UTILIZATION OF PLANT CELL SUSPENSION EXTRACELLULAR VESICLE-DERIVED SMALL RNAs AS COSMETIC ACTIVE RAW MATERIALS
Patent Information
- Application Number
- TR202308707
- Authority / Receiving Office
- TR · TR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-07-24
- Publication Date
- 2026-06-22
- Estimated Expiration
- 2043-07-24
Smart Images

Figure 00000066_0000 
Figure 00000067_0000 
Figure 00000067_0001
Abstract
Description
1 TARIFF PLANT CELL SUSPENSION EXTRACELLULAR VESICLES ORIGINATING FROM USE OF SMALL RNAS AS COSMETIC ACTIVE RAW MATERIALS TECHNICAL FIELD The invention relates to small RNAs derived from plant cell suspension extracellular vesicles. Anti-aging, wound healing, anti-dark circle, anti-spot, and hair loss. active raw material that allows its use as an anti-cosmetic raw material 10 It relates to the method of producing the material. PREVIOUS TECHNIQUE The skin protects the body from the external environment and helps regulate temperature and fluid balance. helpful, keeping out harmful microorganisms and chemicals, and sunlight It forms the largest living organ, providing some protection against light. It consists of 3 layers: epidermis, dermis, and hypodermis, which are tightly bound together. It comes from the epidermis, the outermost layer of the skin; keratinocytes, melanocytes, Langerhans cells, and It contains Merkel cells. The epidermis is responsible for skin renewal and color formation. 20 It is a protective layer for the body. It is the second layer of skin. The dermis contains fibroblast cells and extracellular matrix components. Collagen and elastin, located within the extracellular matrix, are the main fibrillar support of the dermis. when forming its tissue, proteoglycans, glycoproteins, glycoaminoglycans, Hyaluronic acid is another supporting structure. In the hypodermis, the deepest layer, its capillaries are 25 nourishing thick blood vessels, nerves, lymphatic channels, hair follicles and abundant adipocytes are located here. The skin, thanks to its protective layers, acts as a shield against environmental factors. However, it can be insufficient in the face of many internal and external factors. 30 and various cosmetic problems are encountered on the skin. The most common are: Cosmetic problems include wrinkles and skin aging, hyperpigmentation, and dark circles. 2 formation, acne, hair thinning and loss, increased skin sensitivity, eczema and This is known as microbiome disruption. Internal microbiome disruption occurs in individuals with increasing age. and loss of both functional and structural stability in the skin due to external factors. is happening. With age, the thickness of the dermis, the amount of glycosaminoglycans, and hyaluronic acid production, the number of fibroblast cells and consequently collagen collagen synthesis decreases. In addition, collagen cross-links in the dermis layer also decrease. stabilization, disorganization of collagen bundles, degradation of elastin fibers This leads to a decrease in skin elasticity and a reduction in the skin's water retention capacity. Some changes occur, such as a decrease in collagen during the skin aging process. and decreased elastin expression, inflammation, glycation, weakening of the skin barrier, symptoms such as decreased blood circulation and pigmentation, or these Combinations are shown. Reactive oxygen species (ROS) are radicals formed from a non-radical atom or molecule. It is formed by the removal of an electron or the addition of an electron to an atom or molecule. Because they can donate electrons to other molecules or take electrons from them. Because they can absorb ROS, they act as reducing or oxidizing agents in the organism. Free radicals behave in this way. During the normal metabolism of cells, 20 It is produced and causes damage to structures such as DNA, proteins and lipids. Free radicals can be formed during metabolism, while UV rays... It can be triggered by environmental factors such as air pollution and cigarette smoke. The human metabolism uses an antioxidant system to prevent the harmful effects of ROS. It uses it. However, high levels of ROS synthesis disrupt the oxidative balance and 25 Cellular signaling pathways are negatively affected by this condition. Excessive ROS. Its production leads to lipid, protein, and carbohydrate peroxidation, DNA damage, and apoptosis. This is the cause. Inflammation, cancer, and neurodegenerative diseases, for example. ROS synthesis also increases in these situations. In addition to these, ROS synthesis... Increased skin aging, the formation of skin blemishes and hair loss are 30 skin-related problems. It also contributes to the development of many problems. As age progresses, metabolism... Because antioxidant defenses are reduced, ROS species are more effective. 3 This occurs with increasing oxidative stress on the ECM (extracellular matrix). The synthesis of MMPs (metalloproteinases) that degrade its components increases. Activation of MMPs stimulates collagen and elastin, which provide firmness and elasticity to the skin. The components are damaged. As a result, the signs of skin aging appear. Wrinkles form and skin elasticity decreases. 5 Senescence, synonymous with aging, is the decrease in the division capacity of somatic cells. It refers to the cessation of cell replication upon its end. In skin aging... Fibroblast dysfunction and loss of function play a significant role. Age As skin aging progresses, signs of aging appear, while external factors also affect the skin. It accelerates the aging process. Senescence is the process by which cells containing damaged DNA... It prevents replication and reduces telomere shortening, DNA damage, and oncogenicity. It occurs in response to harmful stimuli such as signaling. DNA damage and this Senescence related to ionizing radiation, chemotherapeutics, genotoxic stress, and oxidative stress. It is triggered by stress. Senescence in the cell is one of the 15 natural processes that can occur. due to the presence of factors that cause DNA damage, such as It can occur. Senescence is the aging process of cells and a series of events in the body. It can cause an effect; It causes a decrease in collagen and elastin synthesis in the skin, leading to wrinkles. to its formation, decreases skin elasticity and leads to deep wrinkles, fine lines and sagging to its formation, It reduces the skin's ability to maintain its moisture balance and can cause skin irritation and to flake, 25 By causing a decrease or increase in melanin production, it alters skin color. these changes, also known as age spots, are brown or dark in color. to the formation of stains, causes loss of building blocks in the skin such as collagen, elastin and hyaluronic acid as a result of thinning of the skin and increased sensitivity, 30 4 By reducing the firmness and elasticity of the skin, the skin becomes more saggy and loose. to appear, causes weakening and widening of blood vessels in the skin, resulting in facial discoloration. redness, and the network of blood vessels and capillaries becoming more prominent. This can lead to problems. These effects manifest differently in each individual. These can occur due to genetic factors, lifestyle, UV radiation, etc. It can interact with various factors, such as environmental factors. An increase in free radicals also stimulates the formation of hyperpigmentation in the skin. Hyperpigmentation is a condition in which the skin develops pigments called melanin, resulting from excessive production. This is a significant cosmetic problem that leads to the appearance of blemishes. Melanin gives the skin its color. It is a pigment whose primary function is to protect the skin from UV radiation. However, excessive exposure to UV radiation can be a side effect of medications and illnesses. Its effect is hyperpigmentation resulting from conditions such as acne and certain skin problems. Skin blemishes may be observed. 15 Melanin synthesis (melanogenesis) is controlled by multiple cellular pathways in the skin. is produced hormonally as alpha melanin stimulating hormone (α-MSH) It is stimulated by this cellular pathway. Stimulation of this cellular pathway is the key to melanin synthesis. enzymes TYR (Tyrosinase), TYRP1 (Tyrosinase-associated protein 1), TYRP2 20 (Tyrosinase-associated protein 2) and the regulator of these enzymes, MITF (Microphytamia-associated protein). Synthesis of transcription factors occurs. As a result, melanin synthesis takes place. This occurs when skin exposure to UV light leads to the formation of free radicals and oxidative stress. This causes an increase in stress. This, in turn, affects the epidermis layer. release of inflammatory cytokines and α-MSH from keratinocytes and 25 by causing melanocytes to synthesize excessive amounts of melanin This results in hyperpigmentation. Free radicals cause hyperpigmentation. along with stimulating the melanosomes (melanin-containing cells) in melanocytes They can also alter melanin distribution by affecting the organelle. As a result... Irregular pigmentation may occur on the skin. 30 Another significant cosmetic problem is dark circles around the eyes. Dark circles under the eyes are bilateral, round, and homogeneous in the infraorbital regions. They are described as spots (pigment macules). The skin around the eyes is soft and thin. Because it has a unique structure, it creates a unique area on the face. Under the eyes In this region, collagen, elastin, glycosaminoglycans, and surface lipids are less abundant. Because it is present in smaller amounts, it is thinner and looser compared to other areas. Dark ring formation, post-inflammatory hyperpigmentation, melanin deposition, atopic or allergic dermatitis (eczema), venous occlusion, decreased microcirculation, green-blue color that becomes visible due to the thinner skin under the eyes 10 Shadowing caused by anatomical deformities, under-eye discoloration. bags, a blue, purple or pinkish tint along with swelling associated with fat loss the formation of a brown band due to the structural curve under the eye It is caused by many etiological factors, such as its presence. Weakening of connective tissue under the eyes, increased oxidative stress, inflammation. As a result, cytokines and nitric oxide (NO) levels increase, and consequently... Weakening of capillaries and increased permeability lead to melanin accumulation. one or more of the following reasons: increased and decreased microcirculation This combination causes the appearance of dark circles under the eyes. 20 Increased nitric oxide levels in the blood vessels lead to increased vascularization. blood flows out to the tissues because capillary permeability also increases. It seeps in and creates a bruised appearance. Hair loss is a very common cosmetic issue affecting both women and men. 25 It is a problem. Male pattern baldness, often also called androgenic alopecia, is the most common problem. It is a common type. Androgenic alopecia occurs in men who are genetically predisposed. It occurs in relation to hormonal changes. Androgenic alopecia is hair loss. It is characterized by the thinning of the follicles over time and the resulting hair loss. This type of hair... In hair loss, hair usually starts to recede in the forehead area and the crown. Hair thinning or receding occurs in this area. This condition affects the hair. genetic predisposition of follicles to androgen hormones (male hormones) 6 It is associated with being more sensitive due to the testosterone hormone (T), hair. by interacting with the 5α-reductase enzyme (5αR) found in follicle cells It is converted into the hormone dihydrotestosterone (DHT). The resulting DHT is released into the hair follicle. It binds to androgen receptors (ARs) in hair cells and suppresses hair growth. When DHT accumulates in hair follicles, VEGF (Vascular Endothelial Growth Factor) 5 This reduces the synthesis of this substance in the hair follicles and the capillaries that nourish the hair follicle. The blood vessels constrict and recede, the hair follicle miniaturizes, and hair loss occurs. This occurs. As a result, in addition to hormonal pressure, nutritional deficiencies also play a role. When a hair follicle is damaged, hair production slows down or stops completely. The interaction between epithelial and mesenchymal cells found in follicles is called follicle 10. It plays an important role in the morphogenesis and development of hair. The dermal papilla is the part of the hair follicle... a cluster of mesenchymal cells located at the base of the hair, and involved in hair growth and cycle It plays an important role in its regulation. β-catenin in dermal papilla cells proteins are essentially critical for hair follicle regeneration and the continuation of the anagen phase. They are regulated by the Wnt signal, which is significant at the level. Interruption of the β-catenin signal 15 It prevents anagen stimulation. Therefore, with the administration of the candidate active substance... Access to β-catenin proteins is important for the cell. Activation of the Wnt pathway is active. The compound demonstrates activity that stimulates hair growth. The rate of aging in the global population and the desire of individuals to look younger and more attractive 20 Due to their ever-increasing desires, beauty and personal care have become global. Cosmetics has become a significant part of the economy. As a result, every year... Thousands of new products are introduced to the market today. Consumers today have a wide range of products... With people becoming increasingly conscious about their ingredients, especially those with natural ingredients. Demand for cosmetic products is increasing. Consequently, cosmetics have grown significantly in recent years. produced with innovative and sustainable technologies for use in products and Natural active raw materials are being developed. In this regard, cosmetics have been developed in recent years. In the sector, also known as plant stem cell therapy, using plant cell culture techniques. obtaining undifferentiated cells from plants, processing these cells and various extracts Its use has become popular. This technique uses a small amount of plants and water. 30 the requirement, the possibility of production under in vitro culture conditions, standardization 7 Due to advantages such as its ability to be obtained, it is used in the production of cosmetic active raw materials. It is used. The production of raw materials using plant cell culture techniques involves a number of methods: These In this technique, the plant tissue is first sterilized. The sterilized plant is then processed in 5... explants after mechanical injury of the explant with a scalpel When placed in a nutrient medium containing suitable growth regulators, it forms a callus. Stimulation of the given undifferentiated cells is achieved. Plant cell culture method. The principle is to stimulate meristematic activity in the plant through wounding and to keep it undifferentiated. It is based on enabling the formation of cells. Callus cells receive liquid nutrients 10 By placing them in a suitable environment and incubating them, they can multiply at a faster rate. Transferring cells to bioreactor systems by increasing the volume of liquid nutrient medium and their production on an industrial scale is possible. Plant cell culture method regarding the use of cells obtained from this process as raw materials in cosmetic products. There are various patent applications. The current patent applications related to this technology are 15. as explained below: According to our research in patent databases, there is no patent that matches our invention. No such application has been encountered. However, in the known state of the technique, plant cells Cells obtained through culture methods are used as raw materials in cosmetic products. There are several patent applications related to its use. Existing patents related to this technique... The patent applications are described below: Patent number EP1985280A2 uses undifferentiated plant cells as the active substance. a product containing human stem cells as a protective agent against internal and external stresses 25 It concerns its use. Application number WO2021064173A1 refers to Leontopodium alpinum plant cells. In cosmetic applications, the skin's macronutrients, especially proteins, nucleic acids, and lipids, are targeted. It describes its use as a protective agent against the glycation of molecules. 30 8 Patent applications WO 2009 / 151302 and KR 2009-0118877 are for Panax. Ginseng cambium and undifferentiated plant material obtained from plants of the genus Taxus. with anti-aging or antioxidant compositions derived from cells It is related. Patent application number EP1699423 concerns the rejuvenation of skin appearance using salt. The use of lyophilized undifferentiated cells of tolerant plant origin It explains. Patent application number WO2011121051 (A2) describes the undifferentiated 10 argan plant. cells in the treatment of skin aging, inflammation and wound healing It explains its usage. Patent application number EP1244464 concerns plants belonging to the genus Leontopodium. The use of undifferentiated cell extracts as ultraviolet filtering agents 15 It defines it. Patent application number EP 1174120 concerns undifferentiated species of the family Iridaceae. lyophilized extracts of cells as a skin immune function stimulant It is related to its use. 20 Patent application WO 2005 / 072697 concerns lyophilized undifferentiated plant cells. Protective, regenerating properties, skin pigmentation removal and / or whitening. It is related to its use as a cosmetic or pharmaceutical ingredient for this purpose. None of the applications described above were as different as our application. small cells found in extracellular vesicles (EVs) that cells release into the nutrient medium This is not intended for the use of RNAs as cosmetic active ingredients. Furthermore... the use of undifferentiated cells / extracts as stated in the inventions in question It consists of plant cells and intracellular components, and it releases into the culture medium and 30 small RNA molecules that play an important role in intercellular communication It is not being utilized. Unlike other inventions, EP3283092A1 9 The invention involves peptides in undifferentiated plant cell suspension nutrient medium. This relates solely to its use in cosmetic applications for skin rejuvenation. It deals with peptides found in the cellular nutrient environment and small RNAs. It does not include. In recent years, plant extracts have been used in inventions related to the production of plant-derived active raw materials. and the use of plant cell culture extracts as well as EVs of plants EVs have started to be used. EVs are used for different types of microbial, plant, and human cells. They are small lipid structures produced by cells, such as DNA, RNA, proteins, and lipids. By enabling the transfer of encapsulated bioactive molecules, it facilitates cell-to-cell communication. They facilitate (Akers et al., (2013) 'Biogenesis of extracellular vesicles (EV): exosomes, microvesicles, retrovirus-like vesicles, and apoptotic bodies', Journal of Neuro-Oncology, 113(1), pp. 1–11; Patil et al., (2019) 'Exosomes: Biogenesis, 'Composition, Functions, and Their Role in Pre-metastatic Niche Formation', Biotechnology and Bioprocess Engineering, 24, pp. 689–70; Raposo et al., (2013) 15 'Extracellular vesicles: exosomes, microvesicles, and friends', The Journal of Cell (Biology, 200(4), pp. 373–383.) Animal-derived EVs, according to their size 100 Those smaller than nm are exosomes; those between 100-1000 nm in size are microvesicles. microparticles or ectosomes, and those larger than 1000 nm are called apoptotic vesicles. is classified (Bazzan et al., (2021) 'Critical Review of the Evolution of 20 Extracellular Vesicles' Knowledge: From 1946 to Today', International Journal of Molecular Sciences, 22(12), p. 6417; Liu and Wang, (2023) 'A review of the regulatory mechanisms of extracellular vesicles-mediated intercellular communication', Cell communication and signaling: CCS, 21(1), p. 77.). EVs derived from human cells and stem cells for liver fibrosis (WO2019050071A1) and protective against cellular senescence (WO2016104911A1), angiogenesis stimulant (WO2018004143A1), anti-cancer (WO2022045813A, CN114686593A, KR101820264B1), treatment of neuro-inflammation. (WO2019212371A1), hair growth stimulation (EP2629782A1), anti-aging 30 (CN115444807A, WO2017123022A1) and skin whitening (WO2017123022A1) There are various inventions related to its use for this purpose. In addition to human cell-derived EVs, EVs derived from plants also have therapeutic properties. There are also studies reporting their activities (Kameli et al., (2021) 'Plant- Derived Extracellular Vesicles: Current Findings, Challenges, and Future Applications', Membranes, 11(6); Nemati et al., (2022) 'Plant-derived extracellular 5 vesicles: a novel nanomedicine approach with advantages and challenges', Cell communication and signaling: CCS, 20(1), p. 69). Plant-derived extracellular Vesicles are nano-sized membrane vesicles secreted by plant cells and are lipids. It contains protein, nucleic acid, and specific pharmacologically active components. Some patents relate to the use of plant-derived EVs for cosmetic purposes. Applications are available: Invention number EP3354272A1 derived from the ginseng plant. Exosome-like vesicles for skin whitening; invention number WO2017057881A1 The invention with reference number WO2017164517A1 is an anti-hair loss active ingredient and an anti-aging active ingredient. It concerns its use as an article. Document number KR20220019228A; 15 Exosomes obtained from the broccoli plant have antioxidant and anti-aging properties. Document number KR20200002496A; skin of lemon, cucumber and potato exosomes bleach, document number KR102413200B1; rosemary and water lily plants. Exosomes promote cell regeneration, strengthen the skin barrier, and provide hydration. Document number KR102391636B1 for its activities; Scutellaria baicalensis and 20 Houttuynia cordata exosomes contain an active ingredient that improves skin and hair condition. This explains its use in cosmetic products. The exosomes mentioned in the inventions are directly involved in the apoptotic processes of plant tissues. It is obtained from their fluids and is released into the nutrient medium by plant cell cultures. They are not obtained from EVs. Furthermore, only exosomes are involved in the inventions. They are in use and, as we explained in our application, are small items located inside the EVs. RNA isolation and its use are not involved. Apoptotic fluids in plant tissues such as fruits, seeds, leaves, and roots contain 30 Isolation of exosomes found and their use for cosmetic activity 11 patents describing the use of nutrients in plant cell cultures There are several inventions concerning the use of exosomes in the environment: Invention number WO2023022414A1; obtained from lily cell culture Their exosomes have wrinkle-reducing, skin elasticity-enhancing and skin tone-balancing properties. Invention number WO2022071643A1; derived from alpine star plant cell culture nutrient medium. The exosomes obtained have skin elasticity-enhancing and wrinkle-reducing properties. Invention number KR102257524B1; Centella asiatica cell culture nutrient medium The exosomes obtained have skin elasticity-enhancing and anti-wrinkle properties, 10 Invention number KR102435006B1; Gynostemma pentaphyllum plant cell culture Exosomes obtained from nutrient medium strengthen the skin barrier. Invention number KR102248258B1; 15 derived from green tea cell culture. exosomes have anti-aging properties. Invention number KR102419102B1; exosomes derived from apple plant cell cultures wrinkle-reducing and elasticity-enhancing, Invention number EP3815675A1; obtained from rose cell culture nutrient medium. Exosomes have skin elasticity-enhancing and wrinkle-reducing properties. Invention number KR102248259B1; exosomes derived from soy cell cultures anti-aging, 25 Invention number KR102445516B1; exosomes derived from ginseng cell cultures anti-aging, Invention number CN115161256A; 30 derived from Polygonum cuspidatum cell culture. exosomes stimulate cell repair, 12 Invention number WO2023022446A1; derived from Gardenia jasminoides cell culture. Exosomes have skin elasticity-enhancing, wound-healing, and skin tone-balancing properties. It is used as a brightening and wrinkle-reducing cosmetic active ingredient. It explains. In the aforementioned inventions, the active substances are obtained from plant cell culture nutrient media. Although only exosomes are used as the active substance, A study on the production and use of small RNAs. There is none. In our invention, however, H. cordata cell suspension nutrient medium extracellular vesicles of origin are used to obtain small RNAs. It is used in anti-aging, wound healing, and stain removal. The small RNAs obtained are used in these applications. It has anti-dark circle and anti-hair loss effects. However, there are only a few studies in the literature regarding the isolation of EVs from plant cell cultures. There are 15 publications. From plants and plant cells obtained through traditional cultivation methods. protein and lipid contents of EVs obtained from suspensions were analyzed In one publication, it was stated that EVs could be obtained from both materials, and along with them... EV 20 suspension cultures in terms of having fewer components. It has been reported that its insulation is more advantageous in production (Woith et al., (2021) 'Plant Extracellular Vesicles and Nanovesicles: Focus on Secondary Metabolites, 'Proteins and Lipids with Perspectives on Their Potential and Sources', International Journal of Molecular Sciences, 22(7), p. 3719). Obtained in the publication. A 25-page study on the isolation of small RNAs from EVs and the activities of small RNAs. no studies found (Kocholata et al., (2022) 'Comparison of two isolation methods of tobacco-derived extracellular vesicles, their characterization and uptake by plant and rat cells', Scientific Reports, 12(1), p. 19896). Nicotiana Ultracentrifugation and PEG method from tabacum callus and suspension cultures. He performed extracellular vesicle isolation and characterization. Publication 30 Isolation of EVs from Nicotiana tabacum callus and cell suspension cultures. 13 It describes methods for obtaining small RNA from EVs and their cosmetic applications. It is not related to its use for recreational purposes. Plant-derived EVs are cell-to-cell small RNA, mRNA, long-noncoding RNA. Double lipid membranes play a role in the transfer of materials such as RNA, proteins, and lipids. 5 They are cellular structures surrounded by cells. Post-transcriptional cells are found within plant EVs. In the literature, regulatory molecules, especially small RNAs, are enriched. It has been stated (Baldrich et al., (2019) 'Plant Extracellular Vesicles Contain Diverse Small RNA Species and Are Enriched in 10- to 17-Nucleotide “Tiny” RNAs', The Plant Cell, 31(2), pp. 315–324; Cai et al., (2021) 'Message in a Bubble: Shutting 10 Small RNAs and Proteins Between Cells and Interacting Organisms Using Extracellular Vesicles', Annual review of plant biology, 72, pp. 497–524; Zand Karimi et al., (2022) 'Arabidopsis apoplastic fluid contains sRNA- and circular RNA- protein complexes that are located outside extracellular vesicles', The Plant Cell, 34(5), pp. 1863–1881.). Small RNAs are involved in plant growth, reproduction and defense, etc. 15 non-coding atoms of 21-24 nucleotides in length that participate in a wide variety of processes. They are important signaling molecules. Small RNAs play a role in biogenesis and action. microRNA (miRNA) and small silencing RNA differ in their types. It is divided into two categories, including (siRNA) (Baldrich et al., (2019) 'Plant Extracellular Vesicles Contain Diverse Small RNA Species and Are Enriched in 20 10- to 17-Nucleotide “Tiny” RNAs', The Plant Cell, 31(2), pp. 315–324.). Small RNAs carried within plant EVs express different types of genes. It has been reported that it suppresses transmod (cross-species RNAi) (Cai et al., (2019)). 'Small RNAs and extracellular vesicles: New mechanisms of cross-species 25 communication and innovative tools for disease control', PLoS Pathogens, 15(12), p. e1008090; Chen and Rechavi, (2022) 'Plant and animal small RNA 'communications between cells and organisms', Nature Reviews. Molecular Cell Biology, 23(3), pp. 185–203.). Also, from plant-derived small RNA species. Specifically, microRNAs enter human cells and increase the expression level of some genes by 30 It has been determined that it suppresses (Dad et al., (2021) 'Plant Exosome-like Nanovesicles: Emerging Therapeutics and Drug Delivery Nanoplatforms', Molecular Therapy: 14 The Journal of the American Society of Gene Therapy, 29(1), pp. 13–31; perut et al.,. (2021) 'Strawberry-Derived Exosome-Like Nanoparticles Prevent Oxidative 'Stress in Human Mesenchymal Stromal Cells', Biomolecules, 11(1), p. 87; Saiyed et al., (2022) 'Recent trends in miRNA therapeutics and the application of plant miRNA for prevention and treatment of human diseases', Future Journal of 5 Pharmaceutical Sciences, 8(1), p. 24.). In this context, as stated in the application form. from EVs synthesized by Houttuynia cordata cell suspensions Small RNAs have been isolated. The isolated small RNAs are from cationic liposomes. Encapsulated and ready for use as raw material in cosmetic products. The uniform has been brought. 10 The inventions related to the production and use of small RNAs are described below: Application number US2021155921A1 concerns Anethum, which is rich in small RNAs. This text discusses the method of obtaining the aqueous extract of graveolens and is small. 15 This is not related to the cosmetic use of RNA. Invention number CN101601635A relates to small RNA / DNA in skin whitening lotion and It is related to its use in skin care creams. Small DNA / RNAs used in the invention. It is obtained by oligonucleotide synthesis and from plants or undifferentiated plants. 20 It is not cell-derived. Application number R102268324B1 is rich in low molecular weight RNAs. The invention relates to a topical composition containing Lilium tigrinum extract. The invention concerns cells. viability, improving cellular protection against PM and DNA damage, and cellular 25 It is associated with an anti-aging cosmetic procedure. Application number CA3005605A1 refers to tiger lily extract containing small RNA and This is about its use in anti-aging cosmetics. Application number CN111956519A describes a product that can quickly and safely remove freckles. The use of synthetic small nucleic acids with these properties as skin care products. It is related to. The inventions mentioned regarding the use of small RNA are small RNAs obtained from plants. The RNAs are intended for use and both originate from undifferentiated plant cells. or the extraction of small RNAs from EVs present in the nutrient medium of cells and is not related to its use. Zhang et al., (2013, 'Use of small RNA as antiaging cosmeceuticals', Journal of 10 In the reviews of cosmetic science, 64(6).), synthetic drugs that target a single specific gene. Studies have been conducted on the anti-aging activities of small RNAs obtained in this way. The studies focus on small plant or plant cell-derived organisms. No studies regarding the extraction or use of RNAs are mentioned. Oger et al., (2019, 'Plant Small RNAs: A New Technology for Skin Care', Journal of (Cosmetic Science, 70, pp. 115–126), in their publications, from baobab tree seeds Plant Small RNA (PSR) extraction, patented (US2021155921A1) The small RNA-enriched extract they obtained through their processes is used to treat aging. They reported their antagonistic activities. In the publication, small RNA enrichment processes were performed on plants 20 It has been stated that it is made from seeds, but details about the process have not been disclosed. In addition, the small RNAs mentioned in the study were obtained from plant cell cultures. or not obtained from EVs. Plant-based small RNA regulator molecules regulate gene expression in human cells and various 25 It is known to direct cellular pathways. As explained above, some The inventions explore various application areas of small RNAs found in plants. Its use has been mentioned. However, in these discoveries, the production of small RNAs... The developmental stage of the plant has not been taken into consideration. However, current When the literature was examined, the profile of small RNAs and gene expression dynamics of the plant were found to be 30 It is known to vary depending on the developmental stage and tissue type. Current findings and The most fundamental shortcoming in the developed methods is the lack of plant-derived small RNAs. 16 It is the disregard of the universe in which it is isolated. As emphasized in the literature, in plants Both the diversity (profile) and expression levels (e.g., of small RNAs) expression level) location where it is isolated (root, stem, leaf, tuber, bulb, stolon, etc.) such as) and time period (primordium, callus, apical meristematic tissue, germination and (such as the cotylodon phase) varies considerably. Therefore, in cosmetics, 5 small RNAs that have begun to be used during the plant's correct developmental stage The high quantity and ease of use make it both practical and attractive in the cosmetic field. Scalability is also quite important. Obtained through traditional cultivation In the plants being studied, the plant's developmental phase depends on the environmental conditions in which it is located. It can change. Therefore, since the plant's environmental conditions cannot be kept constant, 10 Therefore, it is possible to standardize the amount and profile of small RNA it contains. It is not. Obtaining small RNA from plants or plant extracts and Since inventions intended for use require the direct use of plants, 15 Therefore, the seasonal availability of the plant requires a large amount of plant and water use. However, problems such as the necessity of pollution and pathogen risk are encountered. Similarly... Since EVs are found in apoplastic fluid in plant tissues, EVs additional measures such as breaking down and removing plant tissues for isolation steps are required. Accordingly, extracellular 20 obtained from plants The purity and yield of the vesicles are low. In inventions describing the production of plant extracts with increased small RNA content, small Is there any method for protecting RNAs from degradation? It has not been explained. When small RNA molecules are purified, temperature, humidity and 25 It can be broken down by various external factors such as RNase. Pure and When small RNAs are used without being encapsulated in a protective layer Their efficiency decreases because their structures are damaged. Therefore, another aspect of these inventions... The disadvantage is that the small RNAs obtained cannot be preserved after purification. 17 In conclusion, the issues encountered in the known state of the art and described above Due to the negative aspects, the need for improvement in the relevant technical field has emerged. It is emerging. 18 THE PURPOSE OF THE INVENTION The overall purpose of the invention is to create a complete system that meets the requirements mentioned above. plant cells that eliminate disadvantages and bring some additional advantages Suspension of extracellular vesicle-derived small RNAs for anti-aging and wound healing 5 Improvement, anti-spot, anti-dark circle and anti-hair loss activities. It is related to its use as a raw material in cosmetics. Due to the drawbacks of the previous technology, the invention, as described above, It aims to resolve the negative aspects. 10 The main goal of the invention is to detect small RNAs obtained from plants in animal cells. They suppress gene expression levels and direct various cellular pathways. Based on the data, EV small RNAs in plant cell suspensions affect skin and hair. to benefit from its beneficial effects on the skin. 15 Another important objective of the invention is to utilize small RNAs in the cosmetics field. The aim is to significantly improve the use of traditional plant extracts. cell suspensions obtained with undifferentiated plant cells instead The small RNA profile and quantity of undifferentiated plant cells were used. 20 It varies depending on the differentiated (leaf-like) plant tissues. In addition to this... Our next invention standardizes all environmental conditions for plant cell cultures. Because it can be done, it always occurs at the same developmental stage and in the same amount of small RNA. is obtained. Another important objective of the invention is the extraction of small RNA from plant cell suspensions. In the use of culture-derived EVs and traditional breeding methods The high volume of plants and water required means that plants are harvested seasonally. The aim is to eliminate problems such as the inability to control existing conditions, pathogen and pollution risks. In the invention, EVs were obtained from cell cultures created with a few plant parts. 30 This is possible. In addition, EVs are introduced into the culture medium by plant cells. isolation process from plant tissues (apoptotic fluid) due to its release 19 No insulation steps are required in the production of EVs. The process has been simplified and insulation efficiency has been increased. Another important objective of the invention is to ensure the stability of the small RNAs obtained. It is for protection. For this purpose, small RNAs obtained from EVs are protected with cationic 5 They are encapsulated using the liposomal method. This allows the small RNAs to be preserved. The formulation ensures that it remains undegraded. Liposomes are the basis. as, one or more phospholipid bilayers encapsulating an aqueous medium are the vesicles formed (Malheiros et al., (2010) 'Food applications of liposome- encapsulated antimicrobial peptides', Trends in Food Science & Technology, 10 21(6), pp. 284–292.). Liposomes are hydrophilic head portions of phospholipids, tail portions Due to the hydrophobic nature of its components, it possesses both hydrophilic and hydrophobic properties. (Wagner and Vorauer-Uhl, (2011) 'Liposome technology for industrial ('purposes', Journal of Drug Delivery, 2011, pp. 591-325). Other liposomes Its advantage over encapsulation technologies (spray drying, extrusion, etc.) is 15 imparting its properties to water-soluble materials in high water activity applications It is stability. In addition, liposomes also improve the permeability of active substances through the skin. It is known to increase miRNA encapsulated with cationic liposomes. the delivery of small RNAs such as microRNA and siRNA (silencing RNA) into cells and their intracellular expression has been reported to be significantly increased in studies. 20 In our discovery, the small RNAs obtained were encapsulated with cationic liposomes. It was both protected from degradation and its delivery to the cell was ensured. Another important difference that distinguishes this invention from other inventions according to the known state of the art. In our invention, H. cordata 25 was compared to the control group with the elicitor application. The goal is to achieve high-yield small RNA synthesis in suspension cells. In addition, existing patent applications involve increasing the synthesis of small RNA. There is no application for this purpose. EXPLANATION OF THE FIGURES Figure 1; Growth phases graph of H. cordata cell suspension. Figure 2; Effect of elicitor applications on cell quantity in H. cordata cell suspension 5 Evaluation of its effect. SA: Salicylic acid, MeJA: Methyl jasmonate, Cold (4°C): Cells incubated at 4°C, Warm (40°C): Cells incubated at 40°C. Figure 2.1; SA, MeJA and Nutrient Deficiency, Figure 2.2; Effect of cold and hot applications. 10 Figure 3; EVs derived from H. cordata cell suspension nutrient medium. Figure 3.1; NTA (Nanoparticle tracking analysis) measurement result, S-TEM image, 15 Figure 3.2; B) Magnification ratio: 60.0000x, Figure 3.3; C) Magnification ratio: 120,000x. Figure 4; Small RNA obtained from EVs of H. cordata cell suspension. Evaluation of the effect of elicitor applications on the amount. SA: Salicylic acid, 20 MeJA: Methyl jasmonate, Cold (4°C): Cells incubated at 4°C, Hot (40°C): Cells incubated at 40°C. Figure 4.1; SA, MeJA and Nutrient Deficiency, Figure 4.2; Effect of cold and hot applications. 25 Figure 5; Reads obtained from small RNA sequencing reaction, Figure 5.1; Phred grove, Figure 5.2; Single-end reading length, 30 Figure 5.3; Adapter array contents, Figure 5.4; Sequencing depth and 21 Figure 5.5; Sequence contamination content graphs. H_cordata celi: H. cordata cells from suspension nutrient medium-derived EVs. Small RNA obtained. H_cordata_leaf: Derived from adult H. cordata leaves. Small RNA obtained from EVs. Figure 6; Effect of H. cordata cell suspension extract on cell viability. HE: H. Cordata cell suspension extract concentrations (µg / mL)*: compared to control This indicates a significant difference, p<0.0001. Figure 7; Effect of liposome-encapsulated small RNAs on cell viability. LE small 10 RNA: H. cordata cell suspension nutrient medium EVs-derived liposomes Concentrations of encapsulated small RNA. (D1=1, D2=5, D3=25, D4=50 and D5=100) (µg / mL) *: indicates a significant difference compared to the control, p<0.0001. Figure 8; H. cordata cell suspension extract and H. cordata cell 15 liposome-encapsulated small RNA compound obtained from the suspension of cells Effect on viability. HE and LE small RNA: H. cordata cell suspension extract. and liposome-encapsulated small RNA obtained from H. cordata cell suspension Compound concentrations D1=50 and D2=100 µg / mL. *: Significantly higher than control. This indicates a difference, p<0.0001. 20 Figure 9; Co-administration of HE, LE small RNA and HE and LE small RNA. related to anti-aging activity Figure 9.1; COL1A1, 25 Figure 9.2; COL3A1, Figure 9.3; Effect of TGFB1 gene expression, D1=50 and D2=100 µg / mL, *: This indicates a significant difference compared to the control group, p<0.0001. Figure 10; HE, LE small RNA and HE and LE small RNA co-administration at 30°C related to wound healing 22 Figure 10.1; VEGF, Figure 10.2; NFKB, Figure 10.3; Effect of TNFα gene expression, D1=50 and D2=100 µg / mL. *: This indicates a significant difference compared to the control group, p<0.0001. Figure 11; Co-administration of HE, LE small RNA and HE and LE small RNA. related to anti-hair loss activity Figure 11-1; 5α Reductase, Figure 11-2; Effect of β-catenin gene expression, D1=50 and D2=100 µg / mL, 10 *: indicates a significant difference compared to the control, p<0.0001. Figure 12; Co-administration of HE, LE small RNA and HE and LE small RNA. related to anti-aging activity Figure 12.1; COL1A1, Figure 12.2; COL3A1, Figure 12.3; Effect of TGFB1 on protein expression, D1=50 and D2=100 µg / mL. *: This indicates a significant difference compared to the control group, p<0.0001. Figure 13; Co-administration of HE, LE small RNA and HE and LE small RNA. related to wound healing Figure 13.1; VEGF, Figure 13.2; NFKB, 25 Figure 13.3; Effect of TNFα on protein expression, D1=50 and D2=100 µg / mL. *: This indicates a significant difference compared to the control group, p<0.0001. Figure 14; Application of HE, LE small RNA and HE and LE small RNA together. Effect on melanin content, D1=50 and D2=100 µg / mL. KA: Kojic acid doses (µM). *: 30 This indicates a significant difference compared to the control group, p<0.0001. 23 Figure 15; Co-administration of HE, LE small RNA and HE and LE small RNA. Effect on tyrosinase activity. D1=50 and D2=100 µg / mL. KA: Kojic acid doses (µM). *: This indicates a significant difference compared to the control group, p<0.0001. Figure 16; HE, LE small RNA and HE and LE small RNA co-administration results in 5 Its effect on cell senescence. Figure 17; Application of HE, LE small RNA and HE and LE small RNA together. Its protective effect against DNA damage. Figure 18; Co-administration of HE, LE small RNA and HE and LE small RNA. Its effect on the formation of intracellular reactive oxygen species (ROS). Figure 19; Application of HE, LE small RNA and HE and LE small RNA together. Effect on inflammation-induced nitrite formation. D1=50 and D2=100 µg / mL. LPS: 15 Lipopolysaccharide. *: indicates a significant difference compared to the control, p<0.0001. 24 DETAILED DESCRIPTION OF THE INVENTION The invention is designed for use in skin and hair care products, for anti-aging and wound healing purposes. It has healing, anti-spot, anti-dark circle and anti-hair loss activities. It relates to the method of obtaining the raw material. The invention; Houttuynia cordata cell 5 Obtaining suspensions, H. cordata cell suspension culture medium Adding 0.05 - 0.5 mM of MeJA on days 12-18 of the culture, cultivating the culture with MeJA for 60 days - Leaving them to incubate for 80 hours resulted in the EVs being removed from the nutrient medium after incubation. Isolation of EV-derived small RNAs, isolation of EV-derived small RNAs 10 It is being developed. In a preferred configuration of the invention, H. cordata cells Suspension systems are used. They are used in different applications for the same purpose. Centella asiatica, Cydonia oblonga, Malva sylvestris, Persea americana, Rosa damascena, Helichrysum arenarium, Glycine max, Prunella vulgaris, Symphytum officinale, Malva sylvestris, Scutellaria baicalensis, Pelargonium graveolens, 15 Filipendula ulmaria, Passiflora edulis, Marribium vulgare, Linum tauricum, Lycium barbarum, Papaver rhoeas, Paeonia peregrina, Leontopodium alpinum, Prunus an individual selected from among the plant species dulcis, Inula helenium and Psoralea corylifolia or cell suspensions obtained from combinations thereof It is available. 20 The overall purpose of the invention is to create a complete system that meets the requirements mentioned above. cosmetics in particular eliminate disadvantages and bring some additional advantages Prepared for use in the industry and in the field of skin and hair care products, Anti-aging, wound healing, anti-spot, anti-dark circle, and hair loss 25 plant cell suspension derived from extracellular vesicles that provides anti-activity It is related to the use of small RNAs as raw materials. The main goal of the invention is to detect small RNAs obtained from plants in animal cells. 30 Based on the data, EVs originating from cell suspension nutrient medium were identified. The aim is to utilize the cosmetic activities of the small RNAs obtained. The invention is intended for use in the cosmetics industry and in skin and hair care products. Anti-aging, wound healing, anti-spot, anti-dark circle, and anti-hair loss. It is a method of producing raw materials that have counter-activities, and its characteristic is; — Preparation of H. cordata cell suspensions, 5 — H. cordata cells were cultured in suspension culture medium from 12 to 18 days. Adding 0.05 - 0.5 mM of MeJA on the same day, — leaving the culture to incubate for 60-80 hours, — Isolation of EVs from nutrient medium after incubation, — Isolation of EV-derived small RNAs, 10 — EV-derived small RNAs are encapsulated within cationic liposomes. being done, — obtained encapsulated small RNA and cell suspension the process steps for obtaining the extract as a raw material It is characterized by its inclusion. 15 26 Figure 1 shows the growth phases graph of H. cordata cell suspension. Figure 2 shows the effect of elicitor applications on the cell quantity of H. cordata cell suspension. evaluation of its impact, Figure 3 shows the NTA of EVs derived from nutrient medium in H. cordata cell suspension. measurement results and S-TEM images, Figure 4 shows small RNA obtained from EVs of H. cordata cell suspension. Evaluation of the effect of elicitor applications on the amount, 10 Figure 5 shows the readout results obtained from the small RNA sequencing reaction. Figure 6 shows the effect of H. cordata cell suspension extract on cell viability. Figure 7 shows the effect of liposome-encapsulated small RNAs on cell viability. Figure 8 shows H. cordata cell suspension extract and H. cordata cells. liposome-encapsulated small RNA compound obtained from the suspension of cells its effect on vitality, 20 Figure 9 shows the combined application of HE, LE small RNA and H.E and LE small RNA. Effect on the expression of genes associated with anti-aging activity, Figure 10 shows the effect of HE, LE small RNA and HE and LE small RNA combined application on 25. Effect on the expression of genes associated with wound healing, Figure 11 shows the application of HE, LE small RNA and HE and LE small RNA together. its effect on the expression of genes that prevent hair loss, Figure 12 shows the application of HE, LE small RNA and HE and LE small RNA together. Effect on the expression of proteins associated with anti-aging activity, 27 Figure 13 shows the effect of HE, LE small RNA and HE and LE small RNA co-administration. Effect on the expression of proteins associated with wound healing, Figure 14 shows the application of HE, LE small RNA and HE and LE small RNA together. Effect on melanin content, 5 Figure 15 shows the application of HE, LE small RNA and HE and LE small RNA together. effect on tyrosinase activity, Figure 16 shows the effect of HE, LE small RNA and HE and LE small RNA combined application on 10 its effect on cell senescence, Figure 17 shows the effect of HE, LE small RNA and HE and LE small RNA co-administration. Its protective effect against DNA damage, Figure 18 shows the effect of HE, LE small RNA and HE and LE small RNA co-administration. Its effect on the formation of intracellular reactive oxygen species (ROS), Figure 19 shows the application of HE, LE small RNA and HE and LE small RNA together. Its effect on nitrite formation due to inflammation has been noted. 20 1. Obtaining H. cordata Seedlings H. cordata adult leaf tissue and cell suspension culture nutrient medium. Comparison of yield and composition of small RNAs obtained from EVs 25 H. cordata seedlings were obtained. H. cordata seeds were sown under conditions of 2-8 °C. The seeds were stored. They were transferred to moist, moderately soft peat soil and photoperiod controlled. The seeds were kept at 25°C under conditions of (16 hours light / 8 hours dark). The seeds germinated after 15 days. It then germinated and a full plant was obtained after 1 month. 28 2. Obtaining H. cordata Cell Suspension Cultures H. cordata seeds were soaked in a 15% NaOCl solution for 15 minutes and then washed 3 times. Surface sterilization was achieved by rinsing with distilled water. The sterilized seeds... For in vitro seedling production, preferably a pH 5 solution containing 1 mg / L BAP, 30 g / L sugar, and 4 g / L agar is used. after being placed in MS nutrient medium (Table 1) with a value set to 5.8 Conditions were provided as follows: 22±2°C and a photoperiod of 16 hours light / 8 hours dark. It was left to incubate in a climate-controlled chamber. It died in approximately 14-20 days. In vitro seedlings were obtained. These in vitro seedlings were prepared for propagation at 3-4 weeks. Subculture was performed by transferring the specimens to fresh nutrient medium at intervals. 10 Leaf and petiole explants of in vitro seedlings were used for callus induction under aseptic conditions. wounded with a scalpel underneath, containing 1 mg / L 2,4D and 0.5 mg / L kinetin. Gamborg's B5 was placed in the environment (Table 2). Callus stimulation was performed in this application. Leaf and petiole explanations were used for this. In a different application, the root of the plant was used. Alternatively, stem explants can also be used. Cultured explants show callus formation in 15 days. They were incubated at 25°C in a dark environment until observation. The explants were 4 weeks old. They were transferred to fresh nutrient media in periodic intervals. They are fragile and can be suspended. When the calluses in this form reach a sufficient quantity, they move to the suspension culture stage. This has been achieved. The nutrient that provides the best callus stimulation in cell suspension culture. The medium content was used. H. cordata 20 for cell suspension culture. Preferably 4-4.5 g of 0-45 day old calluses obtained from explants, preferably 50 mL After being transferred to a 250 mL Erlenmeyer flask containing liquid nutrient medium, it is stored at 20-25 °C for 110 minutes. In rpm, a cell containing a single cell or groups of cells separated from each other in the dark. It was incubated until it formed a suspension. Preferably about 4 weeks. then the large callus masses found in the suspension culture 25 To remove any remaining residue, the suspension was passed through a sterile sieve (30 mesh). The suspension is passed through and fresh nutrient medium is added at a ratio of 1:3. They were cultured. Afterwards, the Erlenmeyer flasks were incubated at 110 rpm. Growth parameters of the cells in the resulting suspension (cell (cell count, cell pellet volume (PCV), settled cell volume (SCV), and cell viability) 30 This is determined on a weekly basis. Cell suspensions are subdivided at 2-3 week intervals. The suspension volume was increased by culturing the culture. 29 Table 1. Macro and micro elements and vitamins present in MS nutrient medium. amount Macroelements mg / L CaCl2 332.02 KH2PO4 170.00 KNO3 1900.54 MgSO4 180.54 NH4NO3 1650.00 Microelements mg / L CoCl2.6H2O 0.025 CuSO4.5H2O 0.025 FeNaEDTA 36.70 H3BO3 6.20 KI 0.83 MnSO4.H2O 16.90 Na2MoO4.2H2O 0.25 ZnSO4.7H2O 8.60 Vitamins mg / L Glycine 2.00 Myo-inositol 100.00 Nicotinic acid 0.50 Pyridoxine HCl 0.50 Thiamine HCl 0.10 Table 2. Macro and micro elements present in Gamborg's B5 nutrient medium. amount of vitamins Macroelements mg / L CaCl2 113.23 NaH2PO4 130.44 KNO3 2500.00 MgSO4 121.56 (NH4)2SO4 134.00 Microelements mg / L CoCl2.6H2O 0.025 CuSO4.5H2O 0.025 FeNaEDTA 36.70 H3BO3 3.00 KI 0.75 MnSO4.H2O 10.00 Na2MoO4.2H2O 0.25 ZnSO4.7H2O 2.00 Vitamins mg / L Myo-inositol 100.00 Nicotinic acid 1.00 Pyridoxine HCl 1.00 Thiamine HCl 10.00 3. Determination of Growth Phases of H. cordata Cell Suspension In order to determine the growth phases of H. cordata suspension cells, The cells were collected under aseptic conditions using a Buhner funnel and a Nuche Erlenmeyer flask. The nutrient medium was removed by transferring it from the flasks onto filter paper. 20 10 For the experiment lasting 2 days, a total of 22 Erlenmeyer flasks with a volume of 250 mL each were filled with 50 mL of nutrient medium. Each flask was inoculated with 4 grams of viable cells. 22 flasks were harvested on different days. They were then incubated at 25°C on an orbital mixer at 110 rpm. To determine the growth phases, two Erlenmeyer flasks are filtered every two days. After passing through and filtering, the wet weights of the cells were determined, and after lyophilization, they were 15. Dry weights were measured and recorded. 20-day wet / dry weight of the cells. Growth phases of H. cordata suspension cells using data. The cells were determined. After weighing the lyophilized cells, they were left for 2-8 hours for further analysis. Stored at °C. 31 Growth phase based on the weight of lyophilized H. cordata cells. In the culture curve, days 0-3 are the lag phase, days 3-12 are the logarithmic phase, and days 12-15 are the lag phase. The period was defined as a stationary phase and a decline phase from day 16 onwards (Figure 1). 4. Elicitor Applications 5 Nutrient deficiencies in plants, heat, cold, salicylic acid (SA), and methyl jasmonate. Studies have shown that (MeJA) applications increase small RNA synthesis. It has been reported (Zeng et al., (2014) 'Role of microRNAs in plant responses to nutrient stress', Plant and Soil, 374(1–2), pp. 1005–1021; Lv et al., (2010) 'Profiling of cold-10 'stress-responsive miRNAs in rice by microarrays', Gene, 459(1–2), pp. 39–47; Zhang et al., (2009) 'Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response’, BMC Genomics, 10(1), p. 449; Lu vd., (2008) ‘Stress-responsive microRNAs in Populus’, The Plant Journal: For Cell and Molecular Biology, 55(1), pp. 131–151; 15 Xin vd., (2011) ‘Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing’, BMC Plant Biology, 11(1), s. 61; Zhang vd., (2022) ‘Roles of microRNAs in abiotic stress response and characteristics regulation of plant’, Frontiers in Plant Science, 13; Rutter vd., (2017) ‘Extracellular 20 Vesicles Isolated from the Leaf Apoplast Carry Stress-Response Proteins1[OPEN]’, Plant Physiology, 173(1), ss. 728–741.). H. cordata hücre süspansiyonlarında en verimli küçük RNA sentezinin elde edilebilmesi için besin Restrictions include cold and hot incubation, salicylic acid, and incubation with MeJA. Various elicitor applications have been carried out. 25 elicitor applications have been completed. The cultures were terminated. Then the suspensions were filtered to provide the cells with nutrients. They were separated from their environment. After the filtered cells were washed with distilled water... The nutrient media obtained during lyophilization were collected in centrifuge tubes. The media for EV and small RNA isolation were -80 °C, while lyophilized cells were used. It was stored at 2-8 °C for extraction studies. 30 32 a) Exposure to Nutritional Deficiency H. cordata cell suspension cultures were extended to an additional 14 days, the normal subculture period. They were then left for additional incubation in the same nutrient medium for 2, 4, 6, and 8 days. b) Cold and Hot Incubation On the 14th day of culture, the cell suspension was incubated at 4°C for 6, 8, 12, and 24 hours. cold application, hot application by holding at 40°C for 1, 2 and 4 hours. It has been done. 10 c) MeJA and SA Application On the 14th day of culture, 0.2-0.4 and 0.8 mM MeJA or After adding SA, the suspensions were incubated for an additional 1, 2, and 3 days. 15 5. H. cordata Cell Suspensions After Elicitor Applications Extraction After the incubation periods of H. cordata suspension cultures are completed, 20 The cells were passed through a filter and the cultures were terminated. Afterwards, all groups were analyzed. The cells were lyophilized. The weights of the lyophilized cells were determined by weighing. Salicylic acid, MeJA, and cold and hot treatments applied to H. cordata cells. statistically significant difference in the amount of suspension compared to the control group No difference was found. Nevertheless, 25 people exposed to nutritional deficiencies for 6 and 8 days... A decrease of 1.1 and 1.3 times, respectively, was determined in the amount of cells left behind (Figure 2.A and B). Lyophilized cells are used to obtain the extract necessary for in vitro experiments. It was stored at -80 °C. Only the most efficient small RNA from the EVs was 30. The lyophilized cells obtained from the elicitor application were subjected to extraction. Lyophilized H. cordata cells were collected for extraction at a ratio of 1:40 (w / v). 33 Homogenize in 70% ethanol for 15 minutes using a rotor-stator homogenizer. The homogenates were then incubated at 22±2 °C for 24 hours. Extraction was performed on a shaker at rpm. Incubation After completion, the cell clumps were separated by a filter. The filtered nutrient medium It was filtered again by passing it through filter paper with a pore size of 4-7 microns. Solvents 5 Extracts are removed by means of a rotary evaporator at 40 °C under low pressure. It has been concentrated. The solvent remaining in the concentrated extracts is removed with a lyophilizer. removed. The resulting H. cordata cell extract is used singly and / or in small amounts. It has been used in experiments in combination with RNA. 6. Nutrients from adult tissues and cell suspension of H. cordata. insulation of EVs from their surroundings Both from differentiated adult tissue (leaves) and from tissue that has been treated with elicitor and EV isolation 15 into nutrient media of untreated suspension groups The following procedure has been applied: From H. cordata leaves and cell suspension culture medium. Isolation of EVs found Huan et al. (2021 'Effective methods for isolation and purification of extracellular vesicles from plants', Journal of Integrative Plant 20 This was done using the method they developed in Biology, 63(12), pp. 2020–2030). The general method for isolating EVs from plants is vacuum infiltration and sequential methods. It is completed in two steps, including centrifugation steps; (i) by vacuum infiltration. Obtaining leaf apoplastic fluid (AWS) and centrifuging the AWS (ii) collection of plant EVs from the resulting AWSs by filtration and sequential centrifugation 25 The isolation of EVs from adult leaf tissue is the process of obtaining AWSs. After this, EVs are removed from the culture fluid of the cell suspension culture. It was obtained. First, a sterile razor blade was used to cut the stem portion at the base of a mature leaf. separated from the stem with the help of, and thus able to come from the plant's vascular bundle Potential contaminants have been minimized. Approximately 20-30 for each experiment. 45 plant leaves were used, and the total number of leaves was measured on a precision scale. The weight was recorded. After washing the plant leaves, they were carefully placed in 200 mL. 34 placed in the syringe and infiltration buffer [20 mmol / L L2-[N-morpholino]ethane] 20-30 with sulfonic acid (MES) hydrate, 2 mmol / L CaCl2, 0.1 mol / L NaCl, pH 6.0]. The leaf was slowly vacuumed for a few seconds. After the vacuuming process... Excess infiltration buffer on the surface was removed with blotting paper and The leaves are attached to a short plastic stick. The tip of the leaves is pointed upwards. 5 placed in a 50 mL centrifuge tube and stored at 4 °C for 1,000 It was centrifuged at g for 15 minutes. The results obtained after centrifugation... To isolate EVs from AWS, relatively large cellular devices are primarily needed. Debris needs to be removed. At this stage, the AWS liquid is heated to 2,000 at 4°C. It was centrifuged at g for 10 minutes and then 0.45 μm pore size was obtained. It was passed through filters with a certain diameter. The transparent material obtained after filtration. The supernatant was used for EV insulation. It was placed in a conical centrifuge tube. The resulting supernatant was collected into ultracentrifuge tubes using sterile pipettes and incubated at 4°C for 10,000 seconds. It was centrifuged at g for 45 minutes. After the pellet was removed, the supernatant was recycled. Centrifuged at 4 °C for 1 hour at 100,000 g. The resulting pellet was divided into 10 mL 15 washed in infiltration buffer and centrifuged again at the same speed and time. prepared and RNA isolation from EVs will be performed in an ultra-deep water tank at -86 °C. It has been placed in the freezer. All these processes are necessary both for the mature leaf tissue and Cell suspension nutrient medium was used for isolation of EVs. The main difference between cell suspension culture nutrient medium and AWS 20 is that From culture medium directly to EV isolation without isolation This involves passing through. As a result, the dimensions and quantitative measurements of the obtained EVs are taken. It has been accomplished. The concentration and size of the obtained EVs were measured on a nanoparticle tracking device at 25°C. (NTA, NS300, Nanosight) were identified. According to the NTA analysis results, it was the most effective. H. treated with elicitor application (72-hour incubation with 0.2 mM MeJA). EVs obtained from nutrient medium of cordata cell suspensions The concentration was determined to be 7.4 x 10⁹ particles / mL (Figure 3.A). EVs The images were obtained using a scanning transmission electron microscope (S-TEM, Quattro S, 30 The analysis was carried out using a Thermo Scientific system with a 30 kV acceleration voltage. The dimensions of the detected EVs were determined to be in the range of 120-150 nm (Figure 3.B). 35 a) Nutritional information from adult tissues and cell suspension of H. cordata. Isolation of small RNAs from EVs in their environments Exogenous small RNA contamination after isolation of EVs. To prevent this, isolated EVs were used to degrade endo-5 single-stranded RNAs. It was treated with micrococcal nuclease, one of the exonucleases. Thus, EV Small RNAs not originating from the source were removed. For this reaction, isolated EVs were used. 10 units of MNase (Thermo Fisher) were added and incubated at 37 °C for 15 minutes. In order to obtain sufficient EV for total RNA isolation, 4 separate tubes were used. Isolated EVs were grouped together. Each group (adult leaf tissue and 10 The samples (derived from cell suspension nutrient medium) come together within themselves. TRIzol™ Reagent (Thermo Fisher) was brought in for total RNA isolation. Scientific kit was used (Cai et al., (2018) 'Plants send small RNAs in extracellular vesicles to fungal pathogen to silence virulence genes', Science (New York, NY), 360(6393), pp. 1126–1129). 1 mL TRIzol™ 15 on EV samples. Reagent was added and immediately processed with the MagNA Lyser (Roche, Germany) device. Homogenized at 4,000 rpm for 60 seconds. According to kit protocol. The samples, which have become completely homogenized, are left at room temperature for 5 minutes. after being incubated and transferred to a sterile, clean 1.5 mL microcentrifuge tube Then approximately 200 μL of chloroform was added. The homogenate was inverted and mixed 20 times. This allowed the contents to mix and incubated at room temperature for approximately 5 minutes. Afterwards, it was centrifuged at 4 °C and 12,000 g for 15 minutes. Centrifugation Of the resulting phases, the transparent uppermost phase is not mixed with the others. It was carefully transferred to a new 1.5 mL microcentrifuge tube. Containing RNA. 500 μL of isopropanol was added to the clear phase, the tube was inverted, and the contents were reduced to 25. It has been mixed. It has been left at room temperature for approximately 10 minutes. After incubation, the tubes were centrifuged at 4 °C and 12,000 g for 10 minutes. The supernatant formed at the end of centrifugation is the RNA pellet that settles at the bottom of the tube. The RNA pellet was removed and washed with 1 mL of 75% ethyl alcohol. The tubes were inverted. After being processed, the pellets were floated in alcohol and then subjected to a 5:30 test at 4°C and 7,500 g. It was centrifuged for minutes. After washing, the alcohol in the tube was completely removed. To remove them, the covers are opened and they are placed upside down inside the laminar flow cabinet. placed and the alcohol completely removed. Then, onto the RNA pellet 36 It was dissolved on a 37 °C dry heating block with 40 μL of ultra-pure water added. Isolated RNA samples were analyzed with DNase I (Thermo Scientific) enzyme at 37 °C for 15 minutes. The RNA isolate was incubated for [number] minutes. Subsequently, the RNA isolate was spectrophorometrically analyzed and... For fluorometric measurement, it was stored in a deep freezer at -86 °C. RNA The samples were spectrophotometrically analyzed using a NanoDrop 2000c (Thermo Scientific) instrument, 5 The measurements were taken fluorometrically using a Qubit 4.0 (Life Science) instrument, and the measurement results are as follows: It has been recorded. Cells that underwent different elicitor applications and cells belonging to the control group. The amounts of small RNA isolated from EVs obtained from suspensions are 10 SA, cold, heat, and nutritional deficiencies were evaluated compared to the control group. applications obtained from H. cordata cell suspension nutrient medium EVs It was determined that it did not provide a significant increase in the amount of RNA obtained (p<0.05). nutrient medium of cells incubated with different concentrations of MeJA The amount of RNA obtained from EVs was increased compared to the control group, and 15 The amount of small RNA obtained from the group incubated with 0.2 mM MeJA for 72 hours It was determined to be 3000 ng / µL, 1.9 times higher compared to the control group. Cells incubated for 72 hours with 0.2 mM MeJA, which yielded the highest small RNA. Suspension of small RNAs obtained from EVs by liposomal encapsulation and in vitro Activities have continued (Figures 4.A and 4.B). 20 b) Nutritional information from adult tissues and cell suspensions of H. cordata. Examination of the small RNA profile obtained from EVs in their environments H. cordata leaf and cell suspension culture nutrient medium (EVs) contained 25 Whether the small RNA profile is different can be determined using a transcriptomic experimental approach. RNA sequencing (RNA-Seq) analyses were performed on the isolated RNAs to demonstrate the findings. This was carried out. First, 7 μL of nuclease-free water was added to the isolated RNAs. The bioanalyzer pico RNA chip contains dissolved RNA integrity. Measurements were taken using (Agilent) and cDNA synthesis was initiated. Small RNA sequencing 30 As stated in the study by Matera et al. (2022), the library NEBNext® Small RNA Library Prep for Illumina kit protocol was followed. Protocol In short, it was carried out as follows; first, 3 μL of total RNA isolate was mixed in a 1:10 ratio. 37 Mixed with 1 μL of diluted 3' SR adapter and incubated at 70 °C for 2 minutes. was done. Then, 6.5 μL of 3' ligation mixture (5 μL of 3' ligation mixture) was added to each tube. Ligation buffer and 1.5 μL of enzyme (3') were added and incubated at 25 °C for 1 hour. After incubation, 2.75 μL of SR mixture (2.5 μL of nuclease) was added to each reaction. water (without additives) and 0.25 μL SR RT primer were added and incubated at 75 °C for 5 minutes, 37 minutes, 5 minutes respectively. Incubated for 15 minutes at °C, then for 15 minutes at 25°C. Pre-denatured. and a 1:10 diluted 5' adapter and 5' ligation mixture (0.5 μL of 5' ligation Reaction buffer, 1.25 μL of 5' ligation enzyme was added to each tube and 25 It was incubated at °C for 1 hour. The first strand is complementary DNA (English: first-strand). For cDNA synthesis, 5 μL of cDNA mixture was added to each tube and incubated at 50°C for 1-10 minutes. After being incubated for 1 hour, incubation is continued at 70°C for 15 minutes. The obtained cDNAs were subjected to PCR reaction. Sterile 0.2 mL A total reaction was performed in a PCR tube with 10 μL of cDNA, NEB index, and SR primers. volume 50 μL (25 μL LongAmp Taq 2x mixture, 12.5 μL nuclease-free water, The PCR mixture was prepared as follows: 1.25 μL SR primer, 1.25 μL index primer. The PCR reaction cycle in the Thermal Cycler (BioRad) device has been prepared as follows. This was carried out as follows: 30 seconds at 94°C for initial denaturation, 15 seconds at 94°C, 30 seconds... 20 cycles at 62°C and 70°C, with a final elongation of 5 minutes at 70°C. PCR result. The resulting amplicons were filled with AMPure XL (Beckman Coulter) beads. It has been purified and the amplicon length has been measured using a QIAxcel Advanced (Qiagen) device: 20 The products obtained after library preparation have been checked. Illumina NextSeq Sequencing was performed on the 500 platform in single-direction 50 base (SE50) mode. The sequencing reaction was performed via a service acquisition and is in the “.fastq” format. The new generation sequencing reads were processed on our computer in the lab. c) Bioinformatic analysis of small RNAs Adult leaf tissue and cell suspension found in EVs in nutrient medium. experimentally determining whether the composition and dynamics of small RNA are different A next-generation sequencing reaction was performed to determine this, and “.fastq” 30 Raw readings were obtained in the specified format. The results of the sequencing reaction were obtained. Raw reads are primarily from fastp tool v0.20.1 (Chen et al., (2018) 'fastp: an ultra-fast all- 38 in-one FASTQ preprocessor', Bioinformatics (Oxford, England), 34(17), pp. i884– The i890 software has undergone a filtering process and is ready for high-quality analysis. Clean reads have been obtained. The quality control and filtering process is as follows: The steps include: (i) Phred score 20 ( <Q20)’den az olan okumaların exclusion from analysis, (ii) longer than 30 nt (nucleotide) and shorter than 18 nt 5 (iii) removal of sequences and (iv) trimming of adapter sequences Readings containing (“N”) are excluded from the analysis. The resulting high-quality reading is obtained. reads mirDeep2 (Friedländer et al., (2012) 'miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades', Nucleic Acids Research, 40(1), pp. 37–52.) software includes “collapse_reads.pl” 10 clustered with a script file and planted with BlastN (-task “blastn-short”) software. miRBase v22.1 containing microRNAs (Kozomara et al., (2019)) 'miRBase: from microRNA sequences to function', Nucleic Acids Research, 47(D1), pp. D155–D162) is aligned to the database (1e-10). Thus, within EV The known miRNA composition involved has been revealed. In addition, the known and more than 15 Previously unidentified miRNA (English: Novel) miRDeep-P2 v.1.1.4 (Kuang et al., (2019)) 'miRDeep-P2: accurate and fast analysis of the microRNA transcriptome in plants', with the software Bioinformatics (Oxford, England), 35(14), pp. 2521–2522) It has been identified. Found in adult leaf tissue and cell suspension EVs. Statistically significant miRNAs observed at the miRNA expression level in DEUS 20 (Jeske et al., (2019) 'DEUS: an R package for accurate small RNA profiling based on differential expression of unique sequences', Bioinformatics (Oxford, England), 35(22), pp. 4834–4836.) and edgeR v3.30.3 (Robinson et al., (2010) 'edgeR: a Bioconductor package for differential expression analysis of digital gene expression data', Bioinformatics (Oxford, England), 26(1), pp. 139–140) software 25 This was determined by (R-adjusted p-value ≤ 0.05 and log2FC ≥ 1.0). Located within EV. Other potential small RNA types include tRNA, rRNA, snoRNA, and others. Non-coding RNA is processed using the BlastN (-task “blastn-short”) software. Rfam v14.2 (Kalvari et al., (2020) 'Rfam 14: expanded coverage of metagenomic, viral and microRNA families', Nucleic Acids Research, 49(D1), pp. D192–D200) 30 The database has been aligned and identified (1e-10)." 39 The main subject of our patent application is H. cordata cell suspension nutrition. microRNAs in EVs obtained from the environment and adult leaf tissues This suggests that the small RNA profile and dynamics, including that involved, are different. Thus, in the early-adult developmental stage (cell suspension and developed leaf) (tissue) Due to the different small RNA profiles contained in EVs; these small RNAs 5 The potential for regulating gene expression in mammalian cells also differs. It exhibits. Accordingly, 3 H. cordata cell suspensions and 3 units Small RNA profiling from EV isolated from adult H. cordata leaf tissue. All bioinformatic analyses were performed in our laboratory. This was carried out at the stations. 10 were obtained as a result of the small RNA sequencing reaction. Below are summary statistical data and information regarding the quality of the readings taken. as stated (Table 3, Figures 5.A, B, C, D and E). H. cordata cell suspension For samples obtained from EVs, a total of ~106 million one-way reads and 2.39 billion bases (nucleotides) were obtained from the group containing adult leaf tissue. In this case, approximately 226 million one-way reads and 6.34 billion bases (nucleotides) were obtained. 15 Table 3. EVs from H. cordata cell suspension and adult leaf tissues. Summary statistics for small RNA sequencing reactions. Example Name Reading Number Total Base Length k (bp) Q20(% ) Q30(% ) GC(% ) H_cordata_cell_ 1 23,755,17 0 513,555,385 50 99.31 98.26 52.02 H_cordata_cell_ 2 23,746,75 1 528,045,310 50 99.36 96.76 51.05 H_cordata_cell_ 3 59,493,74 1 1,355,224,40 7 50 99.86 99.46 52.13 H_cordata_leaf _1 69,103,06 8 1,525,792,74 2 50 99.86 99.45 52.41 H_cordata_leaf _2 88,233,22 3,236,138,77 8 50 98.93 96.71 47.12 H_cordata_leaf _3 69,554,32 0 1,580,853,83 0 50 99.86 99.44 52.05 The Phred Score (Q), which indicates the quality of the readings, must be at least 90% in all samples. It indicates that high-quality readings have been obtained and are ready for analysis. Figure 5 shows that the length of the readings is predominantly around 20-25 bases. No aggregation or adapter contamination was observed. Furthermore, 40 The read depth per sample is over 20 million, and the reads... The fact that almost all of them matched with miRNAs belonging to dicotyledons indicates contamination in our data. This indicates that it is not the case. 5 obtained from H. cordata cell suspension and adult leaf tissues The small RNA profile and dynamics, including microRNAs, in EVs are different. To experimentally demonstrate that this is not the case, different gene expression analyses (English) Differential expression analysis (DEG) was performed on H. cordata cells. suspension obtained from nutrient medium and adult leaf tissues MicroRNA dynamics (increased gene expression is “up-regulated”) and decreased gene expression in EVs 10 In determining the statistical significance of the "down-regulated" model, the following parameters are considered: The following values were obtained: adjusted P-value <0.05 and logarithmic multiplier. (English: fold-change) log2FC >2 and log2FC <-2. According to this analysis result, H. cordata In cell suspension nutrient medium-derived EVs, compared to adult leaf tissue... 15 This has been determined (Table 4). Table 4. H. cordata cell suspension nutrient medium and adult leaf tissue. Statistically significant expression of miRNAs obtained from EVs. Comparison of levels. (Hco: H. cordata) 41 Expression miRNA padj log2FoldChange pvalue stat foldChange log10padj UP- REGULATED –GENES Hco- miR169q 0.03232 13.08714 0.00307 0.03232 8702.07831 1.49059 Hco- miR169g 0.03507 12.80497 0.00402 0.03507 7156.13677 1.45502 Hco- miR169k 0.01072 12.23012 0.00034 0.01072 4804.31571 1.96960 Hco- miR5038b 0.03757 12.15791 0.00566 0.03757 4569.76848 1.42521 Hco- miR408c 0.01072 12.11605 0.00036 0.01072 4439.08457 1.96960 Hco- miR169r 0,00983 11,99731 0,00021 0,00983 4088,37119 2,00734 Hco- miR5678 0,00983 11,49864 0,00018 0,00983 2893,58951 2,00734 Hco- miR156i 0,03232 11,14865 0,00312 0,03232 2270,27101 1,49059 Hco- miR169o 0,04379 10,93896 0,00755 0,04379 1963,15089 1,35858 Hco- miR5036a 0,03634 10,62350 0,00482 0,03634 1577,58134 1,43962 Hco- miR408d 0,01192 10,26593 0,00063 0,01192 1231,26532 1,92374 Hco- miR164i 0,01072 10,24288 0,00029 0,01072 1211,75099 1,96960 Hco- miR171s 0,01141 10,15266 0,00055 0,01141 1138,29361 1,94253 Hco- miR162b 0,04379 10,09937 0,00742 0,04379 1097,01997 1,35858 Hco- miR396c 0,00347 9,98197 0,00005 0,00347 1011,28533 2,46019 Hco- miR399j 0,01072 9,81827 0,00039 0,01072 902,80727 1,96960 Hco- miR10440 0,02118 9,71939 0,00135 0,02118 842,99919 1,67418 Hco- miR160i 0,01072 9,62452 0,00040 0,01072 789,34925 1,96960 Hco- 0,00983 9,57184 0,00022 0,00983 761,04346 2,00734 42 miR165 Hco- miR1511 0,01141 9,05225 0,00054 0,01141 530,88406 1,94253 Hco- miR399d 0,03757 8,63859 0,00585 0,03757 398,54216 1,42521 Hco- miR399q 0,03232 8,42464 0,00243 0,03232 343,61396 1,49059 Hco- miR319c 0,01141 8,39585 0,00056 0,01141 336,82362 1,94253 Hco- miR169a 0,01072 8,25402 0,00041 0,01072 305,28732 1,96960 Hco- miR399g 0,02837 7,98962 0,00196 0,02837 254,16415 1,54709 Hco- miR4413b 0,03232 7,93508 0,00269 0,03232 244,73548 1,49059 Hco- miR160d 0,02129 7,88409 0,00141 0,02129 236,23673 1,67191 Hco- miR395k 0,01769 7,80349 0,00103 0,01769 223,40050 1,75235 Hco- miR171f 0,03232 7,67708 0,00254 0,03232 204,65931 1,49059 Hco- miRN1346 0,03232 7,53734 0,00295 0,03232 185,76569 1,49059 Hco- miR4416b 0,04660 7,53439 0,00824 0,04660 185,38614 1,33160 Hco- miR171q 0,01141 7,27939 0,00057 0,01141 155,35087 1,94253 Hco- miR5669 0,03232 7,12104 0,00260 0,03232 139,20202 1,49059 Hco- miR9750 0,03507 6,65820 0,00426 0,03507 100,99903 1,45502 Hco- miR4414 0,03518 6,38947 0,00448 0,03518 83,83457 1,45373 Hco- 0,03318 5,85721 0,00348 0,03318 57,96896 1,47915 43 miR1510a Hco- miR1515b 0,04819 5,84968 0,00865 0,04819 57,66723 1,31709 Hco- miR156f 0,01769 5,71967 0,00098 0,01769 52,69762 1,75235 Hco- miR164e 0,03232 5,71234 0,00290 0,03232 52,43074 1,49059 Hco- miR159a 0,03232 5,39060 0,00280 0,03232 41,94996 1,49059 Hco- miR5786a 0,03208 5,30290 0,00230 0,03208 39,47600 1,49374 Hco- miR167g 0,03507 5,28559 0,00419 0,03507 39,00502 1,45502 Hco- miR319i 0,03352 5,23130 0,00370 0,03352 37,56455 1,47464 Hco- miR397b 0,03507 5,21108 0,00423 0,03507 37,04176 1,45502 Hco- miR156o 0,03692 5,18563 0,00510 0,03692 36,39396 1,43273 Hco- miR171m 0,03290 5,08811 0,00336 0,03290 34,01528 1,48284 Hco- miR160b 0,03776 4,99972 0,00605 0,03776 31,99390 1,42296 Hco- miR408a 0,03757 4,88918 0,00574 0,03757 29,63391 1,42521 Hco- miR5781 0,02108 4,82142 0,00128 0,02108 28,27437 1,67607 Hco- miR319l 0,03757 4,77008 0,00591 0,03757 27,28582 1,42521 Hco- miR1508a 0,04379 4,75201 0,00762 0,04379 26,94612 1,35858 Hco- miR319h 0,03782 4,73735 0,00616 0,03782 26,67384 1,42223 Hco- 0,03757 4,73014 0,00566 0,03757 26,54078 1,42521 44 miR159g Hco- miR2606b 0,03757 4,68468 0,00585 0,03757 25,71761 1,42521 Hco- miR159i 0,03757 4,67983 0,00555 0,03757 25,63119 1,42521 Hco- miRN1286 0,03692 4,40048 0,00503 0,03692 21,11914 1,43273 Hco- miR171c 0,04950 4,37768 0,00903 0,04950 20,78802 1,30535 DOWN- REGULATED –GENES Hco- miR157g 0,00001 -11,04041 0,00000 0,00001 0,00047 4,95232 Hco- miR395b 0,00219 -10,43091 0,00002 0,00219 0,00072 2,66008 Hco- miR390g 0,00219 -10,49049 0,00002 0,00219 0,00070 2,66008 Hco- miRN1303 0.00219 -10.59533 0.00002 0.00219 0.00065 2.66008 Hco- miR319b 0.03290 -5.29839 0.00329 0.03290 0.02541 1.48284 Hco- miR394d 0.03352 -4.17374 0.00363 0.03352 0.05541 1.47464 Hco- miR1535 0.03518 -5.81034 0.00457 0.03518 0.01782 1.45373 Hco- miR398b 0.03518 -8.86091 0.00446 0.03518 0.00215 1.45373 Hco- miR171l 0.04206 -7.14815 0.00697 0.04206 0.00705 1.37617 45 According to the gene expression analysis results, H. cordata cell suspension from nutrient medium and microRNA expression in EVs obtained from adult leaf tissues It is observed that the levels are different. Therefore, the cell suspension nutrients the composition of small RNA types, such as miRNA, within the environment differs This means that miRNAs in EVs present in the cell suspension also target 5. This indicates that it can affect genes in the cell at different levels. d) Encapsulation of small RNAs To ensure the stability of small RNAs, they must be placed in a cationic liposome (10). Encapsulation has been performed. The encapsulation process steps are described by Wu et al., (2011, 'MicroRNA delivery by cationic lipoplexes for lung cancer therapy', According to the protocol used by Molecular Pharmaceutics, 8(4), pp. 1381–1389.) This was carried out. The final concentration will be 10:90 (ethanol / water), with ethanol... Lipid mixture inside (DOTMA: cholesterol: TPGS = 49.5:49.5:1) 20 mM HEPES 15 Empty liposomes were prepared by injecting them into a buffer (pH=7.4) containing H. cordata. Small RNAs (3 mg / mL) obtained from cell suspension EVs, empty liposomes It was added to the mixture at a final concentration of 1 mg / mL, and the mixture was placed at room temperature. Incubated at [temperature] for 15 minutes. Encapsulated by liposomes. The small RNAs obtained were used in in vitro studies. 20 7. In vitro Activity of H. cordata Cell Suspension Extract and Small RNAs Tests a) Effect on Cell Viability: 25 H. cordata cell suspension extract (HE), H. cordata cell suspension small cells obtained from nutrient medium-derived EVs and encapsulated in liposomes The combined application of RNAs (L, E small RNA) and HE and LE small RNAs. Its effect on cell viability was studied on human normal fibroblast cells (CRL-2076) for 30 days. It has been determined that cell culture incubation procedures are performed at 37 °C with 5% CO2. This was carried out in an incubator. Human fibroblast cells were placed in a 24-well plate. 46 They were seeded at a ratio of 1x10⁵ cells / well. After 24 hours of incubation... The nutrient media in the wells were removed and replaced with specific doses of the extract. Nutrient medium suspensions were added. Cells were incubated with extracts for 48 ± 0.5 hours. After incubation, the extract-nutrient medium solution in the wells removed and MTT-nutrient medium with a final concentration of 5 mg / mL was added to the wells. The suspension was added and the plates were incubated for 3±0.1 hours. Finally, the MTT-nutrient medium solution on the plate is removed, and the live cells are left behind. DMSO was added to each well to dissolve the formazan salts that had formed. The plates were left in the plate shaker for 15 minutes. Afterwards, the plates were OD Optical density (OD) values were read at 570 nm. The results obtained are 10. By evaluating and exposing control cells to specific doses of the substance. The viability levels of the released cells were determined. The experimental setup was blind. Wells that will contain only a nutrient medium will not be exposed to any other substances. wells containing unreleased control cells and various doses of the substance It was designed to have wells containing exposed cells. 15 According to in vitro cytotoxicity results, H.E. was 125 and 200 μg / mL compared to the control. While no significant change was observed at the dose, at doses of 250, 400 and 500 µg / mL Increases of 3%, 4%, 5%, and 9% were determined respectively (Figure 6). According to the in vitro cytotoxicity assay results of LE small RNA, 25, 50 and 100 Concentrations of μg / mL increased cell viability by 4%, 6%, and 10%. determined (Figure 7). In the combined application of HE and LE small RNAs, cell viability was checked at 25°C. Compared to the group, 15% in the application of 250 μg / mL HE + 50 μg / mL LE small RNA, In the application of 500 μg / mL H.E + 100 μg / mL LE small RNA, the concentration was 25%. has increased (Figure 8). Based on in vitro cytotoxicity test results, 30 in in vitro efficacy tests H.E. at 250 and 500 µg / mL and LE small RNA at 50 and 100 µg / mL Concentrations were used. 47 b) Genetic anti-aging, wound healing and anti-hair loss activity Determination at the level by RT-qPCR analysis: Human fibroblast cells will be placed in 25 cm2 cell culture flasks at a rate of 5x10⁵ cells / flask. After being seeded in this manner, they were incubated for 24 hours. At the end of this period, 5 cells were obtained from each cell. The serum-containing nutrient medium was removed and the flasks were filled with serum-free nutrient medium. Prepared extracts and / or small RNA doses were administered. 48-hour incubation. Afterwards, RNA was isolated from the cells in the flasks using an RNA isolation kit. The obtained RNAs were used to synthesize cDNA. Subsequently, H. cordata Cell suspension extract and small RNAs have anti-aging and wound healing properties. 10 and COL1A1, COL3A1, TGFβ1, VEGF, NF-KB and associated with anti-inflammatory activity TNFα genes are associated with 5 SRDA2 (5 α-Reductase) and anti-hair loss activity. Effect of β-catenin (beta-catenin) gene expression on SYBR green method The genes mentioned were analyzed using RT-qPCR. The mechanisms are listed below: 15 TGFβ1 (Transforming Growth Factor Beta 1): Stimulates fibroblasts and It suppresses inflammation and initiates the wound healing process. Additionally... Neovascularization, extracellular matrix accumulation in tissue formation, and many other factors. It organizes the cellular response (Wang et al., (2013) 'Effects of TRAP-1-like 20 protein (TLP) gene on collagen synthesis induced by TGF-β / Smad signaling in human dermal fibroblasts', PloS One, 8(2), p. e55899). VEGF (Vascular Endothelial Growth Factor): During wound healing It provides epithelialization and collagen formation (Wahyuningsih et al. (2019) 25 'Ethanolic Extract Of Tithonia Diversifolia (Hemsley) A. Gray Inhibits Migration Activity And Decrease The Transforming Growth Factor-Beta1, Vegf Expression On Keloid Fibroblasts', Asian Journal of Pharmaceutical and Clinical Research, 12(1), p. 342). COL1A1 (Collagen 1 alpha 1): The COL1A1 gene is responsible for collagen type 1 synthesis in many tissues. Collagen is the most fundamental component of connective tissue and is found in all tissues of the body. 48 Collagen type 1 (COL1A1) makes up 70% of collagen. COL1A1 plays a role in the wound healing process. This is expressed at every stage (Inkinen, (2003) 'Connective Tissue' Formation in Wound Healing An experimental study'.). COL3A1 (Collagen 3 alpha 1): Along with COL1A1, it is involved in wound healing in soft tissues. It promotes healing. It constitutes 20-50% of the collagen content in adults. (Inkinen, (2003) 'Connective Tissue Formation in Wound Healing An experimental study'.). TNFα (Tumor Necrosis Factor alpha): Inhibits collagen formation and collagenase 10. stimulates its synthesis (Chou et al., (1996) 'TNF-alpha inactivation of collagen receptors: implications for fibroblast function and fibrosis', Journal of Immunology (Baltimore, Md.: 1950), 156(11), pp. 4354–4362.). NF-KB (Nuclear factor kappa B): NF-KB is involved in the wound healing process. to increase proliferation and adhesion and inflammation and reactive oxygen It plays a role in reducing the effect of derivatives (Park et al., (2018) 'NF-κB signaling is key in the wound healing processes of silk fibroin', Acta Biomaterialia, 67, pp. 183–195). SRD5A2 (5α-Reductase); 5-alpha-reductase is an enzyme that reacts with the hormone testosterone. interacting with each other to form dihydrotestosterone, a more potent androgen. It is converted to (DHT). VEGF (Vascular Endothelial Growth Factor): A capillary that nourishes the hair follicle. It helps in the formation of blood vessels. β-catenin (CTNNB1): Participates in the Wnt-β catenin signaling pathway in the hair follicle. It plays a role in regeneration and the continuity of the anagen phase. 49 RNA isolation: RNA isolation was performed according to the protocol recommended by the manufacturer (EZNA). Total RNA Kit 1 (Omega Bio-tek). Cells were individually transferred from flasks to trypsin-EDTA. It was removed and centrifuged. After centrifugation, 700 5 was applied to the resulting pellet. µL lysis buffer (TRK lysis buffer) and 20 µL β- for every 1 mL of lysis buffer Mercaptoethanol was added. To homogenize the cell lysate, 1 mL of the lysate was added. magNa lyser (Roche) placed in a centrifuge tube with beads inside. It was homogenized in the device for 45 seconds. An equal volume of 70% ethanol was added to the lysate. The samples were added and carefully mixed by pipetting. The samples were transferred to spin columns and 10 It was centrifuged at 12000 rpm for 30 seconds. This allowed the lysate to be attached to the spin column. It was provided and removed to the bottom of the collection tube. 500 µL was added to the column. Washing solution-1 is added, centrifuged at 12000 rpm for 30 seconds, and left at the bottom. The collected fluid was carefully removed. The columns were washed twice with 500 µL. The columns were washed with solution 2. For the drying process, the columns were transferred to a new collection tube 15 The samples were centrifuged at 14000 rpm for 1 minute. Columns for RNA elution were 1.5 After transferring to a mL capped microcentrifuge tube and adding 40 µL of water to the column... Then it was centrifuged at 12000 rpm for 2 minutes. In the RNA elution process, RNA The molecules are washed with water through the column filter and transferred to the microcentrifuge tube. The collection of these items has been ensured. 20 cDNA synthesis: The determined quantities of RNA parent stocks were diluted to 1000 ng with distilled water to create intermediate stocks. RNAs were prepared. The concentration of RNA intermediate stocks was reduced to 100 ng, then 25 cDNA kit (High-Capacity cDNA Reverse Transcription Kits, Applied Biosystems) cDNA synthesis was performed according to the procedure recommended by the manufacturer. The procedure used for its synthesis is listed below in steps: 1. The kit components were thawed on ice. 30 50 2. For each cDNA synthesis reaction, the cocktail given in Table 5 is prepared on ice. It has been prepared. 3. Gently add 10 µL of 100 ng / µL RNA samples to each prepared cocktail. The contents were transferred via pipetting. The tubes, with their volume and components completed, were then placed in Thermal Cycler 5 tubes. It was kept on ice until it was transferred to the (T100, Biorad) device. 4. Finally, the tubes were placed in a Thermal Cycler device at 25°C for 10 minutes, then at 37°C for 120 minutes. cDNA synthesis was achieved by incubating for 5 minutes at 85 °C. Table 5. Components of the cDNA Synthesis Reaction. Components Quantities 10X RT Buffer 2 µL 25X dNTPMix (100 mM) 0.8 µL 10X RT Random Primers 2 µL Multi Scribe Reverse Transcriptase 1 µL Nuclease-Free H2O 4.2 µL Total cocktail volume: 10 µL 5. The obtained main stock cDNAs were diluted 25-fold and subjected to RT-qPCR studies. TGFβ, VEGF, COL1A1, COL1A3, NF-KB, TNFα, SRD5A2 and were used. Expression levels of CTNBB1 genes were determined using the primer pairs specified in Table 6. using SYBR green (PowerUp SYBR Green Master Mix, Applied 15 This was determined using the Biosystems method. 6. Expression levels of target genes relative to the expression level of the reference gene (ACTN). Ratiodized and normalized according to the 2 -∆∆CT method (Schmittgen and Livak, 2008). Fold changes were determined by analyzing gene expression. 20 The primer sequences used are given in Table 6. Table 6. Reverse and forward primer sequences of genes. Primer Code Sequence TGFβ.-Forward AACCCACAACGAAATCTATGAC TGFβ -Reverse TTCTCGGAGCTCTGATGTG 51 VEGF-Forward GTATAAGTCCTGGAGCGTG VEGF-Reverse TTGTCACATCTGCAAGTACG COL1A1-Forward CTGGAAGAGTGGAGAGTACTG COL1A1- Reverse GTCTCCATGTTGCAGAAGAC COL3A1-Forward CAAGAGTGGAGAATACTGGGT COL3A1- Reverse CCCAGTTTCCATATTACAGAAT ACC NF-KB-Forward CCATCTATGACAGTAAAGCCC NF-KB- Reverse AATCCTTCCCAGACTCCAC TNFα-Forward CTCTAATCAGCCCTCTGGC TNFα-Reverse GAGGGTTTGCTACAACATGG SRD5A2 Forward ATGCTATCTTACGATTAC SRD5A2 Reverse TACCGATTACATACCATAGCT CTNNB1 Forward CATGTATTACATATATTTACGCT CTNNB1 Reverse TATCGATTACATGCTTCGATAC G ACTN Forward CCAGAATCATGGTTTCCATAT ACTN Reverse ACTGCTAATACGATTACGTTA RT-qPCR analysis: RT-qPCR 5 is used to determine gene expression levels using the SYBR Green method. The cocktail is described in Table 7. Table 7. Preparation of the RT-qPCR cocktail. Quantity of Materials SYBR Green Master Mix 5 µL Forward Primer 0.5 µL Reverse Primer 0.5 µL Nuclease-free H2O 1.5 µL Total cocktail volume: 7.5 µL 1. The prepared cocktail is added to an RT-qPCR 96-well microplate, with 10 in each well. It is distributed in amounts of 7.5 µL. 2. Next, the cDNAs will be placed in wells, with 3 technical replicates for each reaction. The volume was increased by adding 2.5 µL at a time until a final volume of 10 µL was obtained. 3. The microplate was centrifuged at 1500 rpm for 2 minutes. 52 4. Finally, in the RT-qPCR device, the thermal protection recommended by the SYBR green manufacturer should be applied. The reaction was carried out by ensuring the cycle (Table 8). Table 8. Thermal cycling used in RT-qPCR analysis. Detection format: Cyber Green Program name: Cycles Analysis mode UDV Activation 1 None Dual-Lock DNA Polymerase 1 None Annealing 40 Quantific ation Melting 1 Melting Curves Cooling 1 None Sıcaklık Hedefleri Sıcaklık (0C) Acqusiti onMode Hold (hh:mm: ss) Ramp Rate(0C / s) UDG Activation 50 None 00:02:00 4.4 Dual-Lock DNA Polymerase 95 None 00:02:00 4.4 Anneling 95 None 00:00:15 4.4 58 None 00:00:15 2.2 72 Single 00:01:00 4.4 Melting None 00:00:15 1.6 53 None 00:01:00 1.6 Continio base 0.11 Cooling 40 None 00:00:10 2.2 When the RT-qPCR analyses performed were evaluated, it was associated with anti-aging activity. HE or LE minor changes in the expression of the genes COL1A1, COL3A1 and TGFβ. In RNA applications, the dose-dependent increase compared to the control group was 5. It has been determined that the combined application of HE and LE small RNAs is superior to other applications. (only in HE or LE small RNA application) compared to the expression of the relevant genes It was observed that the highest rate of increase occurred (Figure 9.A, B and C). The expression of VEGF, a gene associated with wound healing, was 10 times higher compared to the control group. Dose-dependent increase in HE and LE small RNA applications. This has been shown. HE and LE showed small changes in VEGF gene expression within the interventions. The greatest dose-dependent increase was observed with co-administration of RNA. HE application affects the expression of NF-KB and TNFα genes, which are associated with wound healing. A dose-dependent decrease was determined. The expression of these genes was 15 in the control group. Compared to small RNA administration, LE decreased in a dose-dependent manner, at most. The decrease occurred with the combined administration of HE and LE small RNAs. determined (Figure 10.A, B and C) The expression of 5α reductase, one of the genes associated with anti-hair loss activity, is higher in HE 20. and LE small RNA decreased in a dose-dependent manner, while HE and LE small RNA decreased together. The greatest reduction was observed in the application of hair follicle stimulation. The expression of β-catenin, a gene associated with the mechanism, was higher in the control group compared to the control group. HE and LE levels increased in a dose-dependent manner with small RNA applications. In the co-administration of small RNA, it reaches its highest level at 25. determined (Figure 11.A, B and C). 54 Anti-aging effects were determined at the protein level using the western blot method. determination: Human normal fibroblast cells are placed in 25 cm2 cell culture flasks at a rate of 5x10⁵ cells / flask. After being seeded, the samples were incubated for 24 hours. At the end of this period, 5 samples were taken from the flasks. The serum-containing nutrient medium has been removed and replaced with a serum-free medium. H. cordata cell suspension extract and / or small RNA concentrations The procedure was performed. After 48 hours of incubation, RIPA lysis was performed on the cells in the plates. using buffer (RIPA Lysis Buffer system, Santa Cruz Biotechnology) Protein isolation was performed. 10 The steps for protein isolation are listed below: 1. For every 1 ml of RIPA Buffer; 10 µL PMSF (phenylmethylsulfonyl fluoride), 10 μL sodium orthovanadate solution and 10-20 μL protease inhibitor cocktail 15 It was added from the solution. 2. For protein isolation, the cells in the flask were washed with PBS, then 700-800 µL of 0.25% Trypsin-EDTA was added to the cells, and the cells It was incubated in a 37°C incubator until it separated from the flask surface. The cells were collected in the medium in a centrifuge tube. 20 3. To precipitate the cells, the tubes were centrifuged at 125 g for 5 minutes. 4. After centrifugation, the supernatants were removed by vacuum. Afterwards... The cells were washed with PBS and centrifuged again. 5. After centrifugation, the supernatants were removed again. 6. One mL of RIPA buffer was added to each tube, and the tubes were left to incubate for 30 minutes. It was incubated on ice. 7. After incubation, the samples were transferred to microcentrifuge tubes, and the tubes were... 10,000 g was centrifuged for 10 minutes at 4 °C. 8. The supernatants were transferred to new microcentrifuge tubes and the date and sample name were recorded. It is labeled as 30. 55 Determining Protein Amounts with a BCA Kit: Protein levels were determined using a BCA kit. This was done according to the kit's recommendations. Solutions were prepared (Table 9). Table 9. Preparation of BSA Standards Tube Dilue To be done Amount To be added BSA amount Final Concentration 1 0 From stock 300 µL 2000 µg / mL 2 x 125 µL from stock, 375 µL 1500 µg / mL 325 µL from stock, 325 µL 1000 µg / mL 4 tubes of 325 µL each. µL is taken. 500 µg / mL 325 µL Tube 4 to 325 µL is taken. 250 µg / mL 6 tubes of 325 µL each. µL is taken. 125 µg / mL 7 x 400 µL Tubes 6 to 100 µL is taken. µg / mL 8 400 µL 0 0 µg / mL = blank Study Solution 50 units A solution 1 unit B solution 51 units of work solution 1. 25 µL of protein samples were added to microplate wells. 2. 200 µL of working solution was added to each well, and the plate was gently pressed down. It is mixed. 3. Afterwards, the plate was incubated at 37 °C for 30 minutes. Incubation Once completed, the plate was left to cool at room temperature. 4. Finally, the plate was read at 562 nm on a microplate reader. 5. Standard curve 15 is determined using the measured absorbance values. protein concentrations in the samples were determined according to a standard curve. It has been calculated. 56 Separation of proteins using SDS PAGE: 1. Cell lysates were mixed with 2x electrophoresis sample buffer in equal volumes. (2x Sample Buffer 125 mM Tris pH 6.8, 4% SDS, 10% Glycerol, 0.006% Bromophenol blue, 1.8% β-markaptoethanol) and denatured at 94°C for 3-5 min. 5 2. Each well of the gel was loaded with 30 µg of protein. 3. Continue mixing the samples with bromophenol blue until they reach the bottom of the gel. The samples were processed using an electrophoresis system. Protein Blotting: 10 Proteins were processed using a semi-wet blotting device (Biorad-Transblot Turbo Transfer System) PVDF membrane was blotted. 1. The PVDF membrane was wetted with methanol for 15 seconds. 2. The membrane was immersed in deionized water for 2 minutes. 15 3. 5 min in membrane transfer buffer (25 mM Tris, 20% Methanol, pH 10.4). It was kept waiting throughout. 4. One filter paper is moistened with transfer pad and placed in a semi-wet blotting machine. It is placed on the surface. 5. Place SDS-PAGE gel 20 onto the PVDF membrane on top of the filter paper at the bottom. It was inserted and a new filter paper was placed on top. 6. Next, the device was connected to the power supply and the data transfer was completed. Membrane Blocking: 1. The membrane has been removed from the blocking device and the blocking buffer solution has been removed. (5% non-fat milk powder, 10 mM Tris pH 7.5, 100 mM NaCl, 0.1% Tween 20) It has been received. 2. Membrane blocking buffer solution at 37°C for 30 minutes, room temperature. It was incubated at [temperature] for 1 hour or overnight at 4°C. 30 57 Primary Antibody Administration: 1. Primary antibodies (TGFβ, VEGF, COL1A1, COL1A3, NF-κB and TNFα) blocking The buffer solution is diluted in it to the manufacturer's recommended concentration. 2. Removed from the membrane blocking solution and mixed with the primary antibody 5 It was shaken and incubated overnight at 4°C. Secondary Antibody Administration: 1. The primary antibody solution is discharged and 10 is applied to coat the surface of the membrane. Washing buffer was added (10 mM Tris pH 7.5, 100 mM NaCl, 0.1%). Tween 20) and the membrane were rinsed by shaking for 30 minutes. Washing The tampon was changed every 10 minutes, and this process was repeated 3 times. 2. Secondary antibodies are added to the washing buffer at the ratios recommended by the manufacturer. It has been diluted. 15 3. The washing buffer was drained and secondary antibody solution was added. Membrane secondary antibody solution at 37°C for 30 minutes or at room temperature. It was incubated for one hour. Chemulinative Imaging: 20 1. After the incubation period is complete, remove the membrane from the petri dish. The secondary antibody solution was drained and washing buffer was added to the petri dish. The membrane was rinsed by shaking for 30 minutes, and the washing in the petri dish... This process was repeated 3 times, with the tampon being changed every 10 minutes. 25 2. Afterwards, the washing buffer was drained from the petri dish and the membrane was removed. a clean container with chemiluminescence working solution (0.125 mL / cm2) The container is placed in position. Allow 1-5 minutes for the solution to coat the membrane surface. It has been shaken in a shaker. 3. Finally, the resulting protein bands are scanned in a chemiluminescence device for 30 minutes. It has been displayed. 58 Expression of COL1A1, COL3A1 and TGFβ proteins is mediated by HE and LE small RNA. Its effect increases with dose-dependent application, and with combined application (HE + LE is small). RNA was observed to have the highest protein expression levels (Figure 12.A, B and C). Expression of NF-κB and TNFα proteins was determined by HE and LE small RNA application. The decrease was dose-dependent, with the 5 that reduced protein expression the most. The application involves the combined application of HE and LE small RNAs. determined (Figure 13.A, B and C). a) Determining the Effect on Melanin Content 10 H. cordata cell suspension extract and small RNAs in vitro melanin The content experiments were performed on B16-F10 melanoma cells as described below. It was carried out according to the procedure: Day 1; B16-F10 cells are suspended in culture medium and 6 The cells were seeded into well plates at a density of 1 × 10⁵ cells per well. It was incubated for 24 hours in a 37°C incubator containing 5% CO2. Day 2; After the incubation period is complete, the medium on the culture is 20 Melanin synthesis occurs by aspiration while only nutrient medium is added to the control wells. For stimulation, 100 nM α-MSH was applied to all other wells and the cells were reactivated after 24 hours. It has been incubated. Day 3; After incubation, the nutrient medium in the wells was removed and 25 Wells were flushed with PBS. Control (no α-MSH applied) and α-MSH (only) When nutrient medium containing 10% FBS is added to the wells (which have been treated with α-MSH), The determined substance doses and positive results were obtained in other wells (where α-MSH application was performed). The test was applied and the plates were incubated for 48 hours. Day 4; After 48 hours of incubation with the substances, the cells were treated with trypsin / EDTA. The cells were removed from the wells and transferred to centrifuge tubes with 2 mL DMEM + 10% FBS. 59 The tubes were collected and centrifuged at 500 g for 5 minutes. The supernatant was removed with the help of vacuum. The cell pellets were drawn. 300 μL of 10% DMSO, 1N NaOH buffer was added to the cell pellets. After addition, the tubes were incubated at 80°C for 1 hour. Incubation time After completion, the lysates are transferred to the wells of the 96-well plate. Absorbances were measured at 475 nm in the microplate reader. 5 b) Determining its effect on tyrosinase activity. H. cordata cell suspension extract and small RNAs in vitro anti- The effects of tyrosinase activity on B16-F10 melanoma cells are described below in 10 cases. It was carried out according to the procedure: Day 1; B16-F10 cells enzymatically cultured (trypsin / EDTA). Removed from flasks and cell suspension centrifuged (5 in 123 g) (minutes). Then the cells were resuspended in culture medium. The cells were then seeded into 6-well plates at a density of 1 × 10⁵ cells / well. The cells were incubated for 24 hours in a 37°C incubator containing 5% CO2. Day 2; After the incubation period is complete, the medium on the culture By aspirating, melanin synthesis was reduced by 20% while only nutrient medium was added to the control wells. For stimulation, 100 nM α-MSH was applied to all other wells and the cells were reactivated after 24 hours. It has been incubated. Day 3; After incubation, the nutrient medium in the wells was removed and Wells were flushed with PBS. Control (no α-MSH applied) and α-MSH (25 only) When nutrient medium containing 10% FBS is added to the wells (which have been treated with α-MSH), other wells (treated with α-MSH) identified substance and positive control The plates were incubated for 48 hours after the doses were administered. Day 5; After incubation, cells were removed from the plate surface with trypsin / EDTA for 30 minutes. It has been removed. 60 The cells were transferred from the wells to centrifuge tubes with 2 mL of DMEM + 10% FBS. The tubes were collected, centrifuged at 500 g for 5 minutes, and the supernatant was removed using vacuum. It has been photographed. • Each cell pellet was treated with 1% Triton X100 and 100 μM PMSF. 270 μL of prepared lysis buffer was added (Buffer 50 mM PBS, pH 5 (Prepared within 7.4 hours). • Tubes containing lysate were centrifuged at 17500 g for 10 minutes at 4°C. It has been done. • Supernatants were collected in microcentrifuge tubes. Each tube contained 90 μL. To the supernatant, 10 μL of L-DOPA (2 mg / mL) was added and the mixture was prepared in 10 wells of 96 wells. It has been transferred to the license plate. • Incubate the plate in a microplate reader at 37°C for 30 minutes. After that, 5 measurements were taken at 475 nm, every 10 minutes. It has been received. • The absorbance values obtained indicate the tyrosinase activity of the cells. Suppression percentages have been calculated. %Tyrosinase Activity: Abs control - Abs sample x100 / Abs control %Tyrosinase Inhibition Activity: 100-%Tyrosinase Activity Melanoma cell melanin content and tyrosinase activity experiments 20 When evaluated, HE and LE cells were compared to cells treated only with α-MSH. In cells treated with small RNA, melanin content and tyrosinase activity were determined by dose. It has been determined that it decreased depending on the administration of HE and LE small RNA together. Melanoma cells, on the other hand, have the lowest amount of melanin and tyrosinase activity. observed (Figure 14 and Figure 15). 25 c) Determining the Cellular Senescence Effect H. cordata cell suspension extract and antisensation of small RNAs 30 Their activities were determined by the SA-β Galactosidase staining method. In the experiment, 2 mM MgCl2, 0.1 X-gal, 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 61 mM NaCl was prepared in 400 mM citric acid / sodium phosphate buffer (pH 6) SA-β Galactosidase solution was used. Human fibroblast cells are placed in 25 cm2 cell culture flasks at a rate of 5x10⁵ cells / flask. They were seeded in this way and incubated for 24 hours. At the end of the period, serum-based nutrient solution was added. The medium was removed, and H. cordata cells were prepared with serum-free medium. Suspension extract and / or small RNA doses were administered. 48 hours After incubation, the cells in the flasks; • It was washed twice with PBS (phosphate-buffered saline). 10 • Incubate with 4% paraformaldehyde solution for 5 minutes at room temperature. It has been done. • It was then washed two more times with PBS. • After washing, cells were stained with 2 mL of SA-β galactosidase. treated with the solution and incubated with dye for 12-16 hours. It has been done. The cells produce the lysosomal β-galactosidase enzyme as a result of metabolic activity. They produce. As cells age, lysosomal mass increases, and consequently, lysosomal There is also an increase in β-galactosidase levels. The β-galactosidase enzyme in the cell is 20. activity of the chromogenic substrate 5-bromo-4-chloro-3-indolyl βD-galactopyranoside (X- SA-β gal) is used to determine this. SA-β gal positive cells are identified under a light microscope. It takes on a blue-green color. Compared to the control group, those treated with hydrogen peroxide (H2O2) As the amount of senescence increases in the cells, HE and LE small RNA are present in addition to H2O2. The blue-green color appearance was reduced in the application. HE and LE were added to the cells in small amounts (25). When RNA is administered concomitantly, a dose-dependent senescence marker, blue- It was determined that the green color decreased the most (Figure 16). 62 d) Determining the protective effect against DNA damage. H. cordata cell suspension extract and small RNAs' effect on DNA damage. Protective effects were determined using the Comet method. The Comet method... The steps are explained below: 5 The frosted slide was cleaned and dried before use with ethanol. The slide was immersed in low-temperature melt agarose (LMP) and then The agarose was removed by wiping the back of the slide with a cloth. The slides were left to dry. The cells were left to stand overnight at room temperature. The cells were removed from the culture flasks 10 The concentration was removed with trypsin to 1 x 10⁶ cells / mL. 10 µL cell suspension. and mixed with 120 µL of LMP (low melting point) agarose, prepared the night before. LMP agarose was added to the slides and covered with a coverslip. After drying, the coverslip was removed. Lysis was performed 1 hour beforehand at 2-8 °C. The slides were slowly lowered into the solution. The slides were left to steep for a minimum of 1 hour and a maximum of 24-15 minutes. The slides were left in the lysis solution for 20 hours. The slides were placed in the electrophoresis solution for 20 hours. After being left for a few minutes, it was placed in the electrophoresis tank. Electrophoresis Add electrophoresis solution to the tank so that it covers the slides by 1-2 mm. It has been added. Care has been taken to place the slides close to the anode section. Electrophoresis was performed at 2-8 °C, 25V 300 mA for 30 minutes. 20 After the electrophoresis process, neutralization was applied to the slides twice for 5 minutes each time. The solution was dropped onto the slide. 100 µL of PI dye (10 µg / mL) was placed directly onto the slide. Paint was added and left for 20 minutes. Excess paint was washed away. The slides were viewed and examined under a fluorescence microscope. When the images obtained from the Comet experiment were evaluated, only MMC MMC with HE and LE small RNA administration compared to (mitomycin C) administration It has been determined that the DNA tail shortens in cells due to DNA damage. obtained from cells to which HE and LE small RNA were applied together In the images, the DNA tail formed due to DNA damage is largely 30%. It was determined that it was shortened and had a similar appearance to the control group. (Figure 17). 63 e) Determination of the protective effect against reactive oxygen species. Intracellular ROS of H. cordata cell suspension extract and small RNAs Effect of DCFH-DA (2',7'-dichlorofluorescent diacetate) on (reactive oxygen species) formation It was analyzed using the method. The principle of the DCFH-DA method is that DCFH-DA affects cell 5 by diffused into a non-fluorescent compound by cellular esterases deacetylation and subsequent high fluorescence of the resulting compound by ROS It is based on the oxidation of DCF to (2',7'-dichlorofluorescein). With this method Green fluorescence occurs depending on the amount of DCF produced as the intracellular ROS level increases. Because the amount has increased, intracellular ROS levels can be observed. Intracellular ROS 10 The steps of the determination method are described below: DCFH-DA dye will have a final concentration of 10 mM in DMSO. It is prepared as follows. HaCat cells are arranged in 6 wells with 6x10⁵ cells / well. The seeds were seeded onto a plate and incubated at 37°C in a 5% CO2 environment for 24 hours. Then, 600 μM H2O2 was applied to all wells except the control wells, and the cells were sealed. The mixture was incubated with the substance for 6 hours. At the end of this period, HE and / or other substances were added to the nutrient media. LE small RNA was applied or simply nutrient medium was added and the cells were 24 The samples were left to incubate for an hour. After the incubation was complete, all wells... The cells were washed with 500 µL of PBS and 500 µL of 10 µM DCFH-DA 20 was added to the wells. After addition, the plates were incubated in the dark at 37°C for 45 minutes. At the end of the incubation period, all wells were washed again with 500 μL of PBS. Then The cells were photographed using a fluorescence microscope with a GFP filter. It has been photographed. According to the fluorescence microscopy results, HE and LE are small RNAs. The applications reduced intracellular ROS levels in a concentration-dependent manner, HE and in the combined application of LE small RNA, intracellular ROS formation was increased. It has been determined that it is largely suppressed (Figure 18). 64 f) Determination of dark circle activity using the Griess method: Dark ring of H. cordata cell suspension extract and small RNAs The effects on antagonistic activity were determined using the Griess method. The principle of the Griess test is: 5 by the reaction of nitrite with a primary aromatic amine in an acidic solution It is based on the formation of diazonium salt. Nitrites are sulfonylic compounds in acetic acid. It reacts with acid to form a diazonium ion, which then becomes α-naphthylamine. It forms a red azo dye. The steps of the Griess method are as follows: It has been explained: Griess reagent is 1% SA (sulfanilamide), 0.1% NEDD (1-naphthyl) in distilled water. It was prepared to contain ethylenediamine and 5% phosphoric acid. Nitrite standard curve To this end, a 10 mM nitrite solution was prepared in distilled water. Standard is achieved by serial dilution of the main stock nitrite solution in PBS. Concentrations (5-160 µM) were prepared. THP-1 human monocyte cells 24 15 The cells were seeded into well plates at a ratio of 5x10⁴ cells / well. The cells were macrophages. To differentiate into cells, 5 ng / mL PMA was added to the wells and the cells were kept for 24 hours. They were incubated. After cell differentiation was achieved, they were transferred to nutrient medium. By adding μg / mL LPS (lipopolysaccharide), cells are further stimulated to promote inflammation. The wells were incubated for 20 hours. Then, the supernatants in the wells were collected using a micropipette. It was collected into tubes with the help of... 100 μL was added to each well of the 96-well plate. The supernatant and standard concentrations were transferred separately. Subsequently, all 100 μL of Griess reagent was added to each well, and the plate chamber was filled. It was incubated at [temperature] for 10 minutes. After the time was up... Then the absorbance of the plate was measured at 540 nm in a microplate reader. 25 According to the absorbance results obtained, LPS compared to the control group. In addition to stimulation, HE and LE small RNA applications stimulated nitrite formation. It reduced nitrite formation when HE and LE small RNA were administered together. It has been determined that it has decreased significantly (Figure 19). 30
Claims
65 REQUESTS 1. The invention describes anti-aging properties for use in skin and hair care products. wound healing, anti-spot, anti-dark circle, and anti-hair loss. It is a method of producing cosmetic active raw materials that have several activities, and its characteristic is; 5 — From H. cordata leaf and / or petiole, root, stem explants Obtaining cell suspensions, — H. cordata cells were cultured in suspension culture medium from 12 to 18 days. Adding 0.05 - 0.5 mM MeJA on day 10 — The culture is left to incubate with MeJA for 60-80 hours. — Isolation of EVs from nutrient medium after incubation, — Isolation of small RNAs from EVs, — EV-derived small RNAs are encapsulated within cationic liposomes. done, 15 — The resulting encapsulated small RNAs and / or cells the process of using suspension extract as raw material It is characterized by including its steps.
2. A method for producing cosmetic active raw materials in accordance with Claim 1, with the following characteristics: 20 in raw material production; — Houttuynia cordata or Centella asiatica, Cydonia oblonga, Malva sylvestris, Persea americana, Rosa damascena, Helichrysum arenarium, Glycine max, Prunella vulgaris, 25 Symphytum officinale, Malva sylvestris, Scutellaria baicalensis, Pelargonium graveolens, Filipendula ulmaria, Passiflora edulis, Marribium vulgare, Linum tauricum, Lycium barbarum, Papaver rhoeas, Paeonia peregrina, Leontopodium alpinum, Prunus 30 of the following plants: dulcis, Inula helenium, Psoralea corylifolia It is characterized by the use of, or combinations thereof.