTTGATGACGAGCGT AATGGCTGGCCTGTTGAACA AGTCTGGAAAGAAATGCATAA GCTTTTGCCATTCTCACCGGA TTCAGTCGTCACTCATGGTGA TTTCTCACTTGATAACCTTATT TTTGACGAGGGGAAATTAATA GGTTGTATTGATGTTGGACG AGTCGGAATCGCAGACCGAT ACCAGGATCTTGCCATCCTAT GGAACTGCCTCGGTGAGTTT TCTCCTTCATTACAGAAACGG CTTTTTCAAAAATATGGTATT GATAATCCCTGATATGAATAAA TTGCAGTTTCATTTGATGCTC GATGAGTTTTTCTAATAAGCC TGCCTGGTTCTGCGTTTCCC GTCTTTAATACCCTGACCG GAGGTGAGCAATGA 8 Application text CM011 CM011 CI019 Mutant Streptomycin 3"- OH- adenyllyltransfera z gene aadA coding a spectinomycin orange The expression cassette (SpecR) and nifL genin violation. ΔnifL::Spec R ATGAGCATCACGGCGTTATC AGCATCATTTCCTGAGGGGA ATATCCGCCAGCCGCTTGTCG CTGCAACATCCTTCACTGTTT TATACCGTGGTTGAACAATCT TCGGTGGCGAGCGTGTTGAG TCATCCTGACTAGCTGAGAT GAGGGCTCGCCCCCTCGTCC CGACACTTCCAGATCGCCAT AGCGCACAGCGCCTCGAGC GGTGGTAACGGCGCAGTGG CGGTTTTCATGGCTTGTTATG ACTGTTTTTTTGGGGTACAGT CTATGCCTCGGGCATCCAAG CAGCAAGCGCGTTACGCCGT GGGTCGATGTTTGATGTTATG GAGCAGCAACGATGTTACGC AGCAGGGCAGTCGCCCTAAA ACAAAGTTAAACATCATGAGG 90 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation GAAGCGGTGATCGCCGAAGT ATCGACTCAACTATCAGAGGT AGTTGGCGTCATCGAGCGCC ATCTCGAACCGACGTTGCTG GCCGTACATTTGTACGGCTC CGCAGTGGATGGCGGCCTGA AGCCACACAGTGATATTGATT TGCTGGTTACGGTGACCGTA AGGCTTGATGAAACAACGCG GCGAGCTTTGATCAACGACC TTTTGGAAACTTCGGCTTCCC CTGGAGAGAGCGAGATTCTC CGCGCTGTAGAAGTCACCAT TGTTGTGCACGACGACATCA TTCCGTGGCGTTATCCAGCT AAGGCGCGAACTGCAATTTGG AGAATGGCAGCGCAATGACA TTCTTGCAGGTATCTTCGAGC CAGCCACGATCGACATTGAT CTGGCTATCTTGCTGACAAAAA GCAAGGAACATAGCGTTGC CTTGGTAGGTCCAGCGGCGG AGGAACTCTTTGATCCGGTTC CTGAACAGGATCTATTTGAG GCGCTAAATGAAACCTTAAC GCTATGGAACTCGCCGCCCG ACTGGGCTGGCGATGAGCGA AATGTAGTGCTTACGTTGTCC CGCATTTGGTACAGCGCAGT AACCGGCAAAATCGCGCCGA AGGATGTCGCTGCCGACTGG GCAATGGAGCGCCTGCCGG CCCAGTATCAGCCCGTCATA CTTGAAGCTAGACAGGCTTAT CTTGGACAAGAAGAAGATCG CTTGGCCTCGCGCGCAGATC AGTTGGAAGAATTTGTCCACT ACGTGAAAGGCGAGATCACC AAGGTAGTCGGCAAATAATG TCTAACAATTCGTTCAAGCCG ACGCCGCTTCGCGGCGCGG 91 Row First References Dead Name Universal Name I am a DNA Mutagen Disclosure Genotype Gen 1 mutation CTTAACTCAAGCGTTAGATGC ACTAAGCACATATTGCTCAC ACCAAACTATCAGGTCAAG TCTGCTTTTATTATTTTTAAAGC GTGCATAAGCCCTACA AATGGTACCCGACCGGTGGT CONNECTATCTCGCTGACGTG TAGACATCCTTATCCAGAC GCTGATCGCCCATCATCGCG GTTCTTTAGATCTCTCGGTCC GCCCTGATGGCGGCACCTTG CTGACGTTACGCCTGCCGGT ACAGCAGGTTATCACCGGAG GCTTAAAATGA 9 Apply meet CM013 CM013 CI006 Mutant Insert Editing aminoglycoside O- phosphotransferase Genie Kodlayan a kanamycin direction expression cassette (CanR) I found nifL bozulması. ΔnifL::KanR CTGATCCTTCAACTCAGCAAA AGTTCGATTTATTCACAAG CCACGTTGTGTCTCAAAATCT CTGATGTTACATTGCACTION TAAAATATATTHERTCHATCH AATAAAACTGTCTGCTTACAT AAATATATAAGGGGTG TTATGAGCCATATTCAACGGG AAACGTCTTGCTCCAGGCCG CGATTAAATTCCAACATGGAT GCTGATTTATATGGGTATAAA TGGGCTCGCGATAATGTCGG GCAATCAGGTGCGACAATCT ATCGATTGTATGGGAAGCCC GATGCGCCAGAGTTGTTTCT GAAACATGGCAAAGGTAGCG TTGCCAATGATGTTACAGATG AGATGGTCAGACTAAACTGG CTGACGGAATTTATGCCTCTT CCGACCATCAAGCATTTTATC CGTACTCCTGATGATGCATG GTTACTCACCACTGCGATCC CCGGGAAAACAGCATTCCAG GTATTAGAAGAATATCCTGAT TCAGGTGAAAATATTGTTGAT GCGCTGGCAGTGTTCCTGCG CCGGTTGCATTCGATTCCTGT 92 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation TTGTAATTGTCCTTTTAACAG CGATCGCGTATTTCGTCTCG CTCAGGCGCAATCACGAATG AATAACGGTTTGGTTGATGC GAGTGATTTTGATGACGAGC GTAATGGCTGGCCTGTTGAA CAAGTCTGGAAAGAAATGCA TAAGCTTTTGCCATTCTCACC GGATTCAGTCGTCACTCATG GTGATTTCTCACTTGATAACC TTATTTTTGACGAGGGAAAT TAATAGGTTGTATTGATGTTG GACGAGTCGGAATCGCAGAC CGATACCAGGATCTTGCCAT CCTATGGAACTGCCTCGGTG AGTTTTCTCCTTCATTACAGA AACGGCTTTTTCAAAAATATG GTATTGATAATCCTGATATGA ATAAATTGCAGTTTCATTTGA TGCTCGATGAGTTTTTCTAAT AAGCCTTGACCCTACGATTC CCGCTATTTCATTCACTGACC GGAGGTTCAAAATGA Figure 4A CM004 CM004 CI010 Mutant Amphibole Insert made aminoglycoside O- phosphotransferase fire code a kanamycin orange The expression cassette (KanR) amtB genin violation. ΔamtB::Kan R PROVISIONGRADUATE ACAGGTCTGGGAGCGTTGGC TCTTCTTCCCTGATCCTTCAA CTCAGCAAAAGTTCGATTTAT TCAACAAAGCCACGTTGTGT CTCAAAATCTCTGATGTTACA TTGCAAGATAAAAAATATAT CATCATGAACAATAAACTGT CTGCTTACATAAACAGTAATA CAAGGGGTGTTATGAGCCAT ATTCAACGGGAAACGTCTTG CTCCCGTCCGCGCTTAAACT CCAACATGGACGCTGATTTAT ATGGGTATAAATGGGCTCGC GATAATGTCGGGCAATCAGG TGCGACAATCTATCGCTTGTA TGGGAAGCCCGATGCGCCAG AGTTGTTTCTGAAACATGGCA 93 Row First References Dead Name Universal Name I am a DNA Mutagen Disclosure Genotype Gen 1 mutation AAGGTAGCGTTGCCAATGAT GTTACAGATGAGATGGTCCG TCTCAACTGGCTGACGGAGT TTATGCCTCTCCCGACCATCA AGCATTTTATCCGTACTCCTG ATGATGCGTGGTTACTCACC ACCGCGATTCCTGGGAAAAC AGCCTTCCAGGTATTAGAAG AATATCCTGATTCAGGTGAAA ATATTGTTGATGCGCTGGCC GTGTTCCTGCGCCGGTTACA TTCGATTCCTGTTTGTAATTG TCCTTTTAACAGCGATCGTGT ATTTCGTCTTGCTCAGGCGC AATCACGCATGAATAACGGTT TGGTTGATGCGAGTGATTTTG ATGACGAGCGTAATGGCTGG CCTGTTGAACAAGTCTGGAA AGAAATGCACAAGCTCTTGC CATTCTCACCGGATTCAGTC GTCACTCATGGTGATTTCTCA CTTGATAACCTTATTTTTGAC GAGGGGAAATTAATAGGTTG TATTGATGTTGGACGGGTCG GAATCGCAGACCGTTACCAG GACCTTGCCATTCTTTGGAAC TGCCTCGGTGAGTTTTCTCCT TCATTACAGAAACGGCTTTTT CAAAAATATGGTATTGATAAT CCTGATATGAATAAATTGCAG TTTCATTTGATGCTCGATGAG TTTTTCTAATAAGCCTGTGAA GGGCTGGACGTAAACAGCCA CGGCGAAAACGCCTACAACG CCTGA Figure 4A shows the insertion of the CM005 CM005 CI010 mutant. aminoglycoside O- phosphotransferase encoding the gene a bleeding resistance ΔnifL::KanR ATGACCCTGAATATGATGCTC GATAACGCCGTACCCGAGGC GATTGCCGGCTGATCCTTCA ACTCAGCAAAAGTTCGATTTA TTCAACAAAGCCACGTTGTGT CTCAAAATCTCTGATGTTACA 94 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation expression cassette (KanR) with the nifL gene deterioration. TTGCACAAGATAAAAATATAT CATCATGAACAATAAAACTGT CTGCTTACATAAACAGTAATA CAAGGGGGTGTTATGAGCCAT ATTCAACGGGAAACGTCTTG CTCCCGTCCGCGCTTAAACT CCAACATGGACGCTGATTTAT ATGGGTATAAATGGGCTCGC GATAATGTCGGGCAATCAGG TGCGACAATCTATCGCTTGTA TGGGAAGCCCGATGCGCCAG AGTTGTTTCTGAAACATGGCA AAGGTAGCGTTGCCAATGAT GTTACAGATGAGATGGTCCG TCTCAACTGGCTGACGGAGT TTATGCCTCTCCCGACCATCA AGCATTTTATCCGTACTCCTG ATGATGCGTGGTTACTCACC ACCGCGATTCCTGGGAAAAC AGCCTTCCAGGTATTAGAAG AATATCCTGATTCAGGTGAAA ATATTGTTGATGCGCTGGCC GTGTTCCTGCGCCGGTTACA TTCGATTCCTGTTTGTAATTG TCCTTTTAACAGCGATCGTGT ATTTCGTCTTGCTCAGGCGC AATCACGCATGAATAACGGTT TGGTTGATGCGAGTGATTTTG ATGACGAGCGTAATGGCTGG CCTGTTGAACAAGTCTGGAA AGAAATGCACAAGCTCTTGC CATTCTCACCGGATTCAGTC GTCACTCATGGTGATTTCTCA CTTGATAACCTTATTTTTGAC GAGGGGAAATTAATAGGTTG TATTGATGTTGGACGGGTCG GAATGCAGACCGTTACCAG GACCTTGCCATTCTTTGGAAC TGCCTCGGTGAGTTTTCTCCT TCATTACAGAAACGGCTTTTT CAAAAATATGGTATTGATAAT 95 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation CCTGATATGAATAAATTGCAG TTTCATTTGATGCTCGATGAG TTTTTCTAATAAGCCTTGGTT CTGCGTTTCCCGCTCTTTAAT ACCCTGACCGGAGGTGAGCA ATGA Figure 4B CM015 CM015 CI006 Mutant of the OmpX gene upwards region (Prm5) one trailer with nifL gene deterioration. ΔnifL::Prm5 ATGACCCTGAATATGATGATG GATGCCGGCGGACATCATCG CGACAAACAATATTAATACCG GCAACCACACCGGCAATTTA CGAGACTGCGCAGGCATCCT TTCTCCCGTCAATTTCTGTCA AATAAAGTAAAAGAGGCAGT CTACTTGAATTACCCCCGGCT GGTTGAGCGTTTGTTGAAAAA AAGTAACTGAAAAATCCGTAG AATAGCGCCACTCTGATGGT TAATTAACTATCATTAAG AATTATCTGGATGAATGTGCC ATTAAATGCGCAGCATAATGG TGCGTTGTGCGGGAAAACTG CTTTTTTTTGAAAGGGTTGGT CAGTAGCGGAAACAACTCAC TTCACACCCCGAAGGGGGAA GTTGCCTGACCCTACGATTC CCGCTATTTCATTCACTGACC GGAGGTTCAAAATGA 13 Figure 4B CM021 CM021 CI006 Mutant Not Identified above a genin in the section of a fragment and this the first genin 73bp inserted (Prm2) nifL genin violation. ΔnifL::Prm2 ATGACCCTGAATATGATGATG GATGCCGGCTCACCACGGCG ATAACCATAGGTTTCGGCGT GGCCACATCCATGGTGAATC CCACTTTTTCCAGCACGCGC GCCACTTCATCGGGTCTTAAA TACATAGATTTTCCTCGTCAT CTTTCCAAAGCCTCGCCACC TTACATGACTGAGCATGGAC CGTGACTCAGAAAATTCCACA AACGAACCTGAAAGGCGTGA TTGCCGTCTGGCCTTAAAAAT TATGGTCTAAACTAAAATTTA CATCGAAAACGAGGGAGGAT 96 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation CCTATGTTTAACAAACCGAAT CGCCGTGACGTAGATGAAGG TGTTGAGGATATTAACCACGA TGTTAACCAGCTCGAACTCAC TTCACACCCCGAAGGGGGAA GTTGCCTGACCCTACGATTC CCGCTATTTCATTCACTGACC GGAGGTTCAAAATGA Figure 4B CM023 CM023 CI006 Mutant ACPP gene upwards one of the region trailer and inserted the first acpP gene 121bp (Prm4) and nifL genin violation. ΔnifL::Prm4 ATGACCCTGAATATGATGATG GATGCCGGCTGACGAGGCA GGTTACATCACTGGTGAAAC CCTGCACGTCAATGGCGGAA TGTATATGGTTTAACCACGAT GAAATTTTTGCGTTATTAG GGCGAAAGGCCTCAAAATAG CGTAAATCGTGGTAAGAACT GCCGGGATTTAGTTGCAAATT TTTCAACATTTTATACACTAC GAAAACCATCGCGAAAGCGA GTTTTGAATGAATTAAGA GTATGAGCACTATCGAAGAA CGCGTTAAGAAAATTATCGG CGAACAGCTGGGCGTTAAGC AGGAAAGTTACCAACAAT GCTTCCTTCGTTGAAGACCT GGGCGCTGATTCTCTTTGACA CCGAACTCACTTCACACCCC GAAGGGGGAAGTTGCCTGAC CCTACGATTCCCGCTATTTCA TTCACTGACCGGAGGTTCAA AATGA Figure 10A CM014 CM014 CI006 Mutant Lpp Gene upstream a partition in the fragment and lpp the first gene 29bp of the insert (Prm1) nifL gene deterioration. ΔnifL::Prm1 ATGACCCTGAATATGATGATG GATGCCGGCCGTCCTGTAAT AATAACCGGACAATTCGGAC TGATTAAAAAAGCGCCCTTGT GGCGCTTTTTTTATATTCCCG CCTCCATTTAAAATAAAAAAT CCAATCGGATTTCACTATTTA AACTGGCCATTATCTAAGATG AATCCGATGGAAGCTCGCTG TTTTAACACGCGTTTTTTAAC 97 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation CTTTTATTGAAAGTCGGTGCT TCTTTGAGCGAACGATCAAAT TTAAGTGGATTCCCATCAAAA AAATATTCTCAACCTAAAAAA GTTTGTGTAATACTTGTAACG CTACATGGAGATTAACTCAAT CTAGAGGGTATTAATAATGAA TCGTACTAAACTGGTACTGG GCGCAACTCACTTCACACCC CGAAGGGGGAAGTTGCCTGA CCCTACGATTCCCGCTATTTC ATTCACTGACCGGAGGTTCA AAATGA Figure 10A CM016 CM016 CI006 Mutant LexA3 gene upwards one of the region trailer and the first of the lexA3 gene 21bp added (Prm9) nifL gene deterioration. ΔnifL::Prm9 ATGACCCTGAATATGATGATG GATGCCGGCATATTGACACC ATGACGCGCGTAATGCTGAT TGGTTCTGTGACGCTGGTAA TGATTGTCGAAATTCTGAACA GTGCCATCGAAGCCGTAGTA GACCGTATTGGTGCAGAATT CCATGAACTTTCCGGGGCGGG CGAAGGATATGGGGTCGGCG GCGGTGCTGATGTCCATCCT GCTGGCGATGTTTACCTGGA TCGCATTACTCTGGTCACATT TTCGATAACGCTTCCAGAATT CGATAACGCCCTGGTTTTTTG CTTAAATTTGGTTCCAAAATC GCCTTTAGCTGTATATACTCA CAGCATAACTGTATATACACC CAGGGGCGGGATGAAAGC ATTAACGGCCAGGAACTCAC TTCACACCCCGAAGGGGGAA GTTGCCTGACCCTACGATTC CCGCTATTTCATTCACTGACC GGAGGTTCAAAATGA Figure 10A CM022 CM022 CI006 Mutant of the MntP 1 gene upwards one of the region trailer and mntP 1 gene ΔnifL::Prm3 ATGACCCTGAATATGATGATG GATGCCGGCATCATATTGCG CTCCCTGGTTATCATTTGTTA CTAAATGAAATGTTATAATAT AACAATTATAAATACCACATC 98 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation first 53bp added (Prm3) nifL gene deterioration. GCTTTCAATTCACCAGCCAAA TGAGAGGAGGCGCCGTCTGAC ATAGCCAGCGCTATAAAACAT AGCATTATCTATATGTTTATG ATTAATAACTGATTTTTGCGT TTTGGATTTGGCTGTGGCATC CTTGCCGCTCTTTTCGCAGC GTCTTGCGTTTTTGCCCTCCG GTCAGGGCATTTAAGGGTCA GCAATGAGTTTTTACGCAATT ACGATTCTTGCCTTCGGCAT GTCGATGGATGCTTTAACTCA CTTCACACCCCGAAGGGGGA AGTTGCCTGACCCTACGATT CCCGCTATTTCATTCACTGAC CGGAGGTTCAAAATGA Figure 10A CM024 CM024 CI006 Mutant of the NifL gene split sspA top of the gene one in the part with the trailer (Prm7) deterioration. ΔnifL::Prm7 ATGACCCTGAATATGATGATG GATGCCCGGCCGCGTCAGGTT GAACGTAAAAAAGTCGGTCT GGCGAAAAGCACGTCGTCGTC CGCAGTTCTCCAAACGTTAAT TGGTTTCTGCTTCGGCAGAA CGATTGGCGAAAAAACCCGG TGCGAACCGGGTTTTTTTATG GATAAAGATCGTGTTATCCAC AGCAATCCATTGATTATCTCT TCTTTTTCAGCATTTCCAGAA TCCCCTCACCACAAAGCCCG CAAAATCTGGTAAACTATCAT CCAATTTTCTGCCCAAATGGC TGGGATTGTTCATTTTTTGTT TGCCTTACAACGAGAGTGAC AGTACGCGCGGGTAGTTAAC TCAACATCTGACCGGTCGAT AACTCACTTCACACCCCGAA GGGGGAAGTTGCCTGACCCT ACGATTCCCGCTATTTCATTC ACTGACCGGAGGTTCAAAAT GA 99 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation Figure 10A CM025 CM025 CI006 Mutant of hisS gene upwards one of the region trailer and relatively gene first 52bp inserted (Prm10) nifL gene deterioration. ΔnifL::Prm10 ATGACCCTGAATATGATGATG GATGCCGGCCCTGTATGAAG ATGGCGTGCGCAAAGATCGC CTGGATAACAGCGATATGATT AGCCAGCTTGAAGCCCCGCAT TCGCGCGAAAGCGTCAATGC TGGACGAAGCGCGTCGTATC GATGTGCAACAGGTAGAAAA ATAAGGTTGCTGGGAAGCGG CAGGCTTCCCGTGTATGATG AACCCGCCCGGCGCGACCCC GTTGTTCGTCGCGGCCCCGA GGGTTCATTTTTTGTATTAAT AAAGAGAATAACGTGGCAA AAAATATTCAAGCCATTCGCG GCATGAACGATTATCTGCCT GGCGAACTCACTTCACACCC CGAAGGGGGAAGTTGCCTGA CCCTACGATTCCCGCTATTTC ATTCACTGACCGGAGGTTCA AAATGA Figure 10B CM006 CM006 CI010 Mutants of the GlnB gene, aminoglycoside OH- phosphotransferase fire code a kanamycin orange The expression cassette (KanR) violation. ΔglnB::KanR ATGAAAAAGATTGATGCGATT ATTAAACCTTTCAAACTGGAT GACGTGCGCTGATCCTTCAA CTCAGCAAAAGTTCGATTTAT TCAACAAAGCCACGTTGTGT CTCAAAATCTCTGATGTTACA TTGCAAGATAAAAAATATAT CATCATGAACAATAAACTGT CTGCTTACATAAACAGTAATA CAAGGGGTGTTATGAGCCAT ATTCAACGGGAAACGTCTTG CTCCCGTCCGCGCTTAAACT CCAACATGGACGCTGATTTAT ATGGGTATAAATGGGCTCGC GATAATGTCGGGCAATCAGG TGCGACAATCTATCGCTTGTA TGGGAAGCCCGATGCGCCAG AGTTGTTTCTGAAACATGGCA AAGGTAGCGTTGCCAATGAT GTTACAGATGAGATGGTCCG 100 Row First References Dead Name Universal Name I am a DNA Mutagen Disclosure Genotype Gen 1 mutation TCTCAACTGGCTGACGGAGT TTATGCCTCTCCCGACCATCA AGCATTTTATCCGTACTCCTG ATGATGCGTGGTTACTCACC ACCGCGATTCCTGGGAAAC AGCCTTCCAGGTATTAGAAG AATATCCTGATTCAGGTGAAA ATATTGTTGATGCGCTGGCC GTGTTCCTGCGCCGGTTACA TTCGATTCCTGTTTGTAATTG TCCTTTTAACAGCGATCGTGT ATTTCGTCTTGCTCAGGCGC AATCACGCATGAATAACGGTT TGGTTGATGCGAGTGATTTTG ATGACGAGCGTAATGGCTGG CCTGTTGAACAAGTCTGGAA AGAAATGCACAAGCTCTTGC CATTCTCACCGGATTCAGTC GTCACTCATGGTGATTTCTCA CTTGATAACCTTATTTTTGAC GAGGGGAAATTAATAGGTTG TATTGATGTTGGACGGTCG GAATGCAGACCGTTACCAG GACCTTGCCATTCTTTGGAAC TGCCTCGGTGAGTTTTCTCCT TCATTACAGAAACGGCTTTTT CAAAAATATGGTATTGATAAT CCTGATATGAATAAATTGCAG TTTCATTTGATGCTCGATGAG TTTTTCTAATAAGCCTCGCGC GTGATTCGTATCCGCACCGG CGAAGAAGACGACGCGGCG ATTTAA 21 Figure 10C CI028 nifL: Blood R CM017 CI028 Mutant Inserted aminoglycoside O- phosphotransferase encoding the gene a bleeding resistance expression cassette (KanR) ΔnifL::KanR ATGACCATGAACCTGATGAC GGATGTCGTCTCAGCCACCG GGATCGCCGGGTTGCTTTCA CGACAACACCCGACGCTGTT TTTTACACTAATTGAACAGGC CCCCGTGGCGATCACGCTGA CGGATACCGCTGCCCGCATT GTCTATGCCAACCCGGGCGT 101 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation with the nifL gene deterioration. GTTGAGTCATCCTGACTAGCT GAGATGAGGGCTCGCCTGAT CCTTCAACTCAGCAAAAGTTC GATTTATTCAACAAAGCCACG TTGTGTCTCAAAATCTCTGAT GTTACATTGCACAAGATAAAA ATATATCATCATGAACAATAA AACTGTCTGCTTACATAAACA GTAATACAAGGGGTGTTATG AGCCATTTCAACGGGAAAC GTCTTGCTCCAGGCCGCGAT TAAATTCCAACATGGATGCTG ATTTATATGGGTTATAAATGGG CTCGCGATAATGTCGGGCAA TCAGGTGCGACAATCTATCG ATTGTATGGGAAGCCCGATG CGCCAGATGTTTCTGAAA CATGGCAAAGGTAGCGTTGC CAATGATGTTACAGATGAGAT GGTCAGACTAAACTGGCTGA CGGAATTTATGCCTCTTCCGA CCATCAAGCATTTTATCCGTA CTCCTGATGATGCATGGTTAC TCACCACTGCGATCCCCGGG AAAACAGCATTCCAGGTTATTA GAAGAATATCCTGATTCAGGT GAAAATATTGTTGATGCGCTG GCAGTGTTCCTGCGCCGGTT GCATTCGATTCCTGTTGTAA TTGTCCTTTTAACAGCGATCG CGTATTTCGTCTCGCTCAGG CGCAATCACGAATGAATAAC GGTTTGGTTGATGCGAGTGGA TTTTGATGACGAGCGTAATG GCTGGCCTGTTGAACAAGTC TGGAAAGAAATGCATAAGCTT TTGCCATTCTCACCGGATTCA GTCGTCACTCATGGTGATTTC TCACTTGATAACCTTATTTTT GACGAGGGGAAATTAATAGG TTGTATTGATGTTGGACGAGT 102 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation CGGAATCGCAGACCGATACC AGGATCTTGCCATCCTATGG AACTGCCTCGGTGAGTTTTCT CCTTCATTACAGAAACGGCTT TTTCAAAAATATGGTATTGAT AATCCTGATATGAATAAATTG CAGTTTCATTTGATGCTCGAT GAGTTTTTCTAATAAGCCTGA CCGGTGGTGAATTTAATCTC GCTGACGTGTAGACATTCAT CGATCTGCATCCACGGTCCG GCGGCGGTACCTGCCTGACG CTACGTTTACCGCTCTTTTAT GAACTGACCGGAGGCCCAAG ATGA 22 Figure 10C CI019 nifL:Spec R CM011 CI019 Mutant Streptomycin 3"- O-adenylyl Gene transfer aadA codeline a spectinomycin orange The expression cassette (SpecR) and nifL genin violation. ΔnifL::Spec R ATGAGCATCACGGCGTTATC AGCATCATTTCCTGAGGGGA ATATCCGCCAGCCGCTTGTCG CTGCAACATCCTTCACTGTTT TATACCGTGGTTGAACAATCT TCGGTGGCGAGCGTGTTGAG TCATCCTGACTAGCTGAGAT GAGGGCTCGCCCCCTCGTCC CGACACTTCCAGATCGCCAT AGCGCACAGCGCCTCGAGC GGTGGTAACGGCGCAGTGG CGGTTTTCATGGCTTGTTATG ACTGTTTTTTTGGGGTACAGT CTATGCCTCGGGCATCCAAG CAGCAAGCGCGTTACGCCGT GGGTCGATGTTTGATGTTATG GAGCAGCAACGATGTTACGC AGCAGGGCAGTCGCCCTAAA ACAAAGTTAAACATCATGAGG GAAGCGGTGATCGCCGAAGT ATCGACTCAACTATCAGAGGT AGTTGGCGTCATCGAGCGCC ATCTCGAACCGACGTTGCTG GCCGTACATTTGTACGGCTC CGCAGTGGATGGCGGCCTGA AGCCACACAGTGATATTGATT 103 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation TGCTGGTTACGGTGACCGTA AGGCTTGATGAAACAACGCG GCGAGCTTTGATCAACGACC TTTTGGAAACTTCGGCTTCCC CTGGAGAGAGCGAGATTCTC CGCGCTGTAGAAGTCACCAT TGTTGTGCACGACGACATCA TTCCGTGGCGTTATCCAGCT AAGGCGCGAACTGCAATTTGG AGAATGGCAGCGCAATGACA TTCTTGCAGGTATCTTCGAGC CAGCCACGATCGACATTGAT CTGGCTATCTTGCTGACAAAA GCAAGAGAACATAGCGTTGC CTTGGTAGGTCCAGCGGCGG AGGAACTCTTTGATCCGGTTC CTGAACAGGATCTATTTGAG GCGCTAAATGAAACCTTAAC GCTATGGAACTCGCCGCCCG ACTGGGCTGGCGATGAGCGA AATGTAGTGCTTACGTTGTCC CGCATTTGGTACAGCGCAGT AACCGGCAAAATCGCGCCGA AGGATGTCGCTGCCGACTGG GCAATGGAGCGCCTGCCGG CCCAGTATCAGCCCGTCATA CTTGAAGCTAGACAGGCTTAT CTTGGACAAGAAGAAGATCG CTTGGCCTCGCGCGCAGATC AGTTGGAAGAATTTGTCCACT ACGTGAAAGGCGAGATCACC AAGGTAGTCGGCAAATAATG TCTAACAATTCGTTCAAGCCG ACGCCGCTTCGCGGCGCGG CTTAACTCAAGCGTTAGATGC ACTAAGCACATAATTGCTCAC AGCCAAACTATCAGGTCAAG TCTGCTTTTTATTTTTAAGC GTGCATAATAAGCCCTACACA AATGGTACCCGACCGGTGGT GAATTTAATCTCGCTGACGTG 104 Row First References Dead Name Universal Name I am a DNA Mutagen Announcements Genotype Gene 1 mutations TAGACATCCTTATCCAGAC GCTGATCGCCCATCATCGCG GTTCTTTAGATCTCTCGGTCC GCCCTGATGGCGGCACCTTG CTGACGTTACGCCTGCCGGT ACAGCAGGTTATCACCGGAG GCTTAAAATGA 23 Rules 10C CI006 nifL:Can R CM013 CI006 Mutant Insert Editing aminoglycoside O- phosphotransferase Genie Kodlayan a kanamycin direction expression cassette (CanR) I found nifL bozulması. ΔnifL::KanR CTGATCCTTCAACTCAGCAAA AGTTCGATTTATTCACAAG CCACGTTGTGTCTCAAAATCT CTGATGTTACATTGCACTION TAAAATATATTHERTCHATCH AATAAAACTGTCTGCTTACAT AAATATATAAGGGGTG TTATGAGCCATATTCAACGGG AAACGTCTTGCTCCAGGCCG CGATTAAATTCATCCATUREGGAT GCTGATTTATATGGGTATAAA TGGGCTCGCGATAATGTCGG GCAATCAGGTGCGACAATCT ATCGATTGTATGGGAAGCCC GATGCGCCAGAGTTGTTTCT GAAACATGGCAAAGGTAGCG TTGCCAATGATGTTACAGATG AGATGGTCAGACTAAACTGG CTGACGGAATTTATGCCTCTT CCGACCATCAAGCATTTTATC CGTACTCCTGATGATGCATG GTTACTCACCACTGCGATCC CCGGGAAAACAGCATTCCAG GTATTAGAAGAATATCCTGAT TCAGGTGAAAATATTGTTGAT GCGCTGGCAGTGTTCCTGCG CCGGTTGCATTCGATTCCTGT TTGTAATTGTCCTTTTAACAG CGATCGCGTATTTCGTCTCG CTCAGGCGCAATCACGAATG AATAACGGTTTGGTTGATGC GAGTGATTTTGATGACGAGC GTAATGGCTGGCCTGTTGAA CAAGTCTGGAAAGAAATGCA 105 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutations TAAGCTTTTGCCATTCTCACC GGATTCAGTCGTCACTCATG GTGATTTCTCACTTGATAACC TTATTTTTGACGAGGGGAAAT TAATAGGTTGTATTGATGTTG GACGAGTCGGAATCGCAGAC CGATACCAGGATCTTGCCAT CCTATGGAACTGCCTCGGTG AGTTTTCTCCTTCATTACAGA AACGGCTTTTTCAAAAATATG GTATTGATAATCCCTGATGA ATAAATTGCAGTTTCATTTGA TGCTCATGAGTTTTTTTCTAAT AAGCCTTGACCCTAGATTC CCGCTATTTCATTCACTGACC GGAGGTTCAAAAATGA 24 Shekels 10C CI010 nifL:Can R CM005 CI010 Mutant Insert Editing aminoglycoside O- phosphotransferase Genie Kodlayan a kanamycin direction expression cassette (CanR) I found nifL bozulması. ΔnifL::KanR ATGACCCTGAATATGATGCTC GATAACGCCGTACCCGAGGC GATTGCCGGCTGATCCTTCA ACTCAGCAAAAGTTCGATTTA TTCAACAAAGCCACGTTGTGT CTCAAAATCTCTGATGTTACA TTGCAAGATAAAAAATATAT CATCATGAACAATAAACTGT CTGCTTACATAAACAGTAATA CAAGGGGTGTTATGAGCCAT ATTCAACGGGAAACGTCTTG CTCCCGTCCGCGCTTAAACT CCAACATGGACGCTGATTTAT ATGGGTATAAATGGGCTCGC GATAATGTCGGGCAATCAGG TGCGACAATCTATCGCTTGTA TGGGAAGCCCGATGCGCCAG AGTTGTTTCTGAAACATGGCA AAGGTAGCGTTGCCAATGAT GTTACAGATGAGATGGTCCG TCTCAACTGGCTGACGGAGT TTATGCCTCTCCCGACCATCA AGCATTTTATCCGTACTCCTG ATGATGCGTGGTTACTCACC ACCGCGATTCCTGGGAAAAC 106 Row First References Dead Name Universal Name I am a DNA Mutagen Disclosure Genotype Gene 1 mutation AGCCTTCCAGGTATTAGAAG AATATCCTGATTCAGGTGAAA ATATTGTTGATGCGCTGCC GTGTTCCTGCGCCGGTTACA TTCGATTCCTGTTGTGAATTG TCCTTTTAACAGCGATCGTGT ATTTCGTCTTGCTCAGGCGC AATCACGCATGAATAACGGTT TGGTTGATGCGAGTGATTTTG ATGACGAGCGTAATGGCTGG CCTGTTGAACAAGTCTGGAA AGAAATGCACAAGCTCTTGC CATTCTCACCGATTCAGTC GTCACTCATGGTGATTTCTCA CTTGATAACCTTATTTTTGAC GAGGGGAAATTAATAGGTTG TATTGATGTTGGACGGGTCG GAATCGCAGACCGTTACCAG GACCTTGCCATTCTTTGGAAC TGCCTCGGTGAGTTTTTCTCCT TCATTACAGAAACGGCTTTTT CAAAAATATGGTATTGATAAT CCTGATATGAATAAATTGCAG TTTCATTTGATGCTCGATGAG TTTTTCTAATAAGCCTTGGTT CTGCGTTTCCCGCTCTTTTAAT ACCCTGACCGGAGGTGAGCA ATGA Figure 4C Enterobacter strain 2 CI006 isolated in terms of strain produced No WT Figure 4C Strain 4 CI010 Klebsiella 26 isolated in terms of strain produced No WT Figure 4C Strain 1 CI019 Rahnella (27) isolated in terms of strain produced No WT Figure 4C Strain 3 CI028 Enterobacter 28 isolated in terms of strain produced No WT 107 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation Figure 4B Strain 2 CI006 Enterobacter 29 isolated in terms of strain produced No WT Figure 4B High CM014 CI006 Mutant lpp gene upwards in the region trailer and lpp the first gene 29bp of the insert edited (Prm1 nifL genin violation. ΔnifL::Prm1 ATGACCCTGAATATGATGATG GATGCCGGCCGTCCTGTAAT AATAACCGGACAATTCGGAC TGATTAAAAAAGCGCCCTTGT GGCGCTTTTTTTATATTCCCG CCTCCATTTAAAATAAAAT CCAATCGGATTTCACTATTTA AACTGGCCATTATCTAAGATG AATCCGATGGAAGCTCGCTG TTTTAACACGCGTTTTTTAAC CTTTTATTGAAAGTCGGTGCT TCTTTGAGCGAACGATCAAAT TTAAGTGGATTCCCATCAAAA AAATATTCTCAACCTAAAAAA GTTTGTGTAATACTTGTAACG CTACATGGAGATTAACTCAAT CTAGAGGGTATTAATGAA TCGTACTAAACTGGTACTGG GCGCAACTCACTTCACACCC CGAAGGGGGAAGTTGCCTGA CCCTACGATTCCCGCTATTTC ATTCACTGACCGGAGGTTCA AAATGA 31 Figure 4B Medium CM015 CI006 Mutant OmpX Gene upstream of the region (Prm5) a fragment with nifL genin violation. ΔnifL::Prm5 ATGACCCTGAATATGATGATG GATGCCGGCGGACATCATCG CGACAAACAATTAATACCG GCAACCACACCGGCAATTTA CGAGACTGCGCAGGCATCCT TTCTCCCGTCAATTTCTGTCA AATAAAGTAAAAGAGGCAGT CTACTTGAATTACCCCCGGCT GGTTGAGCGTTTGTTGAAAAA AAGTAACTGAAAAATCCGTAG AATAGCGCCACTCTGATGGT TAATTAACTATCATTAAG AATTATCTGGATGAATGTGCC ATTAAATGCGCAGCATAATGG TGCGTTGTGCGGGAAAACTG 108 Row First References Dead Name Universal Name I am a DNA Mutagen Disclosure Genotype Gen 1 mutation CTTTTTTTTGAAAGGGTTGGT CAGTAGCGGAAACAACTCAC TTCACACCCCGAAGGGGGAA GTTGCCTGACCCTACGATTC CCGCTATTTCATTCACTGACC GGAGGTTCAAAATGA 32 Figure 4B Dushuk CM023 CI006 Mutant ACPP Gene upstream section of a fragment and inserted The first acpP gene 121bp (Prm4) and nifL genin violation. ΔnifL::Prm4 ATGACCCTGAATATGATGATG GATGCCGGCTGACGAGGCA GGTTACATCACTGGTGAAAC CCTGCACGTCAATGGCGGAA TGTATATGGTTTAACCACGAT GAAATTTTTGCGTTATTAG GGCGAAAGGCCTCAAAATAG CGTAAATCGTGGTAAGAACT GCCGGGATTTAGTTGCAAATT TTTCAACATTTTATACACTAC GAAAACCATCGCGAAAGCGA GTTTTGAATGAATTAAGA GTATGAGCACTATCGAAGAA CGCGTTAAGAAAATTATCGG CGAACAGCTGGGCGTTAAGC AGGAAAGTTACCAACAAT GCTTCCTTCGTTGAAGACCT GGGCGCTGATTCTCTTTGACA CCGAACTCACTTCACACCCC GAAGGGGGAAGTTGCCTGAC CCTACGATTCCCGCTATTTCA TTCACTGACCGGAGGTTCAA AATGA Figure 4D Strain 2 CI006 Enterobacter 33 isolated in terms of strain produced No WT Figure 4D shows the evolved CM029 CI006 mutant of the OmpX gene. upstream region (Prm5) one trailer with nifL gene deterioration and glutamate- ammonia-ligaze ΔnifL::Prm5 ΔglnE- AR_KO1 ATGACCCTGAATATGATGATG GATGCCGGCGGACATCATCG CGACAAACAATATTAATACCG GCAACCACACCGGCAATTTA CGAGACTGCGCAGGCATCCT TTCTCCCGTCAATTTCTGTCA AATAAAGTAAAAGAGGCAGT CTACTTGAATTACCCCCGGCT GGTTGAGCGTTTGTTGAAAAA 109 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation adenillytransfera zın (ΔglnE- AR_KO1) adenyl-middle lifting includes the domain eden glnE gene beginning from your codon next 1287bp deletion AAGTAACTGAAAAATCCGTAG AATAGCGCCACTCTGATGGT TAATTAACCTATTCAATTAAG AATTATCTGGATGAATGTGCC ATTAAATGCGCAGCATAATGG TGCGTTGTGCGGGAAAACTG CTTTTTTTTGAAAGGGTTGGT CAGTAGCGGAAACAACTCAC TTCACACCCCGAAGGGGGAA GTTGCCTGACCCTACGATTC CCGCTATTTCATTCACTGACC GGAGGTTCAAAATGA Figure 14C Wild CI006 Enterobacter 35 isolated in terms of strain produced No WT Figure 14C Evolved CM014 CI006 Mutant lpp gene upwards in the region trailer and lpp the first gene 29bp of added (Prm1) nifL gene deterioration. ΔnifL::Prm1 ATGACCCTGAATATGATGATG GATGCCGGCCGTCCTGTAAT AATAACCGGACAATTCGGAC TGATTAAAAAAGCGCCCTTGT GGCGCTTTTTTTATATTCCCG CCTCCATTTAAAATAAAAAAT CCAATCGGATTTCACTATTTA AACTGGCCATTATCTAAGATG AATCCGATGGAAGCTCGCTG TTTTAACACGCGTTTTTTAAC CTTTTATTGAAAGTCGGTGCT TCTTTGAGCGAACGATCAAAT TTAAGTGGATTCCCATCAAAA AAATATTCTCAACCTAAAAAA GTTTGTGTAATACTTGTAACG CTACATGGAGATTAACTCAAT CTAGAGGGTATTAATAATGAA TCGTACTAAACTGGTACTGG GCGCAACTCACTTCACACCC CGAAGGGGGAAGTTGCCTGA CCCTACGATTCCCGCTATTTC ATTCACTGACCGGAGGTTCA AAATGA Figure 14B of 37 wild CI019 Rahnella isolated in terms of No WT 110 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation strain produced Figure 14B Evolved CM011 CI019 Mutant Streptomycin 3"- HE- adenillytransfera z gen aadA a coding spectinomycin resistance expression cassette (SpecR) with the nifL gene deterioration. ΔnifL::Spec R ATGAGCATCACGGCGTTATC AGCATCATTTCCTGAGGGGA ATATCGCCAGCCGCTTGTCG CTGCAACATCCTTCACTGTTT TATACCGTGGTTGAACAATCT TCGGTGGCGAGCGTGTTGAG TCATCCTGACTAGCTGAGAT GAGGGCTCGCCCCCTCGTCC CGACACTTCCAGATCGCCAT AGCGCACAGCGCCTCGAGC GGTGGTAACGGCGCAGTGG CGGTTTTCATGGCTTGTTATG ACTGTTTTTTTGGGGTACAGT CTATGCCTCGGGCATCCAAG CAGCAAGCGCGTTACGCCGT GGGTCGATGTTTGATGTTATG GAGCAGCAACGATGTTACGC AGCAGGGCAGTCGCCCTAAA ACAAAGTTAAACATCATGAGG GAAGCGGTGATCGCCGAAGT ATCGACTCAACTATCAGAGGT AGTTGGCGTCATCGAGCGCC ATCTCGAACCGACGTTGCTG GCCGTACATTTGTACGGCTC CGCAGTGGATGGCGGCCTGA AGCCACACAGTGATATTGATT TGCTGGTTACGGTGACCGTA AGGCTTGATGAAACAACGCG GCGAGCTTTGATCAACGACC TTTTGGAAACTTCGGCTTCCC CTGGAGAGAGCGAGATTCTC CGCGCTGTAGAAGTCACCAT TGTTGTGCACGACGACATCA TTCCGTGGCGTTATCCAGCT AAGCGCGAACTGCAATTTGG AGAATGGCAGCGCAATGACA TTCTTGCAGGTATCTTCGAGC CAGCCACGATCGACATTGAT CTGGCTATCTTGCTGACAAAAA GCAAGGAACATAGCGTTGC 111 Row First References Dead Name Universal Name I am a DNA Mutagen Disclosure Genotype Gen 1 mutation CTTGGTAGGTCCAGCGGCGG AGGAACTCTTTGATCCGGTTC CTGAACAGGATCTATTTGAG GCGCTAAATGAAACCTTAAC GCTATGGAACTCGCCGCCCG ACTGGGCTGGCGATGAGCGA AATGTAGTGCTTACGTTGTCC CGCATTTGGTACAGCGCAGT AACCGGCAAAATCGCGCCGA AGGATGTCGCTGCCGACTGG GCAATGGAGCGCCTGCCGG CCCAGTATCAGCCCGTCATA CTTGAAGCTAGACAGGCTTAT CTTGGACAAGAAGAAGATCG CTTGGCCTCGCGCGCAGATC AGTTGGAAGAATTTGTCCACT ACGTGAAAGGCGAGATCACC AAGGTAGTCGGCAAATAATG TCTAACAATTCGTTCAAGCCG ACGCCGCTTCGCGGCGCGG CTTAACTCAAGCGTTAGATGC ACTAAGCACATAATTGCTCAC AGCCAAACTATCAGGTCAAG TCTGCTTTTTATTTTTAAGC GTGCATAATAAGCCCTACACA AATGGTACCCGACCGGTGGT GAATTTAATCTCGCTGACGTG TAGACATTCCCTTATCCAGAC GCTGATCGCCCATCATCGCG GTTCTTTAGATCTCTCGGTCC GCCCTGATGGCGGCACCTTG CTGACGTTACGCCTGCCGGT ACAGCAGGTTATCACCGGAG GCTTAAAATGA 39 Form 14A Evolved CM011 CI019 Mutant Streptomycin 3"- OH- adenyllyltransfera z gene aadA coding a spectinomycin orange ΔnifL::Spec R ATGAGCATCACGGCGTTATC AGCATCATTTCCTGAGGGGA ATATCCGCCAGCCGCTTGTCG CTGCAACATCCTTCACTGTTT TATACCGTGGTTGAACAATCT TCGGTGGCGAGCGTGTTGAG TCATCCTGACTAGCTGAGAT 112 Row First References Dead Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation expression cassette (SpecR) with the nifL gene deterioration. GAGGGCTCGCCCCCTCGTCC CGACACTTCCAGATCGCCAT AGGCGCACAGCGCCTCGAGC GGTGGTAACGGCGCAGTGG CGGTTTTCATGGCTTGTTATG ACTGTTTTTTTGGGGTACAGT CTATGCCTCGGGCATCCAAG CAGCAAGCGCGTTACGCCGT GGGTCGATGTTTGATGTTATG GAGCAGCAACGATGTTACGC AGCAGGGCAGTCGCCCTAAA ACAAAGTTAAACATCATGAGG GAAGCGGTGATCGCCGAAGT ATCGACTCAACTATCAGAGGT AGTTGGCGTCATCGAGCGCC ATCTCGAACCGACGTTGCTG GCCGTACATTTGTACGGCTC CGCAGTGGATGGCGGCCTGA AGCCACACAGTGATATTGATT TGCTGGTTACGGTGACCGTA AGGCTTGATGAAACAACGCG GCGAGCTTTGATCAACGACC TTTTGGAAACTTCGGCTTCCC CTGGAGAGAGCGAGATTCTC CGCGCTGTAGAAGTCACCAT TGTTGTGCACGACGACATCA TTCCGTGGCGTTATCCAGCT AAGCGCGAACTGCAATTTGG AGAATGGCAGCGCAATGACA TTCTTGCAGGTATCTTCGAGC CAGCCACGATCGACATTGAT CTGGCTATCTTGCTGACAAAAA GCAAGGAACATAGCGTTGC CTTGGTAGGTCCAGCGGCGG AGGAACTCTTTGATCCGGTTC CTGAACAGGATCTATTTGAG GCGCTAAATGAAACCTTAAC GCTATGGAACTCGCCGCCCG ACTGGGCTGGCGATGAGCGA AATGTAGTGCTTACGTTGTCC CGCATTTGGTACAGCGCAGT 113 Row First References Dead Name Universal Name I am a DNA Mutagen Disclosure Genotype Gen 1 mutation AACCGGCAAAATCGCGCCGA AGGATGTCGCTGCCGACTGG GCAATGGAGCGCCTGCCGG CCCAGTATCAGCCCGTCATA CTTGAAGCTAGACAGGCTTAT CTTGGACAAGAAGAAGATCG CTTGGCCTCGCGCGCAGATC AGTTGGAAGAATTTGTCCACT ACGTGAAAGGCGAGATCACC AAGGTAGTCGGCAAATAATG TCTAACAATTCGTTCAAGCCG ACGCCGCTTCGCGGCGCGG CTTAACTCAAGCGTTAGATGC ACTAAGCACATAATTGCTCAC AGCCAAACTATCAGGTCAAG TCTGCTTTTATTATTTTTAAGC GTGCATAATAAGCCCTACACA AATGGTACCCCGACCGGTGGT GAATTTAATCTCGCTGACGTG TAGACATTCCCTTATCCAGAC GCTGATCGCCCATCATCGCG GTTCTTTAGATCTCTCGGTCC GCCCTGATGGCGGCACCTTG CTGACGTTACGCCTGCCGGT ACAGCAGGTTATCACCGGAG GCTTAAAATGA Figure 15A Wild CI006 Enterobacter 40 isolated in terms of strain produced No WT Figure 15A Evolved CM013 CI006 Mutant Inserted aminoglycoside O- phosphotransferase encoding the gene a kanamycin details The expression cassette (KanR) and nifL genin violation. ΔnifL::KanR CTGATCCTTCAACTCAGCAAA AGTTCGATTTATTCAACAAAG CCACGTTGTGTCTCAAAATCT CTGATGTTACATTGCACAAGA TAAAAATATCATCATGAAC AATAAAACTGTCTGCTTACAT AAACAGTAATACAAGGGGTG TTATGAGCCATATTCAACGGG AAACGTCTTGCTCCAGGCCG CGATTAAATTCCAACATGGAT GCTGATTTATATGGGTATAAA TGGGCTCGCGATAATGTCGG 114 Row First References Dead Name Universal Name I am a DNA Mutagen Disclosure Genotype Gen 1 mutation GCAATCAGGTGCGACAATCT ATCGATTGTATGGGAAGCCCC GATGCGCCAGAGTTGTTTCT GAAACATGGCAAAGGTAGCG TTGCCAATGATGTTACAGATG AGATGGTCAGACTAAACTGG CTGACGGAATTTATGCCTCTT CCGACCATCAAGCATTTTATC CGTACTCCTGATGATGCATG GTTACTCACCACTGCGATCC CCGGGAAAACAGCATTCCAG GTATTAGAAGAATATCCTGAT TCAGGTGAAAATATTGTTGAT GCGCTGGCAGTGTTCCTGCG CCGGTTGCATTCGATTCCTGT TTGTAATTGTCCTTTTAACAG CGATCGCGTATTTCGTCTCG CTCAGGCGCAATCACGAATG AATAACGGTTTGGTTGATGC GAGTGATTTTGATGACGAGC GTAATGGCTGGCCTGTTGAA CAAGTCTGGAAAGAAATGCA TAAGCTTTTGCCATTCTCACC GGATTCAGTCGTCACTCATG GTGATTTCTCACTTGATAACC TTATTTTTGACGAGGGGAAAT TAATAGGTTGTATTGATGTTG GACGAGTCGGAATCGCAGAC CGATACCAGGATCTTGCCAT CCTATGGAACTGCCTCGGTG AGTTTTCTCCTTCATTACAGA AACGGCTTTTTCAAAAATATG GTATTGATAATCCTGATATGA ATAAATTGCAGTTTCATTTGA TGCTCGATGAGTTTTTCTAAT AAGCCTTGACCCTACGATTC CCGCTATTTCATTCACTGACC GGAGGTTCAAAATGA 42 Figure 15B Unnamed CM011 CI019 Mutant Inserted atreptomycin 3"- HE- ΔnifL::Spec R ATGAGCATCACGGCGTTATC AGCATCATTTCCTGAGGGGA ATATCGCCAGCCGCTTGTCG 115 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation adenillytransfera z gen aadA a coding spectinomycin resistance expression cassette (SpecR) with the nifL gene deterioration. CTGCAACATCCTTCACTGTTT TATACCGTGGTTGAACAATCT TCGGTGGCGAGCGTGTTGAG TCATCCTGACTAGCTGAGAT GAGGGCTCGCCCCCTCGTCC CGACACTTCCAGATCGCCAT AGCGCACAGCGCCTCGAGC GGTGGTAACGGCGCAGTGG CGGTTTTCATGGCTTGTTATG ACTGTTTTTTTGGGGTACAGT CTATGCCTCGGGCATCCAAG CAGCAAGCGCGTTACGCCGT GGGTCGATGTTTGATGTTATG GAGCAGCAACGATGTTACGC AGCAGGGCAGTCGCCCTAAA ACAAAGTTAAACATCATGAGG GAAGCGGTGATCGCCGAAGT ATCGACTCAACTATCAGAGGT AGTTGGCGTCATCGAGCGCC ATCTCGAACCGACGTTGCTG GCCGTACATTTGTACGGCTC CGCAGTGGATGGCGGCCTGA AGCCACACAGTGATATTGATT TGCTGGTTACGGTGACCGTA AGGCTTGATGAAACAACGCG GCGAGCTTTGATCAACGACC TTTTGGAAACTTCGGCTTCCC CTGGAGAGAGCGAGATTCTC CGCGCTGTAGAAGTCACCAT TGTTGTGCACGACGACATCA TTCCGTGGCGTTATCCAGCT AAGCGCGAACTGCAATTTGG AGAATGGCAGCGCAATGACA TTCTTGCAGGTATCTTCGAGC CAGCCACGATCGACATTGAT CTGGCTATCTTGCTGACAAAAA GCAAGGAACATAGCGTTGC CTTGGTAGGTCCAGCGGCGG AGGAACTCTTTGATCCGGTTC CTGAACAGGATCTATTTGAG GCGCTAAATGAAACCTTAAC 116 Row First References Dead Name Universal Name I am a DNA Mutagen Disclosure Genotype Gen 1 mutation GCTATGGAACTCGCCGCCCG ACTGGGCTGGCGATGAGCGA AATGTAGTGCTTACGTTGTCC CGCATTTGGTACAGCGCAGT AACCGGCAAAATCGCGCCGA AGGATGTCGCTGCCGACTGG GCAATGGAGCGCCTGCCGG CCCAGTATCAGCCCGTCATA CTTGAAGCTAGACAGGCTTAT CTTGGACAAGAAGAAGATCG CTTGGCCTCGCGCGCAGATC AGTTGGAAGAATTTGTCCACT ACGTGAAAGGCGAGATCACC AAGGTAGTCGGCAAATAATG TCTAACAATTCGTTCAAGCCG ACGCCGCTTCGCGGCGCGG CTTAACTCAAGCGTTAGATGC ACTAAGCACATAATTGCTCAC AGCCAAACTATCAGGTCAAG TCTGCTTTTTATTTTTAAGC GTGCATAATAAGCCCTACACA AATGGTACCCGACCGGTGGT GAATTTAATCTCGCTGACGTG TAGACATTCCCTTATCCAGAC GCTGATCGCCCATCATCGCG GTTCTTTAGATCTCTCGGTCC GCCCTGATGGCGGCACCTTG CTGACGTTACGCCTGCCGGT ACAGCAGGTTATCACCGGAG GCTTAAAATGA 43 Figure 16B Sush 5 CI008 Burkholderia isolated from the sex edilen sush No WT 44 Figure 16B Sush 1 CM011 CI019 Mutant Insert Edited atreptomycin 3"- OH- adenyllyltransfera z gene aadA coding a spectinomycin orange ΔnifL::Spec R ATGAGCATCACGGCGTTATC AGCATCATTTCCTGAGGGGA ATATCCGCCAGCCGCTTGTCG CTGCAACATCCTTCACTGTTT TATACCGTGGTTGAACAATCT TCGGTGGCGAGCGTGTTGAG TCATCCTGACTAGCTGAGAT GAGGGCTCGCCCCCTCGTCC 117 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gene 1 mutation expression cassette (SpecR) with the nifL gene deterioration. CGACACTTCCAGATCGCCAT AGGCGCACAGCGCCTCGAGC GGTGGTAACGGCGCAGTGG CGGTTTTCATGGCTTGTTATG ACTGTTTTTTTGGGGTACAGT CTATGCCTCGGGCATCCAAG CAGCAAGCGCGTTACGCCGT GGGTCGATGTTTGATGTTATG GAGCAGCAACGATGTTACGC AGCAGGGCAGTCGCCCTAAA ACAAAGTTAAACATCATGAGG GAAGCGGTGATCGCCGAAGT ATCGACTCAACTATCAGAGGT AGTTGGCGTCATCGAGCGCC ATCTCGAACCGACGTTGCTG GCCGTACATTTGTACGGCTC CGCAGTGGATGGCGGCCTGA AGCCACACAGTGATATTGATT TGCTGGTTACGGTGACCGTA AGGCTTGATGAAACAACGCG GCGAGCTTTGATCAACGACC TTTTGGAAACTTCGGCTTCCC CTGGAGAGAGCGAGATTCTC CGCGCTGTAGAAGTCACCAT TGTTGTGCACGACGACATCA TTCCGTGGCGTTATCCAGCT AAGGCGCGAACTGCAATTTGG AGAATGGCAGCGCAATGACA TTCTTGCAGGTATCTTCGAGC CAGCCACGATCGACATTGAT CTGGCTATCTTGCTGACAAAA GCAAGAGAACATAGCGTTGC CTTGGTAGGTCCAGCGGCGG AGGAACTCTTTGATCCGGTTC CTGAACAGGATCTATTTGAG GCGCTAAATGAAACCTTAAC GCTATGGAACTCGCCGCCCG ACTGGGCTGGCGATGAGCGA AATGTAGTGCTTACGTTGTCC CGCATTTGGTACAGCGCAGT AACCGGCAAAATCGCGCCGA 118 First Place Reference Available Name Universal Name Lineage Mutagenic DNA Explanation Genotype Gen 1 mutation AGGATGTCGCTGCCGACTGG GCAATGGAGCGCCTGCCGG CCCAGTATCAGCCCGTCATA CTTGAAGCTAGACAGGCTTAT CTTGGACAAGAAGAAGATCG CTTGGCCTCGCGCGCAGATC AGTTGGAAGAATTTGTCCACT ACGTGAAAGGCGAGATCACC AAGGTAGTCGGCAAATAATG TCTAACAATTCGTTCAAGCCG ACGCCGCTTCGCGGCGCGG CTTAACTCAAGCGTTAGATGC ACTAAGCACATAATTGCTCAC AGCCAAACTATCAGGTCAAG TCTGCTTTTTATTTTTAAGC GTGCATAATAAGCCCTACACA AATGGTACCCGACCGGTGGT GAATTTAATCTCGCTGACGTG TAGACATTCCCTTATCCAGAC GCTGATCGCCCATCATCGCG GTTCTTTAGATCTCTCGGTCC GCCCTGATGGCGGCACCTTG CTGACGTTACGCCTGCCGGT ACAGCAGGTTATCACCGGAG GCTTAAAATGA 10 119 Table 8. Sush Table (continued) First Place Reference Available Name Universal Name Soy Mutagenic DNA Explanation Genotype Gene 1 mutation 34 Figure 4D Evolved CM029 CI006 Mutant OmpX gene upwards region (Prm5) one with the trailer nifL gene deterioration and glutamate- ammonia-ligaze adenillytransfe raz's (ΔglnE- AR_KO1) adenyl- from the middle lifting domain containing glnE gene beginning from your codon next 1287bp deletion ΔnifL::Prm ΔglnE- AR_KO1 ATGTTTAACGATCTGATTGG CGATGATGAAACGGATTCG CCGGAAGATGCGCTTTCTG AGAGCTGGCGCGAATTGTG GCAGGATGCGTTGCAGGAG GAGGATTCCACGCCCGTGC TGGCGCATCTCTCAGAGGA CGATCGCCGCCGCGTGGT GGCGCTGATTGCCGATTTT CGCAAAGAGTTGGATAAAC GCACCATTGGCCCGCGAGG GCGGCAGGTACTCGATCAC TTAATGCCGCATCTGCTCA GCGATGTATGCTCGCGCGA CGATGCGCCAGTACCGCTG TCACGCCTGACGCCGCTGC TCACCGGAATTATTACCCG CACCACTTACCTTGAGCTG CTAAGTGAATTTCCCGGCG CACTGAAACACCTCATTTCC CTGTGTGCCGCGTCGCCGA TGGTTGCCAGTCAGCTGGC GCGCTACCCGATCCTGCTT GATGAATTGCTCGACCCGA ATACGCTCTATCAACCGAC GGCGATGAATGCCTATCGC GATGAGCTGCGCCAATACC TGCTGCGCGTGCCGGAAGA TGATGAAGAGCAACAGCTT GAGGCGCTGCGGCAGTTTA AGCAGGCGCAGTTGCTGCG CGTGGCGGCGGCGGATATT GCCGGTACGTTGCCAGTAA TGAAAGTGAGCGATCACTT AACCTGGCTGGCGGAAGCG ATTATTGATGCGGTGGTGC AGCAAGCCTGGGGGCAGAT GGTGGCGCGTTATGGCCAG 120 CCAACGCATCTGCACGATC GCGAAGGGCGCGGTTTTGC GGTGGTCGGTTATGGCAAG CTGGGCGGCTGGGAGCTG GGTTACAGCTCCGATCTGG ATCTGGTATTCCTGCACGA CTGCCCGATGGATGTGATG ACCGATGGCGAGCGTGAAA TCGATGGTCGCCAGTTCTA TTTGCGTCTCGCGCAGCGC GTGATGCACCTGTTTAGCA CGCGCACGTCGTCCGGCAT CCTTTATGAAGTTGATGCGC GTCTGCGTCCATCTGGCGC TGCGGGGATGCTGGTCACT ACTACGGAATCGTTCGCCG ATTACCAGCAAAACGAAGC CTGGACGTGGGAACATCAG GCGCTGGCCCGTGCGCGC GTGGTGTACGGCGATCCGC AACTGACCGCCGAATTTGA CGCCATTCGCCGCGATATT CTGATGACGCCTCGCGACG GCGCAACGCTGCAAACCGA CGTGCGAGAAATGCGCGAG AAAATGCGTGCCCATCTTG GCAACAAGCATAAAGACCG CTTCGATCTGAAAGCCGAT GAAGGCGGTATCACCGACA TCGAGTTTATCGCCCAATAT CTGGTGCTGCGCTTTGCCC ATGACAAGCCGAAACTGAC GCGCTGGTCGGATAATGTG CGCATTCTCGAAGGGCTGG CGCAAAACGGCATCATGGA GGAGGCAGGAAGCGCAGGC ATTGACGCTGGCGTACACC ACATTGCGTGATGAGCTGC ACCACCTGGCGCTGCAAGA GTTGCCGGGACATGTGGCG CTCTCCTGTTTTGTCGCCGA GCGTGCGCTTATTAAAACC AGCTGGGACAAGTGGCTGG 121 TGGAACCGTGCGCCCCGG CGTAA Notwithstanding the attached claims, the invention described herein comprises the following items: It is defined as: 1. A method for growing one or more bacteria, including the following: 5 (a) isolation of bacteria from the tissue or soil of a primary plant; (b) to produce one or more variant bacteria to one or more bacteria inclusion of genetic variation; (c) exposure of numerous plants to variant bacteria; (d) isolation of bacteria from the tissue or soil of one of a large number of plants; 10 The plant from which the bacteria were isolated here is among many other plants in the same group. It possesses an advanced feature when compared; and (e) Repeat steps (b) through (d) with the bacteria isolated in step (d). 2. The method is according to Article 1, and the advanced feature here is that the bacteria are isolated in 15 It is increased nitrogen fixation in the plant. 3. The method is as described in Article 1, where the genetic variation consists of the following: It is a variation within a selected gene from the group: nifA, nifL, ntrB, ntrC, glnA, glnB, glnK, draT, amtB, glnD, glnE, nifJ, nifH , nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, 20 nifZ, nifM, nifF, nifB and nifQ. 4. The method is according to Article 1, where genetic variation, glutamine synthetase, glutaminase, glutamine synthetase, adenillyltransferase, transcriptional activator, anti- transcriptional activator, pyruvate flavodoxine oxidoreductase, flavodoxine or NAD+-25 A functionally selected group from dinitrogen-reductase and ADP-D-ribosyltransferase. It is a variation in a gene that codes for the protein. 5. The method is according to Article 1, where genetic variation, NifA or glutaminase is used. increased expression or activity of NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, 30 Decreased expression or activity of AmtB; decreased adenylyl adhesion of GlnE a reduction in uridyyl-clearing activity; or a decrease in the uridyyl-clearing activity of GlnD It is a mutation that provides one or more of these benefits. 122 According to Article 6, Section 1, the method involves a knockout mutation as the genetic variation. The method is as described in Article 7, Section 1, where genetic variation is applied to a protein domain. This leads to the elimination or destruction of its activity. 8. The method is according to Article 1, where genetic variation is the regulatory effect of a target gene. It modifies or destroys a sequence. According to Article 9, Section 1, the method is one in which genetic variation acts as a heterologous regulator. It includes the insertion of the series. According to Article 10, Section 1, the method involves genetic variation, including genetic variation. found within the genome of a bacterial species or genus corresponding to the bacteria of which it is derived It includes a regulatory sequence insertion. Article 11. The method according to Article 10, where the regulatory sequence is 15 of a bacterial culture. It is selected based on the expression level of a gene within it or based on the plant tissue. According to Article 12, Section 1, the method involves genetic variation through chemical mutagenesis. It is produced. This is the method according to Article 13, Section 1, where step (c) involves subjecting plants to biotic or abiotic stress. This involves exposure to their sources. According to Article 14, Section 2, the method is where steps (b) to (d) are repeated one or more times. After replication, the isolated bacteria were found in a second plant of the same species as the first plant at a rate of 1-25%. or produces more nitrogen. According to Article 15, Section 2, the method is where steps (b) to (d) are performed one or more times. After repetition, the isolated bacteria were compared with the bacteria isolated from the first plant. Compared to other methods, it shows at least a twofold increase in nitrogen fixation. 30 Article 16. This method is in accordance with Article 14, where the second plant, glutamine, ammonia or another It is grown in the presence of a nitrogen-containing chemical fertilizer supplement. According to Article 17, Section 2, the method is as follows: the first plant here is an agricultural crop. 35 123 Article 18, according to Article 17, is the method where agricultural crop plants such as barley, rice, and corn are used. wheat, sorghum, sweet corn, sugarcane, onions, tomatoes, strawberries, or asparagus. is selected from among them. According to Article 19, Section 1, the method involves the first plant or plants in a large number of plants. It is a model plant. 20. This method is in accordance with Article 19, where the model plant is Setaria, Brachypodium or It is selected from Arabidopsis. 10 This method, according to Article 21, Section 1, involves genetic variation specific to a target region. It is a predetermined genetic variation that is included. According to Article 22, Section 1, the method involves genetic variation in a random sample of 15 individuals in the target area. It is a mutation. The method is in accordance with Article 23, Section 1, where step (a) involves the genetic analysis of isolated bacteria. It involves conducting the analysis. According to Article 24, Section 1, the method is as follows, where step (b) also includes genetic variation. It involves applying a selected pressure to enrich the bacteria. Article 25, method according to 24, where the selected pressure is included in a target area. It involves the linking of genomes lacking the genetic variant, where 25 Binding occurs within 100 nucleotides of the target region. Article 26, according to Article 24, is a method that also involves bacteria surviving at the selected pressure. It involves isolating them. Article 27, according to Article 25, is a method where the connection is a selectable one in the reverse direction. a marker, Zinc Finger nuclease, a CRISPR nuclease, a TALE nuclease or a site-specific nuclease selected from a group of meganucleases It is directed by. 35 124 Article 28. This method, according to Article 27, uses a site-specific nuclease, a CRISPR It is a nuclease. According to Article 29, Section 1, the method involves one or more genetic variations. It is an insertion or deletion of a nucleotide. 5 This is the method according to Article 30, Section 1, where steps (b) to (d) are repeated one or more times. After replication, the isolated bacteria were either endophytic, epiphytic, or rhizospheric. According to Article 31, Section 1, the method is as follows: steps (b) to (d) are performed one or more times. After replication, the isolated bacteria included numerous different bacterial taxa. This method, according to Article 32, Section 1, involves isolating bacteria from plant tissue. According to Article 33, Section 1, the method is as follows: in step (a), the isolation of bacteria is the first 15 It involves isolating bacteria from a plant seed. 34. A method for increasing nitrogen fixation in a plant, and nitrogen fixation. one or more genetic materials that are incorporated into one or more genes that regulate It involves exposing the plant to bacteria containing 20 variations, where the bacteria in the plant... It produces 1% or more nitrogen. Article 35 refers to a method described in Article 34, where bacteria produce 5% or more nitrogen in the plant. It produces. Article 36 refers to a method described in Article 34, where bacteria produce 10% or more nitrogen in the plant. It produces. Article 37. According to Article 34, the method involves bacteria, glutamine, ammonium or additives. Nitrogen is produced in the presence of fertilizers supplemented with other chemical sources. 30 Article 38. This method is based on Article 34, and here genetic variation refers to: nifA, nifL, ntrB, ntrC, glutamine synthase, glnA, glnB, glnK, draT, amtB, glutaminase, glnD, glnE, nifJ, nifH, Consisting of nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB and nifQ. It is a variation in a gene selected from the group. 35 125 Article 39. The method is in accordance with Article 34, where genetic variation, nifA or glutaminase increased expression or activity of nifL, ntrB, glutamine synthetase, glnB, glnK, draT, Decreased expression or activity of amtB; decreased adenylyl amplification of GlnE a reduction in uridyyl-clearing activity; or a decrease in the uridyyl-clearing activity of GlnD It is a mutation that provides 5 or more. According to Article 40, Section 34, the method is where one or more genetic variations (a) are present. (b) is a knockout mutation; it alters or removes a regulatory sequence of a target gene. (c) removes; or includes the insertion of a heterologous regulatory sequence. Article 41 refers to a method described in Article 34, where the bacteria are of the genus Enterobacter. Article 42 refers to a method described in Article 34, where the bacteria are of the genus Rahnella. Article 43. This method is in accordance with Article 34, where the bacteria are endophytic, epiphytic, or rhizospheric. 15 Article 44, method according to 34, where bacteria are collected from numerous different bacterial taxa. includes. Article 45, according to section 34, refers to a method where the plant is an agricultural crop. 20 46. ​​This is a method according to any of the articles 34 to 45, where The plant is a non-legume plant. Article 47, according to Article 45, is a method where the agricultural crop plant is sorghum, canola, 25 Tomatoes, strawberries, barley, rice, corn, and wheat are among the grains chosen. Article 48 refers to a method under Article 45, where the plant is a genetically modified organism. (GMO). Article 49, according to Article 45, is a method involving a genetically modified plant organism. It is not a GMO. Article 50, according to method 45, involves genetically modifying the plant for efficient nitrogen utilization. They are designed or bred as such. 35 126 51. One or more genes that regulate nitrogen fixation are incorporated into one or more genes. a bacterial population containing more genetic variation, where the bacteria, A plant grown in the presence of a bacterial population produces 1% or more nitrogen. Article 52. According to Article 51, the method involves bacteria, glutamine, ammonium or 5. Additional nitrogen produces nitrogen in the presence of fertilizer supplemented with other chemical sources. Article 53. This method, according to Article 51, involves genetic variation; nifA, nifL, ntrB, ntrC, glutamine synthase, glnA, glnB, glnK, draT, amtB, glutaminase, glnD, glnE, nifJ, nifH, 10 consisting of nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB and nifQ. It is a variation in a gene selected from a group. 54. This method, according to Article 51, involves genetic variation, nifA, or increased glutaminase levels. expression or activity of nifL, ntrB, glutamine synthetase, glnB, glnK, draT, amtB decreased expression or activity of GlnE; decreased adenylyl elimination 15 its activity; or one or more of the decreased uridyyl-clearing activity of GlnD. It is a mutation that provides more. 55. The method according to Article 51 is whereby one or more genetic variations (a) are present. (b) is a knockout mutation; it alters or removes a regulatory sequence of a target gene. (c) removes; or includes the insertion of a heterologous regulatory sequence. Article 56 refers to a bacterial population according to Article 51, where the bacteria are Enterobacter. It is of that type. Article 57 refers to a bacterial population according to Article 51, where the bacteria are Rahnella. It is of that type. Article 58 refers to a bacterial population according to Article 51, where the bacteria are endophytic, epiphytic or It is rhizospheric. 30 Article 59, according to Article 51, is a bacterial population where bacteria are numerous and of different kinds. It contains bacterial taxa. 127 60. Bacterial population according to any of the items listed between 51 and 59. It is a compound containing... Article 61. According to Article 60, it is a composition where the composition is applied to one surface of a seed. It contains the bacterial population that is covered. 5 62. A composition according to Article 60, where the composition is formulated as a liquid or powder. It is done. 63. It is a bacterium with ATCC registration number PTA-122293 or PTA-122294. 10 TV SERIES LIST <110> PIVOT BIO, INC. <120> METHODS AND COMPOSITIONS FOR IMPROVING PLANT CHARACTERISTICS <130> 47736-701.301 <140> 15 / 636,595 <141> 2017-06-28 <150> PCT / US2016 / 042170 <151> 2016-07-13 <150> 62 / 213,567 <151> 2015-09-02 <150> 62 / 192,009 <151> 2015-07-13 <160> 61 <170> PatentIn version 3.5 <210> 1 <211> 9 <212> PRT <213> Unknown <220> <223> Explaining the Unknown: "LAGLIDADG" family peptide motif sequence <400> 1 Leu Ala Gly Leu Ile Asp Ala Asp Gly 1 5 <210> 2 <211> 90 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic oligonucleotide <400> 2 gttgatcaga ccgatgttcg gaccttccaa ggtttcgatc ggacatacgc gaccgtagtg 60 ggtcgggtgt acgtctcgaa cttcaaagcc 90 <210> 3 <211> 257 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 3 gcctctcggg gcgctttttt ttattccggc actagccgct attaataaaa atgcaaatcg 60 gaatttacta tttaacgcga gattatctaa gatgaatccg atggaagcgc gctgttttca 120 ctcgcctttt taaagttacg tgatgatttc gatgcttctt tgagcgaacg atcaaaaata 180 agcgtattca ggtaaaaaaa tattctcatc acaaaaaagt ttgtgtaata cttgtaacgc 240 tacatggaga ttaactc 257 <210> 4 <211> 260 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 4 ggttcacata aacataatta tcgccacggc gatagccgta cgctttttgc gtcacaacat 60 ccatggtgaa gccggctttt tcaagaacac gcgccacctc atcgggtctt aaatacatac 120 tcattcctca ttatctttta ccgcacgtta accttacctt attcattaaa ggcaacgctt 180 tcggaatatt ccataaaggg ctatttacag cataattcaa aatcttgtcc tacacttata 240 gactcaatgg aattaaggga 260 <210> 5 <211> 260 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 5 gcgcggaaaa tcgacgcata gcgcattctc agaagccggc ctggtctcgg tggaaaagcg 60 aatctttccc acgaccgccg ggcctttaac aaaagaatca atgacctgat taatgtcgct 120 atccattctc tctccgcgta atgcgatctt ttttcatcat acctaacaaa ctggcagagg 180 gaaaagccgc gcggtttttc tgcgaagtgt attgtaagat ttgtttgata tgttatatcg 240 taacatatta ttgcaaacat 260 <210> 6 <211> 259 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 6 ctgacgaagc gagttacatc accggtgaaa ctctgcacgt caacggcgga atgtatatgg 60 tctgaccgag atttgcgcaa aacgctcagg aaccgcgcag tctgtgcggt tcactgtaat 120 gttttgtaca aaatgatttg cgttatgagg gcaaacagcc gcaaaatagc gtaaaatcgt 180 ggtaagacct gccgggattt agttgcaaat ttttcaacat tttatacact acgaaaacca 240 tcgcgaaagc gagttttga 259 <210> 7 <211> 260 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 7 acgcctgggg cgccgaccag cgggaagagt gatttggcca acgaggcgcc gctctgaatg 60 gaaatcatgg cgattaaaat aaccagtatc ggcaaccatg ccggtacctt acgagacgag 120 ccgggcatcc tttctcctgt caattttgtc aaatgcggta aaggttccag tgtaattgaa 180 ttaccccgcg ccggttgagc taatgttgaa aaaaagggtc ttaaaagcag tacaataggg 240 cgggtctgaa gataatttca 260 <210> 8 <211> 260 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 8 tctgattcct gatgaaaata aacgcgacct tgaagaaatt ccggataacg ttatcgccga 60 tttagatatc catccggtga aacgaatcga ggaagttctg gcacttgcgc tacagaacga 120 accgtttgga atggaagtcg tcacggcaaa atagtgattt cgcgcaaata gcgctaagaa 180 aaatagggct ggtaagtaaa ttcgtacttg ccagcctttt tttgtgtagc taacttagat 240 cgctggcagg ggggtcaatt 260 <210> 9 <211> 259 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 9 gtaagaaagt cggcctgcgt aaagcacgtc gtcgtcctca gttctccaaa cgttaattgt 60 tttctgctca cgcagaacaa tttgcgaaaa aacccgcttc ggcgggtttt tttatggata 120 aatttgccat tttccctcta caaacgcccc attgttacca ctttttcagc atttccagaa 180 tcccctcacc acaacgtctt caaaatctgg taaactatca tccaattttc tgcccaaatg 240 caggtgattg ttcattttt 259 <210> 10 <211> 260 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 10 gtcaaagccg tattatcgac cccttaggga caacgcttgc cggggcggga gagcggccgc 60 agttgatttt tgccgaactt tcagctgatt atattcagca ggtacgcgag cgcctgccgg 120 tgttgcgcaa tcgccgcttt gcgccaccgc aattattatg acgttttttt aaacaaggct 180 tgattcacct tgttacagat tgctattgtg tccgcgcgtc aaatagccgt taattgtatg 240 cgtgtatgat ggcgtattcg 260 <210> 11 <211> 260 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 11 gaggcggtgg ttgaccgtat cggtcccgag catcatgagc tttcggggcg agcgaaagat 60 atgggatcgg cggcggtact gctggcgatt atcatcgcgc tgatcgcgtg gggaacgctg 120 ctgtgggcga actaccgcta agtcttgtcg tagctgctcg caaaacggaa agaaactcct 180 gatttttgtg tgaaatgtgg ttccaaaatc accgttagct gtatatactc acagcataac 240 tgtatataca cccagggggc 260 <210> 12 <211> 260 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 12 taagaaaagc ggcctgtacg aagacggcgt acgtaaagac aggctggata acgacgatat 60 gatcgatcag ctggaagcgc gtattcgcgc taaagcatcg atgctggatg aggcgcgtcg 120 tatcgatatc cagcaggttg aagcgaaata acgtgttggg aagcgatacg cttcccgtgt 180 atgattgaac ctgcgggcgc gaggcgccgg ggttcattttt tgtatatata aagagaataa 240 acgtggcaaa gaacattcaa 260 <210> 13 <211> 237 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 13 atgaatcgta ctaaactggt actgggcgcg gtaatcctgg gttctactct gctggctggt 60 tgctccagca atgctaaaat cgatcagctg tcttctgacg ttcagactct gaacgctaaa 120 gttgaccagc tgagcaacga cgtgaacgca atgcgttccg acgttcaggc tgctaaagat 180 gacgcagctc gcgctaacca gcgtctggac aacgcagcta ctaaataccg taagtaa 237 <210> 14 <211> 327 <212> DNA <213> Yapa Dizi <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 14 atggccaacc gagcaaaccg caacaacgta gaagagagcg ctgaagatat ccataacgat 60 gtcagccaat tagcggatac gctggaagag gtgctgaaat cgtggggcag cgacgccaaa 120 gacgaagcgg aggccgcgcg caaaaaagcg caggcgctgc tgaaagagac ccgcgcccgg 180 cttaacggca acaaccgcgt ccagcaggcg gcgtgcgacg ccatgggctg cgctgacagc 240 tacgtgcgcg acaaaccgtg gcaaagcgtc ggcgccgcag cagccgttgg ggtatttatt 300 ggcgtattac tgaatttacg tcgataa 327 <210> 15 <211> 648 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 15 atgaccaaaa agatttccgc cctagcgttt ggcattggca tggtaatggc gagcagccag 60 gcttttgccc acggtcacca tagtcatggc ccggcgctga ccgaagcgga acaaaaggcg 120 agtgaaggca tttttgctga ccaggacgta aaggacaggg cgctgagcga ctgggagggg 180 atctggcagt cggttaaccc ctatctgctg aacggggatt tagatccggt tctggagcag 240 aaggccaaaa aggccggtaa aagcgtggcg gaatatcggg aatattataa gaagggctac 300 gctaccgatg tcgaccagat tggtatcgag gataacgtca tggagtttca cgtcgggaaa 360 accgtcaacg cctgtaagta cagctattcc ggttacaaaa ttctgaccta cgcatccggt 420 aaaaaaggcg tgcgctacct gttcgaatgc cagcaggcgg attcaaaagc gccgaagttt 480 gttcagttta gcgatcacac catcgcgcca cgcaagtccc agcatttcca catctttatg 540 ggcaatgagt cccaggaagc gctgctgaaa gagatggata actggccaac ctactatcct 600 tatgcgctgc ataaagagca gattgtcgac gaaatgctgc accactaa 648 <210> 16 <211> 237 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 16 atgagcacta tcgaagaacg cgttaagaaa attatcggcg aacagctggg cgttaagcag 60 gaagaagtta ccaacaatgc ttccttcgtt gaagacctgg gcgctgattc tcttgacacc 120 gttgagctgg taatggctct ggaagaagag tttgatactg agattccgga cgaagaagct 180 gagaaaatca ctactgttca ggctgccatt gattacatca acggccacca ggcgtaa 237 <210> 17 <211> 513 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 17 atgaataaaa ttgcacgttt ttcagcactg gccgttgttc tggctgcatc cgtaggtacc 60 actgctttcg ctgcgacttc taccgttacc ggtggctacg cgcagagcga catgcagggt 120 gaagcgaaca aagctggcgg tttcaacctg aagtaccgct acgagcaaga caacaacccg 180 ctgggtgtta tcggttcttt cacctacacc gaaaaagatc gttctgaatc tggcgtttac 240 aaaaaaggcc agtactacgg catcaccgca ggtccggctt accgtctgaa cgactgggct 300 agcatctacg gcgtagtggg tgttggttac ggtaaattcc aggacaacag ctacccgaac 360 aaatctgata tgagcgacta cggtttctct tacggcgctg gtctgcagtt caacccgatc 420 gaaaacgttg ccctggactt ctcctacgag cagtctcgca ttcgtaacgt tgacgttggc 480 acctggattg ctggcgtagg ttaccgcttc taa 513 <210> 18 <211> 273 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 18 gtgaataaat ctcaactgat tgacaaaatt gctgccggtg cggacatttc taaagccgca 60 gctggacgtg cgttagatgc tttaatcgct tctgttactg aatctctgca ggctggagat 120 gacgttgcgc tggtagggtt tggtactttt gctgttaaag agcgcgctgc ccgtactggt 180 cgcaatccgc aaacaggcaa agaaatcacc attgctgctg ctaaagttcc gggtttccgc 240 gcaggtaaag cgctgaaaga cgcggtaaac tga 273 <210> 19 <211> 639 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 19 atggctgtcg ctgccaacaa acgttcggta atgacgctgt tttctggtcc tactgacatc 60 tatagccatc aggtccgcat cgtgctggcc gaaaaaggtg ttagttttga gatagaggcac 120 gtggagaagg acaacccgcc tcaggatctg attgacctca acccgaatca aagcgtaccg 180 acgcttgtgg atcgtgagct cactctgtgg gaatctcgca tcattatgga atatctggat 240 gagcgtttcc cgcatccgcc gctcatgccg gtttacccgg tggcgcgtgg ggaaagccgt 300 ctgtatatgc agcgtatcga aaaggactgg tattcgttga tgaataccat tcagaccggt 360 accgctgcgc aggctgatac tgcgcgtaag cagctgcgtg aagaactaca ggcgattgcg 420 ccagttttca cccagaagcc ctacttcctg agcgatgagt tcagcctggt ggactgctac 480 ctggcaccac tgctgtggcg tctgccggtt ctcggcgtag agctggtcgg cgctggcgcg 540 aaagagctta aaggctatat gactcgcgta tttgagcgcg actctttcct cgcttcttta 600 actgaagccg aacgtgaaat gcgtctcggt cggggctaa 639 <210> 20 <211> 204 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 20 atgggtgaga ttagtattac caaactgctg gtagtcgcag cgctgattat cctggtgttt 60 ggtaccaaaa agttacgcac gctgggtgga gacctgggct cggctatcaa aggctttaaa 120 aaagccatga gcgatgacga tgacagtgcg aagaagacca gtgctgaaga agcgccggca 180 cagaagctct ctcataaaga gtaa 204 <210> 21 <211> 609 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 21 atgaaagcgt taacgaccag gcagcaagag gtgtttgatc tcattcggga tcatatcagc 60 cagacgggca tgccgccgac gcgtgcggag attgctcagc gcttggggtt tcgctcccca 120 aacgcggcgg aagagcatct gaaagcgctg gcgcgtaaag gcgcaatcga gatcgtttcc 180 ggcgcctccc gcggtattcg tctgctgacg gaagaagaaa ccggtctgcc gcttattggc 240 cgcgtcgcgg caggtgagcc gctgctagcg cagcagcaca ttgaaggcca ctaccaggtg 300 gacccggcca tgtttaagcc gaacgccgat tttctgctgc gtgttagcgg tatgtcgatg 360 aaggatatcg gtattctcga tggcgacctg ctggctgtcc ataaaacgca ggatgtgcgc 420 aatggtcagg tggttgtggc gcgtatcgac gaagaagtga ccgtgaagcg tctgaaaaaa 480 cagggtaacg tcgtggaatt gctgccggaa aacagcgaat tctcgccgat cgtggtcgac 540 cttcgcgaac aaagctttac tattgaaggc ctggccgtcg gcgttatccg caacggcaac 600 tggcaataa 609 <210> 22 <211> 1245 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 22 atgaacgatt atctgccggg cgaaaccgct ctctggcagc gcattgaagg ctcactgaag 60 caggtgcttg gtagctacgg ttacagcgaa atccgtttgc cgattgtaga gcagaccccg 120 ttattcaaac gcgctatcgg cgaagtgacc gacgtggttg aaaaagagat gtacaccttt 180 gaggaccgta acggcgatag cctgactcta cgtccggaag gcacggctgg ctgcgtacgc 240 gccggtatcg aacatggtct cctgtacaat caagaacagc gcctgtggta cattgggccg 300 atgttccgcc acgaacgtcc gcaaaaaggc cgctaccgtc agttccacca gattggcgcc 360 gaagcgtttg gcctgcaggg gccggatatc gatgccgagc tgattatgct gaccgcccgc 420 tggtggcgcg agctgggcat ctccggccac gttgcgctgg agctgaactc tatcggttcg 480 ctggaggctc gcgctaacta tcgcgacgcg ctggtggcct atcttgagca gtttaaagat 540 aagctggacg aagactgcaa acgccgcatg tacaccaacc cgctgcgcgt gctggattct 600 aaaaacccgg acgtccaggc gctgctgaac gacgccccga cgctgggcga ctatcttgat 660 gaagagtcca aaacgcattt tgccgggctg tgcgcgctgc tggatgatgc cggtattcgc 720 tataccgtga atcagcgtct ggtacgcggt ctcgactact acaaccgcac cgtgtttgag 780 tgggtcacca ccagcctcgg ttcccagggc accgtctgcg ccggaggccg ttacgatggt 840 ctggttgagc agcttggcgg tcgcgctacc cctggcgtcg gctttgcgat ggggctggaa 900 cgtcttgttt tactggttca ggcagtgaat ccggaattta aagccgatcc tgttgtcgat 960 atatacctgg tagcctccgg aactgacacc cagtccgcag caatgcgtct ggctgaacag 1020 gtacgcgatg cgttacccgg cgttaagctg atgaccaacc atggcggcgg caactttaag 1080 aagcagtttg cgcgcgctga taaatggggc gctcgcgttg cgctggtgct gggcgaatca 1140 gaaatcgccg acggaaacgt ggtagtgaaa gatttacgct caggtgagca aactacccgta 1200 acgcaggata gcgttgctgc gcatttgcgc acacttctgg gttaa 1245 <210> 23 <211> 1413 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 23 atgaaaaaga ccaaaattgt ttgcaccatc ggtccgaaaa ccgaatccga agagatgttg 60 accaaaatgc tggacgcggg catgaacgtt atgcgtctga acttctctca cggtgactat 120 gcggaacacg gtcagcgcat ccagaatctg cgcaatgtga tgagtaaaac cggtaagaaa 180 gcggcaatcc tgctggacac caaaggtccg gaaatccgta cattaagct ggaaggcggc 240 aacgacgtct ccctgaaagc gggccagacc ttcaccttca ccaccgataa atccgttgtc 300 ggtaataacg aaatcgttgc ggtgacctat gaaggcttca ccagcgacct gagcgttggc 360 aacacggtac tggttgacga tggtctgatc ggtatggaag tgaccgctat cgaaggcaac 420 aaagttgttt gtaaagtgct gaacaacggc gacctcggcg agaacaaagg cgttaacctg 480 ccgggcgtat ctatcgcgct gccggcgctg gctgaaaaag acaaacagga tctgatcttc 540 ggttgcgaac agggcgttga ctttgttgcg gcatccttta tccgtaagcg ttctgacgtt 600 gttgaaatcc gtgagcacct gaaagcccac ggcggcgaga agatccagat catctccaaa 660 atcgaaaacc aggaaggcct gaacaacttc gacgaaatcc tcgaagcctc tgacggcatc 720 atggtagccc gtggcgacct gggcgttgaa atcccggttg aagaagttat cttcgcgcag 780 aagatgatga tcgagaaatg tatccgcgcg cgtaaagtcg ttatcaccgc gacccagatg 840 ctggattcca tgatcaaaaa cccgcgtccg acccgtgcgg aagcaggcga cgtggccaac 900 gccatcctcg acggcaccga cgcagttatg ctgtccggcg aatccgcgaa aggtaaatac 960 ccgctggaag cggtcaccat catggcgacc atctgcgaac gtaccgaccg cgtcatgacc 1020 agccgtcttg agtacaacaa cgacaaccgt aagctgcgca tcaccgaagc ggtgtgccgc 1080 ggtgcggtag aaacggctga aaaactggaa gcgccgctga tcgttgtggc aacccagggc 1140 ggtaaatccg cgcgcgccgt acgtaaatac ttcccggatg cactatcct ggcgctgacc 1200 accaacgaaa ccaccgcgcg tcagctggtg ctgagcaaag gcgttgtggc acagctggtt 1260 gaagatatct cctctaccga tgcgttctac atccagggta aagaactggc gctgcagagc 1320 ggtctggcgc gtaaaggcga cgtggttgtt atggttccg gcgcgttagt cccgagcgga 1380 accaccaata ccgcttccgt gcacgtgctg taa 1413 <210> 24 <211> 351 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 24 atgtatttaa gacccgatga ggtggcgcgt gttcttgaaa aagccggctt caccatggat 60 gttgtgacgc aaaaagcgta cggctatcgc cgtggcgata attatgtta tgtgaaccgt 120 gaagctcgta tggggcgtac cgcgttaatt attcatccgg ctttaaaaga gcgcagcaca 180 acgcttgcgg agcccgcgtc ggatatcaaa acctgcgatc attatgagca gttcccgctc 240 tatttagcgg gggatgctca acagcattat ggtattccac acgggttcag ttcgcgaatg 300 gcgcttgagc gttttctgag tggcctgttt ggcgaaacgc agtatagctg a 351 <210> 25 <211> 864 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 25 atggatagcg acattaatca ggtcattgat tcttttgtta aaggcccggc ggtcgtggga 60 aagattcgct tttccaccga gaccaggccg gcttctgaga atgcgctatg cgtcgattttt 120 ccgcgcctcg aaatcatgct tgcgggtcag cttcacgatc cggcgattaa agccgatcgc 180 gcccagctca tgccgcacga tgtgctgtat attcccgctg gcggatggaa tgacccgcaa 240 tggctggcgc cctccactct gctcactatc ttatttggta aacagcagct ggaattcgtc 300 ctgcgccact gggacggcag cgcgcttaac gtgctggata aacagcaggt tccgcgccgc 360 ggtccccggg tcggctcttt tctgctgcag gcgctgaatg aaatgcagat gcagccgcgg 420 gagcagcaca cggcccgctt tattgtcacc agcctgctca gccactgtgc cgatctgctg 480 ggcagccagg tacaaacctc atcgcgcagc caggcgcttt ttgaagcgat tcgtaagcat 540 attgacgccc actttgccga cccgttaacc cgggagtcgg tggcgcaggc gttttacctc 600 tcgccaaact atctatccca cctgttccag aaatgcgggc caatgggctt taacgagtat 660 ctgaatcaca tccgcctgga gcaggccaga atgctgttaa aaggccacga tatgaaagtg 720 aaagatatcg cccacgcctg cggttcgcc gacagcaact acttctgccg cctgtttcgc 780 aaaaacaccg aacgctcgcc gtcggagtat cgccgtcaat atcacagcca gctgacggaa 840 aaaacagccc cggcaaaaaa ctag 864 <210> 26 <211> 735 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 26 atgagttttg aaggaaaaat cgcgctggtt accggtgcaa gtcgcgggat tggccgcgca 60 atcgctgaaa cgctcgttgc ccgtggcgcg aaagttatcg ggactgcgac cagcgaaagc 120 ggcgcgcagg cgatcagcga ttatttaggt gctaacggta aaggtctgct gctgaatgtg 180 accgatcctg catctattga atctgttctg ggaaatattc gcgcagaatt tggtgaagtt 240 gatatcctgg tgaacaatgc cgggatcact cgtgataacc tgttaatgcg catgaaagat 300 gatgagtgga acgatattat cgaaaccaac ctgtcatctg tttccgtct gtcaaaagcg 360 gtaatgcgcg ctatgatgaa aaagcgtcat ggacgtatta tcactatcgg ttctgtggtt 420 ggtaccatgg gaaatgcggg tcaggccaac tacgctgcgg cgaaagcggg tctgattggc 480 ttcagtaaat cactggctcg cgaagttgcg tcccgcggta ttactgtaaa cgttgttgct 540 ccgggcttta ttgaaacgga catgacgcgt gcgctgaccg atgagcagcg tgcgggtacg 600 ctggcggcag ttcctgcggg gcgcctcggc tctccaaatg aaatcgccag tgcggtggca 660 tttttagcct ctgacgaagc gagttacatc accggtgaaa ctctgcacgt caacggcgga 720 atgtatatgg tctga 735 <210> 27 <211> 71 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic oligonucleotide <400> 27 atgcccggct cgtctcgtaa ggtaccggca tggttgccga tactggttat tttaatcgcc 60 atgatttcca t 71 <210> 28 <211> 2355 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 28 atgaatcctg agcgttctga acgcattgaa atccccgtat tgccgttgcg cgatgtggtg 60 gtttatccgc acatggtcat acccctgttt gtagggcggg aaaaatctat ccgttgtctc 120 gaagcagcca tggaccatga taaaaaaatc atgctggttg cgcagaaaga agcctcgacg 180 gatgagccgg gtgtaaacga tcttttcacc gtcgggaccg tggcgtctat tttgcaaatg 240 ctgaagctac cggacggtac tgttaaagtg ctggtcgaag gtttgcagcg cgcgcgcatc 300 tctgcgctgt ctgataatgg cgaacatttt tcggcgaagg cggaatacct tgaatcgccg 360 gcgattgacg aacgcgagca ggaagtgctg gttcgtaccg ctatcagcca gtttgaaggc 420 tacatcaagc tgaacaaaaa aatccctccg gaagtgctga cgtcgctgaa tagcatcgac 480 gatccggcgc gtctggcgga taccatcgct gcgcatatgc cgctgaagct ggcggacaaa 540 cagtccgtgc tggagatgtc cgacgttaac gagcgtctgg aatatctgat ggcgatgatg 600 gagtcggaaa tcgatctgct gcaggtggag aagcgtattc gcaaccgcgt gaaaaagcag 660 atggagaaat ctcagcgcga gtactatctg aatgagcaaa tgaaagccat tcaaaaagag 720 ctcggcgaga tggacgacgc cccggacgag aacgaagcgc tgaagcgtaa gatcgacgcg 780 gcgaaaatgc cgaaagaggc aaaagagaaa accgaagcgg aactgcaaaa actgaaaatg 840 atgtccccga tgtcggcgga agcgaccgtc gttcgcggct acatcgactg gatggtgcag 900 gtaccgtgga acgctcgcag caaggttaaa aaagacctgc gtcaggctca ggagatcctc 960 gataccgatc actacggcct tgagcgcgtg aaggatcgca ttcttgagta cctcgcggtg 1020 cagagccgtg ttaacaagct caaagggccg atcctgtgcc tggttgggcc tccgggggta 1080 ggtaaaacct ctctcggcca atccatcgcc aaagcaactg gacgcaaata tgtgcgtatg 1140 gcgctgggcg gcgtgcgtga tgaagcggaa atccgcggtc accgccgtac ctatattggc 1200 tcaatgccgg gcaaactgat ccagaaaatg gctaaagtgg gcgttaaaaa cccgctgttc 1260 ttgctggatg agatcgacaa gatgtcttct gacatgcgcg gcgatccggc ctcggcgctg 1320 ctggaggtgt tggatccgga acagaacgtg gcctttaacg accactatct ggaagtggat 1380 tacgatctca gcgacgtgat gttcgttgcg acctctaact ccatgaacat cccggcgccg 1440 ctgctggatc gtatggaagt gatccgcctc tccggctata ccgaagatga gaagctaaac 1500 atcgccaaac gccatctgct gtcaaaacag attgagcgta acgcgctcaa gaaaggcgag 1560 ctgacggtgg atgacagcgc gattatcggc atcattcgct actacacccg tgaagcaggc 1620 gtgcgtggtc tggagcgtga aatctcgaaa ctgtgccgca aagcggtgaa acagctgctg 1680 ctggataagt cgctgaaaca catcgagatt aacggcgaca acctgcacga tttccttggc 1740 gtgcagcgct acgactatgg tcgtgcggat agcgaaaacc gcgtaggtca ggtgaccgga 1800 ctggcgtgga cggaagtggg cggcgatctg ctgaccattg aaaccgcctg cgttccgggt 1860 aaaggcaaac tgacctacac cggttcactg ggtgaagtca tgcaggaatc catccaggcg 1920 gcgctgacgg tggttcgttc acgtgcggat aagctgggta ttaactcaga cttttacgaa 1980 aaacgtgata ttcacgttca cgtgccggaa ggcgcgacgc cgaaggatgg tccaagcgcc 2040 ggtatcgcga tgtgcaccgc gctggtttcc tgtctgacgg gtaatccggt acgcgccgac 2100 gtggcgatga ccggtgagat taccctccgt ggccaggtat tgccgattgg tggtctgaag 2160 gaaaaactgt tggccgcgca tcgcggcggc attaagactg ttctgattcc tgatgaaaat 2220 aaacgcgacc ttgaagaaat tccggataac gttatcgccg atttagatat ccatccggtg 2280 aaacgaatcg aggaagttct ggcacttgcg ctacagaacg aaccgtttgg aatggaagtc 2340 gtcacggcaa aatag 2355 <210> 29 <211> 393 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 29 atggctgaaa atcaatacta cggcaccggt cgccgcaaaa gttccgcagc tcgcgttttc 60 atcaaaccgg gcaacggtaa aatcgttatc aaccagcgtt ctctggaaca gtacttcggt 120 cgtgaaactg cccgcatggt agttcgtcag ccgctggaac tggtcgacat ggttgagaaa 180 ttagatctgt acatcaccgt taaaggtggt ggtatctctg gtcaggctgg tgcgatccgt 240 cacggtatca cccgcgctct gatggagtac gacgagtccc tgcgtggcga actgcgtaaa 300 gctggtttcg ttactcgtga tgctcgtcag gttgaacgta agaaagtcgg cctgcgtaaa 360 gcacgtcgtc gtcctcagtt ctccaaacgt taa 393 <210> 30 <211> 789 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 30 atgtttgttg ctgccggaca atttgccgta acgccggact ggacgggaaa cgcgcagacc 60 tgcgtcagca tgatgcgcca ggccgcggag cggggggcgt cgcttctggt tctgcctgag 120 gcgttgctgg cgcgagacga taacgatgcg gatttatcgg ttaaatccgc ccagcagctg 180 gatggcggct tcttacagct cttgctggcg gagagcgaaa acagcgcttt gacgacggtg 240 ctgaccctgc atatcccttc cggcgaaggt cgagcgacga atacgctggt ggccctgcgt 300 caggggaaga ttgtggcgca atatcagaaa ctgcatctct atgatgcgtt caatatccag 360 gaatccaggc tggtcgatgc cgggcggcaa attccgccgc tgatcgaagt cgacgggatg 420 cgcgtcgggc tgatgacctg ctacgattta cgtttccctg agctggcgct gtcgttagcg 480 ctcagcggcg cgcagctcat agtgttgcct gccgcgtggg taaaagggcc gctgaaggaa 540 catcactggg cgacgctgct ggcggcgcgg gcgctggata caacctgcta tattgtcgcc 600 gcaggagagt gcgggacgcg taatatcggt caaagccgta ttatcgaccc cttagggaca 660 acgcttgccg gggcgggaga gcggccgcag ttgatttttg ccgaactttc agctgattat 720 attcagcagg tacgcgagcg cctgccggtg ttgcgcaatc gccgctttgc gccaccgcaa 780 ttattatga 789 <210> 31 <211> 369 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 31 atggccaata ataccactgg gttaacccga attattaaag cggccgggta ttcctggaaa 60 ggattccgtg cggcgtgggt caatgaggcc gcatttcgtc aggaaggcat cgcggccgtt 120 attgccgtgg cgatcgcctg ctggttggac gtcgatgcca tcacgcgggt gctgctcatt 180 agctcggtcc tgttagtgat gatagttgaa attatcaata gcgcgattga ggcggtggtt 240 gaccgtatcg gtcccgagca tcatgagctt tcggggcgag cgaaagatat gggatcggcg 300 gcggtactgc tggcgattat catcgcgctg atcgcgtggg gaacgctgct gtgggcgaac 360 taccgctaa 369 <210> 32 <211> 1122 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 32 atgcataacc aggctccgat tcaacgtaga aaatcaaaac gaatttacgt tgggaatgtg 60 ccgattggcg atggcgcccc catcgccgta cagcgatga caaacacgcg caccaccgat 120 gtggcggcga cggtaaatca attaaagcc ctcgagcgcg ttggcgcgga tatcgtgcgc 180 gttcggtgc cgacgatgga tgcggcggaa gcgttcaaac tttcaaaca gcaggttaac 240 gtcccgctgg ttgccgatat ccacttcgat taccgcattg cgctgaaggt agcggaatac 300 ggcgttgatt gcctgcgtat taacccgggc aatacggca acgaagagcg tatccgcatg 360 gtggtggact gcgctcgcga taaaatatt cctatccgta tcggggtaaa cgccggttct 420 ctggaaaaag atctccagga aaatacggc gaaccgactc cgcaggcgct gctggaatcg 480 gcaatgcgcc atgttgatca tctcgatcgt ctcaacttcg atcagtttaa agtcagcgta 540 aaagcctccg atgtgttcct cgcggttgaa tcctatcgcc tgttggcgaa acagatcgat 600 cagcctctgc acctcgggat caccgaagcg ggcggcgcgc gcagcggcgc ggtgaagtcc 660 gcgatcggcc tcggcctgct gctgtctgaa gggattggcg atacgctgcg cgtctctctg 720 gcggcggatc ccgttgaaga gatcaaagtg ggcttcgata ttctcaagtc gctgcgtatt 780 cgctctcgcg ggatcaactt tattgcctgc ccgacctgtt cacgtcagga gtttgacgtt 840 atcggtaccg ttaacgcgct ggagcagcgc ctggaagata tcattacgcc gatggatatt 900 tcgatcattg gctgcgtggt aaacggtccc ggcgaggcgc tggtttccac cctcggcgta 960 accggcggca ataagaaaag cggcctgtac gaagacggcg tacgtaaaga caggctggat 1020 aacgacgata tgatcgatca gctggaagcg cgtattcgcg ctaaagcatc gatgctggat 1080 gaggcgcgtc gtatcgatat ccagcaggtt gaagcgaaat aa 1122 <210> 33 <211> 876 <212> DNA <213> Artificial Array <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 33 atgagccata ttcaacggga aacgtcttgc tccaggccgc gattaaattc caacatggat 60 gctgattat atgggtataa atgggctcgc gataatgtcg ggcaatcagg tgcgacaatc 120 tatcgattgt atgggaagcc cgatgcgcca gagttgtttc tgaaacatgg caaaggtagc 180 gttgccaatg atgttacaga tgagatggtc agactaaact ggctgacgga attatgcct 240 cttccgacca tcaagcattt tatccgtact cctgatgatg catggttact caccactgcg 300 atccccggga aaacagcatt ccaggtatta gaagaatatc ctgattcagg tgaaaatatt 360 gttgatgcgc tggcagtgtt cctgcgccgg ttgcattcga ttcctgtttg taattgtcct 420 tttaacagcg atcgcgtatt tcgtctcgct caggcgcaat cacgaatgaa taacggtttg 480 gttgatgcga gtgatttga tgacgagcgt aatggctggc ctgttgaaca agtctggaaa 540 gaaatgcata agcttttgcc attctcaccg gattcagtcg tcactcatgg tgatttctca 600 cttgataacc ttatttttga cgaggggaaa ttaataggtt gtattgatgt tggacgagtc 660 ggaatcgcag accgatacca ggatcttgcc atcctatgga actgcctcgg tgagttttct 720 ccttcattac agaaacggct ttttcaaaaa tatggtattg ataatcctga tatgaataaa 780 ttgcagtttc atttgatgct cgatgagttt ttctaataag cctgcctggt tctgcgtttc 840 ccgctcttta ataccctgac cggaggtgag caatga 876 <210> 34 <211> 1491 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 34 atgagcatca cggcgttatc agcatcattt cctgagggga atatcgccag ccgcttgtcg 60 ctgcaacatc cttcactgtt ttataccgtg gttgaacaat cttcggtggc gagcgtgttg 120 agtcatcctg actagctgag atgagggctc gccccctcgt cccgacactt ccagatcgcc 180 atagcgcaca gcgcctcgag cggtggtaac ggcgcagtgg cggttttcat ggcttgttat 240 gactgttttt ttggggtaca gtctatgcct cgggcatcca agcagcaagc gcgttacgcc 300 gtgggtcgat gtttgatgtt atggagcagc aacgatgtta cgcagcaggg cagtcgccct 360 aaaacaaagt taaacatcat gagggaagcg gtgatcgccg aagtatcgac tcaactatca 420 gaggtagttg gcgtcatcga gcgccatctc gaaccgacgt tgctggccgt acatttgtac 480 ggctccgcag tggatggcgg cctgaagcca cacagtgata ttgatttgct ggttacggtg 540 accgtaaggc ttgatgaaac aacgcggcga gctttgatca acgacctttt ggaaacttcg 600 gcttcccctg gagagagcga gattctccgc gctgtagaag tcaccattgt tgtgcacgac 660 gacatcattc cgtggcgtta tccagctaag cgcgaactgc aatttggaga atggcagcgc 720 aatgacattc ttgcaggtat cttcgagcca gccacgatcg acattgatct ggctatcttg 780 ctgacaaaag caagagaaca tagcgttgcc ttggtaggtc cagcggcgga ggaactcttt 840 gatccggttc ctgaacagga tctatttgag gcgctaaatg aaaccttaac gctatggaac 900 tcgccgccccg actgggctgg cgatgagcga aatgtagtgc ttacgttgtc ccgcatttgg 960 tacagcgcag taaccggcaa aatcgcgccg aaggatgtcg ctgccgactg ggcaatggag 1020 cgcctgccgg cccagtatca gcccgtcata cttgaagcta gacaggctta tcttggacaa 1080 gaagaatc gcttggcctc gcgcgcagat cagttggaag aatttgtcca ctacgtgaaa 1140 ggcgagatca ccaaggtagt cggcaaataa tgtctaacaa ttcgttcaag ccgacgccgc 1200 ttcgcggcgc ggcttaactc aagcgttaga tgcactaagc acataattgc tcacagccaa 1260 actatcaggt caagtctgct tttattattt ttaagcgtgc samaaagcc ctacacaaat 1320 ggtacccgac cggtggtgaa tttaatctcg ctgacgtgta gacattccct tatccagacg 1380 ctgatcgccc atcatcgcgg ttctttagat ctctcggtcc gccctgatgg cggcaccttg 1440 ctgacgttac gcctgccggt acagcaggtt atcaccggag gcttaaaatg a 1491 <210> 35 <211> 1021 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 35 ctgatccttc aactcagcaa aagttcgatt tattcaacaa agccacgttg tgtctcaaaa 60 tctctgatgt tacattgcac aagataaaaa tatatcatca tgaacaataa aactgtctgc 120 ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc 180 caggccgcga ttaaattcca acatggatgc tgatttatat gggtataaat gggctcgcga 240 taatgtcggg caatcaggtg cgacaatcta tcgattgtat gggaagcccg atgcgccaga 300 gttgtttctg aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtcag 360 actaaactgg ctgacggaat ttatgcctct tccgaccatc aagcatttta tccgtactcc 420 tgatgatgca tggttactca ccactgcgat ccccgggaaa acagcattcc aggtattaga 480 agaatatcct gattcaggtg aaaatattgt tgatgcgctg gcagtgttcc tgcgccggtt 540 gcattcgatt cctgtttgta attgtccttt taacagcgat cgcgtatttc gtctcgctca 600 ggcgcaatca cgaatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa 660 tggctggcct gttgaacaag tctggaaaga aatgcataag cttttgccat tctcaccgga 720 ttcagtcgtc actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt 780 aataggttgt attgatgttg gacgagtcgg aatcgcagac cgataccagg atcttgccat 840 cctatggaac tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata 900 tggtattgat aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt 960 ctaataagcc ttgaccctac gattcccgct atttcattca ctgaccggag gttcaaaatg 1020 to 1021 <210> 36 <211> 1071 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 36 atgaagatag caacaatgaa aacaggtctg ggagcgttgg ctcttcttc ctgatccttc 60 aactcagcaa aagttcgatt tattcaacaa agccacgttg tgtctcaaaa tctctgatgt 120 tacattgcac aagataaaaa tatatcatca tgaacaataa aactgtctgc ttacataaac 180 agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc ccgtccgcgc 240 ttaaactcca acatggacgc tgatttatat gggtataaat gggctcgcga taatgtcggg 300 caatcaggtg cgacaatcta tcgcttgtat gggaagcccg atgcgccaga gttgtttctg 360 aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtccg tctcaactgg 420 ctgacggagt ttatgcctct cccgaccatc aagcatttta tccgtactcc tgatgatgcg 480 tggttactca ccaccgcgat tcctgggaaa acagccttcc aggtattaga agaatatcct 540 gattcaggtg aaaatattgt tgatgcgctg gccgtgttcc tgcgccggtt acattcgatt 600 cctgtttgta attgtccttt taacagcgat cgtgtatttc gtcttgctca ggcgcaatca 660 cgcatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa tggctggcct 720 gttgaacaag tctggaaaga aatgcacaag ctcttgccat tctcaccgga ttcagtcgtc 780 actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt aataggttgt 840 attgatgttg gacgggtcgg aatcgcagac cgttaccagg accttgccat tctttggaac 900 tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata tggtattgat 960 aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt ctaataagcc 1020 tgtgaagggc tggacgtaaa cagccacggc gaaaacgcct acaacgcctg a 1071 <210> 37 <211> 1071 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 37 atgaccctga atatgatgct cgataacgcc gtacccgagg cgattgccgg ctgatccttc 60 aactcagcaa aagttcgatt tattcaacaa agccacgttg tgtctcaaaa tctctgatgt 120 tacattgcac aagataaaaa tatatcatca tgaacaataa aactgtctgc ttacataaac 180 agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc ccgtccgcgc 240 ttaaactcca acatggacgc tgatttatat gggtataaat gggctcgcga taatgtcggg 300 caatcaggtg cgacaatcta tcgcttgtat gggaagcccg atgcgccaga gttgtttctg 360 aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtccg tctcaactgg 420 ctgacggagt ttatgcctct cccgaccatc aagcatttta tccgtactcc tgatgatgcg 480 tggttactca ccaccgcgat tcctgggaaa acagccttcc aggtattaga agaatatcct 540 gattcaggtg aaaatattgt tgatgcgctg gccgtgttcc tgcgccggtt acattcgatt 600 cctgtttgta attgtccttt taacagcgat cgtgtatttc gtcttgctca ggcgcaatca 660 cgcatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa tggctggcct 720 gttgaacaag tctggaaaga aatgcacaag ctcttgccat tctcaccgga ttcagtcgtc 780 actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt aataggttgt 840 attgatgttg gacgggtcgg aatcgcagac cgttaccagg accttgccat tctttggaac 900 tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata tggtattgat 960 aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt ctaataagcc 1020 ttggttctgc gtttcccgct ctttaatacc ctgaccggag gtgagcaatg a 1071 <210> 38 <211> 426 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 38 atgaccctga atatgatgat ggatgccggc ggacatcatc gcgacaaaca atattaatac 60 cggcaaccac accggcaatt tacgagactg cgcaggcatc ctttctcccg tcaatttctg 120 tcaaataaag taaaagaggc agtctacttg attaccccc ggctggttga gcgtttgttg 180 aaaaaaagta actgaaaaat ccgtagaata gcgccactct gatggttaat taacctattc 240 aattaagaat tatctggatg aatgtgccat taaatgcgca gcataatggt gcgttgtgcg 300 ggaaaactgc tttttttga aagggttggt cagtagcgga aacaactcac ttcacacccc 360 gaagggggaa gttgcctgac cctacgattc ccgctatttc attcactgac cggaggttca 420 aatga 426 <210> 39 <211> 446 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 39 atgaccctga atatgatgat ggatgccggc tcaccacggc gataaccata ggttttcggc 60 gtggccacat ccatggtgaa tcccacttt tccagcacgc gcgccacttc atcgggtctt 120 aaatacatag attttcctcg tcatctttcc aaagcctcgc caccttacat gactgagcat 180 ggaccgtgac tcagaaaatt ccacaaacga acctgaaagg cgtgattgcc gtctggcctt 240 aaaaattatg gtctaaacta aaatttacat cgaaaacgag ggaggatcct atgtttaaca 300 aaccgaatcg ccgtgacgta gatgaaggtg ttgaggatat taaccacgat gttaaccagc 360 tcgaactcac ttcacacccc gaagggggaa gttgcctgac cctacgattc ccgctatttc 420 attcactgac cggaggttca aaatga 446 <210> 40 <211> 452 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 40 atgaccctga atatgatgat ggatgccggc tgacgaggca ggttacatca ctggtgaaac 60 cctgcacgtc aatggcggaa tgtatatggt ttaaccacga tgaaaattat ttgcgttatt 120 agggcgaaag gcctcaaaat agcgtaaaat cgtggtaaga actgccggga tttagttgca 180 aatttttcaa cattttatac actacgaaaa ccatcgcgaa agcgagtttt gataggaaat 240 ttaagagtat gagcactatc gaagaacgcg ttaagaaaat tatcggcgaa cagctgggcg 300 ttaagcagga agaagttacc aacaatgctt ccttcgttga agacctgggc gctgattctc 360 ttgacaccga actcacttca caccccgaag ggggaagttg cctgacccta cgattcccgc 420 tatttcattc actgaccgga ggttcaaaat ga 452 <210> 41 <211> 461 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 41 atgaccctga atatgatgat ggatgccggc cgtcctgtaa tataaccgg acaattcgga 60 ctgattaaaa aagcgccctt gtggcgcttt ttttatattc ccgcctccat ttaaaataaa 120 aaatccaatc ggatttcact atttaaactg gccattatct aagatgaatc cgatggaagc 180 tcgctgtttt aacacgcgtt ttttaacctt tttattgaaag tcggtgcttc tttgagcgaa 240 cgatcaaatt taagtggatt cccatcaaaa aaatattctc aacctaaaaa agtttgtgta 300 atacttgtaa cgctacatgg agattaactc aatctagagg gtattaataa tgaatcgtac 360 taaactggta ctgggcgcaa ctcacttcac accccgaagg gggaagttgc ctgaccctac 420 gattcccgct atttcattca ctgaccggag gttcaaaatg a 461 <210> 42 <211> 463 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 42 atgaccctga atatgatgat ggatgccggc atattgacac catgacgcgc gtaatgctga 60 ttggttctgt gacgctggta atgattgtcg aaattctgaa cagtgccatc gaagccgtag 120 tagaccgtat tggtgcagaa ttccatgaac tttccgggcg ggcgaaggat atggggtcgg 180 cggcggtgct gatgtccatc ctgctggcga tgtttacctg gatcgcatta ctctggtcac 240 attttcgata acgcttccag aattcgataa cgccctggtt ttttgcttaa atttggttcc 300 aaaatcgcct ttagctgtat atactcacag cataactgta tatacaccca gggggcggga 360 tgaaagcatt aacggccagg aactcacttc acaccccgaa gggggaagtt gcctgaccct 420 acgattcccg cctatttcatt cactgaccgg aggttcaaaa tga 463 <210> 43 <211> 428 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 43 atgaccctga atatgatgat ggatgccggc atcatattgc gctccctggt tatcatttgt 60 tactaaatga aatgttataa tataacaatt ataaatacca catcgctttc aattcaccag 120 ccaaatgaga ggagcgccgt ctgacatagc cagcgctata aaacatagca ttatctatat 180 gtttatgatt aataactgat ttttgcgttt tggatttggc tgtggcatcc ttgccgctct 240 tttcgcagcg tctgcgtttt tgccctccgg tcagggcatt taagggtcag caatgagttt 300 ttacgcaatt acgattcttg ccttcggcat gtcgatggat gctttaactc acttcacacc 360 ccgaaggggg aagttgcctg accctacgat tcccgctatt tcattcactg accggaggtt 420 caaaatga 428 <210> 44 <211> 452 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 44 atgaccctga atatgatgat ggatgccggc cgcgtcaggt tgaacgtaaa aaagtcggtc 60 tgcgcaaagc acgtcgtcgt ccgcagttct ccaaacgtta attggttct gcttcggcag 120 aacgattggc gaaaaaaccc ggtgcgaacc gggttttttt atggataaag atcgtgttat 180 ccacagcaat ccattgatta tctcttcttt ttcagcattt ccagaatccc ctcaccacaa 240 agcccgcaaa atctggtaaa ctatcatcca atttctgcc caaatggctg ggattgttca 300 ttttttgttt gccttacaac gagagtgaca gtacgcgcgg gtagttaact caacatctga 360 ccggtcgata actcacttca cacccgaag ggggaagttg cctgacccta cgattcccgc 420 tatttcattc actgaccgga ggttcaaaat ga 452 <210> 45 <211> 410 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 45 atgaccctga atatgatgat ggatgccggc cctgtatgaa gatggcgtgc gcaaagatcg 60 cctggataac agcgatatga ttagccagct tgaagcccgc attcgcgcga aagcgtcaat 120 gctggacgaa gcgcgtcgta tcgatgtgca acaggtagaa aaataaggtt gctgggaagc 180 ggcaggcttc ccgtgtatga tgaacccgcc cggcgcgacc cgttgttcgt cgcggcccg 240 agggttcatt ttttgtatta ataaagagaa taaacgtggc aaaaaatatt caagccattc 300 gcggcatgaa cgattatctg cctggcgaac tcacttcaca ccccgaaggg ggaagttgcc 360 tgaccctacg attcccgcta tttcattcac tgaccggagg ttcaaaatga 410 <210> 46 <211> 1071 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 46 atgaaaaaga ttgatgcgat tattaaacct ttcaaactgg atgacgtgcg ctgatccttc 60 aactcagcaa aagttcgatt tattcaacaa agccacgttg tgtctcaaaa tctctgatgt 120 tacattgcac aagataaaaa tatatcatca tgaaacaataa aactgtctgc ttacataaac 180 agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc ccgtccgcgc 240 ttaaactcca acatggacgc tgattttat gggtataaat gggctcgcga taatgtcggg 300 caatcaggtg cgacaatcta tcgcttgtat gggaagcccg atgcgccaga gttgtttctg 360 aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtccg tctcaactgg 420 ctgacggagt ttatgcctct cccgaccatc aagcatttta tccgtactcc tgatgatgcg 480 tggttactca ccaccgcgat tcctgggaaa acagccttcc aggtattaga agaatatcct 540 gattcaggtg aaaatattgt tgatgcgctg gccgtgttcc tgcgccggtt acattcgatt 600 cctgtttgta attgtccttt taacagcgat cgtgtatttc gtcttgctca ggcgcaatca 660 cgcatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa tggctggcct 720 gttgaacaag tctggaaaga aatgcacaag ctcttgccat tctcaccgga ttcagtcgtc 780 actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt aataggttgt 840 attgatgttg gacgggtcgg aatcgcagac cgttaccagg accttgccat tctttggaac 900 tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata tggtattgat 960 aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt ctaataagcc 1020 tcgcgcgtga ttcgtatccg caccggcgaa gaagacgacg cggcgattta a 1071 <210> 47 <211> 1295 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 47 atgaccatga acctgatgac ggatgtcgtc tcagccaccg ggatcgccgg gttgctttca 60 cgacaacacc cgacgctgtt ttttacacta attgaacagg cccccgtggc gatcacgctg 120 acggataccg ctgcccgcat tgtctatgcc aacccgggcg tgttgagtca tcctgactag 180 ctgagatgag ggctcgcctg atccttcaac tcagcaaaag ttcgatttat tcaacaaagc 240 cacgttgtgt ctcaaaatct ctgatgttac attgcacaag ataaaaatat atcatcatga 300 acaataaaac tgtctgctta cataaacagt aatacaaggg gtgttatgag ccatattcaa 360 cgggaaacgt cttgctccag gccgcgatta aattccaaca tggatgctga tttatatggg 420 tataaatggg ctcgcgataa tgtcgggcaa tcaggtgcga caatctatcg attgtatggg 480 aagcccgatg cgccagagtt gtttctgaaa catggcaaag gtagcgttgc caatgatgtt 540 acagatgaga tggtcagact aaactggctg acggaattta tgcctcttcc gaccatcaag 600 cattttatcc gtactcctga tgatgcatgg ttactcacca ctgcgatccc cgggaaaaca 660 gcattccagg tattagaaga atatcctgat tcaggtgaaa atattgttga tgcgctggca 720 gtgttcctgc gccggttgca ttcgattcct gtttgtaatt gtccttttaa cagcgatcgc 780 gtatttcgtc tcgctcaggc gcaatcacga atgaataacg gtttggttga tgcgagtgat 840 tttgatgacg agcgtaatgg ctggcctgtt gaacaagtct ggaaagaaat gcataagctt 900 ttgccattct caccggattc agtcgtcact catggtgatt tctcacttga taaccttatt 960 tttgacgagg ggaaattaat aggttgtatt gatgttggac gagtcggaat cgcagaccga 1020 taccaggatc ttgccatcct atggaactgc ctcggtgagt tttctcctt attacagaaa 1080 cggctttttc aaaaatatgg tattgataat cctgatatga ataaattgca gtttcatttg 1140 atgctcgatg agttttcta ataagcctga ccggtggtga atttaatctc gctgacgtgt 1200 agacattcat cgatctgcat ccacggtccg gcggcggtac ctgcctgacg ctacgtttac 1260 cgctctttta tgaactgacc ggaggcccaa gatga 1295 <210> 48 <211> 1491 <212> DNA <213> Artificial Array <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 48 atgagcatca cggcgttatc agcatcattt cctgagggga atatcgccag ccgcttgtcg 60 ctgcaacatc cttcactgtt ttataccgtg gttgaacaat cttcggtggc gagcgtgttg 120 agtcatcctg actagctgag atgagggctc gccccctcgt cccgacactt ccagatcgcc 180 atagcgcaca gcgcctcgag cggtggtaac ggcgcagtgg cggttttcat ggcttgttat 240 gactgttttt ttggggtaca gtctatgcct cgggcatcca agcagcaagc gcgttacgcc 300 gtgggtcgat gtttgatgtt atggagcagc aacgatgtta cgcagcaggg cagtcgccct 360 aaaaaaagt taaacatcat gaggaagcg gtgatcgccg aagtatcgac tcaactatca 420 gaggtagttg gcgtcatcga gcgccatctc gaaccgacgt tgctggccgt acatttgtac 480 ggctccgcag tggatggcgg cctgaagcca cacagtgata ttgatttgct ggttacggtg 540 accgtaaggc ttgatgaaac aacgcgggcga gctttgatca acgacctttt ggaaacttcg 600 gcttcccctg gagagagcga gattctccgc gctctagaag tcaccattgt tgtgcacgac 660 gacatcattc cgtggcgtta tccagctaag cgcgaactgc aatttggaga atggcagcgc 720 aatgacattc ttgcaggtat cttcgagcca gccacgatcg acattgatct ggctatcttg 780 ctgacaaaag caagagaaca tagcgttgcc ttggtaggtc cagcggcgga ggaactcttt 840 gatccggttc ctgaacagga tctatttgag gcgctaaatg aaaccttaac gctatggaac 900 tcgccgccccg actgggctgg cgatgagcga aatgtagtgc ttacgttgtc ccgcatttgg 960 tacagcgcag taaccggcaa aatcgcgccg aaggatgtcg ctgccgactg ggcaatggag 1020 cgcctgccgg cccagtatca gcccgtcata cttgaagcta gacaggctta tcttggacaa 1080 gaagaagatc gcttggcctc gcgcgcagat cagttggaag aatttgtcca ctacgtgaaa 1140 ggcgagatca ccaaggtagt cggcaaataa tgtctaacaa ttcgttcaag ccgacgccgc 1200 ttcgcggcgc ggcttaactc aagcgttaga tgcactaagc acataattgc tcacagccaa 1260 actatcaggt caagtctgct tttattattt ttaagcgtgc ataataagcc ctacacaaat 1320 ggtacccgac cggtggtgaa tttaatctcg ctgacgtgta gacattccct tatccagacg 1380 ctgatcgccc atcatcgcgg ttctttagat ctctcggtcc gccctgatgg cggcaccttg 1440 ctgacgttac gcctgccggt acagcaggtt atcaccggag gcttaaaatg a 1491 <210> 49 <211> 1021 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 49 ctgatccttc aactcagcaa aagttcgatt tattcaacaa agccacgttg tgtctcaaaa 60 tctctgatgt tacattgcac aagataaaaa tatatcatca tgaacaataa aactgtctgc 120 ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc 180 caggccgcga ttaaattcca acatggatgc tgatttatat gggtataaat gggctcgcga 240 taatgcggg caatcaggtg cgacaatcta tcgattgtat gggaagcccg atgcgccaga 300 gttgtttctg aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtcag 360 actaaactgg ctgacggaat tttgcctct tccgaccatc aagcatttta tccgtactcc 420 tgatgatgca tggttactca ccactgcgat ccccgggaaa acagcattcc aggtattaga 480 agaatatcct gattcaggtg aaaatattgt tgatgcgctg gcagtgttcc tgcgccggtt 540 gcattcgatt cctgtttgta attgtccttt taacagcgat cgcgtatttc gtctcgctca 600 ggcgcaatca cgaatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa 660 tggctggcct gttgaacaag tctggaaaga aatgcataag cttttgccat tctcaccgga 720 ttcagtcgtc actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt 780 aataggttgt attgatgttg gacgagtcgg aatcgcagac cgataccagg atcttgccat 840 cctatggaac tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata 900 tggtattgat aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt 960 ctaataagcc ttgaccctac gattcccgct atttcattca ctgaccggag gttcaaaatg 1020 a 1021 <210> 50 <211> 1071 <212> DNA <213> Artificial Array <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 50 atgaccctga atatgatgct cgataacgcc gtacccgagg cgattgccgg ctgatccttc 60 aactcagcaa aagttcgatt tattcaacaa agccacgttg tgtctcaaaa tctctgatgt 120 tacattgcac aagataaaaa tatatcatca tgaacaataa aactgtctgc ttacataaac 180 agtaatacaa ggggtgttat gagccatatt caacgggaaa cgtcttgctc ccgtccgcgc 240 ttaaactcca acatggacgc tgatttatat gggtataaat gggctcgcga taatgtcggg 300 caatcaggtg cgacaatcta tcgcttgtat gggaagcccg atgcgccaga gttgtttctg 360 aaacatggca aaggtagcgt tgccaatgat gttacagatg agatggtccg tctcaactgg 420 ctgacggagt tttgcctct cccgaccatc aagcatttta tccgtactcc tgatgatgcg 480 tggttactca ccaccgcgat tcctgggaaa acagccttcc aggtattaga agaatatcct 540 gattcaggtg aaaatattgt tgatgcgctg gccgtgttcc tgcgccggtt acattcgatt 600 cctgtttgta attgccttt taacagcgat cgtgtatttc gtcttgctca ggcgcaatca 660 cgcatgaata acggtttggt tgatgcgagt gattttgatg acgagcgtaa tggctggcct 720 gttgaacaag tctggaaaga aatgcacaag ctcttgccat tctcaccgga ttcagtcgtc 780 actcatggtg atttctcact tgataacctt atttttgacg aggggaaatt aataggttgt 840 attgatgttg gacgggtcgg aatcgcagac cgttaccagg accttgccat tctttggaac 900 tgcctcggtg agttttctcc ttcattacag aaacggcttt ttcaaaaata tggtattgat 960 aatcctgata tgaataaatt gcagtttcat ttgatgctcg atgagttttt ctaataagcc 1020 ttggttctgc gtttcccgct cttaatacc ctgaccggag gtgagcaatg a 1071 <210> 51 <211> 461 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 51 atgaccctga atatgatgat ggatgccggc cgtcctgtaa tataaccgg acaattcgga 60 ctgattaaaa aagcgccctt gtggcgcttt ttttatattc ccgcctccat ttaaaataaa 120 aaatccaatc ggatttcact atttaaactg gccattatct aagatgaatc cgatggaagc 180 tcgctgtttt aacacgcgtt ttttaacctt ttattgaaag tcggtgcttc tttgagcgaa 240 cgatcaaatt taagtggatt cccatcaaaa aaatattctc aacctaaaaa agtttgtgta 300 atacttgtaa cgctacatgg agattaactc aatctagagg gtattaataa tgaatcgtac 360 taaactggta ctgggcgcaa ctcacttcac accccgaagg gggaagttgc ctgaccctac 420 gattcccgct atttcattca ctgaccggag gttcaaaatg a 461 <210> 52 <211> 426 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 52 atgaccctga atatgatgat ggatgccggc ggacatcatc gcgacaaaca atattaatac 60 cggcaaccac accggcaatt tacgagactg cgcaggcatc cttctcccg tcaatttctg 120 tcaaataaag taaaagaggc agtctacttg attaccccc ggctggttga gcgtttgttg 180 aaaaaaagta actgaaaaat ccgtagaata gcgccactct gatggttaat taacctattc 240 aattaagaat tatctggatg aatgtgccat taaatgcgca gcataatggt gcgttgtgcg 300 ggaaaactgc tttttttga aagggttggt cagtagcgga aacaactcac ttcacacccc 360 gaagggggaa gttgcctgac cctacgattc ccgctatttc attcactgac cggaggttca 420 aatga 426 <210> 53 <211> 452 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 53 atgaccctga atatgatgat ggatgccggc tgacgaggca ggttacatca ctggtgaaac 60 cctgcacgtc aatggcggaa tgtatatggt ttaaccacga tgaaaattat ttgcgttatt 120 agggcgaaag gcctcaaaat agcgtaaaat cgtggtaaga actgccggga tttagttgca 180 aatttttcaa cattttatac actacgaaaa ccatcgcgaa agcgagtttt gataggaaat 240 ttaagagtat gagcactatc gaagaacgcg ttaagaaaat tatcggcgaa cagctgggcg 300 ttaagcagga agaagttacc aacaatgctt ccttcgttga agacctgggc gctgattctc 360 ttgacaccga actcacttca caccccgaag ggggaagttg cctgacccta cgattcccgc 420 tatttcattc actgaccgga ggttcaaaat ga 452 <210> 54 <211> 426 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 54 atgaccctga atatgatgat ggatgccggc ggacatcatc gcgacaaaca atattaatac 60 cggcaaccac accggcaatt tacgagactg cgcaggcatc cttctcccg tcaatttctg 120 tcaaataaag taaaagaggc agtctacttg attaccccc ggctggttga gcgtttgttg 180 aaaaaaagta actgaaaaat ccgtagaata gcgccactct gatggttaat taacctattc 240 aattaagaat tatctggatg aatgtgccat taaatgcgca gcataatggt gcgttgtgcg 300 ggaaaactgc tttttttga aagggttggt cagtagcgga aacaactcac ttcacacccc 360 gaagggggaa gttgcctgac cctacgattc ccgctatttc attcactgac cggaggttca 420 aatga 426 <210> 55 <211> 461 <212> DNA <213> Yapa Dizi <220> <223> Yapai Dizinin Disclosure: Synthetic polynucleotide <400> 55 atgaccctga atatgatgat ggatgccggc cgtcctgtaa tataaccgg acaattcgga 60 ctgattaaaa aagcgccctt gtggcgcttt ttttatattc ccgcctccat ttaaaataaa 120 aaatccaatc ggatttcact atttaaactg gccattatct aagatgaatc cgatggaagc 180 tcgctgtttt aacacgcgtt ttttaacctt ttattgaaag tcggtgcttc tttgagcgaa 240 cgatcaaatt taagtggatt cccatcaaaa aaatattctc aacctaaaaa agtttgtgta 300 atacttgtaa cgctacatgg agattaactc aatctagagg gtattaataa tgaatcgtac 360 taaactggta ctgggcgcaa ctcacttcac accccgaagg gggaagttgc ctgaccctac 420 gattcccgct atttcattca ctgaccggag gttcaaaatg a 461 <210> 56 <211> 1491 <212> DNA <213> Yapa Dizi <220> <223> Description of Artificial Array: Synthetic polynucleotide <400> 56 atgagcatca cggcgttatc agcatcattt cctgagggga atatcgccag ccgcttgtcg 60 ctgcaacatc cttcactgtt ttataccgtg gttgaacaat cttcggtggc gagcgtgttg 120 agtcatcctg actagctgag atgagggctc gccccctcgt cccgacactt ccagatcgcc 180 atagcgcaca gcgcctcgag cggtggtaac ggcgcagtgg cggttttcat ggcttgttat 240 gactgttttt ttggggtaca gtctatgcct cgggcatcca agcagcaagc gcgttacgcc 300 gtgggtcgat gtttgatgtt atggagcagc aacgatgtta cgcagcaggg cagtcgccct 360 aaaacaaagt taaacatcat gagggaagcg gtgatcgccg aagtatcgac tcaactatca 420 gaggtagttg gcgtcatcga gcgccatctc gaaccgacgt tgctggccgt acatttgtac 480 ggctccgcag tggatggcgg cctgaagcca cacagtgata ttgatttgct ggttacggtg 540 accgtaaggc ttgatgaaac aacgcgggcga gctttgatca acgacctttt ggaaacttcg 600 gcttcccctg gagagagcga gattctccgc gctctagaag tcaccattgt tgtgcacgac 660 gacatcattc cgtggcgtta tccagctaag...

Claims

1. A method for increasing nitrogen fixation in a non-legume plant, characterized by the following: exposure of the plant to a large number of bacteria, each member of the multiple numbers containing one or more genetic variations inserted into one or more genes or non-coding polynucleotides of the bacteria's nitrogen fixation or assimilation genetic regulatory network; such that the bacteria can fix atmospheric nitrogen in the presence of exogenous nitrogen, where the bacteria are not intergenetic microorganisms; and where the bacteria, in planta, produce 1% or more of the nitrogen fixed in the plant.

2. The method according to Claim 1 is characterized by the fact that it includes an included control sequence where one or more genetic variations are functionally linked to one or more of the aforementioned genes of the nitrogen fixation or assimilation genetic regulatory network.

3. This method, according to claim 2, is characterized by the fact that the control sequence is a promoter.

4. This method, according to claim 3, is characterized by the fact that the promoter is an inducible promoter.

5. This method, according to Claim 1, is characterized by the absence of a constitutive promoter functionally linked to a gene of the nitrogen fixation or assimilation genetic regulatory network in the bacteria.

6. The method is based on Claim T, and its characteristic feature is that the bacteria here do not contain a functionally linked constructive promoter to a gene in the n / i gene cluster.

7. This method, according to claim 1, is characterized by the removal of nitrogen-containing products of nitrogen fixation by bacteria in the plant. 129 8. The method described in Claim T is characterized by the fact that the large number of bacteria exposed to the plant do not stimulate an increase in the uptake of non-atmospheric exogenous nitrogen.

9. The method described in Claim T is characterized by the fact that the plant is grown in soil in a field where fertilizer containing at least 50 lbs of nitrogen per acre has been applied, and the nitrogen fertilizer contains at least 5% nitrogen by weight.

10. This method, according to claim 9, is characterized by the fact that the nitrogen-containing fertilizer contains ammonium or an ammonium-containing molecule.

11. The method is based on Claim T, and its characteristic feature is that it is characterized by the presence of a large number of bacteria, each containing at least two different bacterial species.

12. The method is based on Claim T, and its characteristic feature is that it is characterized by the presence of a large number of bacteria, each containing at least two different strains of the same bacterial species.

13. This method, according to Claim 1, is characterized by the selection of exogenous nitrogen, glutamine, ammonia, ammonium, urea, nitrate, nitrite, and ammonium-containing molecules, as well as one or more nitrate-containing molecules, from a fertilizer containing these substances.

14. The method according to Claim T is characterized by the fact that the bacteria produce 5% or more of the nitrogen fixed in the plant.

15. The method according to Claim T is characterized by the fact that the bacteria produce 10% or more of the nitrogen fixed in the plant.

16. The method described in Claim T is characterized by the selection of one or more genes or non-coding polynucleotides of the nitrogen fixation or assimilation genetic regulatory network of the bacteria from a group consisting of the following: η / 7Ά, n / YL, ntrB, ntrC, polynucleotide 130 encoding glutamine synthetase (glnA, glnB, glnK), drat, amtB, polynucleotide 130 encoding glutaminase (glnE), glnE, nifJ, nifH, nifD, nifK, nifY, nifE, nifN, nifU, nifS, nif\ / , niftN, nifZ, nift\A, nifF, nifB, and nifQ. According to Claim 17, the method is characterized by the presence of one or more genetic variations, resulting in one or more mutations that impart increased expression or activity of NifA or glutaminase; decreased expression or activity of NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, AmtB; decreased adenylyl-clearing activity of GlnE; or decreased uridyyl-clearing activity of GlnD.

18. The method is defined according to Claim 1 as being characterized by having one or more genetic variations: (A) a knockout mutation; (B) altering or eliminating a regulatory sequence of a target gene; or (C) involving the insertion of a heterologous regulatory sequence.

19. This method, according to Claim 1, is characterized by the presence of numerous bacteria from a single genus, including Enterobacter, Rahnella, Cosaconia, Burkholderia, or Klebsiella.

20. This method, according to Claim 1, is characterized by the presence of numerous bacteria, which are endophytic, epiphytic, or rhizospheric.

21. This method, according to Claim 1, is characterized by the colonization of at least the plant roots by a large number of bacteria, specifically at a concentration of at least 10⁵ cfu per gram of fresh plant weight.

22. This method, according to Claim 1, is characterized by the fact that the plant in question is an agricultural crop.

23. This method, according to claim 22, is characterized by the selection of the crop plant from among sorghum, canola, tomato, strawberry, barley, rice, maize, and wheat. 131 24. This method, according to claim 22, is characterized by the fact that the plant in question is a genetically modified organism.

25. This method, according to claim 22, is characterized by the fact that the plant is not a genetically modified organism.

26. This method, according to claim 22, is characterized by the fact that the plant has been genetically engineered or bred for efficient nitrogen utilization.

27. Bacterial nitrogen fixation or assimilation is a bacterial population containing one or more genetic variations inserted into one or more genes or non-coding polynucleotides of the nitrogen fixation or assimilation genetic regulatory network, characterized by the ability of the bacteria to fix atmospheric nitrogen in the presence of exogenous nitrogen; where the bacteria are not intergeneric microorganisms; and where the bacteria produce 1% or more of the nitrogen fixed in a plant grown in the presence of the bacterial population.

28. According to claim 27, a bacterial population is characterized by the presence of one or more genetic variations in a nitrogen fixation or assimilation genetic regulatory network, functionally linked to and incorporated into one or more of the aforementioned genes, and containing a control sequence.

29. According to claim 28, it is a bacterial population, characterized by the fact that the control sequence is a promoter.

30. According to claim 29, it is a bacterial population, characterized by the fact that the promoter is an inducible promoter.

31. According to claim 27, it is a bacterial population characterized by the absence of a constitutive promoter functionally linked to a gene of the nitrogen fixation or assimilation genetic regulatory network in which the bacteria are located. 132 32. According to claim 27, it is a bacterial population characterized by the absence of a constitutive promoter functionally linked to a gene in the nif gene cluster of the bacteria.

33. According to claim 27, it is a bacterial population, characterized by the fact that the bacteria here excrete the nitrogen-containing products of nitrogen fixation.

34. According to claim 27, the bacterial population is characterized by the fact that the bacteria exposed to the plant do not stimulate an increase in the uptake of non-atmospheric exogenous nitrogen.

35. According to claim 27, a bacterial population is characterized by the fact that it contains at least two different bacterial species.

36. According to claim 27, a bacterial population is characterized by the fact that it contains at least two different strains of the same bacterial species.

37. According to Claim 27, it is a bacterial population, characterized by its selection from a fertilizer containing one or more of the following: exogenous nitrogen, glutamine, ammonia, ammonium, urea, nitrate, nitrite, ammonium-containing molecules, nitrate-containing molecules, and nitrite-containing molecules.

38. According to claim 27, a bacterial population is characterized by the fact that the bacteria produce 5% or more of the nitrogen fixed in the plant.

39. According to claim 27, a bacterial population is characterized by the fact that the bacteria produce 10% or more of the nitrogen fixed in the plant.

40. A bacterial population according to Claim 27 is characterized by the selection of one or more genes or non-coding polynucleotides from a group of 133 genes within the bacterial nitrogen fixation or assimilation genetic regulatory network, namely: n / ϊΑ, n / fl_, ntrB, ntrC, polynucleotide encoding glutamine synthetase g / nA, glnB, glnK, drat, amtB, polynucleotide encoding glutaminase g / nD, glnB, nifJ, nifH, nifD, nifK, ηιΊΎ, nifE, nifN, n / flJ, nifS, nif\ / , niftN, nifZ., niftA, nifE, nilB, and nifQ.

41. A bacterial population according to Claim 27 is characterized by having one or more genetic variations, a mutation that confers one or more of the following: increased expression or activity of NifA or glutaminase; decreased expression or activity of NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, AmtB; decreased adenylyl-elimination activity of GlnE; or decreased uridyyl-elimination activity of GlnD.

42. According to claim 27, a bacterial population is characterized by having one or more genetic variations that are (A) a knockout mutation; (B) altering or deleting a regulatory sequence of a target gene; or (C) involving the insertion of a heterologous regulatory sequence.

43. According to claim 27, it is a bacterial population characterized by the presence of a large number of bacteria from a single genus, including Enterobacter, Rahnella, Cosaconia, Burkholderia, or Klebsiella.

44. According to claim 27, it is a bacterial population characterized by the presence of a large number of bacteria, which may be endophytic, epiphytic, or rhizospheric.

45. According to claim 27, it is a bacterial population, characterized by the fact that the plant in question is an agricultural crop.

46. ​​According to claim 45, it is a bacterial population, characterized by the selection of an agricultural crop plant from among sorghum, canola, tomato, strawberry, barley, rice, maize, and wheat.

47. According to claim 45, it is a bacterial population, characterized by the fact that the plant is a genetically modified organism. 134 48. According to claim 45, it is a bacterial population, and its characteristic feature is that the plant is not a genetically modified organism.

49. According to claim 45, it is a bacterial population characterized by the fact that the plant has been genetically engineered or bred for efficient nitrogen utilization.

50. According to claim 27, a bacterial population is characterized by the colonization of the plant by a large number of bacteria, such that the number of bacteria present on the plant is at least 10⁵ cfu per gram of fresh weight of the plant. It is a bacterial population according to any of the requirements between 51.27 and 50, and its characteristic feature is that it contains a composition.

52. According to claim 51, the composition is characterized by the fact that it includes a bacterial population coated on one surface of a seed.

53. According to claim 51, it is a composition, the characteristic of which is that the composition is formulated as a liquid or powder.

54. It is an isolated bacterium, characterized by its ATCC Access Record No. PTA-122293 or PTA-122294.

55. It is a non-intergenous bacterium, characterized by the presence of one or more genetic variations inserted into one or more genes, or non-coding polynucleotides of the nitrogen fixation or assimilation genetic regulatory network of the bacteria, such that the bacteria can fix atmospheric nitrogen in the presence of exogenous nitrogen.

56. According to claim 55, it is a bacterium, characterized by the presence of a control sequence in which one or more genetic variations are functionally linked to and incorporated into one or more genes of the nitrogen fixation or assimilation genetic regulatory network. 135 57. According to claim 56, it is a bacterium, and its characteristic feature is that the control sequence here is a promoter.

58. According to claim 57, it is a bacterium, and its characteristic feature is that the promoter here is an inducible promoter.

59. According to claim 55, it is a bacterium, characterized by the absence of a constitutive promoter functionally linked to a gene of the nitrogen fixation or assimilation genetic regulatory network.

60. According to claim 55, it is a bacterium, and its characteristic feature is that the bacterium does not contain a functionally linked constructive promoter to a gene in the n / Y gene cluster.

61. According to claim 55, the bacterium is characterized by the selection of one or more genes or non-coding polynucleotides of the nitrogen fixation or assimilation genetic regulatory network from the following groups: n / YA, n / YL, ntrB, ntrC, polynucleotide encoding glutamine synthetase g / nA, g / nB, g / nK, drat, amtB, polynucleotide encoding glutaminase glnö, glnE., nifJ, nifH, nifD, nifK, ηιΊΎ, nifE, nifN, / 7 / YU, nifS, niN, niftN, nifZ., nifM, nifF, nifö, and nifQ.

62. According to claim 55, it is a bacterium, characterized by having one or more genetic variations resulting in increased expression or activity of NifA or glutaminase; decreased expression or activity of NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, AmtB; decreased adenylyl-clearing activity of GlnE; or decreased uridyyl-clearing activity of GlnD.

63. According to claim 55, it is a bacterium and is characterized by having one or more genetic variations, (A) a knockout mutation; (B) altering or deleting a regulatory sequence of a target gene; or (C) involving the insertion of a heterologous regulatory sequence. 136 64. According to claim 55, it is a bacterium, characterized by the fact that it belongs to a genus including Enterobacter, Rahnella, Cosaconia, Burkholderia, or Klebsiella.

65. According to claim 55, it is a bacterium, and its characteristic feature is that the bacterium is characterized by whether it is endophytic, epiphytic, or rhizospheric.

66. A method for producing one or more bacteria, characterized by the following: (a) isolating bacteria from the tissue or soil of a primary plant; (b) introducing genetic variation into one or more bacteria to produce one or more variant bacteria; (c) exposing a large number of plants to the variant bacteria; (d) isolating bacteria from the tissue or soil of one of a large number of plants, where the plant from which the bacteria are isolated exhibits an enhanced trait compared to other plants within the large number of plants; and (e) repeating steps (b) through (d) with the bacteria isolated in step (d).

67. This method, according to claim 66, is characterized by the fact that the improved feature is nitrogen fixation in the plant from which the bacteria were isolated.

68. The method according to claim 66 is characterized by the fact that genetic variation here is a variation in a gene selected from the group consisting of nifA, nifL, ntrB, ntrC, glnA, glnB, glnK, draT, amtB, glnD, glnE, nifJ, nifH, nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB and nifQ.

69. The method according to claim 66 is characterized by the presence of a variation in a gene encoding a protein with selected functionality from a group consisting of: glutamine synthetase, glutaminase, glutamine synthetase adenillytransferase, transcriptional activator, anti-transcriptional activator, pyruvate flavodoxine oxidoreductase, flavodoxine, or NAD+-dinitrogen-reductase ADP-D-ribosyltransferase.

70. The method according to claim 66 is characterized by the presence of a mutation that results in one or more of the following: increased expression or activity of NifA or glutaminase; decreased expression or activity of NifL, NtrB, glutamine 137 synthetase, GlnB, GlnK, DraT, AmtB; decreased adenylyl-clearing activity of GlnE; or decreased uridyyl-clearing activity of GlnD.

71. This method, according to Claim 66, is characterized by the fact that the genetic variation is a knockout mutation.

72. This method, according to claim 66, is characterized by the fact that the genetic variation results in the elimination or destruction of the activity of a protein domain.

73. This method, according to claim 66, is characterized by the fact that the genetic variation alters or eliminates a regulatory sequence of a target gene.

74. This method, according to claim 66, is characterized by the fact that the genetic variation involves the insertion of a heterologous regulatory sequence.

75. The method according to claim 66 is characterized by the fact that the genetic variation involves a regulatory sequence insertion within the genome of a bacterial species or genus corresponding to the bacteria in which the genetic variation is included.

76. This method, according to claim 75, is characterized by the selection of a regulatory sequence based on the expression level of a gene within a bacterial culture or plant tissue.

77. This method, according to claim 66, is characterized by the fact that the genetic variation is produced by chemical mutagenesis.

78. The method according to claim 66 is characterized by the exposure of step (c) plants to biotic or abiotic stress sources. 138 79. The method according to claim 67 is characterized by the fact that, after repeating steps (b) to (d) one or more times, the isolated bacteria produce 1% or more nitrogen in a second plant of the same species as the first plant.

80. This method, according to claim 67, is characterized by the fact that the bacteria isolated after repeating steps (b) to (d) one or more times exhibit at least a 2-fold increase in nitrogen fixation compared to the bacteria isolated from the first plant.

81. This method, according to claim 80, is characterized by the fact that the second plant is grown in the presence of fertilizer supplemented with glutamine, ammonia, or another nitrogenous chemical source.

82. This is a method according to claim 66, and its characteristic feature is that the first plant is characterized by being an agricultural crop.

83. According to claim 82, the method is characterized by the selection of the agricultural crop from among barley, rice, maize, wheat, sorghum, sweet corn, sugarcane, onion, tomato, strawberry, or asparagus.

84. This is a method according to claim 66, and its characteristic feature is that it is a model plant consisting of a first plant or plants from a large number of plants.

85. This method, according to claim 84, is characterized by the selection of the model plant from Setaria, Brachypodium, or Arabidopsis.

86. The method is defined according to Claim 66 as follows: the genetic variation here is characterized by being a predetermined genetic variation specifically introduced into a target region.

87. This method, according to claim 66, is characterized by the fact that the genetic variation is a random mutation in the target site. 139 88. This method, according to claim 66, is characterized by its performance of genetic analysis of the bacteria isolated in step (a).

89. The method according to claim 66 is characterized by the application of a pressure chosen to enrich the bacteria containing genetic variation.

90. The method according to claim 89 is characterized by the fact that the chosen pressure involves the binding of genomes lacking the genetic variant included in a target region, where the binding occurs within 100 nucleotides of the target region.

91. This method, according to claim 89, is characterized by its feature of involving the isolation of bacteria that survive at the selected pressure.

92. The method according to claim 91 is characterized by the fact that binding is directed by a site-specific nuclease selected from a group consisting of a reverse-selectable marker, a Zinc Finger nuclease, a CRISPR nuclease, a TALE nuclease, or a meganuclease.

93. This method, according to claim 92, is characterized by the fact that the site-specific nuclease used is a CRISPR nuclease.

94. This method, according to claim 66, is characterized by the fact that the genetic variation is represented by an insertion or deletion of one or more nucleotides.

95. This method, according to claim 66, is characterized by the fact that the bacteria isolated after repeating steps (b) to (d) one or more times are endophytic, epiphytic, or rhizospheric.

96. This method, according to claim 66, is characterized by the fact that the bacteria isolated after repeating steps (b) to (d) one or more times contain a large number of different bacterial taxa. 140 97. This method, according to claim 66, is characterized by its isolation of bacteria from plant tissue.

98. The method according to claim 66 is characterized by the fact that step (a) involves the isolation of bacteria from a seed of the first plant.

99. A method for modifying the genome of a cell of a bacterial species, characterized by: (a) providing a polynucleotide containing a subsequence comprising sequences of bacterial species, where the subsequence includes a first homologous sequence, a promoter, and a second homologous sequence in the 5' to 3' direction; and (b) inducing homologous recombination between a polynucleotide and a target locus to produce a recombinant sequence, where (i) the target locus contains a target sequence flanked by the first and second homologous sequences, and (ii) amplifies the expression of one or more secondary genes adjacent to the target locus.

100. The method is defined according to claim 99 and is characterized by the following: (b) (iii) homologous recombination disrupts the expression of a first gene containing the target sequence.

101. The method according to claim 99 is characterized by its inclusion of the following: (c) isolation of bacterial cells containing recombinant arrays.

102. This method, according to claim 99, is characterized by the fact that the promoter is selected based on its expression activity above a threshold level under a given environmental condition.

103. The method according to claim 102 is characterized by its selection from a group including environmental conditions, nutrient status, nutrient deficiency, nitrogen stress, increased nitrogen exposure, heat, cold, osmotic stress, drought, flooding, salinity, presence or absence of interspecies signaling compounds, presence or absence of pathogens, and presence or absence of pesticides, herbicides, insecticides, nematicides, fungicides or bactericides, where increased or decreased exposure is relative to a reference condition.

104. The method according to claim 103 is characterized by the fact that the selection of the promoter involves: (a) exposure of bacterial species cells to environmental conditions, (b) measurement of the expression levels of the transcripts of the cells, and (c) identification of the promoter that triggers the expression of a transcript with a level above the threshold.

105. This method, according to claim 99, is characterized by the fact that the subset of bacteria does not encode a protein of a particular species.

106. This method, according to claim 99, is characterized by the fact that the substring does not encode a selectable token.

107. This method, according to claim 101, is characterized by the isolation of bacterial cells and the application of negative selection against cells that do not contain a recombinant sequence.

108. This method, according to claim 107, is characterized by negative selection involving the binding of genes lacking a recombinant sequence, where the binding occurs within 100 nucleotides of the target sequence.

109. The method according to claim 108 is characterized by the fact that binding is directed by a site-specific nuclease chosen from a group consisting of a reverse-selectable marker, a Zinc Finger nuclease, a CRISPR nuclease, a TALE nuclease, or a meganuclease.

110. A method according to Claim 109, characterized by the fact that the site-specific nuclease is a CRISPR nuclease.

11. A method according to List 99, characterized by the fact that the first gene is a negative regulator of one or more second genes. 142 112. This method, according to claim 99, is characterized by the fact that the first gene is a member of one or more second genes, or both are members of the nitrogen fixation pathway.

113. This method, according to claim 99, is characterized by the selection of the first gene from a group consisting of the following: NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, and AmtB.

114. This method, according to claim 99, is characterized by the selection of one or more secondary genes from a group consisting of: NifA and glutaminase.

115. This method, according to claim 99, is characterized by whether the bacterial cells isolated here are endophytic, epiphytic, or rhizospheric.

116. This method, according to claim 115, is characterized by the fact that the bacterial cells isolated herein produce 5% or more nitrogen in the cells of a host plant.

117. This method, according to claim 116, is characterized by the fact that the bacteria isolated herein produce nitrogen in the presence of fertilizer supplemented with glutamine, ammonium, or other chemical sources of supplemental nitrogen.

118. A polynucleotide used to disrupt a target gene in a cell of a bacterial species is characterized by containing a subsequence composed of sequences derived from the bacterial species, where: (a) the subsequence contains a first homologous sequence in the 5' to 3' direction, a promoter, and a second homologous sequence; (b) the first and second homologous sequences correspond to sequences surrounding a target sequence that is deleted upon homologous recombination between the subsequence and the target sequence, and the target locus containing the target sequence; (c) the target sequence contains at least one first protein-coding segment of a first gene; and (d) the subsequence does not encode a protein of the bacterial species. 143 119. It is a polynucleotide according to claim 118, and its characteristic feature is that the subsequence does not encode a selectable marker.

120. According to claim 118, it is a polynucleotide, characterized by the fact that the promoter is a promoter of a gene that has an expression activity above a threshold level under an environmental condition.

121. According to claim 120, it is a polynucleotide and its characteristic is that the environmental condition increases nitrogen exposure, and this increased exposure is related to a reference condition.

122. According to claim 118, it is a polynucleotide, characterized by the fact that the target sequence is adjacent to one or more secondary genes.

123. According to claim 122, it is a polynucleotide, characterized by the fact that the first gene is a member of the nitrogen fixation pathway, and one or more second genes, or both, are members of this pathway.

124. According to claim 118, it is a polynucleotide, characterized by the fact that the first gene is selected from a group consisting of NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, and AmtB.

125. According to claim 118, it is a polynucleotide, and its characteristic is that the cell is a bacterium, whether endophytic, epiphyseal, or rhizospheric. It is a polynucleotide according to any of the statements between 126118 and 125, and its characteristic feature is that it contains an expression vector. According to claim 126, it is a polynucleotide, and its characteristic feature is that it is a cell containing expression.

128. This method, according to Claim 1, is characterized by the presence of a large number of bacteria belonging to the genus Enterobacter. 144 129. This method, according to Claim 1, is characterized by the presence of a large number of bacteria belonging to the genus Rahnella. This method, according to Claim 130, is characterized by the presence of a large number of bacteria belonging to the genus Cosakonia.

131. This method, according to Claim 1, is characterized by the presence of a large number of bacteria belonging to the genus Burkholderia.

132. This method, according to Claim 1, is characterized by the presence of a large number of bacteria belonging to the genus Klebsiella.

133. According to claim 27, it is a bacterial population characterized by the presence of a large number of bacteria belonging to the genus Enterobacter.

134. According to claim 27, it is a bacterial population, characterized by the presence of a large number of bacteria of the genus Rahnella.

135. According to claim 27, it is a bacterial population, characterized by the presence of a large number of bacteria belonging to the genus Cosakonia.

136. According to claim 27, it is a bacterial population, characterized by the presence of a large number of bacteria belonging to the genus Burkholderia.

137. According to claim 27, it is a bacterial population characterized by the presence of a large number of bacteria belonging to the genus Klebsiella.

138. According to claim 55, it is a bacterium, and its distinguishing feature is that it belongs to the genus Enterobacter.

139. According to claim 55, it is a bacterium, and its distinguishing feature is that it belongs to the genus Rahnella.

140. According to claim 55, it is a bacterium, and its characteristic feature is that it is characterized by belonging to the genus Cosakonia. 145 141. According to claim 55, it is a bacterium, and its characteristic feature is that it is characterized by belonging to the genus Burkholderia. 5 According to claim 55, item 142 is a bacterium, and its distinguishing feature is that it belongs to the genus Klebsiella.

143. The method according to claim 99 is characterized by its inclusion of the following: (b) (iii) homologous recombination disrupting the expression of a primary gene containing the target sequence; and (c) isolation of bacterial cells containing the recombinant sequence.