Compositions and methods for modulating PKK expression.
Patent Information
- Application Number
- TR202606712
- Authority / Receiving Office
- TR · TR
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2014-12-05
- Filing Date
- 2015-05-01
- Publication Date
- 2026-06-22
- Estimated Expiration
- 2035-05-01
AI Technical Summary
Current technologies are inadequate in effectively modulating plasma prekallikrein (PKK) expression, which contributes to inflammatory and thromboembolic conditions, and there is a need for compounds and methods to reduce PKK mRNA and protein levels to treat or prevent these conditions.
Development of a modified oligonucleotide with a specific nucleobase sequence and conjugate group, covalently linked to the 5' end, designed to target and reduce PKK expression by hybridizing with PKK mRNA, thereby reducing PKK protein levels.
The modified oligonucleotide effectively decreases PKK mRNA and protein levels in a time- and dose-dependent manner, providing therapeutic benefits for inflammatory and thromboembolic diseases, including hereditary angioedema, angioedema, and thromboembolic conditions such as thrombosis and stroke.
Abstract
Description
Field
[0001] Provided are compounds, compositions, and methods for reducing expression of human plasma prekallikrein (PKK) mRNA and protein in an animal. Such compositions and methods are useful to treat, prevent, or ameliorate inflammatory and thromboembolic conditions.Background
[0002] Plasma prekallikrein (PKK) is the precursor of plasma kallikrein (PK), which is encoded by the KLKB1 gene. PKK is a glycoprotein that participates in the surface-dependent activation of blood coagulation, fibrinolysis, kinin generation, and inflammation. PKK is converted to PK by Factor XIIa by the cleavage of an internal Arg-Ile peptide bond. PK liberates kinins from kininogens and also generates plasmin from plasminogen. PK is a member of the kinin-kallikrein pathway, which consists of several proteins that play a role in inflammation, blood pressure control, coagulation, and pain.
[0003] WO 2013 / 003808 describes methods for modulating kallikrein (klkb1) expression. WO 2013 / 033230 describes oligomer-conjugate complexes and their uses. R. Kallanthottathil, 29th October 2012, 8th Annual Meeting of the Oligonucleotide Therapeutics Society, describes conjugation strategies for in vivo siRNA delivery. Bhattacharjee et al., 2013, Nucleic Acid Therapeutics, 23(3), 175-187, describes inhibition of vascular permneability by antisense-mediated inhibition of plasma kallikrein and coagulation factor 12.Summary
[0004] The scope of the invention and thus of protection is defined by the appended claims. Subject-matter herein disclosed but not encompassed by the claims is not to be understood as being part of the invention.
[0005] The invention provides a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 20 linked nucleosides and has the nucleobase sequence 5'-TGCAAGTCTCTTGGCAAACA-3' (SEQ ID NO: 570), and wherein the conjugate group is covalently linked to the modified oligonucleotide at the 5' end of the modified oligonucleotide.
[0006] The invention also provides a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide is a gapmer consisting of a 5' wing segment, a central gap segment, and a 3' wing segment, wherein: the 5' wing segment consists of five 2'-O-methoxyethyl nucleosides the central gap segment consists of ten β-D-deoxyribonucleosides and the 3' wing segment consists of five 2'-O-methoxyethyl nucleosides wherein the modified oligonucleotide has the nucleobase sequence 5'-TGCAAGTCTCTTGGCAAACA-3' (SEQ ID NO: 570), wherein each cytosine is a 5-methylcytosine wherein the internucleoside linkages of the modified oligonucleotide are ssoosssssssssssooss from 5' to 3', wherein each s is a phosphorothioate linkage and each o is a phosphodiester linkage, wherein the conjugate group is linked to the modified oligonucleotide at the 5' end of the modified oligonucleotide, and wherein the conjugate group has the following chemical structure:
[0007] The invention also provides a salt of a compound of the invention, wherein the anion of the salt has the following chemical structure: (SEQ ID NO: 570).
[0008] The invention also provides a compound according to the following chemical structure: (SEQ ID NO: 570), or a salt thereof.
[0009] The invention also provides a pharmaceutical composition comprising or consisting essentially of a compound of the invention, or a salt of a compound of the invention and a pharmaceutically acceptable carrier or diluent, wherein optionally the pharmaceutically acceptable diluent is phosphate-buffered saline (PBS).
[0010] The invention also provides a compound of the invention, a salt of a compound of the invention, or a pharmecutical composition of the invention, for use in the treatment of a thromboembolic disease, an inflammatory disease, or edema, optionally wherein the edema is hereditary angioedema, angioedema of the lids, macular edema, ocular edema, or cerebral edema.
[0011] Any references to methods of treatment in the subsequent paragraphs of this description are to be interpreted as references to the compounds, pharmaceutical compositions of the present invention for use in a method for treatment of the human (or animal) body by therapy.
[0012] Described herein are compounds, compositions, and methods for modulating expression of PKK mRNA and protein. In certain embodiments, compounds useful for modulating expression of PKK mRNA and protein are antisense compounds. In certain embodiments, the antisense compounds are antisense oligonucleotides.
[0013] In certain embodiments, modulation can occur in a cell or tissue. In certain embodiments, the cell or tissue is in an animal. In certain embodiments, the animal is a human. In certain embodiments, PKK mRNA levels are reduced. In certain embodiments, PKK protein levels are reduced. Such reduction can occur in a time-dependent manner or in a dose-dependent manner.
[0014] Also described are compounds, compositions, and methods useful for preventing, treating, and ameliorating diseases, disorders, and conditions associated with PKK. In certain embodiments, such PKK associated diseases, disorders, and conditions are inflammatory diseases. In certain embodiments, the inflammatory disease may be an acute or chronic inflammatory disease. In certain embodiments, such inflammatory diseases may include hereditary angioedema (HAE), edema, angioedema, swelling, angioedema of the lids, ocular edema, macular edema, and cerebral edema. In certain embodiments, such PKK associated diseases, disorders, and conditions are thromboembolic diseases. In certain embodiments, such thromboembolic diseases may include thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, stroke, and infarct.
[0015] Such diseases, disorders, and conditions can have one or more risk factors, causes, or outcomes in common.
[0016] Certain risk factors and causes for development of an inflammatory disease include genetic predisposition to an inflammatory disease and environmental factors. In certain embodiments, the subject has a mutated complement 1 esterase inhibitor (C1-INH) gene or mutated Factor 12 gene. In certain embodiments, the subject has taken or is on angiotensin-converting enzyme inhibitors (ACE inhibitors) or angiotensin II receptor blockers (ARBs). In certain embodiments, the subject has had an allergic reaction leading to angioedema. In certain embodiments, the subject has type I HAE. In certain embodiments, the subject has type II HAE. In certain embodiments, the subject has type III HAE.
[0017] Certain outcomes associated with development of an inflammatory disease include edema / swelling in various body parts including the extremities (i.e., hands, feet, arms, legs), the intestines (abdomen), the face, the genitals, the larynx (i.e., voice box); vascular permeability; vascular leakage; generalized inflammation; abdominal pain; bloating; vomiting; diarrhea; itchy skin; respiratory (asthmatic) reactions; rhinitis; anaphylaxis; bronchoconstriction; hypotension; coma; and death.
[0018] Certain risk factors and causes for development of a thromboembolic disease include genetic predisposition to a thromboembolic disease, immobility, surgery (particularly orthopedic surgery), malignancy, pregnancy, older age, use of oral contraceptives, atrial fibrillation, previous thromboembolic condition, chronic inflammatory disease, and inherited or acquired prothrombotic clotting disorders. Certain outcomes associated with development of a thromboembolic condition include decreased blood flow through an affected vessel, death of tissue, and death.
[0019] In certain embodiments, methods of treatment include administering a PKK antisense compound to an individual in need thereof. In certain embodiments, methods of treatment include administering a PKK antisense oligonucleotide to an individual in need thereof.Detailed Description
[0020] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as defined in the appended claims. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and / or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
[0021] Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Certain such techniques and procedures may be found for example in "Carbohydrate Modifications in Antisense Research" Edited by Sangvi and Cook, American Chemical Society , Washington D.C., 1994; "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 21st edition, 2005; and "Antisense Drug Technology, Principles, Strategies, and Applications" Edited by Stanley T. Crooke, CRC Press, Boca Raton, Florida; and Sambrook et al., "Molecular Cloning, A laboratory Manual," 2nd Edition, Cold Spring Harbor Laboratory Press, 1989.
[0022] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.Definitions
[0023] Unless otherwise indicated, the following terms have the following meanings: "2'-O-methoxyethyl" (also 2'-MOE and 2'-OCH 2 CH 2 -OCH 3 and MOE) refers to an O-methoxyethyl modification of the 2' position of a furanose ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.
[0024] "2'-O-methoxyethyl modified nucleoside" (also "2'-MOE nucleoside") means a nucleoside comprising a 2'-MOE modified sugar moiety.
[0025] "2'-substituted nucleoside" means a nucleoside comprising a substituent at the 2'-position of the furanose ring other than H or OH. In certain embodiments, 2' substituted nucleosides include nucleosides with bicyclic sugar modifications.
[0026] "2'-deoxynucleoside" means a nucleoside comprising a hydrogen at the 2' position of the sugar portion of the nucleoside.
[0027] "3' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 3'-most nucleotide of a particular antisense compound.
[0028] "5' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 5'-most nucleotide of a particular antisense compound.
[0029] "5-methylcytosine" means a cytosine modified with a methyl group attached to the 5 position. A 5-methylcytosine is a modified nucleobase.
[0030] "About" means within ±7% of a value. For example, if it is stated, "the compounds affected at least about 70% inhibition of PKK", it is implied that the PKK levels are inhibited within a range of 63% and 77%.
[0031] "Administered concomitantly" refers to the co-administration of two pharmaceutical agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both pharmaceutical agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both pharmaceutical agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
[0032] "Administering" means providing a pharmaceutical agent to an animal, and includes, but is not limited to administering by a medical professional and self-administering.
[0033] "Alkyl," as used herein, means a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms. Examples of alkyl groups include without limitation, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (C 1 -C 12 alkyl) with from 1 to about 6 carbon atoms being more preferred.
[0034] As used herein, "alkenyl," means a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include without limitation, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally include one or more further substituent groups.
[0035] As used herein, "alkynyl," means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, without limitation, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally include one or more further substituent groups.
[0036] As used herein, "acyl," means a radical formed by removal of a hydroxyl group from an organic acid and has the general Formula -C(O)-X where X is typically aliphatic, alicyclic or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates and the like. Acyl groups as used herein may optionally include further substituent groups.
[0037] As used herein, "alicyclic" means a cyclic ring system wherein the ring is aliphatic. The ring system can comprise one or more rings wherein at least one ring is aliphatic. Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring. Alicyclic as used herein may optionally include further substituent groups.
[0038] As used herein, "aliphatic" means a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond. An aliphatic group preferably contains from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being more preferred. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation, polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein may optionally include further substituent groups.
[0039] As used herein, "alkoxy" means a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule. Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.
[0040] As used herein, "aminoalkyl" means an amino substituted C 1 -C 12 alkyl radical. The alkyl portion of the radical forms a covalent bond with a parent molecule. The amino group can be located at any position and the aminoalkyl group can be substituted with a further substituent group at the alkyl and / or amino portions.
[0041] As used herein, "aralkyl" and "arylalkyl" mean an aromatic group that is covalently linked to a C 1 -C 12 alkyl radical. The alkyl radical portion of the resulting aralkyl (or arylalkyl) group forms a covalent bond with a parent molecule. Examples include without limitation, benzyl, phenethyl and the like. Aralkyl groups as used herein may optionally include further substituent groups attached to the alkyl, the aryl or both groups that form the radical group.
[0042] As used herein, "aryl" and "aromatic" mean a mono- or polycyclic carbocyclic ring system radicals having one or more aromatic rings. Examples of aryl groups include without limitation, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituent groups.
[0043] "Amelioration" refers to a lessening, slowing, stopping, or reversing of at least one indicator of the severity of a condition or disease. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
[0044] "Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
[0045] "Antisense activity" means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid. "Antisense compound" means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.
[0046] "Antisense compound" means an oligomeric compound that is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.
[0047] "Antisense inhibition" means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels or in the absence of the antisense compound. "Antisense mechanisms" are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
[0048] "Antisense mechanisms" are all those mechanisms involving hybridization of a compound with a target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing.
[0049] "Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding segment of a target nucleic acid. "Base complementarity" refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.
[0050] "Base complementarity" refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.
[0051] "Bicyclic sugar" means a furanose ring modified by the bridging of two atoms. A bicyclic sugar is a modified sugar.
[0052] "Bicyclic nucleoside" (also BNA) means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring.
[0053] "Cap structure" or "terminal cap moiety" means chemical modifications, which have been incorporated at either terminus of an antisense compound.
[0054] "Carbohydrate" means a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative.
[0055] "Carbohydrate cluster" means a compound having one or more carbohydrate residues attached to a scaffold or linker group. (see, e.g., Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting," Bioconjugate Chemistry, 2003, (14): 18-29, or Rensen et al., "Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med. Chem. 2004, (47): 5798-5808, for examples of carbohydrate conjugate clusters).
[0056] "Carbohydrate derivative" means any compound which may be synthesized using a carbohydrate as a starting material or intermediate.
[0057] "cEt" or "constrained ethyl" means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH 3 )-O-2'.
[0058] "cEt modified nucleoside" (also "constrained ethyl nucleoside") means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH 3 )-O-2' bridge.
[0059] "Chemically distinct region" refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-O-methoxyethyl nucleosides is chemically distinct from a region having nucleosides without 2'-O-methoxyethyl modifications.
[0060] "Chemical modification" means a chemical difference in a compound when compared to a naturally occurring counterpart. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications. In reference to an oligonucleotide, chemical modification does not include differences only in nucleobase sequence.
[0061] "Chimeric antisense compound" means an antisense compound that has at least two chemically distinct regions, each position having a plurality of subunits.
[0062] "Cleavable bond" means any chemical bond capable of being split. In certain embodiments, a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.
[0063] "Cleavable moiety" means a bond or group that is capable of being split under physiological conditions. In certain embodiments, a cleavable moiety is cleaved inside a cell or sub-cellular compartments, such as a lysosome. In certain embodiments, a cleavable moiety is cleaved by endogenous enzymes, such as nucleases. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
[0064] "Co-administration" means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses parallel or sequential administration.
[0065] "Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
[0066] "Comprise," "comprises," and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
[0067] "Conjugate" or "conjugate group" means an atom or group of atoms bound to an oligonucleotide or oligomeric compound. In general, conjugate groups modify one or more properties of the compound to which they are attached, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and / or clearance properties. "conjugate linker" or "linker" in the context of a conjugate group means a portion of a conjugate group comprising any atom or group of atoms and which covalently link (1) an oligonucleotide to another portion of the conjugate group or (2) two or more portions of the conjugate group.
[0068] Conjugate groups are shown herein as radicals, providing a bond for forming covalent attachment to an oligomeric compound such as an antisense oligonucleotide. In certain embodiments, the point of attachment on the oligomeric compound is the 3'-oxygen atom of the 3'-hydroxyl group of the 3' terminal nucleoside of the oligomeric compound. In certain embodiments the point of attachment on the oligomeric compound is the 5'-oxygen atom of the 5'-hydroxyl group of the 5' terminal nucleoside of the oligomeric compound. In certain embodiments, the bond for forming attachment to the oligomeric compound is a cleavable bond. In certain such embodiments, such cleavable bond constitutes all or part of a cleavable moiety.
[0069] In certain embodiments, conjugate groups comprise a cleavable moiety (e.g., a cleavable bond or cleavable nucleoside) and a carbohydrate cluster portion, such as a GalNAc cluster portion. Such carbohydrate cluster portion comprises: a targeting moiety and, optionally, a conjugate linker. In certain embodiments, the carbohydrate cluster portion is identified by the number and identity of the ligand. For example, in certain embodiments, the carbohydrate cluster portion comprises 3 GalNAc groups and is designated "GalNAc 3 ". In certain embodiments, the carbohydrate cluster portion comprises 4 GalNAc groups and is designated "GalNAc 4 ". Specific carbohydrate cluster portions (having specific tether, branching and conjugate linker groups) are described herein and designated by Roman numeral followed by subscript "a". Accordingly "GalNac3-1 a " refers to a specific carbohydrate cluster portion of a conjugate group having 3 GalNac groups and specifically identified tether, branching and linking groups. Such carbohydrate cluster fragment is attached to an oligomeric compound via a cleavable moiety, such as a cleavable bond or cleavable nucleoside.
[0070] "Conjugate compound" means any atoms, group of atoms, or group of linked atoms suitable for use as a conjugate group. In certain embodiments, conjugate compounds may possess or impart one or more properties, including, but not limited to pharmacodynamic, pharmacokinetic, binding, absorption, cellular distribution, cellular uptake, charge and / or clearance properties.
[0071] "Contiguous nucleobases" means nucleobases immediately adjacent to each other.
[0072] "Designing" or "Designed to" refer to the process of creating an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
[0073] "Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, in drugs that are injected, the diluent may be a liquid, e.g. saline solution.
[0074] "Dose" means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection, therefore, two or more injections may be used to achieve the desired dose. In certain embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week, or month.
[0075] "Downstream" refers to the relative direction toward the 3' end or C-terminal end of a nucleic acid.
[0076] "Effective amount" in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of pharmaceutical agent to a subject in need of such modulation, treatment, or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.
[0077] "Efficacy" means the ability to produce a desired effect.
[0078] "Expression" includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.
[0079] "Fully complementary" or "100% complementary" means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.
[0080] "Gapmer" means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as a "gap" and the external regions may be referred to as the "wings."
[0081] "Halo" and "halogen," mean an atom selected from fluorine, chlorine, bromine and iodine.
[0082] "Heteroaryl," and "heteroaromatic," mean a radical comprising a mono- or poly-cyclic aromatic ring, ring system or fused ring system wherein at least one of the rings is aromatic and includes one or more heteroatoms. Heteroaryl is also meant to include fused ring systems including systems where one or more of the fused rings contain no heteroatoms. Heteroaryl groups typically include one ring atom selected from sulfur, nitrogen or oxygen. Examples of heteroaryl groups include without limitation, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isooxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzooxazolyl, quinoxalinyl and the like. Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or hetero atom. Heteroaryl groups as used herein may optionally include further substituent groups.
[0083] "Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a target nucleic acid. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.
[0084] "Identifying an animal having an inflammatory disease" means identifying an animal having been diagnosed with an inflammatory disease or predisposed to develop an inflammatory disease. Individuals predisposed to develop an inflammatory disease include those having one or more risk factors for developing an inflammatory disease including environmental factors, having a personal or family history, or genetic predisposition to one or more inflammatory disease. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments, such as genetic testing.
[0085] "Identifying an animal having a PKK associated disease" means identifying an animal having been diagnosed with a PKK associated disease or predisposed to develop a PKK associated disease. Individuals predisposed to develop a PKK associated disease include those having one or more risk factors for developing a PKK associated disease including having a personal or family history, or genetic predisposition of one or more PKK associated diseases. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments, such as genetic testing.
[0086] "Identifying an animal having a thromboembolic disease" means identifying an animal having been diagnosed with a thromboembolic disease or predisposed to develop a thromboembolic disease. Individuals predisposed to develop a thromboembolic disease include those having one or more risk factors for developing a thromboembolic disease including having a personal or family history, or genetic predisposition of one or more thromboembolic diseases, immobility, surgery (particularly orthopedic surgery), malignancy, pregnancy, older age, use of oral contraceptives, atrial fibrillation, previous thromboembolic condition, chronic inflammatory disease, and inherited or acquired prothrombotic clotting disorders. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments, such as genetic testing.
[0087] "Immediately adjacent" means there are no intervening elements between the immediately adjacent elements. "Individual" means a human or non-human animal selected for treatment or therapy.
[0088] "Individual" means a human or non-human animal selected for treatment or therapy.
[0089] "Inhibiting PKK" means reducing the level or expression of a PKK mRNA and / or protein. In certain embodiments, PKK mRNA and / or protein levels are inhibited in the presence of an antisense compound targeting PKK, including an antisense oligonucleotide targeting PKK, as compared to expression of PKK mRNA and / or protein levels in the absence of a PKK antisense compound, such as an antisense oligonucleotide.
[0090] "Inhibiting the expression or activity" refers to a reduction or blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.
[0091] "Internucleoside linkage" refers to the chemical bond between nucleosides.
[0092] "Internucleoside neutral linking group" means a neutral linking group that directly links two nucleosides.
[0093] "Internucleoside phosphorus linking group" means a phosphorus linking group that directly links two nucleosides.
[0094] "Linkage motif" means a pattern of linkage modifications in an oligonucleotide or region thereof. The nucleosides of such an oligonucleotide may be modified or unmodified. Unless otherwise indicated, motifs herein describing only linkages are intended to be linkage motifs. Thus, in such instances, the nucleosides are not limited.
[0095] "Linked nucleosides" means adjacent nucleosides linked together by an internucleoside linkage.
[0096] "Locked nucleic acid" or " LNA" or "LNA nucleosides" means nucleic acid monomers having a bridge connecting two carbon atoms between the 4' and 2'position of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugar include, but are not limited to A) α-L-Methyleneoxy (4'-CH 2 -O-2') LNA , (B) β-D-Methyleneoxy (4'-CH 2 -O-2') LNA, (C) Ethyleneoxy (4'-(CH 2 ) 2 -O-2') LNA , (D) Aminooxy (4'-CH 2 -O-N(R)-2') LNA and (E) Oxyamino (4'-CH 2 -N(R)-O-2') LNA, as depicted below.
[0097] As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the sugar wherein each of the bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(R 1 )(R 2 )] n -, -C(R 1 )=C(R 2 )-, -C(R 1 )=N-, -C(=NR 1 )-, -C(=O)-, -C(=S)-, -O-, -Si(R 1 ) 2 -, -S(=O) x - and -N(R 1 )-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R 1 and R 2 is, independently, H, a protecting group, hydroxyl, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, a heterocycle radical, a substituted heterocycle radical, heteroaryl, substituted heteroaryl, C 5 -C 7 alicyclic radical, substituted C 5 -C 7 alicyclic radical, halogen, OJ 1 , NJ 1 J 2 , SJ 1 , N 3 , COOJ 1 , acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O) 2 -J 1 ), or sulfoxyl (S(=O)-J 1 ); and each J 1 and J 2 is, independently, H, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C 1 -C 12 aminoalkyl, substituted C 1 -C 12 aminoalkyl or a protecting group.
[0098] Examples of 4'- 2' bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: -[C(R 1 )(R 2 )] n -, -[C(R 1 )(R 2 )] n -O-, -C(R 1 R 2 )-N(R 1 )-O- or -C(R 1 R 2 )-O-N(R 1 )-. Furthermore, other bridging groups encompassed with the definition of LNA are 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -O-2', 4'-(CH 2 ) 2 -O-2', 4'-CH 2 -O-N(R 1 )-2' and 4'-CH 2 -N(R 1 )-O-2'- bridges, wherein each R 1 and R 2 is, independently, H, a protecting group or C 1 -C 12 alkyl.
[0099] Also included within the definition of LNA according to the invention are LNAs in which the 2'-hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH 2 -O-2') bridge to form the bicyclic sugar moiety. The bridge can also be a methylene (-CH 2 -) group connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'-CH 2 -O-2') LNA is used. Furthermore; in the case of the bicylic sugar moiety having an ethylene bridging group in this position, the term ethyleneoxy (4'-CH 2 CH 2 -O-2') LNA is used. α -L- methyleneoxy (4'-CH 2 -O-2'), an isomer of methyleneoxy (4'-CH 2 -O-2') LNA is also encompassed within the definition of LNA, as used herein.
[0100] "Mismatch" or "non-complementary nucleobase" refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
[0101] "Modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).
[0102] "Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine (also known as 5-methyluracil), or uracil. An "unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
[0103] "Modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and / or modified nucleobase.
[0104] "Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, and / or modified nucleobase.
[0105] "Modified oligonucleotide" means an oligonucleotide comprising at least one modified internucleoside linkage, modified sugar, and / or modified nucleobase.
[0106] "Modified sugar" means substitution and / or any change from a natural sugar moiety.
[0107] "Mono or polycyclic ring system" is meant to include all ring systems selected from single or polycyclic radical ring systems wherein the rings are fused or linked and is meant to be inclusive of single and mixed ring systems individually selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic and heteroarylalkyl. Such mono and poly cyclic structures can contain rings that each have the same level of saturation or each, independently, have varying degrees of saturation including fully saturated, partially saturated or fully unsaturated. Each ring can comprise ring atoms selected from C, N, O and S to give rise to heterocyclic rings as well as rings comprising only C ring atoms which can be present in a mixed motif such as for example benzimidazole wherein one ring has only carbon ring atoms and the fused ring has two nitrogen atoms. The mono or polycyclic ring system can be further substituted with substituent groups such as for example phthalimide which has two =O groups attached to one of the rings. Mono or polycyclic ring systems can be attached to parent molecules using various strategies such as directly through a ring atom, fused through multiple ring atoms, through a substituent group or through a bifunctional linking moiety.
[0108] "Monomer" means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.
[0109] "Motif" means the pattern of unmodified and modified nucleosides in an antisense compound.
[0110] "Natural sugar moiety" means a sugar moiety found in DNA (2'-H) or RNA (2'-OH).
[0111] "Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.
[0112] "Neutral linking group" means a linking group that is not charged. Neutral linking groups include without limitation phosphotriesters, methylphosphonates, MMI (-CH 2 -N(CH 3 )-O-), amide-3 (-CH 2 -C(=O)-N(H)-), amide-4 (-CH 2 -N(H)-C(=O)-), formacetal (-O-CH 2 -O-), and thioformacetal (-S-CH 2 -O-). Further neutral linking groups include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook Eds. ACS Symposium Series 580; Chapters 3 and 4, (pp. 40-65)). Further neutral linking groups include nonionic linkages comprising mixed N, O, S and CH 2 component parts.
[0113] "Non-complementary nucleobase" refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
[0114] "Non-internucleoside neutral linking group" means a neutral linking group that does not directly link two nucleosides. In certain embodiments, a non-internucleoside neutral linking group links a nucleoside to a group other than a nucleoside. In certain embodiments, a non-internucleoside neutral linking group links two groups, neither of which is a nucleoside.
[0115] "Non-internucleoside phosphorus linking group" means a phosphorus linking group that does not directly link two nucleosides. In certain embodiments, a non-internucleoside phosphorus linking group links a nucleoside to a group other than a nucleoside. In certain embodiments, a non-internucleoside phosphorus linking group links two groups, neither of which is a nucleoside.
[0116] "Nucleic acid" refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), and microRNAs (miRNA).
[0117] "Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
[0118] "Nucleobase complementarity" refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
[0119] "Nucleobase modification motif" means a pattern of modifications to nucleobases along an oligonucleotide. Unless otherwise indicated, a nucleobase modification motif is independent of the nucleobase sequence.
[0120] "Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage, and / or nucleobase modification.
[0121] "Nucleoside" means a nucleobase linked to a sugar.
[0122] "Nucleoside mimetic" includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by -N(H)-C(=O)-O- or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. "Mimetic" refers to groups that are substituted for a sugar, a nucleobase, and / or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
[0123] "Nucleoside motif" means a pattern of nucleoside modifications in an oligonucleotide or a region thereof. The linkages of such an oligonucleotide may be modified or unmodified. Unless otherwise indicated, motifs herein describing only nucleosides are intended to be nucleoside motifs. Thus, in such instances, the linkages are not limited.
[0124] "Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
[0125] "Off-target effect" refers to an unwanted or deleterious biological effect associated with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.
[0126] "Oligomeric compound" or "oligomer" means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
[0127] "Oligonucleotide" means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
[0128] "Parenteral administration" means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.
[0129] "Peptide" means a molecule formed by linking at least two amino acids by amide bonds. Without limitation, as used herein, peptide refers to polypeptides and proteins.
[0130] "Pharmaceutical agent" means a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeted to PKK is a pharmaceutical agent.
[0131] "Pharmaceutical composition" means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an antisense oligonucleotide and a sterile aqueous solution.
[0132] "Pharmaceutically acceptable derivative" encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.
[0133] "Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
[0134] "Phosphorothioate linkage" means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage. "Phosphorus linking group" means a linking group comprising a phosphorus atom. Phosphorus linking groups include without limitation groups having the formula: wherein: R a and R d are each, independently, O, S, CH 2 , NH, or NJ 1 wherein J 1 is C 1 -C 6 alkyl or substituted C 1 -C 6 alkyl; R b is O or S; R c is OH, SH, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 1 -C 6 alkoxy, substituted C 1 -C 6 alkoxy, amino or substituted amino; and J 1 is R b is O or S. Phosphorus linking groups include without limitation, phosphodiester, phosphorothioate, phosphorodithioate, phosphonate, phosphoramidate, phosphorothioamidate, thionoalkylphosphonate, phosphotriesters, thionoalkylphosphotriester and boranophosphate.
[0135] "PKK" means mammalian plasma prekallikrein, including human plasma prekallikrein. Plasma prekallikrein (PKK) is the precursor of plasma kallikrein (PK), which is encoded by the KLKB 1 gene.
[0136] "PKK associated disease" means any disease associated with any PKK nucleic acid or expression product thereof. Such diseases may include an inflammatory disease or a thromboembolic disease. Such diseases may include hereditary angioedema (HAE).
[0137] "PKK mRNA" means any messenger RNA expression product of a DNA sequence encoding PKK.
[0138] "PKK nucleic acid" means any nucleic acid encoding PKK. For example, in certain embodiments, a PKK nucleic acid includes a DNA sequence encoding PKK, an RNA sequence transcribed from DNA encoding PKK (including genomic DNA comprising introns and exons), and an mRNA sequence encoding PKK. "PKK mRNA" means an mRNA encoding a PKK protein.
[0139] "PKK protein" means the polypeptide expression product of a PKK nucleic acid.
[0140] "Portion" means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound.
[0141] "Prevent" or "preventing" refers to delaying or forestalling the onset or development of a disease, disorder, or condition for a period of time from minutes to days, weeks to months, or indefinitely.
[0142] "Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and / or conditions.
[0143] "Prophylactically effective amount" refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.
[0144] "Protecting group" means any compound or protecting group known to those having skill in the art. Non-limiting examples of protecting groups may be found in "Protective Groups in Organic Chemistry", T. W. Greene, P. G. M. Wuts, ISBN 0-471-62301-6, John Wiley & Sons, Inc, New York.
[0145] "Region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
[0146] "Ribonucleotide" means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.
[0147] "RISC based antisense compound" means an antisense compound wherein at least some of the antisense activity of the antisense compound is attributable to the RNA Induced Silencing Complex (RISC).
[0148] "RNase H based antisense compound" means an antisense compound wherein at least some of the antisense activity of the antisense compound is attributable to hybridization of the antisense compound to a target nucleic acid and subsequent cleavage of the target nucleic acid by RNase H.
[0149] "Salts" mean a physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
[0150] "Segments" are defined as smaller or sub-portions of regions within a target nucleic acid.
[0151] "Separate regions" means portions of an oligonucleotide wherein the chemical modifications or the motif of chemical modifications of any neighboring portions include at least one difference to allow the separate regions to be distinguished from one another.
[0152] "Sequence motif" means a pattern of nucleobases arranged along an oligonucleotide or portion thereof. Unless otherwise indicated, a sequence motif is independent of chemical modifications and thus may have any combination of chemical modifications, including no chemical modifications.
[0153] "Side effects" means physiological responses attributable to a treatment other than desired effects. In certain embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.
[0154] "Single-stranded oligonucleotide" means an oligonucleotide which is not hybridized to a complementary strand.
[0155] "Sites," as used herein, are defined as unique nucleobase positions within a target nucleic acid.
[0156] "Specifically hybridizable" or "specifically hybridizes" refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments.
[0157] "Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.
[0158] "Subject" means a human or non-human animal selected for treatment or therapy.
[0159] "Substituent" and "substituent group," means an atom or group that replaces the atom or group of a named parent compound. For example a substituent of a modified nucleoside is any atom or group that differs from the atom or group found in a naturally occurring nucleoside (e.g., a modified 2'-substuent is any atom or group at the 2'-position of a nucleoside other than H or OH). Substituent groups can be protected or unprotected. In certain embodiments, compounds of the present disclosure have substituents at one or at more than one position of the parent compound. Substituents may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to a parent compound.
[0160] Likewise, as used herein, "substituent" in reference to a chemical functional group means an atom or group of atoms that differs from the atom or a group of atoms normally present in the named functional group. In certain embodiments, a substituent replaces a hydrogen atom of the functional group (e.g., in certain embodiments, the substituent of a substituted methyl group is an atom or group other than hydrogen which replaces one of the hydrogen atoms of an unsubstituted methyl group). Unless otherwise indicated, groups amenable for use as substituents include without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (-CCO)R aa ), carboxyl (-C(O)O-R aa ), aliphatic groups, alicyclic groups, alkoxy, substituted oxy (-O-R aa ), aryl, aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino (-N(R bb )(R cc )), imino(=NR bb ), amido (-C(O)N-(R bb )(R cc ) or -N(R bb )C(O)R aa ), azido (-N 3 ), nitro (-NO 2 ), cyano (-CN), carbamido (-OC(O)N(R bb )(R cc ) or -N(R bb )C(O)OR aa ), ureido (-N(R bb )C(O)N(R bb )(R cc )), thioureido (-N(R bb )C(S)N(R bb )(R cc )), guanidinyl (-N(R bb )C(=NR bb )N(R bb )(R cc )), amidinyl (-C(=NR bb )N(R bb )(R cc ) or -N(R bb )C(=NR bb )(R aa )), thiol (-SR bb ), sulfinyl (-S(O)R bb ), sulfonyl (-S(O) 2 R bb ) and sulfonamidyl (-S(O) 2 N(R bb )(R cc ) or -N(R bb )S(O) 2 R bb ). Wherein each R aa , R bb and R cc is, independently, H, an optionally linked chemical functional group or a further substituent group with a preferred list including without limitation, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl. Selected substituents within the compounds described herein are present to a recursive degree.
[0161] "Substituted sugar moiety" means a furanosyl that is not a naturally occurring sugar moiety. Substituted sugar moieties include, but are not limited to furanosyls comprising substituents at the 2'-position, the 3'-position, the 5'-position and / or the 4'-position. Certain substituted sugar moieties are bicyclic sugar moieties.
[0162] "Sugar moiety" means a naturally occurring sugar moiety or a modified sugar moiety of a nucleoside.
[0163] "Sugar motif" means a pattern of sugar modifications in an oligonucleotide or a region thereof.
[0164] "Sugar surrogate" means a structure that does not comprise a furanosyl and that is capable of replacing the naturally occurring sugar moiety of a nucleoside, such that the resulting nucleoside sub-units are capable of linking together and / or linking to other nucleosides to form an oligomeric compound which is capable of hybridizing to a complementary oligomeric compound. Such structures include rings comprising a different number of atoms than furanosyl (e.g., 4, 6, or 7-membered rings); replacement of the oxygen of a furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen); or both a change in the number of atoms and a replacement of the oxygen. Such structures may also comprise substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates optionally comprising additional substituents). Sugar surrogates also include more complex sugar replacements (e.g., the non-ring systems of peptide nucleic acid). Sugar surrogates include without limitation morpholinos, cyclohexenyls and cyclohexitols.
[0165] "Target" refers to a protein, the modulation of which is desired.
[0166] "Target gene" refers to a gene encoding a target.
[0167] "Targeting" or "targeted" means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
[0168] "Target nucleic acid," "target RNA," and "target RNA transcript" and "nucleic acid target" all mean a nucleic acid capable of being targeted by antisense compounds.
[0169] "Target region" means a portion of a target nucleic acid to which one or more antisense compounds is targeted.
[0170] "Target segment" means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. "5' target site" refers to the 5'-most nucleotide of a target segment. "3' target site" refers to the 3'-most nucleotide of a target segment.
[0171] "Terminal group" means one or more atom attached to either, or both, the 3' end or the 5' end of an oligonucleotide. In certain embodiments a terminal group is a conjugate group. In certain embodiments, a terminal group comprises one or more terminal group nucleosides.
[0172] "Terminal internucleoside linkage" means the linkage between the last two nucleosides of an oligonucleotide or defined region thereof.
[0173] "Therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
[0174] "Treat" or "treating" or "treatment" refers to administering a composition to effect an improvement of the disease or condition.
[0175] "Type of modification" in reference to a nucleoside or a nucleoside of a "type" means the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Accordingly, unless otherwise indicated, a "nucleoside having a modification of a first type" may be an unmodified nucleoside.
[0176] "Unmodified nucleobases" mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
[0177] "Unmodified nucleotide" means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).
[0178] "Upstream" refers to the relative direction toward the 5' end or N-terminal end of a nucleic acid.
[0179] "Wing segment" means a plurality of nucleosides modified to impart to an oligonucleotide properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.Certain Embodiments
[0180] Certain embodiments disclose compounds, compositions, and methods for inhibiting plasma prekallikrein (PKK) mRNA and protein expression. Certain embodiments disclose compounds, compositions, and methods for decreasing PKK mRNA and protein levels. All embodiments not covered by the claims are merely aspects of the present disclosure and do not form part of the invention.
[0181] In certain embodiments, the compound consists of a single-stranded modified oligonucleotide.
[0182] In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.
[0183] In certain embodiments, at least one modified internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.
[0184] In certain embodiments, the modified oligonucleotide comprises at least 1, 2, 3, 4, 5, 6, or 7 phosphodiester internucleoside linkages.
[0185] In certain embodiments, each internucleoside linkage of the modified oligonucleotide is selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.
[0186] In certain embodiments, each internucleoside linkage of the modified oligonucleotide is a phosphorothioate linkage.
[0187] In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.
[0188] In certain embodiments, the modified nucleobase is a 5-methylcytosine.
[0189] In certain embodiments, the modified oligonucleotide comprises at least one modified sugar.
[0190] In certain embodiments, the modified sugar is a 2' modified sugar, a BNA, or a THP.
[0191] In certain embodiments, the modified sugar is any of a 2'-O-methoxyethyl, 2'-O-methyl, a constrained ethyl, a LNA, or a 3'-fluoro-HNA.
[0192] In certain embodiments, the compound comprises at least one 2'-O-methoxyethyl nucleoside, 2'-O-methyl nucleoside, constrained ethyl nucleoside, LNA nucleoside, or 3'-fluoro-HNA nucleoside.
[0193] In certain embodiments, the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of 5 linked nucleosides; and a 3' wing segment consisting of 5 linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
[0194] In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.
[0195] In certain embodiments, the modified oligonucleotide consists of 19 linked nucleosides.
[0196] In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides.
[0197] Certain embodiments provide compounds consisting of a conjugate group and a modified oligonucleotide according to the following formula: Tes Ges mCes Aes Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aes Aes Aes mCes Ae; wherein, A = an adenine, mC = a 5'-methylcytosine G = a guanine, T = a thymine, e = a 2'-O-methoxyethyl modified nucleoside, d = a 2'-deoxynucleoside, and s = a phosphorothioate internucleoside linkage.
[0198] In certain embodiments, the conjugate group is linked to the modified oligonucleotide at the 5' end of the modified oligonucleotide. In certain embodiments of the disclosure, the conjugate group is linked to the modified oligonucleotide at the 3' end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises at least one N- Acetylgalactosamine (GalNAc), at least two N-Acetylgalactosamines (GalNAcs), or at least three N- Acetylgalactosamines (GalNAcs).
[0199] Certain embodiments provide compounds according to the following formula:
[0200] In certain embodiments, a compound having the following chemical structure comprises or consists of ISIS 721744 with a 5'-X, wherein X is a conjugate group comprising GalNAc as described herein:
[0201] In certain embodiments, a compound having the following chemical structure comprises or consists of ISIS 546254 with a 5'-X, wherein X is a conjugate group comprising GalNAc as described herein:
[0202] Certain embodiments provide a compound comprising or consisting of the following formula:
[0203] Certain embodiments provide a compound comprising or consisting of the following formula: wherein either R 1< is -OCH 2 CH 2 OCH 3 (MOE)and R 2< is H; or R 1< and R 2< together form a bridge, wherein R 1< is -O- and R 2< is -CH 2 -, -CH(CH 3 )-, or -CH 2 CH 2 -, and R 1< and R 2< are directly connected such that the resulting bridge is selected from: -O-CH 2 -, -O-CH(CH 3 )-, and -O-CH 2 CH 2 -; and for each pair of R 3< and R 4< on the same ring, independently for each ring: either R 3< is selected from H and -OCH 2 CH 2 OCH 3 and R 4< is H; or R 3< and R 4< together form a bridge, wherein R 3< is -O-, and R 4< is -CH 2 -, - CH(CH 3 )-, or -CH 2 CH 2 -and R 3< and R 4< are directly connected such that the resulting bridge is selected from: - O-CH 2 -, -O-CH(CH 3 )-, and -O-CH 2 CH 2 -; and R 5< is selected from H and -CH 3 ; and Z is selected from S -< and O -< .
[0204] Certain embodiments provide compositions comprising a compound as described hereinor salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
[0205] Certain embodiments disclose methods comprising administering to an animal a compound or composition as described herein.
[0206] In certain embodiments, the animal is a human.
[0207] In certain embodiments, administering the compound prevents, treats, or ameliorates a PKK associated disease, disorder or condition.
[0208] In certain embodiments, the PKK associated disease, disorder or condition is a hereditary angioedema (HAE), edema, angioedema, swelling, angioedema of the lids, ocular edema, macular edema, cerebral edema, thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, stroke, or infarct.
[0209] Certain embodiments disclose use of a compound or composition as described herein for the manufacture of a medicament for treating an inflammatory disease or a thromboembolic disease.Antisense Compounds
[0210] Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.
[0211] In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.
[0212] In certain embodiments antisense oligonucleotides targeted to a PKK nucleic acid may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation). A shortened or truncated antisense compound targeted to a PKK nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.
[0213] When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5' or 3' end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.
[0214] It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and / or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches.
[0215] Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bel-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.
[0216] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358,1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.Antisense Compound Motifs
[0217] In certain embodiments, antisense compounds targeted to a PKK nucleic acid have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.
[0218] Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and / or increased inhibitory activity. A second region of a chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.
[0219] Antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides may include 2'-MOE, and 2'-O-CH 3 , among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a 4'-(CH 2 )n-O-2' bridge, where n=1 or n=2 and 4'-CH 2 -O-CH 2 -2'). In certain embodiments, wings may include several modified sugar moieties, including, for example 2'-MOE. In certain embodiments, wings may include several modified and unmodified sugar moieties. In certain embodiments, wings may include various combinations of 2'-MOE nucleosides and 2'-deoxynucleosides.
[0220] Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties. The wing-gap-wing motif is frequently described as "X-Y-Z", where "X" represents the length of the 5' wing, "Y" represents the length of the gap, and "Z" represents the length of the 3' wing. "X" and "Z" may comprise uniform, variant, or alternating sugar moieties. In certain embodiments, "X" and "Y" may include one or more 2'-deoxynucleosides. "Y" may comprise 2'-deoxynucleosides. As used herein, a gapmer described as "X-Y-Z" has a configuration such that the gap is positioned immediately adjacent to each of the 5' wing and the 3' wing. Thus, no intervening nucleotides exist between the 5' wing and gap, or the gap and the 3' wing. Any of the antisense compounds described herein can have a gapmer motif. In certain embodiments, "X" and "Z" are the same; in other embodiments they are different.
[0221] In certain embodiments, gapmers provided herein include, for example 20-mers having a motif of 5-10-5.Target Nucleic Acids, Target Regions and Nucleotide Sequences
[0222] Nucleotide sequences that encode human plasma prekallikrein (PKK) include, without limitation, the following: GENBANK Accession No. NM_000892.3 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. DC412984.1 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. CN265612.1 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. AK297672.1 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. DC413312.1 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No. AV688858.2 (incorporated herein as SEQ ID NO: 6), GENBANK Accession No. CD652077.1 (incorporated herein as SEQ ID NO: 7), GENBANK Accession No. BC143911.1 (incorporated herein as SEQ ID NO: 8), GENBANK Accession No. CB162532.1 (incorporated herein as SEQ ID NO: 9), GENBANK Accession No. NT_016354.19 truncated from nucleobases 111693001 to 111730000 (incorporated herein as SEQ ID NO: 10), GENBANK Accession No. NM_008455.2 (incorporated herein as SEQ ID NO: 11), GENBANK Accession No. BB598673.1 (incorporated herein as SEQ ID NO: 12), GENBANK Accession No. NT_039460.7 truncated from nucleobases 6114001 to 6144000 (incorporated herein as SEQ ID NO: 13), GENBANK Accession No. NM_012725.2 (incorporated herein as SEQ ID NO: 14), GENBANK Accession No. NW_047473.1 truncated from nucleobases 10952001 to 10982000 (incorporated herein as SEQ ID NO: 15), GENBANK Accession No. XM_002804276.1 (incorporated herein as SEQ ID NO: 17), and GENBANK Accession No. NW_001118167.1 truncated from nucleobases 2358000 to 2391000 (incorporated herein as SEQ ID NO: 18).
[0223] It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.
[0224] In certain embodiments, a target region is a structurally defined region of the target nucleic acid. For example, a target region may encompass a 3' UTR, a 5' UTR, an exon, an intron, an exon / intron junction, a coding region, a translation initiation region, translation termination region, or other defined nucleic acid region. The structurally defined regions for PKK can be obtained by accession number from sequence databases such as NCBI. In certain embodiments, a target region may encompass the sequence from a 5' target site of one target segment within the target region to a 3' target site of another target segment within the same target region.
[0225] Targeting includes determination of at least one target segment to which an antisense compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
[0226] A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.
[0227] Suitable target segments may be found within a 5' UTR, a coding region, a 3' UTR, an intron, an exon, or an exon / intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.
[0228] The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may hybridize in a non-specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off-target sequences).
[0229] There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the antisense compounds within an active target region. In certain embodiments, reductions in PKK mRNA levels are indicative of inhibition of PKK expression. Reductions in levels of a PKK protein are also indicative of inhibition of target mRNA expression. Further, phenotypic changes are indicative of inhibition of PKK expression. For example, reduced or prevented inflammation can be indicative of inhibition of PKK expression. In another example, reduced or prevented edema / swelling can be indicative of inhibition of PKK expression. In another example, reduced or prevented vascular permeability can be indicative of inhibition of PKK expression. In another example, reduced or prevented vascular leakage can be indicative of inhibition of PKK expression. In certain embodiments, vascular permeability is measured by quanification of a dye, such as Evans Blue.Hybridization
[0230] In some embodiments, hybridization occurs between an antisense compound disclosed herein and a target nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
[0231] Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
[0232] Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a target nucleic acid.Complementarity
[0233] An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a PKK nucleic acid).
[0234] Non-complementary nucleobases between an antisense compound and a PKK nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a PKK nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
[0235] In certain embodiments, antisense compounds, or a specified portion thereof, are, or are at least, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an PKK nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.
[0236] For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having four noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
[0237] In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, an antisense compound may be fully complementary to a plasma prekallikrein nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and / or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.
[0238] The location of a non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.
[0239] The antisense compounds provided also include those which are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.Identity
[0240] The antisense compounds described herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
[0241] In certain embodiments, the antisense compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
[0242] In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
[0243] In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.Modifications
[0244] A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
[0245] Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.
[0246] Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.Modified Internucleoside Linkages
[0247] The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
[0248] Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.
[0249] In certain embodiments, antisense compounds targeted to a plasma prekallikrein nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.
[0250] In certain embodiments, oligonucleotides comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, internucleoside linkages are arranged in a gapped motif. In such embodiments, the internucleoside linkages in each of two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. The nucleoside motif is independently selected, so such oligonucleotides having a gapped internucleoside linkage motif may or may not have a gapped nucleoside motif and if it does have a gapped nucleoside motif, the wing and gap lengths may or may not be the same.
[0251] In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.
[0252] In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3' end of the oligonucleotide.
[0253] In certain embodiments, oligonucleotides comprise one or more methylphosponate linkages. In certain embodiments, oligonucleotides having a gapmer nucleoside motif comprise a linkage motif comprising all phosphorothioate linkages except for one or two methylphosponate linkages. In certain embodiments, one methylphosponate linkage is in the central gap of an oligonucleotide having a gapmer nucleoside motif.
[0254] In certain embodiments, it is desirable to arrange the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, it is desirable to arrange the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages to maintain nuclease resistance. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased. In certain embodiments, the number of phosphorothioate internucleoside linkages may be decreased and the number of phosphodiester internucleoside linkages may be increased while still maintaining nuclease resistance. In certain embodiments it is desirable to decrease the number of phosphorothioate internucleoside linkages while retaining nuclease resistance. In certain embodiments it is desirable to increase the number of phosphodiester internucleoside linkages while retaining nuclease resistance.Modified Sugar Moieties
[0255] Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(R 1 )(R 2 ) (R, R 1 and R 2 are each independently H, C 1 -C 12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleoside (see PCT International Application WO 2008 / 101157 Published on 8 / 21 / 08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5'-substitution of a BNA (see PCT International Application WO 2007 / 134181 Published on 11 / 22 / 07 wherein LNA is substituted with for example a 5'-methyl or a 5'-vinyl group).
[0256] Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH 3 , 2'-OCH 2 CH 3 , 2'-OCH 2 CH 2 F and 2'-O(CH 2 ) 2 OCH 3 substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-C 1 -C 10 alkyl, OCF 3 , OCH 2 F, O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 -O-N(R m )(R n ), O-CH 2 -C(=O)-N(R m )(R n ), and O-CH 2 -C(=O)-N(R 1 )-(CH 2 ) 2 -N(R m )(R n ), where each R 1 , R m and R n is, independently, H or substituted or unsubstituted C 1 -C 10 alkyl.
[0257] As used herein, "bicyclic nucleosides" refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to one of the formulae: 4'-(CH 2 )-O-2' (LNA); 4'-(CH 2 )-S-2'; 4'-(CH 2 ) 2 -O-2' (ENA); 4'-CH(CH 3 )-O-2' (also referred to as constrained ethyl or cEt) and 4'-CH(CH 2 OCH 3 )-O-2' (and analogs thereof see U.S. Patent 7,399,845, issued on July 15, 2008); 4'-C(CH 3 )(CH 3 )-O-2' (and analogs thereof see published International Application WO / 2009 / 006478, published January 8, 2009); 4'-CH 2 -N(OCH 3 )-2' (and analogs thereof see published International Application WO / 2008 / 150729, published December 11, 2008); 4'-CH 2 -O-N(CH 3 )-2' (see published U.S. Patent Application US2004-0171570, published September 2, 2004 ); 4'-CH 2 -N(R)-O-2', wherein R is H, C 1 -C 12 alkyl, or a protecting group (see U.S. Patent 7,427,672, issued on September 23, 2008); 4'-CH 2 -C(H)(CH 3 )-2' (see Zhou et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH 2 -C(=CH 2 )-2' (and analogs thereof see published International Application WO 2008 / 154401, published on December 8, 2008).
[0258] Further reports related to bicyclic nucleosides can also be found in published literature (see for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication No. US2008-0039618; US2009-0012281; U.S. Patent Serial Nos. 61 / 026,995 and 61 / 097,787; Published PCT International applications WO 1999 / 014226; WO 2004 / 106356; WO 2005 / 021570; WO 2007 / 134181; WO 2008 / 150729; WO 2008 / 154401; WO 2009 / 006478; WO 2010 / 036698; WO 2011 / 017521; WO 2009 / 067647; WO 2009 / 100320. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT / DK98 / 00393, published on March 25, 1999 as WO 99 / 14226).
[0259] In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from - [C(R a )(R b )] n -, -C(R a )=C(R b )-, -C(R a )=N-, -C(=O)-, -C(=NR a )-, -C(=S)-, -O-, -Si(R a ) 2 -, -S(=O) x -, and -N(R a )-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R a and R b is, independently, H, a protecting group, hydroxyl, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C 5 -C 7 alicyclic radical, substituted C 5 -C 7 alicyclic radical, halogen, OJ 1 , NJ 1 J 2 , SJ 1 , N 3 , COOJ 1 , acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O) 2 -J 1 ), or sulfoxyl (S(=O)-J 1 ); and each J 1 and J 2 is, independently, H, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 5 -C 20 aryl, substituted C 5 -C 20 aryl, acyl (C(=O)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C 1 -C 12 aminoalkyl, substituted C 1 -C 12 aminoalkyl or a protecting group.
[0260] In certain embodiments, the bridge of a bicyclic sugar moiety is -[C(R a )(R b )] n- , -[C(R a )(R b )] n -O-, -C(R a R b )-N(R)-O- or -C(R a R b )-O-N(R)-. In certain embodiments, the bridge is 4'-CH 2 -2', 4'-(CH 2 ) 2 -2', 4'-(CH 2 ) 3 -2', 4'-CH 2 -O-2', 4'-(CH 2 ) 2 -O-2', 4'-CH 2 -O-N(R)-2' and 4'-CH 2 -N(R)-O-2'- wherein each Ris, independently, H, a protecting group or C 1 -C 12 alkyl.
[0261] In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4'-2' methylene-oxy bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4'-CH 2 -O-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
[0262] In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) α-L-methyleneoxy (4'-CH 2 -O-2') BNA , (B) β-D-methyleneoxy (4'-CH 2 -O-2') BNA , (C) ethyleneoxy (4'-(CH 2 ) 2 -O-2') BNA , (D) aminooxy (4'-CH 2 -O-N(R)-2') BNA, (E) oxyamino (4'-CH 2 -N(R)-O-2') BNA, and (F) methyl(methyleneoxy) (4'-CH(CH 3 )-O-2') BNA, (G) methylene-thio (4'-CH 2 -S-2') BNA, (H) methylene-amino (4'-CH 2 -N(R)-2') BNA, (I) methyl carbocyclic (4'-CH 2 -CH(CH 3 )-2') BNA, (J) propylene carbocyclic (4'-(CH 2 ) 3 -2') BNA and (K) vinyl BNA as depicted below: wherein Bx is the base moiety and R is independently H, a protecting group, C 1 -C 12 alkyl or C 1 -C 12 alkoxy.
[0263] In certain embodiments, bicyclic nucleosides are provided having Formula I: wherein: Bx is a heterocyclic base moiety; -Q a -Q b -Q c - is -CH 2 -N(R c )-CH 2 -, -C(=O)-N(R c )-CH 2 -, -CH 2 -O-N(R c )-, -CH 2 -N(R c )-O- or -N(R c )-O-CH 2 ; R c is C 1 -C 12 alkyl or an amino protecting group; and T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.
[0264] In certain embodiments, bicyclic nucleosides are provided having Formula II: wherein: Bx is a heterocyclic base moiety; T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; Z a is C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 1 -C 6 alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C 6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.
[0265] In one embodiment, each of the substituted groups is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ c , NJ c J d , SJ c , N 3 , OC(=X)J c , and NJ e C(=X)NJ c J d , wherein each J c , J d and J e is, independently, H, C 1 -C 6 alkyl, or substituted C 1 -C 6 alkyl and X is O or NJ c .
[0266] In certain embodiments, bicyclic nucleosides are provided having Formula III: wherein: Bx is a heterocyclic base moiety; T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; Z b is C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 1 -C 6 alkyl, substituted C 2 -C 6 alkenyl, substituted C 2 -C 6 alkynyl or substituted acyl (C(=O)-).
[0267] In certain embodiments, bicyclic nucleosides are provided having Formula IV: wherein: Bx is a heterocyclic base moiety; T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; R d is C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl; each q a , q b , q c and q d is, independently, H, halogen, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl, C 1 -C 6 alkoxyl, substituted C 1 -C 6 alkoxyl, acyl, substituted acyl, C 1 -C 6 aminoalkyl or substituted C 1 -C 6 aminoalkyl;
[0268] In certain embodiments, bicyclic nucleosides are provided having Formula V: wherein: Bx is a heterocyclic base moiety; T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; q a , q b , q e and q f are each, independently, hydrogen, halogen, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 1 -C 12 alkoxy, substituted C 1 -C 12 alkoxy, OJ j , SJ j , SOJ j , SO 2 J j , NJ j J k , N 3 , CN, C(=O)OJ j , C(=O)NJ j J k , C(=O)J j , O-C(=O)NJ j J k , N(H)C(=NH)NJ j J k , N(H)C(=O)NJ j J k or N(H)C(=S)NJ j J k ; or q e and q f together are =C(q g )(q h ); q g and q h are each, independently, H, halogen, C 1 -C 12 alkyl or substituted C 1 -C 12 alkyl.
[0269] The synthesis and preparation of the methyleneoxy (4'-CH 2 -O-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98 / 39352 and WO 99 / 14226.
[0270] Analogs of methyleneoxy (4'-CH 2 -O-2') BNA and 2'-thio-BNAs, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99 / 14226 ). Furthermore, synthesis of 2'-amino-BNA, a novel comformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'-amino- and 2'-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.
[0271] In certain embodiments, bicyclic nucleosides are provided having Formula VI: wherein: Bx is a heterocyclic base moiety; T a and T b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium; each q i , q j , q k and q l is, independently, H, halogen, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, substituted C 2 -C 12 alkynyl, C 1 -C 12 alkoxyl, substituted C 1 -C 12 alkoxyl, OJ j , SJ j , SOJ j , SO 2 J j , NJ j J k , N 3 , CN, C(=O)OJ j , C(=O)NJ j J k , C(=O)J j , O-C(=O)NJ j J k , N(H)C(=NH)NJ j J k , N(H)C(=O)NJ j J k or N(H)C(=S)NJ j J k ; and q i and q or q l and q k together are =C(q g )(q h ), wherein q g and q h are each, independently, H, halogen, C 1 -C 12 alkyl or substituted C 1 -C 12 alkyl.
[0272] One carbocyclic bicyclic nucleoside having a 4'-(CH 2 ) 3 -2' bridge and the alkenyl analog bridge 4'-CH=CH-CH 2 -2' have been described (Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al., J. Am. Chem. Soc., 2007, 129(26), 8362-8379).
[0273] As used herein, "4'-2' bicyclic nucleoside" or "4' to 2' bicyclic nucleoside" refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.
[0274] As used herein, "monocylic nucleosides" refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.
[0275] As used herein, "2'-modified sugar" means a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2' modifications are selected from substituents including, but not limited to: O[(CH 2 ) n O] m CH 3 , O(CH 2 ) n NH 2 , O(CH 2 ) n CH 3 , O(CH 2 ) n F, O(CH 2 ) n ONH 2 , OCH 2 C(=O)N(H)CH 3 , and O(CH 2 ) n ON[(CH 2 ) n CH 3 ] 2 , where n and m are from 1 to about 10. Other 2'-substituent groups can also be selected from: C 1 -C 12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, F, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modifed nucleosides comprise a 2'-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).
[0276] As used herein, a "modified tetrahydropyran nucleoside" or "modified THP nucleoside" means a nucleoside having a six-membered tetrahydropyran "sugar" substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate). Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (RNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-1954) or fluoro HNA (F-HNA) having a tetrahydropyran ring system as illustrated below:
[0277] In certain embodiments, sugar surrogates are selected having Formula VII: wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII: Bx is a heterocyclic base moiety; T a and T b are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T a and T b is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T a and T b is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group; q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each independently, H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or substituted C 2 -C 6 alkynyl; and each of R 1 and R 2 is selected from hydrogen, hydroxyl, halogen, subsitituted or unsubstituted alkoxy, NJ 1 J 2 , SJ 1 , N 3 , OC(=X)J 1 , OC(=X)NJ 1 J 2 , NJ 3 C(=X)NJ 1 J 2 and CN, wherein X is O, S or NJ 1 and each J 1 , J 2 and J 3 is, independently, H or C 1 -C 6 alkyl.
[0278] In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 are each H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is other than H. In certain embodiments, at least one of q 1 , q 2 , q 3 , q 4 , q 5 , q 6 and q 7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R 1 and R 2 is fluoro. In certain embodiments, R 1 is fluoro and R 2 is H; R 1 is methoxy and R 2 is H, and R 1 is methoxyethoxy and R 2 is H.
[0279] In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the term "morpholino" means a sugar surrogate having the following formula: In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as "modifed morpholinos."
[0280] Combinations of modifications are also provided without limitation, such as 2'-F-5'-methyl substituted nucleosides (see PCT International Application WO 2008 / 101157 published on 8 / 21 / 08 for other disclosed 5', 2'-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5'-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007 / 134181, published on 11 / 22 / 07 wherein a 4'-CH 2 -O-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (see, e.g., Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).
[0281] In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010 / 036696, published on April 10, 2010, Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horváth et al., Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al., J. Am. Chem. Soc., 2007, 129(30), 9340-9348; Gu et al.,, Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al., Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al., Tetrahedron, 2004, 60(9), 2111-2123; Gu et al., Oligonucleotides, 2003, 13(6), 479-489; Wang et al., J. Org. Chem., 2003, 68, 4499-4505; Verbeure et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J. Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06 / 047842; and Published PCT Application WO 01 / 049687). Certain modified cyclohexenyl nucleosides have Formula X. wherein independently for each of said at least one cyclohexenyl nucleoside analog of Formula X: Bx is a heterocyclic base moiety; T 3 and T 4 are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T 3 and T 4 is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'-or 3'-terminal group; and q 1 , q 2 , q 3 , q 4 , q 5 , q 6 , q 7 , q 8 and q 9 are each, independently, H, C 1 -C 6 alkyl, substituted C 1 -C 6 alkyl, C 2 -C 6 alkenyl, substituted C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, substituted C 2 -C 6 alkynyl or other sugar substituent group.
[0282] As used herein, "2'-modified" or "2'-substituted" refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH. 2'-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2'substituents, such as allyl, amino, azido, thio, O-allyl, O-C 1 -C 10 alkyl, -OCF 3 , O-(CH 2 ) 2 -O-CH 3 , 2'-O(CH 2 ) 2 SCH 3 , O-(CH 2 ) 2 -ON(R m )(R n ), or O-CH 2 -C(=O)-N(R m )(R n ), where each R m and R n is, independently, H or substituted or unsubstituted C 1 -C 10 alkyl. 2'-modifed nucleosides may further comprise other modifications, for example at other positions of the sugar and / or at the nucleobase.
[0283] As used herein, "2'-F" refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position of the sugar ring.
[0284] As used herein, "2'-OMe" or "2'-OCH 3 " or "2'-O-methyl" each refers to a nucleoside comprising a sugar comprising an -OCH 3 group at the 2' position of the sugar ring.
[0285] As used herein, "MOE" or "2'-MOE" or "2'-OCH 2 CH 2 OCH 3 " or "2'-O-methoxyethyl" each refers to a nucleoside comprising a sugar comprising a -OCH 2 CH 2 OCH 3 group at the 2' position of the sugar ring.
[0286] As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).
[0287] Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-1954). Such ring systems can undergo various additional substitutions to enhance activity.
[0288] Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and International Application PCT / US2005 / 019219, filed June 2, 2005 and published as WO 2005 / 121371 on December 22, 2005.
[0289] In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.
[0290] In certain embodiments, antisense compounds comprise one or more nucleosides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH 3 )-O-2') bridging group. In certain embodiments, the (4'-CH(CH 3 )-O-2') modified nucleosides are arranged throughout the wings of a gapmer motif.Conjugated Antisense compounds
[0291] In certain embodiments, the present disclosure provides conjugated antisense compounds. In certain embodiments, the present disclosure provides conjugated antisense compounds comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In certain embodiments, the present disclosure describes methods comprising contacting a cell with a conjugated antisense compound comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In certain embodiments, the present disclosure describes methods comprising contacting a cell with a conjugated antisense compound comprising an antisense oligonucleotide and reducing the amount or activity of a nucleic acid transcript in a cell.
[0292] The asialoglycoprotein receptor (ASGP-R) has been described previously. See e.g., Park et al., PNAS vol. 102, No. 47, pp 17125-17129 (2005). Such receptors are expressed on liver cells, particularly hepatocytes. Further, it has been shown that compounds comprising clusters of three N-acetylgalactosamine (GalNAc) ligands are capable of binding to the ASGP-R, resulting in uptake of the compound into the cell. See e.g., Khorev et al., Bioorganic and Medicinal Chemistry, 16, 9, pp 5216-5231 (May 2008). Accordingly, conjugates comprising such GalNAc clusters have been used to facilitate uptake of certain compounds into liver cells, specifically hepatocytes. For example it has been shown that certain GalNAc-containing conjugates increase activity of duplex siRNA compounds in liver cells in vivo. In such instances, the GalNAc-containing conjugate is typically attached to the sense strand of the siRNA duplex. Since the sense strand is discarded before the antisense strand ultimately hybridizes with the target nucleic acid, there is little concern that the conjugate will interfere with activity. Typically, the conjugate is attached to the 3' end of the sense strand of the siRNA. See e.g., U.S. Patent 8,106,022. Certain conjugate groups described herein are more active and / or easier to synthesize than conjugate groups previously described.
[0293] In certain embodiments, conjugates are attached to single-stranded antisense compounds, including, but not limited to RNase H based antisense compounds and antisense compounds that alter splicing of a pre-mRNA target nucleic acid. In such embodiments, the conjugate should remain attached to the antisense compound long enough to provide benefit (improved uptake into cells) but then should either be cleaved, or otherwise not interfere with the subsequent steps necessary for activity, such as hybridization to a target nucleic acid and interaction with RNase H or enzymes associated with splicing or splice modulation. This balance of properties is more important in the setting of single-stranded antisense compounds than in siRNA compounds, where the conjugate may simply be attached to the sense strand. Disclosed herein are conjugated single-stranded antisense compounds having improved potency in liver cells in vivo compared with the same antisense compound lacking the conjugate. Given the required balance of properties for these compounds such improved potency is surprising.
[0294] In certain embodiments, conjugate groups herein comprise a cleavable moiety. As noted, without wishing to be bound by mechanism, it is logical that the conjugate should remain on the compound long enough to provide enhancement in uptake, but after that, it is desirable for some portion or, ideally, all of the conjugate to be cleaved, releasing the parent compound (e.g., antisense compound) in its most active form. In certain embodiments, the cleavable moiety is a cleavable nucleoside. Such embodiments take advantage of endogenous nucleases in the cell by attaching the rest of the conjugate (the cluster) to the antisense oligonucleotide through a nucleoside via one or more cleavable bonds, such as those of a phosphodiester linkage. In certain embodiments, the cluster is bound to the cleavable nucleoside through a phosphodiester linkage. In certain embodiments, the cleavable nucleoside is attached to the antisense oligonucleotide (antisense compound) by a phosphodiester linkage. In certain embodiments, the conjugate group may comprise two or three cleavable nucleosides. In such embodiments, such cleavable nucleosides are linked to one another, to the antisense compound and / or to the cluster via cleavable bonds (such as those of a phosphodiester linkage). Certain conjugates herein do not comprise a cleavable nucleoside and instead comprise a cleavable bond. It is shown that that sufficient cleavage of the conjugate from the oligonucleotide is provided by at least one bond that is vulnerable to cleavage in the cell (a cleavable bond).
[0295] In certain embodiments, conjugated antisense compounds are prodrugs. Such prodrugs are administered to an animal and are ultimately metabolized to a more active form. For example, conjugated antisense compounds are cleaved to remove all or part of the conjugate resulting in the active (or more active) form of the antisense compound lacking all or some of the conjugate.
[0296] In certain embodiments, conjugates are attached at the 5' end of an oligonucleotide. Certain such 5'-conjugates are cleaved more efficiently than counterparts having a similar conjugate group attached at the 3' end. In certain embodiments, improved activity may correlate with improved cleavage. In certain embodiments, oligonucleotides comprising a conjugate at the 5' end have greater efficacy than oligonucleotides comprising a conjugate at the 3' end (see, for example, Examples 56, 81, 83, and 84). Further, 5'-attachment allows simpler oligonucleotide synthesis. Typically, oligonucleotides are synthesized on a solid support in the 3' to 5' direction. To make a 3'-conjugated oligonucleotide, typically one attaches a pre-conjugated 3' nucleoside to the solid support and then builds the oligonucleotide as usual. However, attaching that conjugated nucleoside to the solid support adds complication to the synthesis. Further, using that approach, the conjugate is then present throughout the synthesis of the oligonucleotide and can become degraded during subsequent steps or may limit the sorts of reactions and reagents that can be used. Using the structures and techniques described herein for 5'-conjugated oligonucleotides, one can synthesize the oligonucleotide using standard automated techniques and introduce the conjugate with the final (5'-most) nucleoside or after the oligonucleotide has been cleaved from the solid support.
[0297] In view of the art and the present disclosure, one of ordinary skill can easily make any of the conjugates and conjugated oligonucleotides herein. Moreover, synthesis of certain such conjugates and conjugated oligonucleotides disclosed herein is easier and / or requires few steps, and is therefore less expensive than that of conjugates previously disclosed, providing advantages in manufacturing. For example, the synthesis of certain conjugate groups consists of fewer synthetic steps, resulting in increased yield, relative to conjugate groups previously described. Conjugate groups such as GalNAc3-10 in Example 46 and GalNAc3-7 in Example 48 are much simpler than previously described conjugates such as those described in U.S. 8,106,022 or U.S. 7,262,177 that require assembly of more chemical intermediates . Accordingly, these and other conjugates described herein have advantages over previously described compounds for use with any oligonucleotide, including single-stranded oligonucleotides and either strand of double-stranded oligonucleotides (e.g., siRNA).
[0298] Similarly, disclosed herein are conjugate groups having only one or two GalNAc ligands. As shown, such conjugates groups improve activity of antisense compounds. Such compounds are much easier to prepare than conjugates comprising three GalNAc ligands. Conjugate groups comprising one or two GalNAc ligands may be attached to any antisense compounds, including single-stranded oligonucleotides and either strand of double-stranded oligonucleotides (e.g., siRNA).
[0299] In certain embodiments, the conjugates herein do not substantially alter certain measures of tolerability. For example, it is shown herein that conjugated antisense compounds are not more immunogenic than unconjugated parent compounds. Since potency is improved, embodiments in which tolerability remains the same (or indeed even if tolerability worsens only slightly compared to the gains in potency) have improved properties for therapy.
[0300] In certain embodiments, conjugation allows one to alter antisense compounds in ways that have less attractive consequences in the absence of conjugation. For example, in certain embodiments, replacing one or more phosphorothioate linkages of a fully phosphorothioate antisense compound with phosphodiester linkages results in improvement in some measures of tolerability. For example, in certain instances, such antisense compounds having one or more phosphodiester are less immunogenic than the same compound in which each linkage is a phosphorothioate. However, in certain instances, as shown in Example 26, that same replacement of one or more phosphorothioate linkages with phosphodiester linkages also results in reduced cellular uptake and / or loss in potency. In certain embodiments, conjugated antisense compounds described herein tolerate such change in linkages with little or no loss in uptake and potency when compared to the conjugated full-phosphorothioate counterpart. In fact, in certain embodiments, for example, in Examples 44, 57, 59, and 86, oligonucleotides comprising a conjugate and at least one phosphodiester internucleoside linkage actually exhibit increased potency in vivo even relative to a full phosphorothioate counterpart also comprising the same conjugate. Moreover, since conjugation results in substantial increases in uptake / potency a small loss in that substantial gain may be acceptable to achieve improved tolerability. Accordingly, in certain embodiments, conjugated antisense compounds comprise at least one phosphodiester linkage.
[0301] In certain embodiments, conjugation of antisense compounds herein results in increased delivery, uptake and activity in hepatocytes. Thus, more compound is delivered to liver tissue. However, in certain embodiments, that increased delivery alone does not explain the entire increase in activity. In certain such embodiments, more compound enters hepatocytes. In certain embodiments, even that increased hepatocyte uptake does not explain the entire increase in activity. In such embodiments, productive uptake of the conjugated compound is increased. For example, as shown in Example 102, certain embodiments of GalNAc-containing conjugates increase enrichment of antisense oligonucleotides in hepatocytes versus non-parenchymal cells. This enrichment is beneficial for oligonucleotides that target genes that are expressed in hepatocytes.
[0302] In certain embodiments, conjugated antisense compounds herein result in reduced kidney exposure. For example, as shown in Example 20, the concentrations of antisense oligonucleotides comprising certain embodiments of GalNAc-containing conjugates are lower in the kidney than that of antisense oligonucleotides lacking a GalNAc-containing conjugate. This has several beneficial therapeutic implications. For therapeutic indications where activity in the kidney is not sought, exposure to kidney risks kidney toxicity without corresponding benefit. Moreover, high concentration in kidney typically results in loss of compound to the urine resulting in faster clearance. Accordingly for non-kidney targets, kidney accumulation is undesired.
[0303] In certain embodiments, the present disclosure provides conjugated antisense compounds represented by the formula: wherein A is the antisense oligonucleotide; B is the cleavable moiety C is the conjugate linker D is the branching group each E is a tether; each F is a ligand; and q is an integer between 1 and 5.
[0304] In the above diagram and in similar diagrams herein, the branching group "D" branches as many times as is necessary to accommodate the number of (E-F) groups as indicated by "q". Thus, where q = 1, the formula is: A-B-C-D-E-F where q = 2, the formula is: where q = 3, the formula is: where q = 4, the formula is: where q = 5, the formula is: In certain embodiments, conjugated antisense compounds are provided having the structure:
[0305] In certain embodiments, conjugated antisense compounds are provided having the structure:
[0306] In certain embodiments, conjugated antisense compounds are provided having the structure:
[0307] In certain embodiments, conjugated antisense compounds are provided having the structure:
[0308] In embodiments having more than one of a particular variable (e.g., more than one "m" or "n"), unless otherwise indicated, each such particular variable is selected independently. Thus, for a structure having more than one n, each n is selected independently, so they may or may not be the same as one another.i. Certain Cleavable Moieties (CM)
[0309] In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety comprises a cleavable bond. In certain embodiments, the conjugate group comprises a cleavable moiety. In certain such embodiments, the cleavable moiety attaches to the antisense oligonucleotide. In certain such embodiments, the cleavable moiety attaches directly to the cell-targeting moiety. In certain such embodiments, the cleavable moiety attaches to the conjugate linker. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a cleavable nucleoside or nucleoside analog. In certain embodiments, the nucleoside or nucleoside analog comprises an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside comprising an optionally protected heterocyclic base selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. In certain embodiments, the cleavable moiety is 2'-deoxy nucleoside that is attached to the 3' position of the antisense oligonucleotide by a phosphodiester linkage and is attached to the linker by a phosphodiester or phosphorothioate linkage. In certain embodiments, the cleavable moiety is 2'-deoxy adenosine that is attached to the 3' position of the antisense oligonucleotide by a phosphodiester linkage and is attached to the linker by a phosphodiester or phosphorothioate linkage. In certain embodiments, the cleavable moiety is 2'-deoxy adenosine that is attached to the 3' position of the antisense oligonucleotide by a phosphodiester linkage and is attached to the linker by a phosphodiester linkage.
[0310] In certain embodiments, the cleavable moiety is attached to the 3' position of the antisense oligonucleotide. In certain embodiments, the cleavable moiety is attached to the 5' position of the antisense oligonucleotide. In certain embodiments, the cleavable moiety is attached to a 2' position of the antisense oligonucleotide. In certain embodiments, the cleavable moiety is attached to the antisense oligonucleotide by a phosphodiester linkage. In certain embodiments, the cleavable moiety is attached to the linker by either a phosphodiester or a phosphorothioate linkage. In certain embodiments, the cleavable moiety is attached to the linker by a phosphodiester linkage. In certain embodiments, the conjugate group does not include a cleavable moiety.
[0311] In certain embodiments, the cleavable moiety is cleaved after the complex has been administered to an animal only after being internalized by a targeted cell. Inside the cell the cleavable moiety is cleaved thereby releasing the active antisense oligonucleotide. While not wanting to be bound by theory it is believed that the cleavable moiety is cleaved by one or more nucleases within the cell. In certain embodiments, the one or more nucleases cleave the phosphodiester linkage between the cleavable moiety and the linker. In certain embodiments, the cleavable moiety has a structure selected from among the following: wherein each of Bx, Bx 1 , Bx 2 , and Bx 3 is independently a heterocyclic base moiety. In certain embodiments, the cleavable moiety has a structure selected from among the following: ii. Certain Linkers
[0312] In certain embodiments, the conjugate groups comprise a linker. In certain such embodiments, the linker is covalently bound to the cleavable moiety. In certain such embodiments, the linker is covalently bound to the antisense oligonucleotide. In certain embodiments, the linker is covalently bound to a cell-targeting moiety. In certain embodiments, the linker further comprises a covalent attachment to a solid support. In certain embodiments, the linker further comprises a covalent attachment to a protein binding moiety. In certain embodiments, the linker further comprises a covalent attachment to a solid support and further comprises a covalent attachment to a protein binding moiety. In certain embodiments, the linker includes multiple positions for attachment of tethered ligands. In certain embodiments, the linker includes multiple positions for attachment of tethered ligands and is not attached to a branching group. In certain embodiments, the linker further comprises one or more cleavable bond. In certain embodiments, the conjugate group does not include a linker.
[0313] In certain embodiments, the linker includes at least a linear group comprising groups selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether (-S-) and hydroxylamino (-O-N(H)-) groups. In certain embodiments, the linear group comprises groups selected from alkyl, amide and ether groups. In certain embodiments, the linear group comprises groups selected from alkyl and ether groups. In certain embodiments, the linear group comprises at least one phosphorus linking group. In certain embodiments, the linear group comprises at least one phosphodiester group. In certain embodiments, the linear group includes at least one neutral linking group. In certain embodiments, the linear group is covalently attached to the cell-targeting moiety and the cleavable moiety. In certain embodiments, the linear group is covalently attached to the cell-targeting moiety and the antisense oligonucleotide. In certain embodiments, the linear group is covalently attached to the cell-targeting moiety, the cleavable moiety and a solid support. In certain embodiments, the linear group is covalently attached to the cell-targeting moiety, the cleavable moiety, a solid support and a protein binding moiety. In certain embodiments, the linear group includes one or more cleavable bond.
[0314] In certain embodiments, the linker includes the linear group covalently attached to a scaffold group. In certain embodiments, the scaffold includes a branched aliphatic group comprising groups selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain embodiments, the scaffold includes a branched aliphatic group comprising groups selected from alkyl, amide and ether groups. In certain embodiments, the scaffold includes at least one mono or polycyclic ring system. In certain embodiments, the scaffold includes at least two mono or polycyclic ring systems. In certain embodiments, the linear group is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety and the linker. In certain embodiments, the linear group is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety, the linker and a solid support. In certain embodiments, the linear group is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety, the linker and a protein binding moiety. In certain embodiments, the linear group is covalently attached to the scaffold group and the scaffold group is covalently attached to the cleavable moiety, the linker, a protein binding moiety and a solid support. In certain embodiments, the scaffold group includes one or more cleavable bond.
[0315] In certain embodiments, the linker includes a protein binding moiety. In certain embodiments, the protein binding moiety is a lipid such as for example including but not limited to cholesterol, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-Bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine), a vitamin (e.g., folate, vitamin A, vitamin E, biotin, pyridoxal), a peptide, a carbohydrate (e.g., monosaccharide, disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, polysaccharide), an endosomolytic component, a steroid (e.g., uvaol, hecigenin, diosgenin), a terpene (e.g., triterpene, e.g., sarsasapogenin, friedelin, epifriedelanol derivatized lithocholic acid), or a cationic lipid. In certain embodiments, the protein binding moiety is a C16 to C22 long chain saturated or unsaturated fatty acid, cholesterol, cholic acid, vitamin E, adamantane or 1-pentafluoropropyl.
[0316] In certain embodiments, a linker has a structure selected from among: wherein each n is, independently, from 1 to 20; and p is from 1 to 6.
[0317] In certain embodiments, a linker has a structure selected from among: and wherein each n is, independently, from 1 to 20.
[0318] In certain embodiments, a linker has a structure selected from among: and wherein n is from 1 to 20.
[0319] In certain embodiments, a linker has a structure selected from among: wherein each L is, independently, a phosphorus linking group or a neutral linking group; and each n is, independently, from 1 to 20.
[0320] In certain embodiments, a linker has a structure selected from among: and
[0321] In certain embodiments, a linker has a structure selected from among: and
[0322] In certain embodiments, a linker has a structure selected from among: and
[0323] In certain embodiments, a linker has a structure selected from among: wherein n is from 1 to 20.
[0324] In certain embodiments, a linker has a structure selected from among:
[0325] In certain embodiments, a linker has a structure selected from among:
[0326] In certain embodiments, a linker has a structure selected from among:
[0327] In certain embodiments, the conjugate linker has the structure:
[0328] In certain embodiments, the conjugate linker has the structure:
[0329] In certain embodiments, a linker has a structure selected from among:
[0330] In certain embodiments, a linker has a structure selected from among: wherein each n is independently, 0, 1, 2, 3, 4, 5, 6, or 7.iii. Certain Cell-Targeting Moieties
[0331] In certain embodiments, conjugate groups comprise cell-targeting moieties. Certain such cell-targeting moieties increase cellular uptake of antisense compounds. In certain embodiments, cell-targeting moieties comprise a branching group, one or more tether, and one or more ligand. In certain embodiments, cell-targeting moieties comprise a branching group, one or more tether, one or more ligand and one or more cleavable bond.1. Certain Branching Groups
[0332] In certain embodiments, the conjugate groups comprise a targeting moiety comprising a branching group and at least two tethered ligands. In certain embodiments, the branching group attaches the conjugate linker. In certain embodiments, the branching group attaches the cleavable moiety. In certain embodiments, the branching group attaches the antisense oligonucleotide. In certain embodiments, the branching group is covalently attached to the linker and each of the tethered ligands. In certain embodiments, the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain embodiments, the branching group comprises groups selected from alkyl, amide and ether groups. In certain embodiments, the branching group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system. In certain embodiments, the branching group comprises one or more cleavable bond. In certain embodiments, the conjugate group does not include a branching group.
[0333] In certain embodiments, a branching group has a structure selected from among: wherein each n is, independently, from 1 to 20; j is from 1 to 3; and m is from 2 to 6.
[0334] In certain embodiments, a branching group has a structure selected from among: and wherein each n is, independently, from 1 to 20; and m is from 2 to 6.
[0335] In certain embodiments, a branching group has a structure selected from among:
[0336] In certain embodiments, a branching group has a structure selected from among: wherein each A 1 is independently, O, S, C=O or NH; and each n is, independently, from 1 to 20.
[0337] In certain embodiments, a branching group has a structure selected from among: wherein each A 1 is independently, O, S, C=O or NH; and each n is, independently, from 1 to 20.
[0338] In certain embodiments, a branching group has a structure selected from among: wherein A 1 is O, S, C=O or NH; and each n is, independently, from 1 to 20.
[0339] In certain embodiments, a branching group has a structure selected from among:
[0340] In certain embodiments, a branching group has a structure selected from among:
[0341] In certain embodiments, a branching group has a structure selected from among: 2. Certain Tethers
[0342] In certain embodiments, conjugate groups comprise one or more tethers covalently attached to the branching group. In certain embodiments, conjugate groups comprise one or more tethers covalently attached to the linking group. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amide and polyethylene glycol groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amide, phosphodiester and polyethylene glycol groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether and amide groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, substituted alkyl, phosphodiester, ether and amide groups in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group.
[0343] In certain embodiments, the tether includes one or more cleavable bond. In certain embodiments, the tether is attached to the branching group through either an amide or an ether group. In certain embodiments, the tether is attached to the branching group through a phosphodiester group. In certain embodiments, the tether is attached to the branching group through a phosphorus linking group or neutral linking group. In certain embodiments, the tether is attached to the branching group through an ether group. In certain embodiments, the tether is attached to the ligand through either an amide or an ether group. In certain embodiments, the tether is attached to the ligand through an ether group. In certain embodiments, the tether is attached to the ligand through either an amide or an ether group. In certain embodiments, the tether is attached to the ligand through an ether group.
[0344] In certain embodiments, each tether comprises from about 8 to about 20 atoms in chain length between the ligand and the branching group. In certain embodiments, each tether group comprises from about 10 to about 18 atoms in chain length between the ligand and the branching group. In certain embodiments, each tether group comprises about 13 atoms in chain length.
[0345] In certain embodiments, a tether has a structure selected from among: wherein each n is, independently, from 1 to 20; and each p is from 1 to about 6.
[0346] In certain embodiments, a tether has a structure selected from among:
[0347] In certain embodiments, a tether has a structure selected from among: wherein each n is, independently, from 1 to 20.
[0348] In certain embodiments, a tether has a structure selected from among: wherein L is either a phosphorus linking group or a neutral linking group; Z 1 is C(=O)O-R 2 ; Z 2 is H, C 1 -C 6 alkyl or substituted C 1 -C 6 alky; R 2 is H, C 1 -C 6 alkyl or substituted C 1 -C 6 alky; and each m 1 is, independently, from 0 to 20 wherein at least one m 1 is greater than 0 for each tether.
[0349] In certain embodiments, a tether has a structure selected from among:
[0350] In certain embodiments, a tether has a structure selected from among: wherein Z 2 is H or CH 3 ; and each m 1 is, independently, from 0 to 20 wherein at least one m 1 is greater than 0 for each tether.
[0351] In certain embodiments, a tether has a structure selected from among: wherein each n is independently, 0, 1, 2, 3, 4, 5, 6, or 7.
[0352] In certain embodiments, a tether comprises a phosphorus linking group. In certain embodiments, a tether does not comprise any amide bonds. In certain embodiments, a tether comprises a phosphorus linking group and does not comprise any amide bonds.3. Certain Ligands
[0353] In certain embodiments, the present disclosure provides ligands wherein each ligand is covalently attached to a tether. In certain embodiments, each ligand is selected to have an affinity for at least one type of receptor on a target cell. In certain embodiments, ligands are selected that have an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, ligands are selected that have an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is, independently selected from galactose, N-acetyl galactoseamine, mannose, glucose, glucosamone and fucose. In certain embodiments, each ligand is N-acetyl galactoseamine (GalNAc). In certain embodiments, the targeting moiety comprises 2 to 6 ligands. In certain embodiments, the targeting moiety comprises 3 ligands. In certain embodiments, the targeting moiety comprises 3 N-acetyl galactoseamine ligands.
[0354] In certain embodiments, the ligand is a carbohydrate, carbohydrate derivative, modified carbohydrate, multivalent carbohydrate cluster, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain embodiments, the ligand is an amino sugar or a thio sugar. For example, amino sugars may be selected from any number of compounds known in the art, for example glucosamine, sialic acid, α-D-galactosamine, N-Acetylgalactosamine, 2-acetamido-2-deoxy-D-galactopyranose (GalNAc), 2-Amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose (β-muramic acid), 2-Deoxy-2-methylamino-L-glucopyranose, 4,6-Dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-Deoxy-2-sulfoamino-D-glucopyranose and N-sulfo-D-glucosamine, and N-Glycoloyl-α-neuraminic acid. For example, thio sugars may be selected from the group consisting of 5-Thio-β-D-glucopyranose, Methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-Thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside.
[0355] In certain embodiments, "GalNac" or "Gal-NAc" refers to 2-(Acetylamino)-2-deoxy-D-galactopyranose, commonly referred to in the literature as N-acetyl galactosamine. In certain embodiments, "N-acetyl galactosamine" refers to 2-(Acetylamino)-2-deoxy-D-galactopyranose. In certain embodiments, "GalNac" or "Gal-NAc" refers to 2-(Acetylamino)-2-deoxy-D-galactopyranose. In certain embodiments, "GalNac" or "Gal-NAc" refers to 2-(Acetylamino)-2-deoxy-D-galactopyranose, which includes both the β-form: 2-(Acetylamino)-2-deoxy-β-D-galactopyranose and α-form: 2-(Acetylamino)-2-deoxy-D-galactopyranose. In certain embodiments, both the β-form: 2-(Acetylamino)-2-deoxy-β-D-galactopyranose and α-form: 2-(Acetylamino)-2-deoxy-D-galactopyranose may be used interchangeably. Accordingly, in structures in which one form is depicted, these structures are intended to include the other form as well. For example, where the structure for an α-form: 2-(Acetylamino)-2-deoxy-D-galactopyranose is shown, this structure is intended to include the other form as well. In certain embodiments, In certain preferred embodiments, the β-form 2-(Acetylamino)-2-deoxy-D-galactopyranose is the preferred embodiment.
[0356] In certain embodiments one or more ligand has a structure selected from among: wherein each R 1 is selected from OH and NHCOOH.
[0357] In certain embodiments one or more ligand has a structure selected from among: and
[0358] In certain embodiments one or more ligand has a structure selected from among:
[0359] In certain embodiments one or more ligand has a structure selected from among: i. Certain Conjugates
[0360] In certain embodiments, conjugate groups comprise the structural features above. In certain such embodiments, conjugate groups have the following structure: wherein each n is, independently, from 1 to 20.
[0361] In certain such embodiments, conjugate groups have the following structure:
[0362] In certain such embodiments, conjugate groups have the following structure: wherein each n is, independently, from 1 to 20; Z is H or a linked solid support; Q is an antisense compound; X is O or S; and Bx is a heterocyclic base moiety.
[0363] In certain such embodiments, conjugate groups have the following structure:
[0364] In certain such embodiments, conjugate groups have the following structure:
[0365] In certain such embodiments, conjugate groups have the following structure:
[0366] In certain such embodiments, conjugate groups have the following structure:
[0367] In certain such embodiments, conjugate groups have the following structure:
[0368] In certain such embodiments, conjugate groups have the following structure:
[0369] In certain such embodiments, conjugate groups have the following structure:
[0370] In certain such embodiments, conjugate groups have the following structure:
[0371] In certain embodiments, conjugates do not comprise a pyrrolidine.
[0372] In certain such embodiments, conjugate groups have the following structure:
[0373] In certain such embodiments, conjugate groups have the following structure:
[0374] In certain such embodiments, conjugate groups have the following structure:
[0375] In certain such embodiments, conjugate groups have the following structure:
[0376] In certain such embodiments, conjugate groups have the following structure:
[0377] In certain such embodiments, conjugate groups have the following structure:
[0378] In certain such embodiments, conjugate groups have the following structure:
[0379] In certain such embodiments, conjugate groups have the following structure:
[0380] In certain such embodiments, conjugate groups have the following structure:
[0381] In certain such embodiments, conjugate groups have the following structure:
[0382] In certain such embodiments, conjugate groups have the following structure:
[0383] In certain embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein X is a substituted or unsubstituted tether of six to eleven consecutively bonded atoms.
[0384] In certain embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein X is a substituted or unsubstituted tether of ten consecutively bonded atoms.
[0385] In certain embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein X is a substituted or unsubstituted tether of four to eleven consecutively bonded atoms and wherein the tether comprises exactly one amide bond.
[0386] In certain embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein Y and Z are independently selected from a C 1 -C 12 substituted or unsubstituted alkyl, alkenyl, or alkynyl group, or a group comprising an ether, a ketone, an amide, an ester, a carbamate, an amine, a piperidine, a phosphate, a phosphodiester, a phosphorothioate, a triazole, a pyrrolidine, a disulfide, or a thioether.
[0387] In certain such embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein Y and Z are independently selected from a C 1 -C 12 substituted or unsubstituted alkyl group, or a group comprising exactly one ether or exactly two ethers, an amide, an amine, a piperidine, a phosphate, a phosphodiester, or a phosphorothioate.
[0388] In certain such embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein Y and Z are independently selected from a C 1 -C 12 substituted or unsubstituted alkyl group.
[0389] In certain such embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein m and n are independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12.
[0390] In certain such embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein m is 4, 5, 6, 7, or 8, and n is 1, 2, 3, or 4.
[0391] In certain embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein X is a substituted or unsubstituted tether of four to thirteen consecutively bonded atoms, and wherein X does not comprise an ether group.
[0392] In certain embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein X is a substituted or unsubstituted tether of eight consecutively bonded atoms, and wherein X does not comprise an ether group.
[0393] In certain embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein X is a substituted or unsubstituted tether of four to thirteen consecutively bonded atoms, and wherein the tether comprises exactly one amide bond, and wherein X does not comprise an ether group.
[0394] In certain embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein X is a substituted or unsubstituted tether of four to thirteen consecutively bonded atoms and wherein the tether consists of an amide bond and a substituted or unsubstituted C 2 -C 11 alkyl group.
[0395] In certain embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein Y is selected from a C 1 -C 12 substituted or unsubstituted alkyl, alkenyl, or alkynyl group, or a group comprising an ether, a ketone, an amide, an ester, a carbamate, an amine, a piperidine, a phosphate, a phosphodiester, a phosphorothioate, a triazole, a pyrrolidine, a disulfide, or a thioether.
[0396] In certain such embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein Y is selected from a C 1 -C 12 substituted or unsubstituted alkyl group, or a group comprising an ether, an amine, a piperidine, a phosphate, a phosphodiester, or a phosphorothioate.
[0397] In certain such embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein Y is selected from a C 1 -C 12 substituted or unsubstituted alkyl group.
[0398] In certain such embodiments, the cell-targeting moiety of the conjugate group has the following structure:
[0399] Wherein n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12.
[0400] In certain such embodiments, the cell-targeting moiety of the conjugate group has the following structure: wherein n is 4, 5, 6, 7, or 8.Certain conjugated antisense compounds
[0401] In certain embodiments, the conjugates are bound to a nucleoside of the antisense oligonucleotide at the 2', 3', of 5' position of the nucleoside. In certain embodiments, a conjugated antisense compound has the following structure: wherein A is the antisense oligonucleotide; B is the cleavable moiety C is the conjugate linker D is the branching group each E is a tether; each F is a ligand; and q is an integer between 1 and 5.
[0402] In certain embodiments, a conjugated antisense compound has the following structure: wherein A is the antisense oligonucleotide; C is the conjugate linker D is the branching group each E is a tether; each F is a ligand; and q is an integer between 1 and 5.
[0403] In certain such embodiments, the conjugate linker comprises at least one cleavable bond.
[0404] In certain such embodiments, the branching group comprises at least one cleavable bond.
[0405] In certain embodiments each tether comprises at least one cleavable bond.
[0406] In certain embodiments, the conjugates are bound to a nucleoside of the antisense oligonucleotide at the 2', 3', of 5' position of the nucleoside.
[0407] In certain embodiments, a conjugated antisense compound has the following structure: wherein A is the antisense oligonucleotide; B is the cleavable moiety C is the conjugate linker each E is a tether; each F is a ligand; and q is an integer between 1 and 5.
[0408] In certain embodiments, the conjugates are bound to a nucleoside of the antisense oligonucleotide at the 2', 3', of 5' position of the nucleoside. In certain embodiments, a conjugated antisense compound has the following structure: wherein A is the antisense oligonucleotide; C is the conjugate linker each E is a tether; each F is a ligand; and q is an integer between 1 and 5.
[0409] In certain embodiments, a conjugated antisense compound has the following structure: wherein A is the antisense oligonucleotide; B is the cleavable moiety D is the branching group each E is a tether; each F is a ligand; and q is an integer between 1 and 5.
[0410] In certain embodiments, a conjugated antisense compound has the following structure: wherein A is the antisense oligonucleotide; D is the branching group each E is a tether; each F is a ligand; and q is an integer between 1 and 5.
[0411] In certain such embodiments, the conjugate linker comprises at least one cleavable bond.
[0412] In certain embodiments each tether comprises at least one cleavable bond.
[0413] In certain embodiments, a conjugated antisense compound has a structure selected from among the following:
[0414] In certain embodiments, a conjugated antisense compound has a structure selected from among the following:
[0415] In certain embodiments, a conjugated antisense compound has a structure selected from among the following:
[0416] Representative United States patents, United States patent application publications, and international patent application publications that teach the preparation of certain of the above noted conjugates, conjugated antisense compounds, tethers, linkers, branching groups, ligands, cleavable moieties as well as other modifications include without limitation, US 5,994,517, US 6,300,319, US 6,660,720, US 6,906,182, US 7,262,177, US 7,491,805, US 8,106,022, US 7,723,509, US 2006 / 0148740, US 2011 / 0123520, WO 2013 / 033230 and WO 2012 / 037254.
[0417] Representative publications that teach the preparation of certain of the above noted conjugates, conjugated antisense compounds, tethers, linkers, branching groups, ligands, cleavable moieties as well as other modifications include without limitation, BIESSEN et al., "The Cholesterol Derivative of a Triantennary Galactoside with High Affinity for the Hepatic Asialoglycoprotein Receptor: a Potent Cholesterol Lowering Agent" J. Med. Chem. (1995) 38:1846-1852, BIESSEN et al., "Synthesis of Cluster Galactosides with High Affinity for the Hepatic Asialoglycoprotein Receptor" J. Med. Chem. (1995) 38:1538-1546, LEE et al., "New and more efficient multivalent glyco-ligands for asialoglycoprotein receptor of mammalian hepatocytes" Bioorganic & Medicinal Chemistry (2011) 19:2494-2500, RENSEN et al., "Determination of the Upper Size Limit for Uptake and Processing of Ligands by the Asialoglycoprotein Receptor on Hepatocytes in Vitro and in Vivo" J. Biol. Chem. (2001) 276(40):37577-37584, RENSEN et al., "Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asialoglycoprotein Receptor" J. Med. Chem. (2004) 47:5798-5808, SLIEDREGT et al., "Design and Synthesis of Novel Amphiphilic Dendritic Galactosides for Selective Targeting of Liposomes to the Hepatic Asialoglycoprotein Receptor" J. Med. Chem. (1999) 42:609-618, and Valentijn et al., "Solid-phase synthesis of lysine-based cluster galactosides with high affinity for the Asialoglycoprotein Receptor" Tetrahedron, 1997, 53(2), 759-770.
[0418] In certain embodiments, conjugated antisense compounds comprise an RNase H based oligonucleotide (such as a gapmer) or a splice modulating oligonucleotide (such as a fully modified oligonucleotide) and any conjugate group comprising at least one, two, or three GalNAc groups. In certain embodiments a conjugated antisense compound comprises any conjugate group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycobiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798-5808; Rensen et al., Arterioscler Thromb Vasc Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato et al., J Am Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29; Jayaprakash et al., Org Lett, 2010, 12, 5410-5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International applications WO1998 / 013381; WO2011 / 038356; WO1997 / 046098; WO2008 / 098788; WO2004 / 101619; WO2012 / 037254; WO2011 / 120053; WO2011 / 100131; WO2011 / 163121; WO2012 / 177947; WO2013 / 033230; WO2013 / 075035; WO2012 / 083185; WO2012 / 083046; WO2009 / 082607; WO2009 / 134487; WO2010 / 144740; WO2010 / 148013; WO1997 / 020563; WO2010 / 088537; WO2002 / 043771; WO2010 / 129709; WO2012 / 068187; WO2009 / 126933; WO2004 / 024757; WO2010 / 054406; WO2012 / 089352; WO2012 / 089602; WO2013 / 166121; WO2013 / 165816; U.S. Patents 4,751,219; 8,552,163; 6,908,903; 7,262,177; 5,994,517; 6,300,319; 8,106,022; 7,491,805; 7,491,805; 7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,720; 7,723,509; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Application Publications US2011 / 0097264; US2011 / 0097265; US2013 / 0004427; US2005 / 0164235; US2006 / 0148740; US2008 / 0281044; US2010 / 0240730; US2003 / 0119724; US2006 / 0183886; US2008 / 0206869; US2011 / 0269814; US2009 / 0286973; US2011 / 0207799; US2012 / 0136042; US2012 / 0165393; US2008 / 0281041; US2009 / 0203135; US2012 / 0035115; US2012 / 0095075; US2012 / 0101148; US2012 / 0128760; US2012 / 0157509; US2012 / 0230938; US2013 / 0109817; US2013 / 0121954; US2013 / 0178512; US2013 / 0236968; US2011 / 0123520; US2003 / 0077829; US2008 / 0108801; and US2009 / 0203132.Cell culture and antisense compounds treatment
[0419] The effects of antisense compounds on the level, activity, or expression of PKK nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commercial vendors (e.g., American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and are cultured according to the vendor's instructions using commercially available reagents (e.g., Life Technologies, Carlsbad, CA). Illustrative cell types include, but are not limited to, HepaRG ™< T cells and mouse primary hepatocytes.In vitro testing of antisense oligonucleotides
[0420] Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.
[0421] Cells may be treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.
[0422] One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Life Technologies, Carlsbad, CA). Antisense oligonucleotides may be mixed with LIPOFECTIN in OPTI-MEM 1 (Life Technologies, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that may range from 2 to 12 ug / mL per 100 nM antisense oligonucleotide.
[0423] Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Life Technologies, Carlsbad, CA). Antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Life Technologies, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that may range from 2 to 12 ug / mL per 100 nM antisense oligonucleotide.
[0424] Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation.
[0425] Yet another technique used to introduce antisense oligonucleotides into cultured cells includes free uptake of the oligonucleotides by the cells.
[0426] Cells are treated with antisense oligonucleotides by routine methods. Cells may be harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.
[0427] The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.RNA Isolation
[0428] RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Life Technologies, Carlsbad, CA) according to the manufacturer's recommended protocols.Analysis of inhibition of target levels or expression
[0429] Inhibition of levels or expression of a PKK nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions.Quantitative Real-Time PCR Analysis of Target RNA Levels
[0430] Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
[0431] Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents may be obtained from Life Technologies (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.
[0432] Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Life Technologies, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.
[0433] Probes and primers are designed to hybridize to a PKK nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).Analysis of Protein Levels
[0434] Antisense inhibition of PKK nucleic acids can be assessed by measuring PKK protein levels. Protein levels of PKK can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art.In vivo testing of antisense compounds
[0435] Antisense compounds, for example, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of PKK and produce phenotypic changes.
[0436] In certain embodiments, such phenotypic changes include those associated with an inflammatory disease, such as, reduced inflammation, edema / swelling, vascular permeability, and vascular leakage. In certain embodiments, inflammation is measured by measuring the increase or decrease of edema, temperature, pain, color of tissue, and abdominal function in the animal.
[0437] In certain embodiments, such phenotypic changes include those associated with a thromboembolic disease, such as, prolonged aPTT, prolonged aPTT time in conjunction with a normal PT, decreased quantity of Platelet Factor 4 (PF-4), and reduced formation of thrombus or increased time for thrombus formation.
[0438] Testing may be performed in normal animals, or in experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of antisense oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with antisense oligonucleotides, RNA is isolated from liver tissue and changes in PKK nucleic acid expression are measured.Certain Indications
[0439] In certain embodiments, there are disclosed herein methods of treating an individual comprising administering one or more pharmaceutical compositions as described herein.
[0440] In certain embodiments, the individual has an inflammatory disease. In certain embodiments, the individual is at risk for developing an inflammatory condition, including, but not limited to hereditary angioedema (HAE), edema, angioedema, swelling, angioedema of the lids, ocular edema, macular edema, and cerebral edema. This includes individuals with an acquired problem, disease, or disorder that leads to a risk of inflammation, for example, genetic predisposition to an inflammatory condition, environmental factors, and exposure to certain medications, including, for example, ACE inhibitors and ARBs. In certain embodiments, the individual has been identified as in need of anti-inflammation therapy. Examples of such individuals include, but are not limited to those having a mutation in the genetic code for complement 1 esterase inhibitor (i.e., C1-INH) or Factor 12. In certain embodiments, an abnormal code can lead to a deficiency in C1-INH (i.e., type I HAE), an inability of existing C1-INH to function properly (type II HAE), or hyperfunctional Factor 12 (i.e., type III HAE).
[0441] In certain embodiments, the individual has a thromboembolic disease. In certain embodiments, the individual is at risk for a blood clotting disorder, including, but not limited to, infarct, thrombosis, embolism, thromboembolism such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. This includes individuals with an acquired problem, disease, or disorder that leads to a risk of thrombosis, for example, surgery, cancer, immobility, sepsis, atherosclerosis atrial fibrillation, as well as genetic predisposition, for example, antiphospholipid syndrome and the autosomal dominant condition, Factor V Leiden. In certain embodiments, the individual has been identified as in need of anticoagulation therapy. Examples of such individuals include, but are not limited to, those undergoing major orthopedic surgery (e.g., hip / knee replacement or hip fracture surgery) and patients in need of chronic treatment, such as those suffering from arterial fibrillation to prevent stroke.
[0442] In certain embodiments there are disclosed herein methods for prophylactically reducing PKK expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of an antisense compound targeted to a PKK nucleic acid.
[0443] In one embodiment, administration of a therapeutically effective amount of an antisense compound targeted to a PKK nucleic acid is accompanied by monitoring of PKK levels in the serum of an individual, to determine an individual's response to administration of the antisense compound. An individual's response to administration of the antisense compound is used by a physician to determine the amount and duration of therapeutic intervention.
[0444] In certain embodiments, administration of an antisense compound targeted to a PKK nucleic acid results in reduction of PKK expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, or a range defined by any two of these values. In certain embodiments, pharmaceutical compositions comprising an antisense compound targeted to PKK are used for the preparation of a medicament for treating a patient suffering or susceptible to an inflammatory disease or thromboembolic disease.Certain Compositions1. ISIS 546254
[0445] In certain embodiments, ISIS 546254 is characterized as a 5-10-5 MOE gapmer, having a sequence of (from 5' to 3') TGCAAGTCTCTTGGCAAACA (incorporated herein as SEQ ID NO: 570), wherein each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5'-methylcytosine, each of nucleosides 1-5 and 16-20 are 2'-O-methoxyethyl modified nucleosides, and each of nucleosides 6-15 are 2'-deoxynucleosides.
[0446] In certain embodiments, ISIS 546254 is described by the following chemical notation: Tes Ges mCes Aes Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aes Aes Aes mCes Ae; wherein, A = an adenine, mC = a 5'-methylcytosine G = a guanine, T = a thymine, e = a 2'-O-methoxyethyl modified nucleoside, d = a 2'-deoxynucleoside, and s = a phosphorothioate internucleoside linkage.
[0447] In certain embodiments, ISIS 546254 is described by the following chemical structure: Structure 1. ISIS 546254
[0448] In certain embodiments, as provided in Example 2 (hereinbelow), ISIS 546254 achieved 95% inhibition of human PKK mRNA in cultured HepaRG ™< cells (density of 20,000 cells per well) when transfected using electroporation with 5,000 nM antisense oligonucleotide after a treatment period of 24 hours and measured by quantitative real-time PCR using human primer probe set RTS3454 and adjusted according to total RNA content, as measured by RIBOGREEN ®< .
[0449] In certain embodiments, as provided in Example 5 (see Tables 34 and 41 hereinbelow), ISIS 546254 achieved an IC 50 of 0.2µM and 0.3µM in a 4 point dose response curve (0.19 µM, 0.56 µM, 1.67 µM, and 5.0 µM) in cultured HepaRG ™< cells (density of 20,000 cells per well) when transfected using electroporation after a treatment period of 16 and measured by quantitative real-time PCR using human primer probe set RTS3454 and adjusted according to total RNA content, as measured by RIBOGREEN ®< .
[0450] In certain embodiments, as provided in Example 7 (hereinbelow), ISIS 546254 achieved 31%, 55%, 84%, and 83% human PKK mRNA inhibition and 0%, 36%, 51%, and 76% human PKK protein inhibition in transgenic mice harboring the human PKK gene sequence when injected subcutaneously twice a week for 3 weeks with 2.5 mg / kg / week, 5.0 mg / kg / week, 10 mg / kg / week or 20 mg / kg / week with ISIS 546254.
[0451] In certain embodiments, as provided in Example 8 (hereinbelow), ISISI 546254 is effective for inhibiting PKK mRNA and protein expression and is tolerable in primates.4. ISIS 721744
[0452] In certain embodiments, ISIS 721744 is characterized as a 5-10-5 MOE gapmer, having a sequence of (from 5' to 3') TGCAAGTCTCTTGGCAAACA (incorporated herein as SEQ ID NO: 570), wherein the internucleoside linkages between nucleosides 3 to 4, 4 to 5, 16 to 17, and 17 to 18 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 2 to 3, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 18 to 19, and 19 to 20 are phosphorothioate linkages, each cytosine is a 5'-methylcytosine, each of nucleosides 1-5 and 16-20 are 2'-O-methoxyethyl modified nucleosides, and each of nucleosides 6-15 are 2'-deoxynucleosides.
[0453] In certain embodiments, ISIS 721744 is described by the following chemical notation: GalNAc3-7 a-o' Tes Ges mCeo Aeo Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae; wherein, A = an adenine, mC = a 5'-methylcytosine G = a guanine, T = a thymine, e = a 2'-O-methoxyethyl modified nucleoside, d = a 2'-deoxynucleoside, o= a phosphodiester internucleoside linkage, s = a phosphorothioate internucleoside linkage, and GalNAc3-7 a-o' =
[0454] In certain embodiments, ISIS 721744 is described by the following chemical structure: EXAMPLES Non-limiting disclosure
[0455] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein. Any example lying outside the scope of the claims does not form part of the invention and is only intended for illustrative as well as comparative purposes.
[0456] The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinity modifications at the same position are considered suitable, unless otherwise indicated.Example 1: General Method for the Preparation of Phosphoramidites, Compounds 1, 1a and 2
[0457] Bx is a heterocyclic base;
[0458] Compounds 1, 1a and 2 were prepared as per the procedures well known in the art as described in the specification herein (see Seth et al., Bioorg. Med. Chem., 2011, 21(4), 1122-1125, J. Org. Chem., 2010, 75(5), 1569-1581, Nucleic Acids Symposium Series, 2008, 52(1), 553-554); and also see published PCT International Applications (WO 2011 / 115818, WO 2010 / 077578, WO2010 / 036698, WO2009 / 143369, WO 2009 / 006478, and WO 2007 / 090071), and US patent 7,569,686).Example 2: Preparation of Compound 7
[0459]
[0460] Compounds 3 (2-acetamido-1,3,4,6-tetra-O-acetyl-2-deoxy-β-Dgalactopyranose or galactosamine pentaacetate) is commercially available. Compound 5 was prepared according to published procedures (Weber et al., J. Med. Chem., 1991, 34, 2692).Example 3: Preparation of Compound 11
[0461]
[0462] Compounds 8 and 9 are commercially available.Example 4: Preparation of Compound 18
[0463]
[0464] Compound 11 was prepared as per the procedures illustrated in Example 3. Compound 14 is commercially available. Compound 17 was prepared using similar procedures reported by Rensen et al., J. Med. Chem., 2004, 47, 5798-5808.Example 5: Preparation of Compound 23
[0465]
[0466] Compounds 19 and 21 are commercially available.Example 6: Preparation of Compound 24
[0467]
[0468] Compounds 18 and 23 were prepared as per the procedures illustrated in Examples 4 and 5.Example 7: Preparation of Compound 25
[0469]
[0470] Compound 24 was prepared as per the procedures illustrated in Example 6.Example 8: Preparation of Compound 26
[0471]
[0472] Compound 24 is prepared as per the procedures illustrated in Example 6.Example 10: General preparation conjugated ASOs comprising GalNAc 3 -1 at the 5' terminus, Compound 34
[0473]
[0474] The Unylinker ™< 30 is commercially available. Oligomeric Compound 34 comprising a GalNAc 3 -1 cluster at the 5' terminus is prepared using standard procedures in automated DNA / RNA synthesis (see Dupouy et al., Angew. Chem. Int. Ed., 2006, 45, 3623-3627). Phosphoramidite building blocks, Compounds 1 and 1a were prepared as per the procedures illustrated in Example 1. The phosphoramidites illustrated are meant to be representative and not intended to be limiting as other phosphoramidite building blocks can be used to prepare an oligomeric compound having a predetermined sequence and composition. The order and quantity of phosphoramidites added to the solid support can be adjusted to prepare gapped oligomeric compounds as described herein. Such gapped oligomeric compounds can have predetermined composition and base sequence as dictated by any given target.Example 11: Preparation of Compound 39
[0475]
[0476] Compounds 4, 13 and 23 were prepared as per the procedures illustrated in Examples 2, 4, and 5. Compound 35 is prepared using similar procedures published in Rouchaud et al., Eur. J. Org. Chem., 2011, 12, 2346-2353.Example 12: Preparation of Compound 40
[0477]
[0478] Compound 38 is prepared as per the procedures illustrated in Example 11.Example 13: Preparation of Compound 44
[0479]
[0480] Compounds 23 and 36 are prepared as per the procedures illustrated in Examples 5 and 11. Compound 41 is prepared using similar procedures published in WO 2009082607.Example 14: Preparation of Compound 45
[0481]
[0482] Compound 43 is prepared as per the procedures illustrated in Example 13.Example 15: Preparation of Compound 47
[0483]
[0484] Compound 46 is commercially available.Example 16: Preparation of Compound 53
[0485]
[0486] Compounds 48 and 49 are commercially available. Compounds 17 and 47 are prepared as per the procedures illustrated in Examples 4 and 15.Example 17: Preparation of Compound 54
[0487]
[0488] Compound 53 is prepared as per the procedures illustrated in Example 16.Example 18: Preparation of Compound 55
[0489]
[0490] Compound 53 is prepared as per the procedures illustrated in Example 16.Example 27: Compound 56
[0491]
[0492] Compound 56 is commercially available from Glen Research or may be prepared according to published procedures reported by Shchepinov et al., Nucleic Acids Research, 1997, 25(22), 4447-4454.Example 28: Preparation of Compound 60
[0493]
[0494] Compound 4 was prepared as per the procedures illustrated in Example 2. Compound 57 is commercially available. Compound 60 was confirmed by structural analysis.
[0495] Compound 57 is meant to be representative and not intended to be limiting as other monoprotected substituted or unsubstituted alkyl diols including but not limited to those presented in the specification herein can be used to prepare phosphoramidites having a predetermined composition.Example 29: Preparation of Compound 63
[0496]
[0497] Compounds 61 and 62 are prepared using procedures similar to those reported by Tober et al., Eur. J. Org. Chem., 2013, 3, 566-577; and Jiang et al., Tetrahedron, 2007, 63(19), 3982-3988.
[0498] Alternatively, Compound 63 is prepared using procedures similar to those reported in scientific and patent literature by Kim et al., Synlett, 2003, 12, 1838-1840; and Kim et al., published PCT International Application, WO 2004063208.Example 30: Preparation of Compound 63b
[0499]
[0500] Compound 63a is prepared using procedures similar to those reported by Hanessian et al., Canadian Journal of Chemistry, 1996, 74(9), 1731-1737.Example 31: Preparation of Compound 63d
[0501]
[0502] Compound 63c is prepared using procedures similar to those reported by Chen et al., Chinese Chemical Letters, 1998, 9(5), 451-453.Example 32: Preparation of Compound 67
[0503]
[0504] Compound 64 was prepared as per the procedures illustrated in Example 2. Compound 65 is prepared using procedures similar to those reported by Or et al., published PCT International Application, WO 2009003009. The protecting groups used for Compound 65 are meant to be representative and not intended to be limiting as other protecting groups including but not limited to those presented in the specification herein can be used.Example 33: Preparation of Compound 70
[0505]
[0506] Compound 64 was prepared as per the procedures illustrated in Example 2. Compound 68 is commercially available. The protecting group used for Compound 68 is meant to be representative and not intended to be limiting as other protecting groups including but not limited to those presented in the specification herein can be used.Example 34: Preparation of Compound 75a
[0507]
[0508] Compound 75 is prepared according to published procedures reported by Shchepinov et al., Nucleic Acids Research, 1997, 25(22), 4447-4454.Example 35: Preparation of Compound 79
[0509]
[0510] Compound 76 was prepared according to published procedures reported by Shchepinov et al., Nucleic Acids Research, 1997, 25(22), 4447-4454.Example 36: Preparation of Compound 79a
[0511]
[0512] Compound 77 is prepared as per the procedures illustrated in Example 35.Example 37: General method for the preparation of conjugated oligomeric compound 82 comprising a phosphodiester linked GalNAc 3 -2 conjugate at 5' terminus via solid support (Method I)
[0513] wherein GalNAc 3 -2 has the structure:
[0514] The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -2 (GalNAc 3 -2 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. Wherein GalNAc 3 -2 a has the formula:
[0515] The VIMAD-bound oligomeric compound 79b was prepared using standard procedures for automated DNA / RNA synthesis (see Dupouy et al., Angew. Chem. Int. Ed., 2006, 45, 3623-3627). The phosphoramidite Compounds 56 and 60 were prepared as per the procedures illustrated in Examples 27 and 28, respectively. The phosphoramidites illustrated are meant to be representative and not intended to be limiting as other phosphoramidite building blocks including but not limited those presented in the specification herein can be used to prepare an oligomeric compound having a phosphodiester linked conjugate group at the 5' terminus. The order and quantity of phosphoramidites added to the solid support can be adjusted to prepare the oligomeric compounds as described herein having any predetermined sequence and composition.Example 38: Alternative method for the preparation of oligomeric compound 82 comprising a phosphodiester linked GalNAc 3 -2 conjugate at 5' terminus (Method II)
[0516]
[0517] The VIMAD-bound oligomeric compound 79b was prepared using standard procedures for automated DNA / RNA synthesis (see Dupouy et al., Angew. Chem. Int. Ed., 2006, 45, 3623-3627). The GalNAc 3 -2 cluster phosphoramidite, Compound 79 was prepared as per the procedures illustrated in Example 35. This alternative method allows a one-step installation of the phosphodiester linked GalNAc 3 -2 conjugate to the oligomeric compound at the final step of the synthesis. The phosphoramidites illustrated are meant to be representative and not intended to be limiting, as other phosphoramidite building blocks including but not limited to those presented in the specification herein can be used to prepare oligomeric compounds having a phosphodiester conjugate at the 5' terminus. The order and quantity of phosphoramidites added to the solid support can be adjusted to prepare the oligomeric compounds as described herein having any predetermined sequence and composition.Example 39: General method for the preparation of oligomeric compound 83h comprising a GalNAc 3 -3 Conjugate at the 5' Terminus (GalNAc 3 -1 modified for 5' end attachment) via Solid Support
[0518]
[0519] Compound 18 was prepared as per the procedures illustrated in Example 4. Compounds 83a and 83b are commercially available. Oligomeric Compound 83e comprising a phosphodiester linked hexylamine was prepared using standard oligonucleotide synthesis procedures. Treatment of the protected oligomeric compound with aqueous ammonia provided the 5'-GalNAc 3 -3 conjugated oligomeric compound (83h).
[0520] Wherein GalNAc 3 -3 has the structure:
[0521] The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -3 (GalNAc 3 -3 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. Wherein GalNAc 3 -3 a has the formula: Example 41: General method for the preparation of ASOs comprising a phosphodiester linked GalNAc 3 -2 (see Example 37, Bx is adenine) conjugate at the 5' position via solid phase techniques (preparation of ISIS 661134)
[0522] Unless otherwise stated, all reagents and solutions used for the synthesis of oligomeric compounds are purchased from commercial sources. Standard phosphoramidite building blocks and solid support are used for incorporation nucleoside residues which include for example T, A, G, and m< C residues. Phosphoramidite compounds 56 and 60 were used to synthesize the phosphodiester linked GalNAc 3 -2 conjugate at the 5' terminus. A 0.1 M solution of phosphoramidite in anhydrous acetonitrile was used for β-D-2'-deoxyribonucleoside and 2'-MOE.
[0523] The ASO syntheses were performed on ABI 394 synthesizer (1-2 µmol scale) or on GE Healthcare Bioscience AKTA oligopilot synthesizer (40-200 µmol scale) by the phosphoramidite coupling method on VIMAD solid support (110 µmol / g, Guzaev et al., 2003) packed in the column. For the coupling step, the phosphoramidites were delivered at a 4 fold excess over the initial loading of the solid support and phosphoramidite coupling was carried out for 10 min. All other steps followed standard protocols supplied by the manufacturer. A solution of 6% dichloroacetic acid in toluene was used for removing the dimethoxytrityl (DMT) groups from 5'-hydroxyl groups of the nucleotide. 4,5-Dicyanoimidazole (0.7 M) in anhydrous CH 3 CN was used as activator during the coupling step. Phosphorothioate linkages were introduced by sulfurization with 0.1 M solution of xanthane hydride in 1:1 pyridine / CH 3 CN for a contact time of 3 minutes. A solution of 20% tert-butylhydroperoxide in CH 3 CN containing 6% water was used as an oxidizing agent to provide phosphodiester internucleoside linkages with a contact time of 12 minutes.
[0524] After the desired sequence was assembled, the cyanoethyl phosphate protecting groups were deprotected using a 20% diethylamine in toluene (v / v) with a contact time of 45 minutes. The solid-support bound ASOs were suspended in aqueous ammonia (28-30 wt %) and heated at 55 °C for 6 h. The unbound ASOs were then filtered and the ammonia was boiled off. The residue was purified by high pressure liquid chromatography on a strong anion exchange column (GE Healthcare Bioscience, Source 30Q, 30 µm, 2.54 x 8 cm, A = 100 mM ammonium acetate in 30% aqueous CH 3 CN, B = 1.5 M NaBr in A, 0-40% of B in 60 min, flow 14 mL min-1, λ = 260 nm). The residue was desalted by HPLC on a reverse phase column to yield the desired ASOs in an isolated yield of 15-30% based on the initial loading on the solid support. The ASOs were characterized by ion-pair-HPLC coupled MS analysis with Agilent 1100 MSD system. Table 34 ASO comprising a phosphodiester linked GalNAc 3 -2 conjugate at the 5' position targeting SRB-1 ISIS No.Sequence (5' to 3')CalCd MassObserved MassSEQ ID No.6611346482.26481.62254Subscripts: "e" indicates 2'-MOE modified nucleoside; "d" indicates β-D-2'-deoxyribonucleoside; "k" indicates 6'-(S)-CH 3 bicyclic nucleoside (e.g. cEt); "s" indicates phosphorothioate internucleoside linkages (PS); "o" indicates phosphodiester internucleoside linkages (PO); and "o'" indicates - O-P(=O)(OH)-. Superscript "m" indicates 5-methylcytosines. The structure of GalNAc 3 -2 a is shown in Example 37. Example 42: General method for the preparation of ASOs comprising a GalNAc 3 -3 conjugate at the 5' position via solid phase techniques (preparation of ISIS 661166)
[0525] The synthesis for ISIS 661166 was performed using similar procedures as illustrated in Examples 39 and 41.
[0526] ISIS 661166 is a 5-10-5 MOE gapmer, wherein the 5' position comprises a GalNAc 3 -3 conjugate. The ASO was characterized by ion-pair-HPLC coupled MS analysis with Agilent 1100 MSD system. Table 34a ASO comprising a GalNAc 3 -3 conjugate at the 5' position via a hexylamino phosphodiester linkage targeting Malat-1 ISIS No.Sequence (5' to 3')ConjugateCalcd MassObserved MassSEQ ID No.6611665'-GalNAc 3 -3 8992.168990.512255Subscripts: "e" indicates 2'-MOE modified nucleoside; "d" indicates β-D-2'-deoxyribonucleoside; "s" indicates phosphorothioate internucleoside linkages (PS); "o" indicates phosphodiester internucleoside linkages (PO); and "o'" indicates -O-P(=O)(OH)-. Superscript "m" indicates 5-methylcytosines. The structure of "5'-GalNAc 3 -3a" is shown in Example 39. Example 44: Effect of PO / PS linkages on antisense inhibition of ASOs comprising GalNAc 3 -1 conjugate (see Example 9) at the 3' terminus targeting SRB-1
[0527] ISIS 655861 and 655862 comprising a GalNAc 3 -1 conjugate at the 3' terminus each targeting SRB-1 were tested in a single administration study for their ability to inhibit SRB-1 in mice. The parent unconjugated compound, ISIS 353382 was included in the study for comparison.
[0528] The ASOs are 5-10-5 MOE gapmers, wherein the gap region comprises ten 2'-deoxyribonucleosides and each wing region comprises five 2'-MOE modified nucleosides. The ASOs were prepared using similar methods as illustrated previously in Example 19 and are described Table 36, below. Table 36 Modified ASOs comprising GalNAc 3 -1 conjugate at the 3' terminus targeting SRB-1 ISIS No.Sequence (5' to 3')ChemistrySEQ ID No.353382 (parent)Full PS no conjugate2256655861Full PS with GalNAc 3 -1 conjugate2257655862Mixed PS / PO with GalNAc 3 -1 conjugate2257Subscripts: "e" indicates 2'-MOE modified nucleoside; "d" indicates β-D-2'-deoxyribonucleoside; "s" indicates phosphorothioate internucleoside linkages (PS); "o" indicates phosphodiester internucleoside linkages (PO); and "o'" indicates -O-P(=O)(OH)-. Superscript "m" indicates 5-methylcytosines. The structure of "GalNAc 3 -1" is shown in Example 9. Treatment
[0529] Six week old male Balb / c mice (Jackson Laboratory, Bar Harbor, ME) were injected subcutaneously once at the dosage shown below with ISIS 353382, 655861, 655862 or with PBS treated control. Each treatment group consisted of 4 animals. Prior to the treatment as well as after the last dose, blood was drawn from each mouse and plasma samples were analyzed. The mice were sacrificed 72 hours following the final administration to determine the liver SRB-1 mRNA levels using real-time PCR and RIBOGREEN ®< RNA quantification reagent (Molecular Probes, Inc. Eugene, OR) according to standard protocols. SRB-1 mRNA levels were determined relative to total RNA (using Ribogreen), prior to normalization to PBS-treated control. The results below are presented as the average percent of SRB-1 mRNA levels for each treatment group, normalized to PBS-treated control and is denoted as "% PBS". The ED 50 s were measured using similar methods as described previously and are reported below.
[0530] As illustrated in Table 37, treatment with antisense oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent manner compared to PBS treated control. Indeed, the antisense oligonucleotides comprising the GalNAc 3 -1 conjugate at the 3' terminus (ISIS 655861 and 655862) showed substantial improvement in potency comparing to the unconjugated antisense oligonucleotide (ISIS 353382). Further, ISIS 655862 with mixed PS / PO linkages showed an improvement in potency relative to full PS (ISIS 655861). Table 37 Effect of PO / PS linkages on antisense inhibition of ASOs comprising GalNAc 3 -1 conjugate at 3' terminus targeting SRB-1 ISIS No.Dosage (mg / kg)SRB-1 mRNA levels (% PBS)ED 50 (mg / kg)ChemistrySEQ ID No.PBS0100----353382 (parent)376.6510.4Full PS without conjugate22561052.403024.956558610.581.222.2Full PS with GalNAc 3 -1 conjugate22571.563.51524.611514.806558620.569.571.3Mixed PS / PO with GalNAc 3 -1 conjugate22571.545.78519.701512.90
[0531] Liver transaminase levels, alanine aminotransferase (ALT) and aspartate aminotransferase (AST), in serum were measured relative to saline injected mice using standard protocols. Organ weights were also evaluated. The results demonstrated that no elevation in transaminase levels (Table 38) or organ weights (data not shown) were observed in mice treated with ASOs compared to PBS control. Further, the ASO with mixed PS / PO linkages (ISIS 655862) showed similar transaminase levels compared to full PS (ISIS 655861). Table 38 Effect of PO / PS linkages on transaminase levels of ASOs comprising GalNAc 3 -1 conjugate at 3' terminus targeting SRB-1 ISIS No.Dosage (mg / kg)ALT (U / L)AST (U / L)ChemistrySEQ ID No.PBS028.565--353382 (parent)350.2589Full PS without conjugate22561027.579.33027.3976558610.52855.7Full PS with GalNAc 3 -1 22571.5307852963.51528.867.86558620.55075.5Mixed PS / PO with GalNAc 3 -1 22571.521.758.5529.369152261 Example 45: Preparation of PFP Ester, Compound 110a
[0532]
[0533] Compound 4 (9.5g, 28.8 mmoles) was treated with compound 103a or 103b (38 mmoles), individually, and TMSOTf (0.5 eq.) and molecular sieves in dichloromethane (200 mL), and stirred for 16 hours at room temperature. At that time, the organic layer was filtered thru celite, then washed with sodium bicarbonate, water and brine. The organic layer was then separated and dried over sodium sulfate, filtered and reduced under reduced pressure. The resultant oil was purified by silica gel chromatography (2%-->10% methanol / dichloromethane) to give compounds 104a and 104b in >80% yield. LCMS and proton NMR was consistent with the structure.
[0534] Compounds 104a and 104b were treated to the same conditions as for compounds 100a-d (Example 47), to give compounds 105a and 105b in >90% yield. LCMS and proton NMR was consistent with the structure.
[0535] Compounds 105a and 105b were treated, individually, with compound 90 under the same conditions as for compounds 901a-d, to give compounds 106a (80%) and 106b (20%). LCMS and proton NMR was consistent with the structure.
[0536] Compounds 106a and 106b were treated to the same conditions as for compounds 96a-d (Example 47), to give 107a (60%) and 107b (20%). LCMS and proton NMR was consistent with the structure.
[0537] Compounds 107a and 107b were treated to the same conditions as for compounds 97a-d (Example 47), to give compounds 108a and 108b in 40-60% yield. LCMS and proton NMR was consistent with the structure.
[0538] Compounds 108a (60%) and 108b (40%) were treated to the same conditions as for compounds 100a-d (Example 47), to give compounds 109a and 109b in >80% yields. LCMS and proton NMR was consistent with the structure.
[0539] Compound 109a was treated to the same conditions as for compounds 101a-d (Example 47), to give Compound 110a in 30-60% yield. LCMS and proton NMR was consistent with the structure. Alternatively, Compound 110b can be prepared in a similar manner starting with Compound 109b.Example 46: General Procedure for Conjugation with PFP Esters (Oligonucleotide 111); Preparation of ISIS 666881 (GalNAc 3 -10)
[0540] A 5'-hexylamino modified oligonucleotide was synthesized and purified using standard solid-phase oligonucleotide procedures. The 5'-hexylamino modified oligonucleotide was dissolved in 0.1 M sodium tetraborate, pH 8.5 (200 µL) and 3 equivalents of a selected PFP esterified GalNAc 3 cluster dissolved in DMSO (50 µL) was added. If the PFP ester precipitated upon addition to the ASO solution DMSO was added until all PFP ester was in solution. The reaction was complete after about 16 h of mixing at room temperature. The resulting solution was diluted with water to 12 mL and then spun down at 3000 rpm in a spin filter with a mass cut off of 3000 Da. This process was repeated twice to remove small molecule impurities. The solution was then lyophilized to dryness and redissolved in concentrated aqueous ammonia and mixed at room temperature for 2.5 h followed by concentration in vacuo to remove most of the ammonia. The conjugated oligonucleotide was purified and desalted by RP-HPLC and lyophilized to provide the GalNAc 3 conjugated oligonucleotide.
[0541] Oligonucleotide 111 is conjugated with GalNAc 3 -10. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -10 (GalNAc 3 -10 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)- as shown in the oligonucleotide (ISIS 666881) synthesized with GalNAc 3 -10 below. The structure of GalNAc 3 -10 (GalNAc 3 -10 a -CM-) is shown below:
[0542] Following this general procedure ISIS 666881 was prepared. 5'-hexylamino modified oligonucleotide, ISIS 660254, was synthesized and purified using standard solid-phase oligonucleotide procedures. ISIS 660254 (40 mg, 5.2 µmol) was dissolved in 0.1 M sodium tetraborate, pH 8.5 (200 µL) and 3 equivalents PFP ester (Compound 110a) dissolved in DMSO (50 µL) was added. The PFP ester precipitated upon addition to the ASO solution requiring additional DMSO (600 µL) to fully dissolve the PFP ester. The reaction was complete after 16 h of mixing at room temperature. The solution was diluted with water to 12 mL total volume and spun down at 3000 rpm in a spin filter with a mass cut off of 3000 Da. This process was repeated twice to remove small molecule impurities. The solution was lyophilized to dryness and redissolved in concentrated aqueous ammonia with mixing at room temperature for 2.5 h followed by concentration in vacuo to remove most of the ammonia. The conjugated oligonucleotide was purified and desalted by RP-HPLC and lyophilized to give ISIS 666881 in 90% yield by weight (42 mg, 4.7 µmol).GalNAc 3 -10 conjugated oligonucleotide
[0543] ASO Sequence (5' to 3') 5' group SEQ ID No. ISIS 660254Hexylamine2258ISIS 666881GalNAc 3 -10 2258Capital letters indicate the nucleobase for each nucleoside and m< C indicates a 5-methyl cytosine. Subscripts: "e" indicates a 2'-MOE modified nucleoside; "d" indicates a β-D-2'-deoxyribonucleoside; "s" indicates a phosphorothioate internucleoside linkage (PS); "o" indicates a phosphodiester internucleoside linkage (PO); and "o'" indicates -O-P(=O)(OH)-. Conjugate groups are in bold. Example 47: Preparation of Oligonucleotide 102 Comprising GalNAc 3 -8
[0544]
[0545] The triacid 90 (4 g, 14.43 mmol) was dissolved in DMF (120 mL) and N,N-Diisopropylethylamine (12.35 mL, 72 mmoles). Pentafluorophenyl trifluoroacetate (8.9 mL, 52 mmoles) was added dropwise, under argon, and the reaction was allowed to stir at room temperature for 30 minutes. Boc-diamine 91a or 91b (68.87 mmol) was added, along with N,N-Diisopropylethylamine (12.35 mL, 72 mmoles), and the reaction was allowed to stir at room temperature for 16 hours. At that time, the DMF was reduced by >75% under reduced pressure, and then the mixture was dissolved in dichloromethane. The organic layer was washed with sodium bicarbonate, water and brine. The organic layer was then separated and dried over sodium sulfate, filtered and reduced to an oil under reduced pressure. The resultant oil was purified by silica gel chromatography (2%->10% methanol / dichloromethane) to give compounds 92a and 92b in an approximate 80% yield. LCMS and proton NMR were consistent with the structure.
[0546] Compound 92a or 92b (6.7 mmoles) was treated with 20 mL of dichloromethane and 20 mL of trifluoroacetic acid at room temperature for 16 hours. The resultant solution was evaporated and then dissolved in methanol and treated with DOWEX-OH resin for 30 minutes. The resultant solution was filtered and reduced to an oil under reduced pressure to give 85-90% yield of compounds 93a and 93b.
[0547] Compounds 7 or 64 (9.6 mmoles) were treated with HBTU (3.7g, 9.6 mmoles) and N,N-Diisopropylethylamine (5 mL) in DMF (20 mL) for 15 minutes. To this was added either compounds 93a or 93b (3 mmoles), and allowed to stir at room temperature for 16 hours. At that time, the DMF was reduced by >75% under reduced pressure, and then the mixture was dissolved in dichloromethane. The organic layer was washed with sodium bicarbonate, water and brine. The organic layer was then separated and dried over sodium sulfate, filtered and reduced to an oil under reduced pressure. The resultant oil was purified by silica gel chromatography (5%-->20% methanol / dichloromethane) to give compounds 96a-d in 20-40% yield. LCMS and proton NMR was consistent with the structure.
[0548] Compounds 96a-d (0.75 mmoles), individually, were hydrogenated over Raney Nickel for 3 hours in Ethanol (75 mL). At that time, the catalyst was removed by filtration thru celite, and the ethanol removed under reduced pressure to give compounds 97a-d in 80-90% yield. LCMS and proton NMR were consistent with the structure.
[0549] Compound 23 (0.32g, 0.53 mmoles) was treated with HBTU (0.2g, 0.53 mmoles) and N,N-Diisopropylethylamine (0.19 mL, 1.14 mmoles) in DMF (30mL) for 15 minutes. To this was added compounds 97a-d (0.38 mmoles), individually, and allowed to stir at room temperature for 16 hours. At that time, the DMF was reduced by >75% under reduced pressure, and then the mixture was dissolved in dichloromethane. The organic layer was washed with sodium bicarbonate, water and brine. The organic layer was then separated and dried over sodium sulfate, filtered and reduced to an oil under reduced pressure. The resultant oil was purified by silica gel chromatography (2%-->20% methanol / dichloromethane) to give compounds 98a-d in 30-40% yield. LCMS and proton NMR was consistent with the structure.
[0550] Compound 99 (0.17g, 0.76 mmoles) was treated with HBTU (0.29 g, 0.76 mmoles) and N,N-Diisopropylethylamine (0.35 mL, 2.0 mmoles) in DMF (50mL) for 15 minutes. To this was added compounds 97a-d (0.51 mmoles), individually, and allowed to stir at room temperature for 16 hours. At that time, the DMF was reduced by >75% under reduced pressure, and then the mixture was dissolved in dichloromethane. The organic layer was washed with sodium bicarbonate, water and brine. The organic layer was then separated and dried over sodium sulfate, filtered and reduced to an oil under reduced pressure. The resultant oil was purified by silica gel chromatography (5%-->20% methanol / dichloromethane) to give compounds 100a-d in 40-60% yield. LCMS and proton NMR was consistent with the structure.
[0551] Compounds 100a-d (0.16 mmoles), individually, were hydrogenated over 10% Pd(OH) 2 / C for 3 hours in methanol / ethyl acetate (1:1, 50 mL). At that time, the catalyst was removed by filtration thru celite, and the organics removed under reduced pressure to give compounds 101a-d in 80-90% yield. LCMS and proton NMR was consistent with the structure.
[0552] Compounds 101a-d (0.15 mmoles), individually, were dissolved in DMF (15 mL) and pyridine (0.016 mL, 0.2 mmoles). Pentafluorophenyl trifluoroacetate (0.034 mL, 0.2 mmoles) was added dropwise, under argon, and the reaction was allowed to stir at room temperature for 30 minutes. At that time, the DMF was reduced by >75% under reduced pressure, and then the mixture was dissolved in dichloromethane. The organic layer was washed with sodium bicarbonate, water and brine. The organic layer was then separated and dried over sodium sulfate, filtered and reduced to an oil under reduced pressure. The resultant oil was purified by silica gel chromatography (2%-->5% methanol / dichloromethane) to give compounds 102a-d in an approximate 80% yield. LCMS and proton NMR were consistent with the structure.
[0553] Oligomeric Compound 102, comprising a GalNAc 3 -8 conjugate group, was prepared using the general procedures illustrated in Example 46. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -8 (GalNAc 3 -8 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In a preferred embodiment, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-.
[0554] The structure of GalNAc 3 -8 (GalNAc 3 -8 a -CM-) is shown below: Example 48: Preparation of Oligonucleotide 119 Comprising GalNAc 3 -7
[0555]
[0556] Compound 112 was synthesized following the procedure described in the literature (J. Med. Chem. 2004, 47, 5798-5808).
[0557] Compound 112 (5 g, 8.6 mmol) was dissolved in 1:1 methanol / ethyl acetate (22 mL / 22 mL). Palladium hydroxide on carbon (0.5 g) was added. The reaction mixture was stirred at room temperature under hydrogen for 12 h. The reaction mixture was filtered through a pad of celite and washed the pad with 1:1 methanol / ethyl acetate. The filtrate and the washings were combined and concentrated to dryness to yield Compound 105a (quantitative). The structure was confirmed by LCMS.
[0558] Compound 113 (1.25 g, 2.7 mmol), HBTU (3.2 g, 8.4 mmol) and DIEA (2.8 mL, 16.2 mmol) were dissolved in anhydrous DMF (17 mL) and the reaction mixture was stirred at room temperature for 5 min. To this a solution of Compound 105a (3.77 g, 8.4 mmol) in anhydrous DMF (20 mL) was added. The reaction was stirred at room temperature for 6 h. Solvent was removed under reduced pressure to get an oil. The residue was dissolved in CH 2 Cl 2 (100 mL) and washed with aqueous saturated NaHCO 3 solution (100 mL) and brine (100 mL). The organic phase was separated, dried (Na 2 SO 4 ), filtered and evaporated. The residue was purified by silica gel column chromatography and eluted with 10 to 20 % MeOH in dichloromethane to yield Compound 114 (1.45 g, 30%). The structure was confirmed by LCMS and 1< H NMR analysis.
[0559] Compound 114 (1.43 g, 0.8 mmol) was dissolved in 1:1 methanol / ethyl acetate (4 mL / 4 mL). Palladium on carbon (wet, 0.14 g) was added. The reaction mixture was flushed with hydrogen and stirred at room temperature under hydrogen for 12 h. The reaction mixture was filtered through a pad of celite. The celite pad was washed with methanol / ethyl acetate (1:1). The filtrate and the washings were combined together and evaporated under reduced pressure to yield Compound 115 (quantitative). The structure was confirmed by LCMS and 1< H NMR analysis.
[0560] Compound 83a (0.17 g, 0.75 mmol), HBTU (0.31 g, 0.83 mmol) and DIEA (0.26 mL, 1.5 mmol) were dissolved in anhydrous DMF (5 mL) and the reaction mixture was stirred at room temperature for 5 min. To this a solution of Compound 115 (1.22 g, 0.75 mmol) in anhydrous DMF was added and the reaction was stirred at room temperature for 6 h. The solvent was removed under reduced pressure and the residue was dissolved in CH 2 Cl 2 . The organic layer was washed aqueous saturated NaHCO 3 solution and brine and dried over anhydrous Na 2 SO 4 and filtered. The organic layer was concentrated to dryness and the residue obtained was purified by silica gel column chromatography and eluted with 3 to 15 % MeOH in dichloromethane to yield Compound 116 (0.84 g, 61%). The structure was confirmed by LC MS and 1< H NMR analysis.
[0561] Compound 116 (0.74 g, 0.4 mmol) was dissolved in 1:1 methanol / ethyl acetate (5 mL / 5 mL). Palladium on carbon (wet, 0.074 g) was added. The reaction mixture was flushed with hydrogen and stirred at room temperature under hydrogen for 12 h. The reaction mixture was filtered through a pad of celite. The celite pad was washed with methanol / ethyl acetate (1:1). The filtrate and the washings were combined together and evaporated under reduced pressure to yield compound 117 (0.73 g, 98%). The structure was confirmed by LCMS and 1< H NMR analysis.
[0562] Compound 117 (0.63 g, 0.36 mmol) was dissolved in anhydrous DMF (3 mL). To this solution N,N-Diisopropylethylamine (70 µL, 0.4 mmol) and pentafluorophenyl trifluoroacetate (72 µL, 0.42 mmol) were added. The reaction mixture was stirred at room temperature for 12 h and poured into a aqueous saturated NaHCO 3 solution. The mixture was extracted with dichloromethane, washed with brine and dried over anhydrous Na 2 SO 4 . The dichloromethane solution was concentrated to dryness and purified with silica gel column chromatography and eluted with 5 to 10 % MeOH in dichloromethane to yield compound 118 (0.51 g, 79%). The structure was confirmed by LCMS and 1< H and 1< H and 19< F NMR.
[0563] Oligomeric Compound 119, comprising a GalNAc 3 -7 conjugate group, was prepared using the general procedures illustrated in Example 46. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -7 (GalNAc 3 -7 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-.
[0564] The structure of GalNAc 3 -7 (GalNAc 3 -7 a -CM-) is shown below: Example 49: Preparation of Oligonucleotide 132 Comprising GalNAc 3 -5
[0565]
[0566] Compound 120 (14.01 g, 40 mmol) and HBTU (14.06 g, 37 mmol) were dissolved in anhydrous DMF (80 mL). Triethylamine (11.2 mL, 80.35 mmol) was added and stirred for 5 min. The reaction mixture was cooled in an ice bath and a solution of compound 121 (10 g, mmol) in anhydrous DMF (20 mL) was added. Additional triethylamine (4.5 mL, 32.28 mmol) was added and the reaction mixture was stirred for 18 h under an argon atmosphere. The reaction was monitored by TLC (ethyl acetate:hexane; 1:1; Rf = 0.47). The solvent was removed under reduced pressure. The residue was taken up in EtOAc (300 mL) and washed with 1M NaHSO 4 ( 3 x 150 mL), aqueous saturated NaHCO 3 solution (3 x 150 mL) and brine (2 x 100 mL). Organic layer was dried with Na 2 SO 4 . Drying agent was removed by filtration and organic layer was concentrated by rotary evaporation. Crude mixture was purified by silica gel column chromatography and eluted by using 35 - 50% EtOAc in hexane to yield a compound 122 (15.50 g, 78.13%). The structure was confirmed by LCMS and 1< H NMR analysis. Mass m / z 589.3 [M + H] +< .
[0567] A solution of LiOH (92.15 mmol) in water (20 mL) and THF (10 mL) was added to a cooled solution of Compound 122 (7.75 g,13.16 mmol) dissolved in methanol (15 mL). The reaction mixture was stirred at room temperature for 45 min. and monitored by TLC (EtOAc:hexane; 1:1). The reaction mixture was concentrated to half the volume under reduced pressure. The remaining solution was cooled an ice bath and neutralized by adding concentrated HCl. The reaction mixture was diluted, extracted with EtOAc (120 mL) and washed with brine (100 mL). An emulsion formed and cleared upon standing overnight. The organic layer was separated dried (Na 2 SO 4 ), filtered and evaporated to yield Compound 123 (8.42 g). Residual salt is the likely cause of excess mass. LCMS is consistent with structure. Product was used without any further purification. M.W.cal:574.36; M.W.fd:575.3 [M + H] +< .
[0568] Compound 126 was synthesized following the procedure described in the literature (J. Am. Chem. Soc. 2011, 133, 958-963).
[0569] Compound 123 (7.419 g, 12.91 mmol), HOBt (3.49 g, 25.82 mmol) and compound 126 (6.33 g, 16.14 mmol) were dissolved in and DMF (40 mL) and the resulting reaction mixture was cooled in an ice bath. To this N,N-Diisopropylethylamine (4.42 mL, 25.82 mmol), PyBop (8.7 g, 16.7 mmol) followed by Bop coupling reagent (1.17 g, 2.66 mmol) were added under an argon atmosphere. The ice bath was removed and the solution was allowed to warm to room temperature. The reaction was completed after 1 h as determined by TLC (DCM:MeOH:AA; 89:10:1). The reaction mixture was concentrated under reduced pressure. The residue was dissolved in EtOAc (200 mL) and washed with 1 M NaHSO 4 (3x100 mL), aqueous saturated NaHCO 3 (3x100 mL) and brine (2x100 mL). The organic phase separated dried (Na 2 SO 4 ), filtered and concentrated. The residue was purified by silica gel column chromatography with a gradient of 50% hexanes / EtOAC to 100% EtOAc to yield Compound 127 (9.4 g) as a white foam. LCMS and 1< H NMR were consistent with structure. Mass m / z 778.4 [M + H] +< .
[0570] Trifluoroacetic acid (12 mL) was added to a solution of compound 127 (1.57 g, 2.02 mmol) in dichloromethane (12 mL) and stirred at room temperature for 1 h. The reaction mixture was co-evaporated with toluene (30 mL) under reduced pressure to dryness. The residue obtained was co-evaporated twice with acetonitrile (30 mL) and toluene (40 mL) to yield Compound 128 (1.67 g) as trifluoro acetate salt and used for next step without further purification. LCMS and 1< H NMR were consistent with structure. Mass m / z 478.2 [M + H] +< .
[0571] Compound 7 (0.43 g, 0.963 mmol), HATU (0.35 g, 0.91 mmol), and HOAt (0.035 g, 0.26 mmol) were combined together and dried for 4 h over P 2 O 5 under reduced pressure in a round bottom flask and then dissolved in anhydrous DMF (1 mL) and stirred for 5 min. To this a solution of compound 128 (0.20 g, 0.26 mmol) in anhydrous DMF (0.2 mL) and N,N-Diisopropylethylamine (0.2 mL) was added. The reaction mixture was stirred at room temperature under an argon atmosphere. The reaction was complete after 30 min as determined by LCMS and TLC (7% MeOH / DCM). The reaction mixture was concentrated under reduced pressure. The residue was dissolved in DCM (30 mL) and washed with 1 M NaHSO 4 (3x20 mL), aqueous saturated NaHCO 3 (3 x 20 mL) and brine (3x20 mL). The organic phase was separated, dried over Na 2 SO 4 , filtered and concentrated. The residue was purified by silica gel column chromatography using 5-15% MeOH in dichloromethane to yield Compound 129 (96.6 mg). LC MS and 1< H NMR are consistent with structure. Mass m / z 883.4 [M + 2H] +< .
[0572] Compound 129 (0.09 g, 0.051 mmol) was dissolved in methanol (5 mL) in 20 mL scintillation vial. To this was added a small amount of 10% Pd / C (0.015 mg) and the reaction vessel was flushed with H 2 gas. The reaction mixture was stirred at room temperature under H 2 atmosphere for 18 h. The reaction mixture was filtered through a pad of Celite and the Celite pad was washed with methanol. The filtrate washings were pooled together and concentrated under reduced pressure to yield Compound 130 (0.08 g). LCMS and 1< H NMR were consistent with structure. The product was used without further purification. Mass m / z 838.3 [M + 2H] +< .
[0573] To a 10 mL pointed round bottom flask were added compound 130 (75.8 mg, 0.046 mmol), 0.37 M pyridine / DMF (200 µL) and a stir bar. To this solution was added 0.7 M pentafluorophenyl trifluoroacetate / DMF (100 µL) drop wise with stirring. The reaction was completed after 1 h as determined by LC MS. The solvent was removed under reduced pressure and the residue was dissolved in CHCl 3 (~ 10 mL). The organic layer was partitioned against NaHSO 4 (1 M, 10 mL) , aqueous saturated NaHCO 3 (10 mL) and brine (10 mL) three times each. The organic phase separated and dried over Na 2 SO 4 , filtered and concentrated to yield Compound 131 (77.7 mg). LCMS is consistent with structure. Used without further purification. Mass m / z 921.3 [M + 2H] +< .
[0574] Oligomeric Compound 132, comprising a GalNAc 3 -5 conjugate group, was prepared using the general procedures illustrated in Example 46. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -5 (GalNAc 3 -5 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-.
[0575] The structure of GalNAc 3 -5 (GalNAc 3 -5 a -CM-) is shown below: Example 50: Preparation of Oligonucleotide 144 Comprising GalNAc 4 -11
[0576]
[0577] Synthesis of Compound 134. To a Merrifield flask was added aminomethyl VIMAD resin (2.5 g, 450 µmol / g) that was washed with acetonitrile, dimethylformamide, dichloromethane and acetonitrile. The resin was swelled in acetonitrile (4 mL). Compound 133 was pre-activated in a 100 mL round bottom flask by adding 20 (1.0 mmol, 0.747 g), TBTU (1.0 mmol, 0.321 g), acetonitrile (5 mL) and DIEA (3.0 mmol, 0.5 mL). This solution was allowed to stir for 5 min and was then added to the Merrifield flask with shaking. The suspension was allowed to shake for 3 h. The reaction mixture was drained and the resin was washed with acetonitrile, DMF and DCM. New resin loading was quantitated by measuring the absorbance of the DMT cation at 500 nm (extinction coefficient = 76000) in DCM and determined to be 238 µmol / g. The resin was capped by suspending in an acetic anhydride solution for ten minutes three times.
[0578] The solid support bound compound 141 was synthesized using iterative Fmoc-based solid phase peptide synthesis methods. A small amount of solid support was withdrawn and suspended in aqueous ammonia (28-30 wt%) for 6 h. The cleaved compound was analyzed by LC-MS and the observed mass was consistent with structure. Mass m / z 1063.8 [M + 2H] +< .
[0579] The solid support bound compound 142 was synthesized using solid phase peptide synthesis methods.
[0580] The solid support bound compound 143 was synthesized using standard solid phase synthesis on a DNA synthesizer.
[0581] The solid support bound compound 143 was suspended in aqueous ammonia (28-30 wt%) and heated at 55 °C for 16 h. The solution was cooled and the solid support was filtered. The filtrate was concentrated and the residue dissolved in water and purified by HPLC on a strong anion exchange column. The fractions containing full length compound 144 were pooled together and desalted. The resulting GalNAc 4 -11 conjugated oligomeric compound was analyzed by LC-MS and the observed mass was consistent with structure.
[0582] The GalNAc 4 cluster portion of the conjugate group GalNAc 4 -11 (GalNAc a -11 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-.
[0583] The structure of GalNAc 4 -11 (GalNAc 4 -11 a -CM) is shown below: Example 51: Preparation of Oligonucleotide 155 Comprising GalNAc 3 -6
[0584]
[0585] Compound 146 was synthesized as described in the literature (Analytical Biochemistry 1995, 229, 54-60).
[0586] Compound 4 (15 g, 45.55 mmol) and compound 35b (14.3 grams, 57 mmol) were dissolved in CH 2 Cl 2 (200 ml). Activated molecular sieves (4 Å. 2 g, powdered) were added, and the reaction was allowed to stir for 30 minutes under nitrogen atmosphere. TMS-OTf was added (4.1 ml, 22.77 mmol) and the reaction was allowed to stir at room temp overnight. Upon completion, the reaction was quenched by pouring into solution of saturated aqueous NaHCO 3 (500 ml) and crushed ice (~ 150 g). The organic layer was separated, washed with brine, dried over MgSO 4 , filtered, and was concentrated to an orange oil under reduced pressure. The crude material was purified by silica gel column chromatography and eluted with 2-10 % MeOH in CH 2 Cl 2 to yield Compound 112 (16.53 g, 63 %). LCMS and 1< H NMR were consistent with the expected compound.
[0587] Compound 112 (4.27 g, 7.35 mmol) was dissolved in 1:1 MeOH / EtOAc (40 ml). The reaction mixture was purged by bubbling a stream of argon through the solution for 15 minutes. Pearlman's catalyst (palladium hydroxide on carbon, 400 mg) was added, and hydrogen gas was bubbled through the solution for 30 minutes. Upon completion (TLC 10% MeOH in CH 2 Cl 2 , and LCMS), the catalyst was removed by filtration through a pad of celite. The filtrate was concentrated by rotary evaporation, and was dried briefly under high vacuum to yield Compound 105a (3.28 g). LCMS and 1H NMR were consistent with desired product.
[0588] Compound 147 (2.31 g, 11 mmol) was dissolved in anhydrous DMF (100 mL). N,N-Diisopropylethylamine (DIEA, 3.9 mL, 22 mmol) was added, followed by HBTU (4 g, 10.5 mmol). The reaction mixture was allowed to stir for ~ 15 minutes under nitrogen. To this a solution of compound 105a (3.3 g, 7.4 mmol) in dry DMF was added and stirred for 2 h under nitrogen atmosphere. The reaction was diluted with EtOAc and washed with saturated aqueous NaHCO 3 and brine. The organics phase was separated, dried (MgSO 4 ), filtered, and concentrated to an orange syrup. The crude material was purified by column chromatography 2-5 % MeOH in CH 2 Cl 2 to yield Compound 148 (3.44 g, 73 %). LCMS and 1< H NMR were consistent with the expected product.
[0589] Compound 148 (3.3 g, 5.2 mmol) was dissolved in 1:1 MeOH / EtOAc (75 ml). The reaction mixture was purged by bubbling a stream of argon through the solution for 15 minutes. Pearlman's catalyst (palladium hydroxide on carbon) was added (350 mg). Hydrogen gas was bubbled through the solution for 30 minutes. Upon completion (TLC 10% MeOH in DCM, and LCMS), the catalyst was removed by filtration through a pad of celite. The filtrate was concentrated by rotary evaporation, and was dried briefly under high vacuum to yield Compound 149 (2.6 g). LCMS was consistent with desired product. The residue was dissolved in dry DMF (10 ml) was used immediately in the next step.
[0590] Compound 146 (0.68 g, 1.73 mmol) was dissolved in dry DMF (20 ml). To this DIEA (450 µL, 2.6 mmol, 1.5 eq.) and HBTU (1.96 g, 0.5.2 mmol) were added. The reaction mixture was allowed to stir for 15 minutes at room temperature under nitrogen. A solution of compound 149 (2.6 g) in anhydrous DMF (10 mL) was added. The pH of the reaction was adjusted to pH = 9-10 by addition of DIEA (if necessary). The reaction was allowed to stir at room temperature under nitrogen for 2 h. Upon completion the reaction was diluted with EtOAc (100 mL), and washed with aqueous saturated aqueous NaHCO 3 , followed by brine. The organic phase was separated, dried over MgSO 4 , filtered, and concentrated. The residue was purified by silica gel column chromatography and eluted with 2-10 % MeOH in CH 2 Cl 2 to yield Compound 150 (0.62 g, 20 %). LCMS and 1< H NMR were consistent with the desired product.
[0591] Compound 150 (0.62 g) was dissolved in 1:1 MeOH / EtOAc (5 L). The reaction mixture was purged by bubbling a stream of argon through the solution for 15 minutes. Pearlman's catalyst (palladium hydroxide on carbon) was added (60 mg). Hydrogen gas was bubbled through the solution for 30 minutes. Upon completion (TLC 10% MeOH in DCM, and LCMS), the catalyst was removed by filtration (syringe-tip Teflon filter, 0.45 µm). The filtrate was concentrated by rotary evaporation, and was dried briefly under high vacuum to yield Compound 151 (0.57 g). The LCMS was consistent with the desired product. The product was dissolved in 4 mL dry DMF and was used immediately in the next step.
[0592] Compound 83a (0.11 g, 0.33 mmol) was dissolved in anhydrous DMF (5 mL) and N,N-Diisopropylethylamine (75 µL, 1 mmol) and PFP-TFA (90 µL, 0.76 mmol) were added. The reaction mixture turned magenta upon contact, and gradually turned orange over the next 30 minutes. Progress of reaction was monitored by TLC and LCMS. Upon completion (formation of the PFP ester), a solution of compound 151 (0.57 g, 0.33 mmol) in DMF was added. The pH of the reaction was adjusted to pH = 9-10 by addition ofN,N-Diisopropylethylamine (if necessary). The reaction mixture was stirred under nitrogen for ~ 30 min. Upon completion, the majority of the solvent was removed under reduced pressure. The residue was diluted with CH 2 Cl 2 and washed with aqueous saturated NaHCO 3 , followed by brine. The organic phase separated, dried over MgSO 4 , filtered, and concentrated to an orange syrup. The residue was purified by silica gel column chromatography (2-10 % MeOH in CH 2 Cl 2 ) to yield Compound 152 (0.35 g, 55 %). LCMS and 1< H NMR were consistent with the desired product.
[0593] Compound 152 (0.35 g, 0.182 mmol) was dissolved in 1:1 MeOH / EtOAc (10 mL). The reaction mixture was purged by bubbling a stream of argon thru the solution for 15 minutes. Pearlman's catalyst (palladium hydroxide on carbon) was added (35 mg). Hydrogen gas was bubbled thru the solution for 30 minutes. Upon completion (TLC 10% MeOH in DCM, and LCMS), the catalyst was removed by filtration (syringe-tip Teflon filter, 0.45 µm). The filtrate was concentrated by rotary evaporation, and was dried briefly under high vacuum to yield Compound 153 (0.33 g, quantitative). The LCMS was consistent with desired product.
[0594] Compound 153 (0.33 g, 0.18 mmol) was dissolved in anhydrous DMF (5 mL) with stirring under nitrogen. To this N,N-Diisopropylethylamine (65 µL, 0.37 mmol) and PFP-TFA (35 µL, 0.28 mmol) were added. The reaction mixture was stirred under nitrogen for ~ 30 min. The reaction mixture turned magenta upon contact, and gradually turned orange. The pH of the reaction mixture was maintained at pH = 9-10 by adding more N,-Diisopropylethylamine. The progress of the reaction was monitored by TLC and LCMS. Upon completion, the majority of the solvent was removed under reduced pressure. The residue was diluted with CH 2 Cl 2 (50 mL), and washed with saturated aqueous NaHCO 3 , followed by brine. The organic layer was dried over MgSO 4 , filtered, and concentrated to an orange syrup. The residue was purified by column chromatography and eluted with 2-10 % MeOH in CH 2 Cl 2 to yield Compound 154 (0.29 g, 79 %). LCMS and 1< H NMR were consistent with the desired product.
[0595] Oligomeric Compound 155, comprising a GalNAc 3 -6 conjugate group, was prepared using the general procedures illustrated in Example 46. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -6 (GalNAc 3 -6 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-.
[0596] The structure of GalNAc 3 -6 (GalNAc 3 -6 a -CM-) is shown below: Example 52: Preparation of Oligonucleotide 160 Comprising GalNAc 3 -9
[0597]
[0598] Compound 156 was synthesized following the procedure described in the literature (J. Med. Chem. 2004, 47, 5798-5808).
[0599] Compound 156, (18.60 g, 29.28 mmol) was dissolved in methanol (200 mL). Palladium on carbon (6.15 g, 10 wt%, loading (dry basis), matrix carbon powder, wet) was added. The reaction mixture was stirred at room temperature under hydrogen for 18 h. The reaction mixture was filtered through a pad of celite and the celite pad was washed thoroughly with methanol. The combined filtrate was washed and concentrated to dryness. The residue was purified by silica gel column chromatography and eluted with 5-10 % methanol in dichloromethane to yield Compound 157 (14.26 g, 89%). Mass m / z 544.1 [M-H] -< .
[0600] Compound 157 (5 g, 9.17 mmol) was dissolved in anhydrous DMF (30 mL). HBTU (3.65 g, 9.61 mmol) and N,N-Diisopropylethylamine (13.73 mL, 78.81 mmol) were added and the reaction mixture was stirred at room temperature for 5 minutes. To this a solution of compound 47 (2.96 g, 7.04 mmol) was added. The reaction was stirred at room temperature for 8 h. The reaction mixture was poured into a saturated NaHCO 3 aqueous solution. The mixture was extracted with ethyl acetate and the organic layer was washed with brine and dried (Na 2 SO 4 ), filtered and evaporated. The residue obtained was purified by silica gel column chromatography and eluted with 50% ethyl acetate in hexane to yield compound 158 (8.25g, 73.3%). The structure was confirmed by MS and 1< H NMR analysis.
[0601] Compound 158 (7.2 g, 7.61 mmol) was dried over P 2 O 5 under reduced pressure. The dried compound was dissolved in anhydrous DMF (50 mL). To this 1H-tetrazole (0.43 g, 6.09 mmol) and N-methylimidazole (0.3 mL, 3.81 mmol) and 2-cyanoethyl-N,N,N',N'-tetraisopropyl phosphorodiamidite (3.65 mL, 11.50 mmol) were added. The reaction mixture was stirred t under an argon atmosphere for 4 h. The reaction mixture was diluted with ethyl acetate (200 mL). The reaction mixture was washed with saturated NaHCO 3 and brine. The organic phase was separated, dried (Na 2 SO 4 ), filtered and evaporated. The residue was purified by silica gel column chromatography and eluted with 50-90 % ethyl acetate in hexane to yield Compound 159 (7.82 g, 80.5%). The structure was confirmed by LCMS and 31< P NMR analysis.
[0602] Oligomeric Compound 160, comprising a GalNAc 3 -9 conjugate group, was prepared using standard oligonucleotide synthesis procedures. Three units of compound 159 were coupled to the solid support, followed by nucleotide phosphoramidites. Treatment of the protected oligomeric compound with aqueous ammonia yielded compound 160. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -9 (GalNAc 3 -9 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-. The structure of GalNAc 3 -9 (GalNAc 3 -9 a -CM) is shown below: Example 53: Alternate procedure for preparation of Compound 18 (GalNAc 3 -1a and GalNAc 3 -3a)
[0603]
[0604] Lactone 161 was reacted with diamino propane (3-5 eq) or Mono-Boc protected diamino propane (1 eq) to provide alcohol 162a or 162b. When unprotected propanediamine was used for the above reaction, the excess diamine was removed by evaporation under high vacuum and the free amino group in 162a was protected using CbzCl to provide 162b as a white solid after purification by column chromatography. Alcohol 162b was further reacted with compound 4 in the presence of TMSOTf to provide 163a which was converted to 163b by removal of the Cbz group using catalytic hydrogenation. The pentafluorophenyl (PFP) ester 164 was prepared by reacting triacid 113 (see Example 48) with PFPTFA (3.5 eq) and pyridine (3.5 eq) in DMF (0.1 to 0.5 M). The triester 164 was directly reacted with the amine 163b (3-4 eq) and DIPEA (3-4 eq) to provide Compound 18. The above method greatly facilitates purification of intermediates and minimizes the formation of byproducts which are formed using the procedure described in Example 4.Example 54: Alternate procedure for preparation of Compound 18 (GalNAc 3 -1a and GalNAc 3 -3a)
[0605]
[0606] The triPFP ester 164 was prepared from acid 113 using the procedure outlined in example 53 above and reacted with mono-Boc protected diamine to provide 165 in essentially quantitative yield. The Boc groups were removed with hydrochloric acid or trifluoroacetic acid to provide the triamine which was reacted with the PFP activated acid 166 in the presence of a suitable base such as DIPEA to provide Compound 18.
[0607] The PFP protected Gal-NAc acid 166 was prepared from the corresponding acid by treatment with PFPTFA (1-1.2 eq) and pyridine (1-1.2 eq) in DMF. The precursor acid in turn was prepared from the corresponding alcohol by oxidation using TEMPO (0.2 eq) and BAIE in acetonitrile and water. The precursor alcohol was prepared from sugar intermediate 4 by reaction with 1,6-hexanediol (or 1,5-pentanediol or other diol for other n values) (2-4 eq) and TMSOTf using conditions described previously in example 47.Example 56 : Dose-dependent study of oligonucleotides comprising either a 3' or 5'-conjugate group (comparison of GalNAc 3 -1, 2, 3, 5, 6, 7 and 10) targeting SRB-1 in vivo
[0608] The oligonucleotides listed below were tested in a dose-dependent study for antisense inhibition of SRB-1 in mice. Unconjugated ISIS 353382 was included as a standard. Each of the various GalNAc 3 conjugate groups was attached at the 5' terminus of the respective oligonucleotide by a phosphodiester linked 2'-deoxyadenosine nucleoside (cleavable moiety) except for ISIS 655861 which had the GalNAc 3 conjugate group attached at the 3' terminus. Table 42 Modified ASO targeting SRB-1 ASOSequence (5' to 3')MotifConjugate SEQ ID No.ISIS 353382 (parent)5 / 10 / 5no conjugate2256ISIS 6558615 / 10 / 5GalNAc 3 -1 2257ISIS 6645075 / 10 / 5GalNAc 3 -2 2258ISIS 6611615 / 10 / 5GalNAc 3 -3 2258ISIS 6662245 / 10 / 5GalNAc 3 -5 2258ISIS 6669615 / 10 / 5GalNAc 3 -6 2258ISIS 6669815 / 10 / 5GalNAc 3 -7 2258ISIS 6668815 / 10 / 5GalNAc 3 -10 2258Capital letters indicate the nucleobase for each nucleoside and m< C indicates a 5-methyl cytosine. Subscripts: "e" indicates a 2'-MOE modified nucleoside; "d" indicates a β-D-2'-deoxyribonucleoside; "s" indicates a phosphorothioate internucleoside linkage (PS); "o" indicates a phosphodiester internucleoside linkage (PO); and "o'" indicates -O-P(=O)(OH)-. Conjugate groups are in bold.
[0609] The structure of GalNAc 3 -1 a was shown previously in Example 9. The structure of GalNAc 3 -2 a was shown previously in Example 37. The structure of GalNAc 3 -3 a was shown previously in Example 39. The structure of GalNAc 3 -5 a was shown previously in Example 49. The structure of GalNAc 3 -6 a was shown previously in Example 51. The structure of GalNAc 3 -7 a was shown previously in Example 48. The structure of GalNAc 3 -10 a was shown previously in Example 46.Treatment
[0610] Six week old male Balb / c mice (Jackson Laboratory, Bar Harbor, ME) were injected subcutaneously once at the dosage shown below with ISIS 353382, 655861, 664507, 661161, 666224, 666961, 666981, 666881 or with saline. Each treatment group consisted of 4 animals. The mice were sacrificed 72 hours following the final administration to determine the liver SRB-1 mRNA levels using real-time PCR and RIBOGREEN ®< RNA quantification reagent (Molecular Probes, Inc. Eugene, OR) according to standard protocols. The results below are presented as the average percent of SRB-1 mRNA levels for each treatment group, normalized to the saline control.
[0611] As illustrated in Table 43, treatment with antisense oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent manner. Indeed, the conjugated antisense oligonucleotides showed substantial improvement in potency compared to the unconjugated antisense oligonucleotide (ISIS 353382). The 5' conjugated antisense oligonucleotides showed a slight increase in potency compared to the 3' conjugated antisense oligonucleotide. Table 43 ISIS No. Dosage (mg / kg) SRB-1 mRNA (% Saline) Conjugate Salinen / a100.0353382396.0none1073.13036.16558610.599.4GalNac 3 -1 (3')1.581.2533.91515.26645070.5102.0GalNac 3 -2 (5')1.573.2531.31510.86611610.590.7GalNac 3 -3 (5')1.567.6524.31511.56662240.596.1GalNac 3 -5 (5')1.561.6525.61511.76669610.585.5GalNAc 3 -6 (5')1.556.3534.21513.16669810.584.7GalNAc 3 -7 (5')1.559.9524.9158.56668810.5100.0GalNAc 3 -10 (5')1.565.8526.01513.0
[0612] Liver transaminase levels, alanine aminotransferase (ALT) and aspartate aminotransferase (AST), in serum were measured relative to saline injected mice using standard protocols. Total bilirubin and BUN were also evaluated. The change in body weights was evaluated with no significant change from the saline group. ALTs, ASTs, total bilirubin and BUN values are shown in Table 44 below. Table 44 ISIS No. Dosage mg / kg ALT AST Total Bilirubin BUN Conjugate Saline26570.227353382325920.227none1023400.2253029540.1286558610.525710.234GalNac 3 -1 (3')1.528600.226526630.2281525610.2286645070.525620.225GalNac 3 -2 (5')1.524490.226521500.2261559840.1226611610.520420.229GalNac 3 -3 (5')1.5 g37740.2255 g28610.2291521410.2256662240.534480.221GalNac 3 -5 (5')1.523460.226524470.2231532490.1266669610.517630.226GalNAc 3 -6 (5')1.523680.226525660.22615291070.2286669810.524480.226GalNAc 3 -7 (5')1.530550.224546740.1241529580.1266668810.520650.227GalNAc 3 -10 (5')1.523590.224545700.2261521570.224 Example 61: Preparation of oligomeric compound 175 comprising GalNAc 3 -12
[0613]
[0614] Compound 169 is commercially available. Compound 172 was prepared by addition of benzyl (perfluorophenyl) glutarate to compound 171. The benzyl (perfluorophenyl) glutarate was prepared by adding PFP-TFA and DIEA to 5-(benzyloxy)-5-oxopentanoic acid in DMF. Oligomeric compound 175, comprising a GalNAc 3 -12 conjugate group, was prepared from compound 174 using the general procedures illustrated in Example 46. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -12 (GalNAc 3 -12 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In a certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-. The structure of GalNAc 3 -12 (GalNAc 3 -12 a -CM-) is shown below: Example 62: Preparation of oligomeric compound 180 comprising GalNAc 3 -13
[0615]
[0616] Compound 176 was prepared using the general procedure shown in Example 2. Oligomeric compound 180, comprising a GalNAc 3 -13 conjugate group, was prepared from compound 177 using the general procedures illustrated in Example 49. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -13 (GalNAc 3 -13 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In a certainembodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-. The structure of GalNAc 3 -13 (GalNAc 3 -13 a -CM-) is shown below: Example 63: Preparation of oligomeric compound 188 comprising GalNAc 3 -14
[0617]
[0618] Compounds 181 and 185 are commercially available. Oligomeric compound 188, comprising a GalNAc 3 -14 conjugate group, was prepared from compound 187 using the general procedures illustrated in Example 46. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -14 (GalNAc 3 -14 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-. The structure of GalNAc 3 -14 (GalNAc 3 -14 a -CM-) is shown below: Example 64: Preparation of oligomeric compound 197 comprising GalNAc 3 -15
[0619]
[0620] Compound 189 is commercially available. Compound 195 was prepared using the general procedure shown in Example 31. Oligomeric compound 197, comprising a GalNAc 3 -15 conjugate group, was prepared from compounds 194 and 195 using standard oligonucleotide synthesis procedures. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -15 (GalNAc 3 -15 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-. The structure of GalNAc 3 -15 (GalNAc 3 -15 a -CM-) is shown below: Example 67: Preparation of oligomeric compound 199 comprising GalNAc 3 -16
[0621]
[0622] Oligomeric compound 199, comprising a GalNAc 3 -16 conjugate group, is prepared using the general procedures illustrated in Examples 7 and 9. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -16 (GalNAc 3 -16 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-.The structure of GalNAc 3 -16 (GalNAc 3 -16 a -CM-) is shown below: Example 68: Preparation of oligomeric compound 200 comprising GalNAc 3 -17
[0623]
[0624] Oligomeric compound 200, comprising a GalNAc 3 -17 conjugate group, was prepared using the general procedures illustrated in Example 46. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -17 (GalNAc 3 -17 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-. The structure of GalNAc 3 -17 (GalNAc 3 -17 a -CM-) is shown below: Example 69: Preparation of oligomeric compound 201 comprising GalNAc 3 -18
[0625]
[0626] Oligomeric compound 201, comprising a GalNAc 3 -18 conjugate group, was prepared using the general procedures illustrated in Example 46. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -18 (GalNAc 3 -18 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-. The structure of GalNAc 3 -18 (GalNAc 3 -18 a -CM-) is shown below: Example 70: Preparation of oligomeric compound 204 comprising GalNAc 3 -19
[0627]
[0628] Oligomeric compound 204, comprising a GalNAc 3 -19 conjugate group, was prepared from compound 64 using the general procedures illustrated in Example 52. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -19 (GalNAc 3 -19 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-. The structure of GalNAc 3 -19 (GalNAc 3 -19 a -CM-) is shown below: Example 71: Preparation of oligomeric compound 210 comprising GalNAc 3 -20
[0629]
[0630] Compound 205 was prepared by adding PFP-TFA and DIEA to 6-(2,2,2-trifluoroacetamido)hexanoic acid in acetonitrile ,which was prepared by adding triflic anhydride to 6-aminohexanoic acid. The reaction mixture was heated to 80 °C, then lowered to rt. Oligomeric compound 210, comprising a GalNAc 3 -20 conjugate group, was prepared from compound 208 using the general procedures illustrated in Example 52. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -20 (GalNAc 3 -20 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-. The structure of GalNAc 3 -20 (GalNAc 3 -20 a -CM-) is shown below: Example 72: Preparation of oligomeric compound 215 comprising GalNAc 3 -21
[0631]
[0632] Compound 211 is commercially available. Oligomeric compound 215, comprising a GalNAc 3 -21 conjugate group, was prepared from compound 213 using the general procedures illustrated in Example 52. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -21 (GalNAc 3 -21 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-. The structure of GalNAc 3 -21 (GalNAc 3 -21 a -CM-) is shown below: Example 73: Preparation of oligomeric compound 221 comprising GalNAc 3 -22
[0633]
[0634] Compound 220 was prepared from compound 219 using diisopropylammonium tetrazolide. Oligomeric compound 221, comprising a GalNAc 3 -21 conjugate group, is prepared from compound 220 using the general procedure illustrated in Example 52. The GalNAc 3 cluster portion of the conjugate group GalNAc 3 -22 (GalNAc 3 -22 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the cleavable moiety is -P(=O)(OH)-A d -P(=O)(OH)-. The structure of GalNAc 3 -22 (GalNAc 3 -22 a -CM-) is shown below: Example 75: Pharmacokinetic analysis of oligonucleotides comprising a 5'-conjugate group
[0635] The PK of the ASOs in Tables 54, 57 and 60 above was evaluated using liver samples that were obtained following the treatment procedures described in Examples 65, 66, and 74. The liver samples were minced and extracted using standard protocols and analyzed by IP-HPLC-MS alongside an internal standard. The combined tissue level (µg / g) of all metabolites was measured by integrating the appropriate UV peaks, and the tissue level of the full-length ASO missing the conjugate ("parent," which is Isis No. 353382 in this case) was measured using the appropriate extracted ion chromatograms (EIC). Table 63 PK Analysis in Liver ISIS No.Dosage (mg / kg)Total Tissue Level by UV (µg / g)Parent ASO Tissue Level by EIC (µg / g)GalNAc 3 ClusterCM35338238.98.6n / an / a1022.421.03054.244.2661161532.420.7GalNAc 3 -3aA d 1563.244.1671144520.519.2GalNAc 3 -12aA d 1548.641.5670061531.628.0GalNAc 3 -13aA d 1567.655.5671261519.816.8GalNAc 3 -14aA d 1564.749.1671262518.57.4GalNAc 3 -15aA d 1552.324.2670699516.410.4GalNAc 3 -3aT d 1531.522.5670700519.310.9GalNAc 3 -3aA e 1538.120.0670701521.88.8GalNAc 3 -3aT e 1535.216.1671165527.126.5GalNAc 3 -13aA d 1548.344.3666904530.824.0GalNAc 3 -3aPO1552.637.6675441525.419.0GalNAc 3 -17aA d 1554.242.1675442522.220.7GalNAc 3 -18aA d 1539.629.0
[0636] The results in Table 63 above show that there were greater liver tissue levels of the oligonucleotides comprising a GalNAc 3 conjugate group than of the parent oligonucleotide that does not comprise a GalNAc 3 conjugate group (ISIS 353382) 72 hours following oligonucleotide administration, particularly when taking into consideration the differences in dosing between the oligonucleotides with and without a GalNAc 3 conjugate group. Furthermore, by 72 hours, 40-98% of each oligonucleotide comprising a GalNAc 3 conjugate group was metabolized to the parent compound, indicating that the GalNAc 3 conjugate groups were cleaved from the oligonucleotides.Example 76: Preparation of oligomeric compound 230 comprising GalNAc 3 -23
[0637]
[0638] Compound 222 is commercially available. 44.48 ml (0.33 mol) of compound 222 was treated with tosyl chloride (25.39 g, 0.13 mol) in pyridine (500mL) for 16 hours. The reaction was then evaporated to an oil, dissolved in EtOAc and washed with water, sat. NaHCO 3 , brine, and dried over Na 2 SO 4 . The ethyl acetate was concentrated to dryness and purified by column chromatography, eluted with EtOAc / hexanes (1:1) followed by 10% methanol in CH 2 Cl 2 to give compound 223 as a colorless oil. LCMS and NMR were consistent with the structure. 10 g (32.86 mmol) of 1-Tosyltriethylene glycol (compound 223) was treated with sodium azide (10.68 g, 164.28 mmol) in DMSO (100mL) at room temperature for 17 hours. The reaction mixture was then poured onto water, and extracted with EtOAc. The organic layer was washed with water three times and dried over Na 2 SO 4 . The organic layer was concentrated to dryness to give 5.3g of compound 224 (92%). LCMS and NMR were consistent with the structure. 1-Azidotriethylene glycol (compound 224, 5.53 g, 23.69 mmol) and compound 4 (6 g, 18.22 mmol) were treated with 4A molecular sieves (5g), and TMSOTf (1.65 ml, 9.11 mmol) in dichloromethane (100mL) under an inert atmosphere. After 14 hours, the reaction was filtered to remove the sieves, and the organic layer was washed with sat. NaHCO 3 , water, brine, and dried over Na 2 SO 4 . The organic layer was concentrated to dryness and purified by column chromatography, eluted with a gradient of 2 to 4% methanol in dichloromethane to give compound 225. LCMS and NMR were consistent with the structure. Compound 225 (11.9 g, 23.59 mmol) was hydrogenated in EtOAc / Methanol (4:1, 250mL) over Pearlman's catalyst. After 8 hours, the catalyst was removed by filtration and the solvents removed to dryness to give compound 226. LCMS and NMR were consistent with the structure.
[0639] In order to generate compound 227, a solution of nitromethanetrispropionic acid (4.17 g, 15.04 mmol) and Hunig's base (10.3 ml, 60.17 mmol) in DMF (100mL) were treated dropwise with pentaflourotrifluoro acetate (9.05 ml, 52.65 mmol). After 30 minutes, the reaction was poured onto ice water and extracted with EtOAc. The organic layer was washed with water, brine, and dried over Na 2 SO 4 . The organic layer was concentrated to dryness and then recrystallized from heptane to give compound 227 as a white solid. LCMS and NMR were consistent with the structure. Compound 227 (1.5 g, 1.93 mmol) and compound 226 (3.7 g, 7.74 mmol) were stirred at room temperature in acetonitrile (15 mL) for 2 hours. The reaction was then evaporated to dryness and purified by column chromatography, eluting with a gradient of 2 to10% methanol in dichloromethane to give compound 228. LCMS and NMR were consistent with the structure. Compound 228 (1.7 g, 1.02 mmol) was treated with Raney Nickel (about 2g wet) in ethanol (100mL) in an atmosphere of hydrogen. After 12 hours, the catalyst was removed by filtration and the organic layer was evaporated to a solid that was used directly in the next step. LCMS and NMR were consistent with the structure. This solid (0.87 g, 0.53 mmol) was treated with benzylglutaric acid (0.18 g, 0.8 mmol), HBTU (0.3 g, 0.8 mmol) and DIEA (273.7 µl, 1.6 mmol) in DMF (5mL). After 16 hours, the DMF was removed under reduced pressure at 65°C to an oil, and the oil was dissolved in dichloromethane. The organic layer was washed with sat. NaHCO 3 , brine, and dried over Na 2 SO 4 . After evaporation of the organic layer, the compound was purified by column chromatography and eluted with a gradient of 2 to 20% methanol in dichloromethane to give the coupled product. LCMS and NMR were consistent with the structure. The benzyl ester was deprotected with Pearlman's catalyst under a hydrogen atmosphere for 1 hour. The catalyst was them removed by filtration and the solvents removed to dryness to give the acid. LCMS and NMR were consistent with the structure. The acid (486 mg, 0.27 mmol) was dissolved in dry DMF (3 mL). Pyridine (53.61 µl, 0.66 mmol) was added and the reaction was purged with argon. Pentaflourotriflouro acetate (46.39 µl, 0.4 mmol) was slowly added to the reaction mixture. The color of the reaction changed from pale yellow to burgundy, and gave off a light smoke which was blown away with a stream of argon. The reaction was allowed to stir at room temperature for one hour (completion of reaction was confirmed by LCMS). The solvent was removed under reduced pressure (rotovap) at 70 °C. The residue was diluted with DCM and washed with 1N NaHSO 4 , brine, saturated sodium bicarbonate and brine again. The organics were dried over Na 2 SO 4 , filtered, and were concentrated to dryness to give 225 mg of compound 229 as a brittle yellow foam. LCMS and NMR were consistent with the structure.
[0640] Oligomeric compound 230, comprising a GalNAc 3 -23 conjugate group, was prepared from compound 229 using the general procedure illustrated in Example 46. The GalNAc 3 cluster portion of the GalNAc 3 -23 conjugate group (GalNAc 3 -23 a ) can be combined with any cleavable moiety to provide a variety of conjugate groups. The structure of GalNAc 3 -23 (GalNAc 3 -23 a -CM) is shown below: Example 80: Antisense inhibition in vivo by oligonucleotides targeting Alpha-1 Antitrypsin (A1AT) comprising a GalNAc 3 Conjugate
[0641] The oligonucleotides listed in Table 72 below were tested in a study for dose-dependent inhibition of A1AT in mice. Table 72 Modified ASOs targeting A1AT ISIS No.Sequences (5' to 3')GalNAc 3 ClusterCMSEQ ID No.476366n / an / a2265656326GalNAc 3 -1aA d 2266678381GalNAc 3 -3aA d 2267678382GalNAc 3 -7aA d 2267678383GalNAc 3 -10aA d 2267678384GalNAc 3 -13aA d 2267The structure of GalNAc 3 -1 a was shown previously in Example 9, GalNAc 3 -3 a was shown in Example 39, GalNAc 3 -7 a was shown in Example 48, GalNAc 3 -10 a was shown in Example 46, and GalNAc 3 -13 a was shown in Example 62. Treatment
[0642] Six week old, male C57BL / 6 mice (Jackson Laboratory, Bar Harbor, ME) were each injected subcutaneously once per week at a dosage shown below, for a total of three doses, with an oligonucleotide listed in Table 72 or with PBS. Each treatment group consisted of 4 animals. The mice were sacrificed 72 hours following the final administration. A1AT liver mRNA levels were determined using real-time PCR and RIBOGREEN ®< RNA quantification reagent (Molecular Probes, Inc. Eugene, OR) according to standard protocols. A1AT plasma protein levels were determined using the Mouse Alpha 1-Antitrypsin ELISA (catalog # 41-A1AMS-E01, Alpco, Salem, NH). The results below are presented as the average percent of A1AT liver mRNA and plasma protein levels for each treatment group, normalized to the PBS control.
[0643] As illustrated in Table 73, treatment with antisense oligonucleotides lowered A1AT liver mRNA and A1AT plasma protein levels in a dose-dependent manner. The oligonucleotides comprising a GalNAc conjugate were significantly more potent than the parent (ISIS 476366). Table 73 A1AT liver mRNA and plasma protein levels ISIS No.Dosage (mg / kg)A1AT liver mRNA (% PBS)A1AT plasma protein (% PBS)GalNAc 3 ClusterCMPBSn / a100100n / an / a47636658678n / an / a1573614530386563260.69990GalNAc 3 -1aA d 2617061530186106783810.610590GalNAc 3 -3aA d 2536061620187136783820.69079GalNAc 3 -7aA d 2495762127188116783830.69484GalNAc 3 -10aA d 2445361324186106783840.610691GalNAc 3 -13aA d 2655962631181115
[0644] Liver transaminase and BUN levels in plasma were measured at time of sacrifice using standard protocols. Body weights and organ weights were also measured. The results are shown in Table 74 below. Body weight is shown as % relative to baseline. Organ weights are shown as % of body weight relative to the PBS control group. Table 74 ISIS No.Dosage (mg / kg)ALT (U / L)AST (U / L)BUN (mg / dL)Body weight (% baseline)Liver weight (Rel % BW)Kidney weight (Rel % BW)Spleen weight (Rel % BW)PBSn / a25513711910010010047636653468351169198106153774301229210112845304731118991081236563260.629574012310010311923675391149811110663267391259997122184677361161021091016783810.62657321179310911022652331219610612564078321249210612618315428118941031206783820.6264235114100103103225503111791104117630792911789102107186511231120891041136783830.63067381219110012323353331189810212163263321179710510518366831118991031086783840.636633111898103982326132119931021146346934122100100961828543011798101104 Example 81: Duration of action in vivo of oligonucleotides targeting A1AT comprising a GalNAc 3 cluster
[0645] The oligonucleotides listed in Table 72 were tested in a single dose study for duration of action in mice.Treatment
[0646] Six week old, male C57BL / 6 mice were each injected subcutaneously once with an oligonucleotide listed in Table 72 or with PBS. Each treatment group consisted of 4 animals. Blood was drawn the day before dosing to determine baseline and at 5, 12, 19, and 25 days following the dose. Plasma A1AT protein levels were measured via ELISA (see Example 80). The results below are presented as the average percent of plasma A1AT protein levels for each treatment group, normalized to baseline levels. The results show that the oligonucleotides comprising a GalNAc conjugate were more potent and had longer duration of action than the parent lacking a GalNAc conjugate (ISIS 476366). Furthermore, the oligonucleotides comprising a 5'-GalNAc conjugate (ISIS 678381, 678382, 678383, and 678384) were generally even more potent with even longer duration of action than the oligonucleotide comprising a 3'-GalNAc conjugate (ISIS 656326). Table 75 Plasma A1AT protein levels in mice ISIS No.Dosage (mg / kg)Time point (days post-dose)A1AT (% baseline)GalNAc 3 ClusterCMPBSn / a593n / an / a129319902597476366100538n / an / a12461962257765632618533GalNAc 3 -1aA d 12361951257267838118521GalNAc 3 -3aA d 12211935254867838218521GalNAc 3 -7aA d 12211939256067838318524GalNAc 3 -10aA d 12211945257367838418529GalNAc 3 -13aA d 123419572576 Example 83: Antisense inhibition in vivo by oligonucleotides targeting Factor XI comprising a GalNAc 3 cluster
[0647] The oligonucleotides listed in Table 77 below were tested in a study for dose-dependent inhibition of Factor XI in mice. Table 77 Modified oligonucleotides targeting Factor XI ISIS No.Sequence (5' to 3')GalNAc clusterCMSEQ ID No.404071n / an / a2259656173GalNAc 3 -1 a A d 2260663086GalNAc 3 -3 a A d 2268678347GalNAc 3 -7 a A d 2268678348GalNAc 3 -10 a A d 2268678349GalNAc 3 -13 a A d 2268The structure of GalNAc 3 -1 a was shown previously in Example 9, GalNAc 3 -3 a was shown in Example 39, GalNAc 3 -7a was shown in Example 48, GalNAc 3 -10 a was shown in Example 46, and GalNAc 3 -13 a was shown in Example 62. Treatment
[0648] Six to eight week old mice were each injected subcutaneously once per week at a dosage shown below, for a total of three doses, with an oligonucleotide listed below or with PBS. Each treatment group consisted of 4 animals. The mice were sacrificed 72 hours following the final dose. Factor XI liver mRNA levels were measured using real-time PCR and normalized to cyclophilin according to standard protocols. Liver transaminases, BUN, and bilirubin were also measured. The results below are presented as the average percent for each treatment group, normalized to the PBS control.
[0649] As illustrated in Table 78, treatment with antisense oligonucleotides lowered Factor XI liver mRNA in a dose-dependent manner. The results show that the oligonucleotides comprising a GalNAc conjugate were more potent than the parent lacking a GalNAc conjugate (ISIS 404071). Furthermore, the oligonucleotides comprising a 5'-GalNAc conjugate (ISIS 663086, 678347, 678348, and 678349) were even more potent than the oligonucleotide comprising a 3'-GalNAc conjugate (ISIS 656173). Table 78 Factor XI liver mRNA, liver transaminase, BUN, and bilirubin levels ISIS No.Dosage (mg / kg)Factor XI mRNA (% PBS)ALT (U / L)AST (U / L)BUN (mg / dL)Bilirubin (mg / dL)GalNAc 3 ClusterSEQ ID No.PBSn / a1006370210.18n / an / a4040713654158210.15n / a225910334953230.1530174357220.146561730.7439089210.16GalNAc 3 -1 a 2260293658260.17635063250.156630860.73391169250.16GalNAc 3 -3 a 2268273855210.16613440230.146783470.7352849200.14GalNAc 3 -7a2268210180149210.18614476190.156783480.7394354210.16GalNAc 3 -10a2268253855220.17622538200.146783490.7343946200.16GalNAc 3 -13a2268284363210.14622841200.14 Example 84: Duration of action in vivo of oligonucleotides targeting Factor XI comprising a GalNAc 3 Conjugate
[0650] The oligonucleotides listed in Table 77 were tested in a single dose study for duration of action in mice.Treatment
[0651] Six to eight week old mice were each injected subcutaneously once with an oligonucleotide listed in Table 77 or with PBS. Each treatment group consisted of 4 animals. Blood was drawn by tail bleeds the day before dosing to determine baseline and at 3, 10, and 17 days following the dose. Plasma Factor XI protein levels were measured by ELISA using Factor XI capture and biotinylated detection antibodies from R & D Systems, Minneapolis, MN (catalog # AF2460 and # BAF2460, respectively) and the OptEIA Reagent Set B (Catalog # 550534, BD Biosciences, San Jose, CA). The results below are presented as the average percent of plasma Factor XI protein levels for each treatment group, normalized to baseline levels. The results show that the oligonucleotides comprising a GalNAc conjugate were more potent with longer duration of action than the parent lacking a GalNAc conjugate (ISIS 404071). Furthermore, the oligonucleotides comprising a 5'-GalNAc conjugate (ISIS 663086, 678347, 678348, and 678349) were even more potent with an even longer duration of action than the oligonucleotide comprising a 3'-GalNAc conjugate (ISIS 656173). Table 79 Plasma Factor XI protein levels in mice ISIS No.Dosage (mg / kg)Time point (days post-dose)Factor XI (% baseline)GalNAc 3 ClusterCMSEQ ID No.PBSn / a3123n / an / an / a10561710040407130311n / an / a225910471752656173631GalNAc 3 -1aA d 22601031721663086631GalNAc 3 -3aA d 2268102179678347631GalNAc 3 -7aA d 2268101178678348631GalNAc 3 -10aA d 2268101176678349631GalNAc 3 -13aA d 2268101175 Example 93: Antisense inhibition in vivo by oligonucleotides targeting SRB-1 comprising mixed wings and a 5'-GalNAc 3 conjugate
[0652] The oligonucleotides listed in Table 100 were tested in a dose-dependent study for antisense inhibition of SRB-1 in mice. Table 100 Modified ASOs targeting SRB-1 ISIS No.Sequences (5' to 3')GalNAc 3 ClusterCMSEQ ID No.449093T ks T ks m< C ks A ds G ds T ds m< C ds A ds T ds G ds A ds m< C ds T ds T ks m< C ks m< C k n / an / a2278699806GalNAc 3 -3aPO2278699807GalNAc 3 -7aPO2278699809GalNAc 3 -7aPO2278699811GalNAc 3 -7aPO2278699813GalNAc 3 -7aPO2278699815GalNAc 3 -7aPO2278The structure of GalNAc 3 -3 a was shown previously in Example 39, and the structure of GalNAc 3 -7a was shown previously in Example 48. Subscripts: "e" indicates 2'-MOE modified nucleoside; "d" indicates β-D-2'-deoxyribonucleoside; "k" indicates 6'-(S)-CH 3 bicyclic nucleoside (cEt); "s" indicates phosphorothioate internucleoside linkages (PS); "o" indicates phosphodiester internucleoside linkages (PO). Supersript "m" indicates 5-methylcytosines. Treatment
[0653] Six to eight week old C57BL / 6 mice (Jackson Laboratory, Bar Harbor, ME) were injected subcutaneously once at the dosage shown below with an oligonucleotide listed in Table 100 or with saline. Each treatment group consisted of 4 animals. The mice were sacrificed 72 hours following the final administration. Liver SRB-1 mRNA levels were measured using real-time PCR. SRB-1 mRNA levels were normalized to cyclophilin mRNA levels according to standard protocols. The results are presented as the average percent of SRB-1 mRNA levels for each treatment group relative to the saline control group. As illustrated in Table 101, treatment with antisense oligonucleotides lowered SRB-1 mRNA levels in a dose-dependent manner, and the gapmer oligonucleotides comprising a GalNAc conjugate and having wings that were either full cEt or mixed sugar modifications were significantly more potent than the parent oligonucleotide lacking a conjugate and comprising full cEt modified wings.
[0654] Body weights, liver transaminases, total bilirubin, and BUN were also measured, and the average values for each treatment group are shown in Table 101. Body weight is shown as the average percent body weight relative to the baseline body weight (% BL) measured just prior to the oligonucleotide dose. Table 101 SRB-1 mRNA, ALT, AST, BUN, and total bilirubin levels and body weights ISIS No.Dosage (mg / kg)SRB-1 mRNA (% PBS)ALT (U / L)AST (U / L)BilBUNBody weight (% BL)PBSn / a10031840.1528102449093111118480.173110439420430.1526103103619500.12291046998060.111423580.13261070.35921450.122710812530610.12301046998070.112119410.14251000.37323560.132610512422690.14251026998090.112523570.14261040.37020490.102510513334620.17251076998110.112348770.14241060.39420450.1325101166571040.14241076998130.19520580.13281040.39822610.172810514919470.11271066998150.19330790.17251050.36430610.122610512418410.1425106 Example 96: Plasma protein binding of antisense oligonucleotides comprising a GalNAc 3 conjugate group
[0655] Oligonucleotides listed in Table 70 targeting ApoC-III and oligonucleotides in Table 106 targeting Apo(a) were tested in an ultra-filtration assay in order to assess plasma protein binding. Table 106 Modified oligonucleotides targeting Apo(a) ISIS No.Sequences (5' to 3')GalNAc 3 ClusterCMSEQ ID No494372n / an / a2281693401n / an / a2281681251GalNAc 3 -7 a PO2281681257GalNAc 3 -7 a PO2281See the Example 74 for table legend. The structure of GalNAc 3 -7a was shown previously in Example 48.
[0656] Ultrafree-MC ultrafiltration units (30,000 NMWL, low-binding regenerated cellulose membrane, Millipore, Bedford, MA) were pre-conditioned with 300 µL of 0.5% Tween 80 and centrifuged at 2000 g for 10 minutes, then with 300µL of a 300 µg / mL solution of a control oligonucleotide in H 2 O and centrifuged at 2000 g for 16 minutes. In order to assess non-specific binding to the filters of each test oligonucleotide from Tables 70 and 106 to be used in the studies, 300 µL of a 250 ng / mL solution of oligonucleotide in H 2 O at pH 7.4 was placed in the pre-conditioned filters and centrifuged at 2000 g for 16 minutes. The unfiltered and filtered samples were analyzed by an ELISA assay to determine the oligonucleotide concentrations. Three replicates were used to obtain an average concentration for each sample. The average concentration of the filtered sample relative to the unfiltered sample is used to determine the percent of oligonucleotide that is recovered through the filter in the absence of plasma (% recovery).
[0657] Frozen whole plasma samples collected in K3-EDTA from normal, drug-free human volunteers, cynomolgus monkeys, and CD-1 mice, were purchased from Bioreclamation LLC (Westbury, NY). The test oligonucleotides were added to 1.2 mL aliquots of plasma at two concentrations (5 and 150 µg / mL). An aliquot (300 µL) of each spiked plasma sample was placed in a pre-conditioned filter unit and incubated at 37°C for 30 minutes, immediately followed by centrifugation at 2000 g for 16 minutes. Aliquots of filtered and unfiltered spiked plasma samples were analyzed by an ELISA to determine the oligonucleotide concentration in each sample. Three replicates per concentration were used to determine the average percentage of bound and unbound oligonucleotide in each sample. The average concentration of the filtered sample relative to the concentration of the unfiltered sample is used to determine the percent of oligonucleotide in the plasma that is not bound to plasma proteins (% unbound). The final unbound oligonucleotide values are corrected for non-specific binding by dividing the % unbound by the % recovery for each oligonucleotide. The final % bound oligonucleotide values are determined by subtracting the final % unbound values from 100. The results are shown in Table 107 for the two concentrations of oligonucleotide tested (5 and 150 µg / mL) in each species of plasma. The results show that GalNAc conjugate groups do not have a significant impact on plasma protein binding. Furthermore, oligonucleotides with full PS internucleoside linkages and mixed PO / PS linkages both bind plasma proteins, and those with full PS linkages bind plasma proteins to a somewhat greater extent than those with mixed PO / PS linkages. Table 107 Percent of modified oligonucleotide bound to plasma proteins ISIS No.Human plasmaMonkey plasmaMouse plasma5 µg / mL150 µg / mL5 µg / mL150 µg / mL5 µg / mL150 µg / mL30480199.298.099.899.598.197.266308397.890.999.399.396.593.067445096.297.098.694.494.689.349437294.189.398.997.597.293.669340193.689.996.792.094.690.268125195.493.999.198.297.896.168125793.490.597.693.795.692.7 Example 98: Evaluation of pro-inflammatory effects of oligonucleotides comprising a GalNAc conjugate in hPMBC assay
[0658] The oligonucleotides listed in Table 109 and were tested for pro-inflammatory effects in an hPMBC assay as described in Examples 23 and 24. (See Tables 30, 83, 95, and 108 for descriptions of the oligonucleotides.) ISIS 353512 is a high responder used as a positive control, and the other oligonucleotides are described in Tables 83, 95, and 108. The results shown in Table 109 were obtained using blood from one volunteer donor. The results show that the oligonucleotides comprising mixed PO / PS internucleoside linkages produced significantly lower pro-inflammatory responses compared to the same oligonucleotides having full PS linkages. Furthermore, the GalNAc conjugate group did not have a significant effect in this assay. Table 109 ISIS No.E max / EC 50 GalNAc 3 clusterLinkagesCM3535123630n / aPSn / a420915802n / aPSn / a6828811311GalNAc 3 -10PSA d 6828880.26GalNAc 3 -10PO / PSA d 6840571.03GalNAc 3 -19PO / PSA d Example 99: Binding affinities of oligonucleotides comprising a GalNAc conjugate for the asialoglycoprotein receptor
[0659] The binding affinities of the oligonucleotides listed in Table 110 (see Table 76 for descriptions of the oligonucleotides) for the asialoglycoprotein receptor were tested in a competitive receptor binding assay. The competitor ligand, α1-acid glycoprotein (AGP), was incubated in 50 mM sodium acetate buffer (pH 5) with 1 U neuraminidase-agarose for 16 hours at 37°C, and > 90% desialylation was confirmed by either sialic acid assay or size exclusion chromatography (SEC). Iodine monochloride was used to iodinate the AGP according to the procedure by Atsma et al. (see J Lipid Res. 1991 Jan; 32(1):173-81.) In this method, desialylated α1-acid glycoprotein (de-AGP) was added to 10 mM iodine chloride, Na 125< I, and 1 M glycine in 0.25 M NaOH. After incubation for 10 minutes at room temperature, 125< I -labeled de-AGP was separated from free 125< I by concentrating the mixture twice utilizing a 3 KDMWCO spin column. The protein was tested for labeling efficiency and purity on a HPLC system equipped with an Agilent SEC-3 column (7.8x300mm) and a β-RAM counter. Competition experiments utilizing 125< I -labeled de-AGP and various GalNAc-cluster containing ASOs were performed as follows. Human HepG2 cells (10 6< cells / ml) were plated on 6-well plates in 2 ml of appropriate growth media. MEM media supplemented with 10% fetal bovine serum (FBS), 2 mM L-Glutamine and 10mM HEPES was used. Cells were incubated 16-20 hours @ 37°C with 5% and 10% CO 2 respectively. Cells were washed with media without FBS prior to the experiment. Cells were incubated for 30 min @37°C with 1ml competition mix containing appropriate growth media with 2% FBS, 10 -8< M 125< I -labeled de-AGP and GalNAc-cluster containing ASOs at concentrations ranging from 10 -11< to 10 -5< M. Non-specific binding was determined in the presence of 10 -2< M GalNAc sugar. Cells were washed twice with media without FBS to remove unbound 125< I -labeled de-AGP and competitor GalNAc ASO. Cells were lysed using Qiagen's RLT buffer containing 1% β-mercaptoethanol. Lysates were transferred to round bottom assay tubes after a brief 10 min freeze / thaw cycle and assayed on a -counter. Non-specific binding was subtracted before dividing 125< I protein counts by the value of the lowest GalNAc-ASO concentration counts. The inhibition curves were fitted according to a single site competition binding equation using a nonlinear regression algorithm to calculate the binding affinities (K D 's).
[0660] The results in Table 110 were obtained from experiments performed on five different days. Results for oligonucleotides marked with superscript "a" are the average of experiments run on two different days. The results show that the oligonucleotides comprising a GalNAc conjugate group on the 5'-end bound the asialoglycoprotein receptor on human HepG2 cells with 1.5 to 16-fold greater affinity than the oligonucleotides comprising a GalNAc conjugate group on the 3'-end. Table 110 Asialoglycoprotein receptor binding assay results ISIS No.GalNAc conjugateOligonucleotide end to which GalNAc conjugate is attachedK D (nM)661161 a< GalNAc 3 -35'3.7666881 a< GalNAc 3 -105'7.6666981GalNAc 3 -75'6.0670061GalNAc 3 -135'7.4655861 a< GalNAc 3 -13'11.6677841 a< GalNAc 3 -193'60.8 Example 101: Antisense inhibition by oligonucleotides comprising a GalNAc cluster linked via a stable moiety
[0661] The oligonucleotides listed in Table 112 were tested for inhibition of mouse APOC-III expression in vivo. C57Bl / 6 mice were each injected subcutaneously once with an oligonucleotide listed in Table 112 or with PBS. Each treatment group consisted of 4 animals. Each mouse treated with ISIS 440670 received a dose of 2, 6, 20, or 60 mg / kg. Each mouse treated with ISIS 680772 or 696847 received 0.6, 2, 6, or 20 mg / kg. The GalNAc conjugate group of ISIS 696847 is linked via a stable moiety, a phosphorothioate linkage instead of a readily cleavable phosphodiester containing linkage. The animals were sacrificed 72 hours after the dose. Liver APOC-III mRNA levels were measured using real-time PCR. APOC-III mRNA levels were normalized to cyclophilin mRNA levels according to standard protocols. The results are presented in Table 112 as the average percent of APOC-III mRNA levels for each treatment group relative to the saline control group. The results show that the oligonucleotides comprising a GalNAc conjugate group were significantly more potent than the oligonucleotide lacking a conjugate group. Furthermore, the oligonucleotide comprising a GalNAc conjugate group linked to the oligonucleotide via a cleavable moiety (ISIS 680772) was even more potent than the oligonucleotide comprising a GalNAc conjugate group linked to the oligonucleotide via a stable moiety (ISIS 696847). Table 112 Modified oligonucleotides targeting mouse APOC-III ISIS No.Sequences (5' to 3')CMDosage (mg / kg)APOC-III mRNA (% PBS)SEQ ID No.440670n / a292227568620596037680772PO0.67922752586312013696847n / a (PS)0.68322752736402028The structure of GalNAc 3 -7a was shown in Example 48. Example 104: Synthesis of oligonucleotides comprising a 5'-GalNAc 2 conjugate
[0662]
[0663] Compound 120 is commercially available, and the synthesis of compound 126 is described in Example 49. Compound 120 (1 g, 2.89 mmol), HBTU (0.39 g, 2.89 mmol), and HOBt (1.64 g, 4.33 mmol) were dissolved in DMF (10 mL. and N,N-diisopropylethylamine (1.75 mL, 10.1 mmol) were added. After about 5 min, aminohexanoic acid benzyl ester (1.36 g, 3.46 mmol) was added to the reaction. After 3h, the reaction mixture was poured into 100 mL of 1 M NaHSO4 and extracted with 2 x 50 mL ethyl acetate. Organic layers were combined and washed with 3 x 40 mL sat NaHCO 3 and 2 x brine, dried with Na 2 SO 4 , filtered and concentrated. The product was purified by silica gel column chromatography (DCM:EA:Hex , 1:1:1) to yield compound 231. LCMS and NMR were consistent with the structure. Compounds 231 (1.34 g, 2.438 mmol) was dissolved in dichloromethane (10 mL) and trifluoracetic acid (10 mL) was added. After stirring at room temperature for 2h, the reaction mixture was concentrated under reduced pressure and co-evaporated with toluene ( 3 x 10 mL). The residue was dried under reduced pressure to yield compound 232 as the trifuloracetate salt. The synthesis of compound 166 is described in Example 54. Compound 166 (3.39 g, 5.40 mmol) was dissolved in DMF (3 mL). A solution of compound 232 (1.3 g, 2.25 mmol) was dissolved in DMF (3 mL) and N,N-diisopropylethylamine (1.55 mL) was added. The reaction was stirred at room temperature for 30 minutes, then poured into water (80 mL) and the aqueous layer was extracted with EtOAc (2x100 mL). The organic phase was separated and washed with sat. aqueous NaHCO 3 (3 x 80 mL), 1 M NaHSO 4 (3 x 80 mL) and brine (2 x 80 mL), then dried (Na 2 SO 4 ), filtered, and concentrated. The residue was purified by silica gel column chromatography to yield compound 233. LCMS and NMR were consistent with the structure. Compound 233 (0.59 g, 0.48 mmol) was dissolved in methanol (2.2 mL) and ethyl acetate (2.2 mL). Palladium on carbon (10 wt% Pd / C, wet , 0.07 g) was added, and the reaction mixture was stirred under hydrogen atmosphere for 3 h. The reaction mixture was filtered through a pad of Celite and concentrated to yield the carboxylic acid. The carboxylic acid (1.32 g, 1.15 mmol, cluster free acid) was dissolved in DMF (3.2 mL). To this N,N-diisopropylehtylamine (0.3 mL, 1.73 mmol) and PFPTFA (0.30 mL, 1.73 mmol) were added. After 30 min stirring at room temperature the reaction mixture was poured into water (40 mL) and extracted with EtOAc (2 x 50 mL). A standard work-up was completed as described above to yield compound 234. LCMS and NMR were consistent with the structure. Oligonucleotide 235 was prepared using the general procedure described in Example 46. The GalNAc 2 cluster portion (GalNAc 2 -24 a ) of the conjugate group GalNAc 2 -24 can be combined with any cleavable moiety present on the oligonucleotide to provide a variety of conjugate groups. The structure of GalNAc 2 -24 (GalNAc 2 -24 a -CM) is shown below: Example 105: Synthesis of oligonucleotides comprising a GalNAc 1 -25 conjugate
[0664]
[0665] The synthesis of compound 166 is described in Example 54. Oligonucleotide 236 was prepared using the general procedure described in Example 46.
[0666] Alternatively, oligonucleotide 236 was synthesized using the scheme shown below, and compound 238 was used to form the oligonucleotide 236 using procedures described in Example 10.
[0667] The GalNAc 1 cluster portion (GalNAc 1 -25 a ) of the conjugate group GalNAc 1 -25 can be combined with any cleavable moiety present on the oligonucleotide to provide a variety of conjugate groups. The structure of GalNAc 1 -25 (GalNAc 1 -25 a -CM) is shown below: Example 107: Synthesis of oligonucleotides comprising a GalNAc 1 -26 or GalNAc 1 -27 conjugate
[0668]
[0669] Oligonucleotide 239 is synthesized via coupling of compound 47 (see Example 15) to acid 64 (see Example 32) using HBTU and DIEA in DMF. The resulting amide containing compound is phosphitylated, then added to the 5'-end of an oligonucleotide using procedures described in Example 10. The GalNAc 1 cluster portion (GalNAc 1 -26 a ) of the conjugate group GalNAc 1 -26 can be combined with any cleavable moiety present on the oligonucleotide to provide a variety of conjugate groups. The structure of GalNAc 1 -26 (GalNAc 1 -26 a -CM) is shown below:
[0670] In order to add the GalNAc 1 conjugate group to the 3'-end of an oligonucleotide, the amide formed from the reaction of compounds 47 and 64 is added to a solid support using procedures described in Example 7. The oligonucleotide synthesis is then completed using procedures described in Example 9 in order to form oligonucleotide 240.
[0671] The GalNAc 1 cluster portion (GalNAc 1 -27 a ) of the conjugate group GalNAc 1 -27 can be combined with any cleavable moiety present on the oligonucleotide to provide a variety of conjugate groups. The structure of GalNAc 1 -27 (GalNAc 1 -27 a -CM) is shown below: Example 109: Synthesis of oligonucleotides comprising a GalNAc 1 -28 or GalNAc 1 -29 conjugate
[0672]
[0673] Oligonucleotide 241 is synthesized using procedures similar to those described in Example 71 to form the phosphoramidite intermediate, followed by procedures described in Example 10 to synthesize the oligonucleotide. The GalNAc 1 cluster portion (GalNAc 1 -28 a ) of the conjugate group GalNAc 1 -28 can be combined with any cleavable moiety present on the oligonucleotide to provide a variety of conjugate groups. The structure of GalNAc 1 -28 (GalNAc 1 -28 a -CM) is shown below:
[0674] In order to add the GalNAc 1 conjugate group to the 3'-end of an oligonucleotide, procedures similar to those described in Example 71 are used to form the hydroxyl intermediate, which is then added to the solid support using procedures described in Example 7. The oligonucleotide synthesis is then completed using procedures described in Example 9 in order to form oligonucleotide 242.
[0675] The GalNAc 1 cluster portion (GalNAc 1 -29 a ) of the conjugate group GalNAc 1 -29 can be combined with any cleavable moiety present on the oligonucleotide to provide a variety of conjugate groups. The structure of GalNAc 1 -29 (GalNAc 1 -29 a -CM) is shown below: Example 110: Synthesis of oligonucleotides comprising a GalNAc 1 -30 conjugate
[0676]
[0677] Oligonucleotide 246 comprising a GalNAc 1 -30 conjugate group, wherein Y is selected from O, S, a substituted or unsubstituted C 1 -C 10 alkyl, amino, substituted amino, azido, alkenyl or alkynyl, is synthesized as shown above. The GalNAc 1 cluster portion (GalNAc 1 -30 a ) of the conjugate group GalNAc 1 -30 can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, Y is part of the cleavable moiety. In certain embodiments, Y is part of a stable moiety, and the cleavable moiety is present on the oligonucleotide. The structure of GalNAc 1 -30 a is shown below: Example 111: Synthesis of oligonucleotides comprising a GalNAc 2 -31 or GalNAc 2 -32 conjugate
[0678]
[0679] Oligonucleotide 250 comprising a GalNAc 2 -31 conjugate group, wherein Y is selected from O, S, a substituted or unsubstituted C 1 -C 10 alkyl, amino, substituted amino, azido, alkenyl or alkynyl, is synthesized as shown above. The GalNAc 2 cluster portion (GalNAc 2 -31 a ) of the conjugate group GalNAc 2 -31 can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the Y-containing group directly adjacent to the 5'-end of the oligonucleotide is part of the cleavable moiety. In certain embodiments, the Y-containing group directly adjacent to the 5'-end of the oligonucleotide is part of a stable moiety, and the cleavable moiety is present on the oligonucleotide. The structure of GalNAc 2 -31 a is shown below:
[0680] The synthesis of an oligonucleotide comprising a GalNAc 2 -32 conjugate is shown below.
[0681] Oligonucleotide 252 comprising a GalNAc 2 -32 conjugate group, wherein Y is selected from O, S, a substituted or unsubstituted C 1 -C 10 alkyl, amino, substituted amino, azido, alkenyl or alkynyl, is synthesized as shown above. The GalNAc 2 cluster portion (GalNAc 2 -32 a ) of the conjugate group GalNAc 2 -32 can be combined with any cleavable moiety to provide a variety of conjugate groups. In certain embodiments, the Y-containing group directly adjacent to the 5'-end of the oligonucleotide is part of the cleavable moiety. In certain embodiments, the Y-containing group directly adjacent to the 5'-end of the oligonucleotide is part of a stable moiety, and the cleavable moiety is present on the oligonucleotide. The structure of GalNAc 2 -32 a is shown below: Example 113: Antisense oligonucleotides targeting kallikrein B, plasma (Fletcher factor) 1 comprising a GalNAc cluster
[0682] The oligonucleotides in Table 121 were designed to target human kallikrein B, plasma (Fletcher factor) 1, or prekallikrein (PKK). Table 121 Sequences (5' to 3')SEQ ID No.GalNAc 3 -3 -T es G es m< C es A es A es G ds T ds m< C ds T ds m< C ds T ds T ds G ds G ds m< C ds A es A es A es m< C es A e 570GalNAc 3 -3- T es G eo m< C eo A eo A eo G ds T ds m< C ds T ds m< C ds T ds T ds G ds G ds m< C ds A eo A eo A es m< C es A e 570GalNAc 3 -7 -T es G es m< C es A es A es G ds T ds m< C ds T ds m< C ds T ds T ds G ds G ds m< C ds A es A es A es m< C es A e 570GalNAc 3 -7- T es G eo m< C eo A eo A eo G ds T ds m< C ds T ds m< C ds T ds T ds G ds G ds m< C ds A eo A eo A es m< C es A e 570GalNAc 3 -10 -T es G es m< C es A es A es G ds T ds m< C ds T ds m< C ds T ds T ds G ds G ds m< C ds A es A es A es m< C es A e 570GalNAc 3 -10 -T es T eo m< C eo A eo A eo G ds T ds m< C ds T ds m< C ds T ds T ds G ds G ds m< C ds A eo A eo A es m< C es A e 570GalNAc 3 -13 -T es T es m< C es A es A es G ds T ds m< C ds T ds m< C ds T ds T ds G ds G ds m< C ds A es A es A es m< C es A e 570GalNAc 3 -13 -T es T eo m< C eo A eo A eo G ds T ds m< C ds T ds m< C ds T ds T ds G ds G ds m< C ds A eo A eo A es m< C es A e 570T es G es m< C es A es A es G ds T ds m< C ds T ds m< C ds T ds T ds G ds G ds m< C ds A es A es A es m< C es A e -GalNAc 3 -19 570T es G eo m< C eo A eo A eo G ds T ds m< C ds T ds m< C ds T ds T ds G ds G ds m< C ds A eo A eo A es m< C es A e -GalNAc 3 -19 570GalNAc 3 -7 a-o' T es G es m< C eo A eo A es G ds T ds m< C ds T ds m< C ds T ds T ds G ds G ds m< C ds A eo A eo A es m< C es A e 570 Example 115: Antisense inhibition of human PKK in HepaRG ™< cells by antisense oligonucleotides with 2'-MOE sugar modifications
[0683] Additional antisense oligonucleotides were designed targeting a PKK nucleic acid and were tested for their effects on PKK mRNA in vitro.
[0684] The chimeric antisense oligonucleotides in the tables below were designed as 5-10-5 MOE gapmers. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-O-methoxyethyl modification. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site" indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3'-most nucleoside to which the gapmer is targeted in the human gene sequence. Each gapmer listed in the tables below is targeted to either SEQ ID NO: 1 or SEQ ID NO: 10. 'n / a' indicates that the antisense oligonucleotide does not target that particular gene sequence.
[0685] Cultured HepaRG ™< cells at a density of 20,000 cells per well were transfected using electroporation with 5,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and PKK mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3454 was used to measure mRNA levels. PKK mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ®< . The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Results are presented as percent inhibition of PKK, relative to untreated control cells. Table 126 ISIS NOSEQ ID NO: 1 Start SiteSEQ ID NO: 1 Stop SiteSequenceMotif% inhibitionSEQ ID NO: 10 Start SiteSEQ ID NO: 10 Stop SiteSEQ ID NO531231n / an / aTATCACTGTACTAGTTTCCT5-10-59814744147633341481514834148861490514945149641500515024150771509615220152391529215311153511537015411154301548315502155551557415613156321568515704158151583415887159061594515964546131423ATGAACGGTCTTCAAGCTGT5-10-57533963415341547269524AATGAACGGTCTTCAAGCTG5-10-55633973416342547270726AAAATGAACGGTCTTCAAGC5-10-568339934183435472711029TTAAAAATGAACGGTCTTCA5-10-560340234213445472721332CACTTAAAAATGAACGGTCT5-10-582340534243455472732544TGAGTCTCTTGTCACTTAAA5-10-593341734363465472742948GAGGTGAGTCTCTTGTCACT5-10-570342134403475461363049GGAGGTGAGTCTCTTGTCAC5-10-586342234413485472753251TTGGAGGTGAGTCTCTTGTC5-10-587342434433495461374059ATTGCTTCTTGGAGGTGAGT5-10-576343234513505472764261CAATTGCTTCTTGGAGGTGA5-10-593343434533515472774463CACAATTGCTTCTTGGAGGT5-10-575343634553525472784564ACACAATTGCTTCTTGGAGG5-10-570343734563535461384766AAACACAATTGCTTCTTGGA5-10-569343934583545472794867AAAACACAATTGCTTCTTGG5-10-569344034593555472804968GAAAACACAATTGCTTCTTG5-10-547344134603565472817089TTGCTTGAATAAAATCATTC5-10-541406940883575461407291GCTTGCTTGAATAAAATCAT5-10-560407140903585472827493TTGCTTGCTTGAATAAAATC5-10-553407340923595472837695AGTTGCTTGCTTGAATAAAA5-10-5674075409436054614182101GAAATAAGTTGCTTGCTTGA5-10-5564081410036154728486105AAATGAAATAAGTTGCTTGC5-10-52640854104362547285102121ACTGTAGCAAACAAGGAAAT5-10-55141014120363546143106125GGAAACTGTAGCAAACAAGG5-10-54641054124364546144110129CACAGGAAACTGTAGCAAAC5-10-57541094128365547286117136AGACATCCACAGGAAACTGT5-10-568n / an / a366547287120139GTCAGACATCCACAGGAAAC5-10-569n / an / a367546146123142TGAGTCAGACATCCACAGGA5-10-572n / an / a368547288131150CATAGAGTTGAGTCAGACAT5-10-58080038022369546147132151TCATAGAGTTGAGTCAGACA5-10-57680048023370547289133152TT...
Claims
1. A compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 20 linked nucleosides and has the nucleobase sequence TGCAAGTCTCTTGGCAAACA-3' (SEQ ID NO: 570), and wherein the conjugate group is covalently linked to the modified oligonucleotide at the 5' end of the modified oligonucleotide.
2. The compound of claim 1, wherein the compound consists of the modified oligonucleotide and the conjugate group, and wherein the modified oligonucleotide is single-stranded.
3. The compound of claim 1 or claim 2, wherein at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage, optionally wherein the at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.
4. The compound of any of claims 1-3, wherein: a) the modified oligonucleotide comprises at least one, at least two, at least three, at least four, at least five, at least six or at least seven phosphodiester internucleoside linkages; and / or b) each internucleoside linkage of the modified oligonucleotide is selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.
5. The compound of any of claims 1-4, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase, optionally wherein the at least one modified nucleobase is a 5-methylcytosine.
6. The compound of any of claims 1-5, wherein at least one nucleoside of the modified oligonucleotide comprises at least one modified sugar.
7. The compound of claim 6, wherein at least one nucleoside of the modified oligonucleotide comprises a 2' modified sugar, a bicyclic sugar, or a sugar surrogate, optionally wherein the 2' modified sugar is a 2'-O-methoxyethyl modified sugar or a 2'-O-methyl modified sugar, and optionally wherein the bicyclic sugar is a constrained ethyl or a LNA, and optionally wherein the sugar surrogate is THP or a 3'-fluoro-HNA.
8. The compound of any of claims 1-7, wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of 5 linked nucleosides; and a 3' wing segment consisting of 5 linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.
9. The compound of any of claims 1-8, wherein the conjugate group comprises at least one N- Acetylgalactosamine (GalNAc).
10. The compound of any of claims 1-8, wherein the conjugate group comprises a cell-targeting moiety, optionally wherein the cell-targeting moiety has the following structure:
11. The compound of any of claims 1-10, wherein the conjugate group comprises:
12. The compound of any of claims 1-11, wherein the conjugate group comprises a cleavable moiety, wherein the cleavable moiety is a bond or group that is capable of being split under physiological conditions, optionally wherein the conjugate group comprises: wherein (CM) is the cleavable moiety, for example wherein the conjugate group comprises:
13. A compound of claim 1 comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide is a gapmer consisting of a 5' wing segment, a central gap segment, and a 3' wing segment, wherein: the 5' wing segment consists of five 2'-O-methoxyethyl nucleosides the central gap segment consists of ten β-D-deoxyribonucleosides and the 3' wing segment consists of five 2'-O-methoxyethyl nucleosides wherein the modified oligonucleotide has the nucleobase sequence 5'-TGCAAGTCTCTTGGCAAACA-3' (SEQ ID NO: 570), wherein each cytosine is a 5-methylcytosine, wherein the internucleoside linkages of the modified oligonucleotide are ssoosssssssssssooss from 5' to 3', wherein each s is a phosphorothioate linkage and each o is a phosphodiester linkage, wherein the conjugate group is linked to the modified oligonucleotide at the 5' end of the modified oligonucleotide, and wherein the conjugate group has the following chemical structure:
14. A salt of a compound of claim 1, wherein the anion of the salt has the following chemical structure: (SEQ ID NO: 570).
15. A compound of claim 1 according to the following chemical structure: (SEQ ID NO: 570), or a salt thereof.
16. A pharmaceutical composition comprising or consisting essentially of the compound of any of claims 1-13 and 15, or the salt of a compound of claim 14, and a pharmaceutically acceptable carrier or diluent, wherein optionally the pharmaceutically acceptable diluent is phosphate-buffered saline (PBS).
17. The compound according to any of claims 1-13 and 15, the salt of a compound of claim 14, or the pharmaceutical composition according to claim 16, for use in the treatment of: a) a thromboembolic disease; b) an inflammatory disease; or c) edema, optionally wherein the edema is hereditary angioedema, angioedema of the lids, macular edema, ocular edema, or cerebral edema.
18. The compound, salt of the compound, or pharmaceutical composition for use according to claim 17, wherein the treatment comprises administering the compound, salt or pharmaceutical composition to a human.