Systemic evaluation method for estimating target gut microbes in pets

Abstract

cycle threshold and the cycle threshold of the target gut microbe; (S6) determining the relative error distance between the measured relative abundance ratio and standard abundance ratio of the target microbe; (S7) calculating the R value of the target microbe based on the relative error distance; (S8) performing a first-stage evaluation of the subhealth risk of the pet based on the R value. The systematic evaluation method may further comprises: (S9) converting the R-value into a risk index, and

Description

Technical Field

[0001] This invention relates to a systematic evaluation method for target gut bacteria in pets. It utilizes real-time quantitative polymerase chain reaction (qPCR) to quantify the target gut bacteria, and then calculates and converts the R value and risk index of the target gut bacteria through multiple formulas, and conducts first and second stage sub-health risk assessment. Prior Technology

[0002] As urbanization increases and interpersonal relationships become more distant, many people are starting to keep pets at home. Owners no longer treat their pets as ordinary animals, but as members of the family, providing them with emotional support. Because pets cannot speak and cannot express their discomfort, by the time owners discover their pets are sick, symptoms have often accumulated over time. Therefore, regular health checkups are crucial.

[0003] The gut microbiota primarily refers to the normal flora, including bacteria and fungi, that reside in the intestines. This microbial community exists in the intestines of humans and other animals (including insects), and each organism has a unique gut microbiota. Furthermore, the variety and quantity of microorganisms in the gut are astonishing; in humans, there can be thousands of different species and hundreds of trillions of different bacteria. The bacteria in the gut microbiota can be roughly divided into probiotics and non-probiotics. An excess of non-probiotics may crowd out probiotics, while an excess of beneficial probiotics may cause diarrhea or infection. Therefore, a balance between probiotics and non-probiotics is ideal; otherwise, it may indirectly affect the pet's sub-optimal health.

[0004] Recent studies have indicated a correlation between gut microbiota imbalance and various diseases, including digestive tract diseases, hepatobiliary diseases, metabolic diseases, allergies and immune-related diseases, cardiovascular diseases, skin diseases, urinary and reproductive tract diseases, and mental illnesses. Therefore, gut microbiota analysis is crucial for the health of living organisms. For pets that cannot verbally express discomfort, regular checks of their gut microbiota can assess for imbalances, allowing for timely intervention, dietary adjustments, or seeking medical help. However, current gut microbiota analysis techniques are costly and cumbersome, highlighting the urgent need for a more economical and simplified assessment method. Summary of the Invention

[0005] In view of the aforementioned shortcomings of the prior art, one objective of this invention is to provide a simple and systematic method for evaluating the target gut microbiota of pets. This method extracts deoxyribonucleic acid (DNA) samples from pet fecal specimens and quantifies the target gut microbiota using real-time quantitative polymerase chain reaction (qPCR). Subsequently, through multiple formula calculations and conversions, a first and / or second-stage assessment of the pet's sub-health risk is performed. Compared to traditional gut microbiota analysis, this invention is simple to operate, provides specific results, and is less costly, making it suitable for daily health management and long-term gut health monitoring in pets.

[0006] To achieve the above objectives, the present invention provides a systematic evaluation method for target gut microbiota in pets, comprising the following steps: (S1) Provide a fecal sample from a pet; (S2) Extract deoxyribonucleic acid (DNA) samples from the fecal specimen; (S3) Using the universal primer pair between the deoxyribonucleic acid sample and 16S ribosomal ribonucleic acid (16S rRNA), a first real-time quantitative polymerase chain reaction was performed to determine the 16S cycle number threshold (Ct 16S) of the deoxyribonucleic acid sample; (S4) Using the primer pair of the deoxyribonucleic acid sample and a target intestinal bacterium, a second real-time quantitative polymerase chain reaction was performed to determine the cycle number threshold (Ct 16S) of the target intestinal bacterium in the deoxyribonucleic acid sample; (S5) Substitute the 16S cycle number threshold and the cycle number threshold of the target intestinal bacteria into Formula I to calculate the target intestinal bacteria quantity measurement ratio (Ct target intestinal bacteria): The bacterial count measurement ratio = [1 / (Ct target gut bacteria – Ct 16S)] Formula I; (S6) Substitute the measured percentage of the target intestinal bacteria and the standard value of the bacterial count into Formula II to calculate the relative error distance of the target intestinal bacteria: [] Relative error distance = [(proportional value of bacterial count measurement – ​​standard value of bacterial count) / standard value of bacterial count] Formula II; (S7) Substitute the relative error distance of the target gut bacteria into Formula III to calculate the R value of the target gut bacteria: R value = tanh x = [(e^(2x-1) / (e^(2x+1))] Formula III; and (S8) The first-stage assessment of the pet's sub-health risk is conducted using the R value of the target gut microbiota: When the R value is less than -0.75, the number of the target gut bacteria is too low; When the R value is greater than or equal to -0.75 and less than -0.35, the number of the target gut bacteria is low; When the R value is greater than or equal to -0.35 and less than 0.35, the number of the target gut microbiota is normal; When the R value is greater than or equal to 0.35 and less than 0.75, the number of the target gut bacteria is too high; and When the R value is greater than or equal to 0.75, the number of the target gut bacteria is too high.

[0007] In some specific embodiments, the target gut bacteria are probiotics: When the R value is less than -0.75 and the target gut microbiota is a probiotic (the probiotic count is too low), it is recommended to supplement with the target gut microbiota and further test the pet's gut microbiota. When the R value is greater than or equal to -0.75 and less than -0.35, and the target gut bacteria are probiotics (the number of probiotics is low), it is recommended to supplement with the target gut bacteria. When the R value is greater than or equal to -0.35 and less than 0.35, and the target gut bacteria are probiotics (with normal probiotic counts), it is recommended to maintain the pet's current diet. When the R-value is greater than or equal to 0.35 and less than 0.75, and the target gut microbiota is probiotic (probiotic count is high), further testing of the pet's gut microbiota is recommended; and When the R value is greater than or equal to 0.75 and the target gut microbiota is a probiotic (the number of probiotics is too high), it is recommended to further test the pet's gut microbiota.

[0008] In some specific embodiments, the target gut bacteria are non-probiotics: When the R value is less than -0.75 and the target gut microbiota is non-probiotic (the number of non-probiotics is too low), it is recommended to maintain the pet's diet. When the R value is greater than or equal to -0.75 and less than -0.35, and the target gut microbiota is non-probiotic (the number of non-probiotics is low), it is recommended to maintain the pet's diet. When the R value is greater than or equal to -0.35 and less than 0.35, and the target gut microbiota is non-probiotic (with normal non-probiotic count), it is recommended to maintain the pet's diet. When the R-value is greater than or equal to 0.35 and less than 0.75, and the target gut microbiota is non-probiotic (the number of non-probiotics is high), further testing of the pet's gut microbiota is recommended; and When the R value is greater than or equal to 0.75 and the target gut microbiota is non-probiotic (the number of non-probiotics is too high), it is recommended to further test the pet's gut microbiota or seek medical assistance regarding the pet's diet.

[0009] In some specific embodiments, the systematic evaluation method for target gut microbiota in pets of the present invention further includes the following steps: (S9) Convert the R value of the target gut microbiota into a risk index for the target gut microbiota: When the R value is greater than or equal to 0.35, and the target gut bacteria is a probiotic, the risk index of the target gut bacteria is the absolute value of R / 3 (i.e., |R / 3|). When the R value is less than 0.35, and the target gut microbiota is a probiotic, the risk index of the target gut microbiota is the absolute value of R (i.e., |R|); and When the target gut microbiota is a non-probiotic, the risk index of the target gut microbiota is the absolute value of R (i.e., |R|); and (S10) The second phase of assessment of the pet's sub-health risk is conducted using the risk index of the target gut microbiota: When the risk index of the target gut microbiota is greater than or equal to 0 and less than 0.35, there is no risk of imbalance in the gut microbiota of the target gut microbiota in the pet. When the risk index of the target gut microbiota is greater than or equal to 0.35 and less than 0.65, the target gut microbiota has a low risk of imbalance in the pet's gut microbiota; and When the risk index of the target gut microbiota is greater than or equal to 0.65 and less than or equal to 1, the target gut microbiota has a high risk of imbalance in the pet's gut microbiota.

[0010] In some specific embodiments, it is recommended to maintain the pet's diet when there is no risk of imbalance in the expression of the target gut microbiota in the pet's gut microbiota.

[0011] In some specific embodiments, when the target gut microbiota has a low risk of imbalance in the pet's gut microbiota, it is recommended to adjust the pet's diet and use appropriate nutritional supplements.

[0012] In some specific embodiments, when the target gut microbiota is at high risk of being dysregulated in the pet's gut microbiota, it is recommended to seek medical assistance regarding the pet's diet.

[0013] In this invention, sub-health is a state between health and disease. Based on the systematic assessment method of this invention, the detected bacterial flora results can be compared with the known bacterial flora distribution of healthy individuals and patients to determine whether the subject's state falls within the sub-health range—a state that "deviates from health but has not yet reached a disease state."

[0014] In this invention, the cycle threshold (Ct) refers to the number of PCR cycles required to bring the fluorescence labeling signal intensity of the target gene to a specified threshold during polymerase chain reaction (PCR). It is commonly used to measure pathogen content. The lower the Ct value, the higher the concentration of pathogen in the sample used for PCR; the higher the Ct value, the lower the concentration of pathogen in the sample used for PCR.

[0015] In this invention, 16S ribosomal ribonucleic acid (16S rRNA) is a component of the 30S subunit of the ribosome in prokaryotes (such as bacteria). The gene sequence of 16S rRNA is highly conserved between bacteria and archaea. In this invention, the total bacterial count in a sample is calculated using the Ct value of the 16S rRNA gene.

[0016] In some specific embodiments, the universal primer pair for the 16S rRNA gene is a universal primer pair in the V3 and / or V4 regions. In some specific embodiments, the universal primer pair for the 16S rRNA gene may be: Forward introducing factor: TCTACGGGAGGCAGCAGT (SEQ ID NO: 1); Reverse primer: GGACTACCAGGGTATCTAATCCTGTT (SEQ ID NO: 2).

[0017] In some specific embodiments, the target intestinal bacterium is *Lactobacillus acidophilus*, and its primer pair may be... Forward induction: GATCGCATGATCAGCTTATA (SEQ ID NO: 3); Reverse primer: AGTCTCTCAACTCGGCTATG (SEQ ID NO: 4).

[0018] In some specific embodiments, the target enteric bacterium is *Bifidobacterium lactis*, and its primer pair may be: Forward induction: CCACATGATCGCATGTGATTG (SEQ ID NO: 5); Reverse primer: CCGAAGGCTTGCTCCAAA (SEQ ID NO: 6).

[0019] In some specific embodiments, the target enteric bacterium is *Streptococcus thermophilus*, and its primer pair may be: Forward introducing agent: CCACTACAAGATGGACCTGC (SEQ ID NO: 7); Reverse primer: CCGTTCTTGACTTACAACGA (SEQ ID NO: 8).

[0020] In some specific embodiments, the pet is a dog or a cat.

[0021] In some specific embodiments, steps (S4) to (S8) are repeated multiple times, and each step (S4) to (S8) is performed on a different target gut microbiota. In some specific embodiments, steps (S4) to (S8) are repeated 2 to 5 times, each time targeting 2 to 5 different target gut microbiota. In some specific embodiments, steps (S4) to (S8) are repeated 3 times, each time targeting 3 different target gut microbiota, and all 3 different target gut microbiota are probiotics. In some specific embodiments, the 3 different target gut microbiota are target gut microbiota resident in the large intestine, target gut microbiota resident in the small intestine, and target gut microbiota resident in the duodenum (the junction of the gastrointestinal tract and small intestine).

[0022] In some specific embodiments, the results of these multiple assessments may differ. If any first-stage assessment result includes "seek medical assistance regarding the pet's diet," then seeking medical assistance regarding the pet's diet is recommended. In some specific embodiments, the results of these multiple assessments may differ. If any first-stage assessment result includes "recommendation for further testing of the pet's gut microbiota," then further testing of the pet's gut microbiota is recommended. In some specific embodiments, the results of these multiple assessments may differ. If any first-stage assessment result includes "recommendation for supplementation with the target gut microbiota," then supplementation with the target gut microbiota is recommended. In some specific embodiments, supplementation with multiple target gut microbiota may be recommended simultaneously.

[0023] In some specific embodiments, steps (S4) to (S9) are repeated multiple times, and each step (S4) to (S9) targets a different target gut microbiota. In some specific embodiments, steps (S4) to (S9) are repeated 2 to 5 times, targeting 2 to 5 different target gut microbiota respectively. In some specific embodiments, steps (S4) to (S9) are repeated 3 times, targeting 3 different target gut microbiota respectively, and all 3 different target gut microbiota are probiotics. In some specific embodiments, the 3 different target gut microbiota are target gut microbiota resident in the large intestine, target gut microbiota resident in the small intestine, and target gut microbiota resident in the duodenum (the junction of the gastrointestinal tract and small intestine). In some specific embodiments, the results of these multiple repetitions may differ; if any second-stage assessment result is "high risk of imbalance," medical assistance is recommended regarding the pet's diet. In some specific embodiments, the results of the multiple assessments may differ. If none of the second-stage assessments result in a "high risk of imbalance" result, but any one result indicates a "low risk of imbalance" result, then it is recommended to adjust the pet's diet.

[0024] The bacterial count standard value used in this invention is based on the bacterial count measurement ratio obtained after performing steps (S1)-(S5) of the method of this invention on the same target intestinal bacteria in the same breed of pets (such as dogs or cats) without disease records and without showing abnormal symptoms. That is, the bacterial count measurement ratio obtained by performing the first and second real-time qPCR after extracting DNA samples from their fecal samples and then substituting it into Formula I is used as the bacterial count standard value. In some specific embodiments, the bacterial count standard value is the average or median obtained by statistically analyzing the bacterial count measurement ratios obtained from testing only the same breed of pets without disease records and without showing abnormal symptoms. In this invention, since the bacterial count standard value is calculated from the bacterial count measurement ratio obtained from multiple dogs or cats with no disease record and no abnormal symptoms, when the number of samples meeting the standard is insufficient and the data test shows an abnormal distribution, the standard range is 25% to 75% of the bacterial count measurement ratio distribution; when the number of samples meeting the standard is sufficient and the data test shows a normal distribution, the 95% confidence interval is adopted as the standard range value.

[0025] In some specific embodiments, if the pet is a dog, its bacterial count standard value should be measured based on dogs with no disease record and no abnormal symptoms. In some specific embodiments, if the pet is a cat, its bacterial count standard value should be measured based on cats with no disease record and no abnormal symptoms. In this invention, the bacterial count measurement ratio obtained from the aforementioned pets of the same breed with no disease record and no abnormal symptoms is used as a reference value for the health standard, which has good representativeness and applicability, and is suitable for risk assessment of general canine and feline intestinal health. The bacterial count standard value of this method has universality and can be applied to the intestinal health assessment of various dogs and cats, facilitating its widespread application in daily health management.

[0026] In some specific embodiments, the target intestinal bacteria are probiotics, and the probiotic strain includes *Bifidobacterium bifidum*, *Bifidobacterium longum*, *Bifidobacterium breve*, *Bifidobacterium infantis*, *Bifidobacterium adolescentis*, *Bifidobacterium lactis* (also known as *Bifidobacterium lactis*), *Lactobacillus acidophilus*, *Lactobacillus fermentum*, *Lactobacillus casei*, *Lactobacillus paracasei*, *Lactobacillus gasseri*, *Lactobacillus rhamnosus*, and *Lactobacillus reuteri*. Lactobacillus reuteri, Lactobacillus helveticus, Lactobacillus plantarum, Lactobacillus salivarius, Lactobacillus delbruekii subsp. Bulgaricus, Streptococcus thermophilus, and Akkermansia muciniphila (also known as AKK bacteria) are included, but not limited to these.

[0027] In some specific embodiments, the target intestinal bacteria are non-probiotics, and the non-probiotics include, but are not limited to, Clostridium perfringens, Clostridium difficile, Klebsiella pneumoniae, Klebsiella oxytoca, Helicobacter pylori, Salmonella enteritidis, Salmonella enterica, Shigella flexneri, and Shigella sonnei.

[0028] The large intestine is an anaerobic environment, generally rich in Bifidobacterium spp. and some anaerobic probiotics. In some specific embodiments, the target intestinal flora residing in the large intestine may be Bifidobacterium bifidum, Bifidobacterium longum, Bifidobacterium lactis, or Akkermansia muciniphila (also known as AKK bacteria), but is not limited to these.

[0029] The small intestine, comprising the jejunum and ileum, is a slightly acidic, neutral environment with a high oxygen content, thus supporting the presence of some facultative anaerobic bacteria, such as *Lactobacillus* spp. In some specific embodiments, the target gut bacteria residing in the small intestine may be *Lactobacillus acidophilus*, but this is not a limitation.

[0030] The duodenum is an acidic environment with a high concentration of various digestive enzymes. Therefore, the bacteria residing there need to possess certain acid and bile salt tolerance, such as *Lactobacillus spp.*. In some specific embodiments, the target intestinal bacteria residing in the duodenum (the junction of the gastrointestinal tract and small intestine) may be *Streptococcus thermophilus* or *Lactobacillus reuteri*, but are not limited to these.

[0031] In some specific embodiments, the risk of imbalance (including low and high imbalance risk) of the target gut microbiota in the pet's gut microbiota is positively correlated with the risk of developing a disease; that is, the higher the risk of imbalance, the higher the risk of disease. The relationship between gut microbiota and disease is extremely complex and not a one-to-one relationship. The contribution of each probiotic and / or non-probiotic (such as pathogens) to the disease is not equal. This invention can indirectly affect the pet's sub-health state (such as increasing the risk of certain diseases) by leveraging the crowding-out effect (or vice versa) of probiotics (or non-probiotics) on pathogens.

[0032] In some specific embodiments, the disease is selected from the group consisting of oral diseases, liver diseases, urinary tract diseases, lung diseases, stomach and duodenal diseases, and large and small bowel diseases.

[0033] In some specific embodiments, the oral disease includes, but is not limited to, oral malformations, dental caries, periodontal disease, stomatitis, periodontitis, and oral ulcers. In some specific embodiments, the oral malformations include, but are not limited to, dental plaque, tartar, and halitosis.

[0034] In some specific embodiments, the liver disease is cholestatic liver disease.

[0035] In some embodiments, the urinary tract disease is a urinary tract infection, such as a bacterial infection of the urinary tract. In some embodiments, the urinary tract includes the kidneys, ureters, bladder, and urethra. In some embodiments, the urinary tract infection includes nephritis, ureteritis, cystitis, and urethritis.

[0036] In some specific embodiments, the lung disease is a lung infection, such as a bacterial infection of the lungs. In some specific embodiments, the lung infection is pneumonia.

[0037] In some specific embodiments, the gastric and duodenal disease is gastritis or duodenal disease. In some specific embodiments, the duodenal disease is a bacterial infection of the duodenum, such as duodenitis.

[0038] In some specific embodiments, the large and small bowel disease is antibiotic enteritis or colitis. [。]

[0039] In some specific embodiments, the target intestinal bacterium is *Lactobacillus acidophilus*, and the disease is selected from the group consisting of oral diseases, liver diseases, and diseases of the large and small intestines. In some specific embodiments, *Lactobacillus acidophilus* has the effect of inhibiting pathogens associated with dental caries and periodontitis. In some specific embodiments, *Lactobacillus acidophilus* can improve the inflammatory response of cholestatic liver disease and protect hepatocytes from damage.

[0040] In some specific embodiments, the target intestinal bacterium is *Bifidobacterium lactis*, and the disease is selected from the group consisting of urinary tract diseases and lung diseases. In some specific embodiments, *Klebsiella pneumoniae* and *Staphylococcus aureus* may cause urinary tract infections, and *Bifidobacterium lactis* has the effect of inhibiting such infections. In some specific embodiments, *Klebsiella pneumoniae* may cause lung infections, and *Bifidobacterium lactis* has the effect of inhibiting such infections.

[0041] In some specific embodiments, the target intestinal bacterium is *Streptococcus thermophilus*, and the disease is selected from the group consisting of diseases of the stomach and duodenum, and diseases of the large and small intestine. In some specific embodiments, *Helicobacter pylori* may cause bacterial infectious gastrointestinal diseases, leading to symptoms such as mucosal damage, vomiting, and diarrhea, and in severe cases, gastric ulcers and gastric perforation; *Streptococcus thermophilus* has the effect of inhibiting such infections. In some specific embodiments, *Clostridium difficile* causes severe enteritis; *Streptococcus thermophilus* has the effect of inhibiting such infections.

[0042] This invention provides a systematic assessment method for the target gut microbiota in pets. Owners can easily collect fecal samples from their pets for testing, quantify the target gut microbiota, and assess the pet's sub-health risk. This assessment can be conducted in two stages: the first stage assesses the overall status of the target gut microbiota, and then decides whether to proceed with the second stage disease risk assessment. If the target gut microbiota count is too low or too high, it increases the risk of related diseases. In such cases, the pet's diet or lifestyle should be adjusted as soon as possible, or medical assistance should be sought to maintain the pet's health. Simple Explanation of the Diagram

[0043] Figure 1A is a flowchart of the systematic evaluation method for target gut bacteria in pets according to the present invention. Figure 1B is another flowchart of the systematic evaluation method for the target gut microbiota of pets according to the present invention. Implementation

[0044] The objectives, advantages, and technical features of the present invention will become apparent from the following detailed description of the embodiments and accompanying drawings.

[0045] [This invention] [Systematic Assessment Methods for Target Gut Microbiota in Pets]

[0046] The flowchart of the systematic evaluation method for target gut microbiota in pets according to the present invention is shown in Figure 1A, which includes the following steps (S1) to (S8):

[0047] (S1) First, collect and provide a fecal sample from a pet for testing. The fecal sample must be collected and sent for testing immediately after excretion to ensure that the sample accurately reflects the intestinal flora of the pet being tested. In addition, the fecal sample should be preserved in a preservation solution to maintain the composition of anaerobic bacteria in the sample. This preservation solution contains ethylenediaminetetraacetic acid disodium salt dihydrate and sodium azide (NaN 3).

[0048] (S2) Using the QIAGEN QIAamp DNA Mini Kit, extract the deoxyribonucleic acid (DNA) sample from the fecal specimen according to the instructions in the kit.

[0049] (S3) Using the universal primer pair between the DNA sample and the 16S ribosomal RNA gene, and using the DNA sample as a template, a first real-time qPCR was performed to determine the 16S cycle number threshold (Ct 16S) of the deoxyribonucleic acid sample. The first real-time qPCR involved first reacting at 50°C for 2 minutes to remove contamination; then reacting at 95°C for 5 minutes to fully open the template DNA; amplification was performed in 40 cycles, each cycle including a 15-second denaturation reaction at 95°C and a 30-second adhesion and extension reaction at 60°C; after the reaction, the product was stored at 4°C.

[0050] (S4) Using the primer pair of the DNA sample and a target entero bacterium, and with the aforementioned DNA sample as a template, a second real-time qPCR was performed to determine the cycle number threshold (Ct target entero bacterium) of the target entero bacterium in the deoxyribonucleic acid sample. The second real-time qPCR was performed under the same conditions as the first real-time qPCR.

[0051] (S5) Substitute the 16S cycle number threshold and the cycle number threshold of the target intestinal bacteria into Formula I to calculate the proportion of the target intestinal bacteria count: The bacterial count measurement ratio = [1 / (Ct target gut bacteria – Ct 16S)] Formula I;

[0052] (S6) Substitute the measured percentage of the target intestinal bacteria and the standard value of the bacterial count into Formula II to calculate the relative error distance of the target intestinal bacteria: Relative error distance = [(proportional value of bacterial count measurement – ​​standard value of bacterial count) / standard value of bacterial count] Formula II;

[0053] The standard value for the target intestinal bacteria count is the proportion of bacterial count obtained by substituting it into Formula I after extracting DNA samples from fecal specimens of the same species (i.e., pets of the same species as the tested pet) that had no disease record and showed no abnormal symptoms.

[0054] (S7) Substitute the relative error distance of the target gut bacteria into x in Formula III to calculate the R value of the target gut bacteria: R value = tanh x = [(e^(2x-1) / (e^(2x+1))] Formula III;

[0055] (S8) The first-stage assessment of the pet's sub-health risk is conducted using the R value of the target gut microbiota:

[0056] When the target gut bacteria is a probiotic: When the R value is less than -0.75 and the target gut microbiota is a probiotic (the probiotic count is too low), it is recommended to supplement with the target gut microbiota and further test the pet's gut microbiota. When the R value is greater than or equal to -0.75 and less than -0.35, and the target gut bacteria are probiotics (the number of probiotics is low), it is recommended to supplement with the target gut bacteria. When the R value is greater than or equal to -0.35 and less than 0.35, and the target gut bacteria are probiotics (with normal probiotic counts), it is recommended to maintain the pet's current diet. When the R-value is greater than or equal to 0.35 and less than 0.75, and the target gut microbiota is probiotic (probiotic count is high), further testing of the pet's gut microbiota is recommended; and When the R value is greater than or equal to 0.75, and the target gut microbiota is a probiotic (the number of probiotics is too high), it is recommended to further test the pet's gut microbiota.

[0057] When the target gut bacteria are non-probiotics: When the R value is less than -0.75 and the target gut microbiota is non-probiotic (the number of non-probiotics is too low), it is recommended to maintain the pet's diet. When the R value is greater than or equal to -0.75 and less than -0.35, and the target gut microbiota is non-probiotic (the number of non-probiotics is low), it is recommended to maintain the pet's diet. When the R value is greater than or equal to -0.35 and less than 0.35, and the target gut microbiota is non-probiotic (with normal non-probiotic count), it is recommended to maintain the pet's diet. When the R-value is greater than or equal to 0.35 and less than 0.75, and the target gut microbiota is non-probiotic (the number of non-probiotics is high), further testing of the pet's gut microbiota is recommended; and When the R value is greater than or equal to 0.75 and the target gut microbiota is non-probiotic (the number of non-probiotics is too high), it is recommended to further test the pet's gut microbiota or seek medical assistance regarding the pet's diet.

[0058] Steps (S4) to (S8) can be selectively repeated multiple times, with each step (S4) to (S8) targeting a different gut microbiota. In routine pet health care, target gut microbiota residing in the large intestine, small intestine, and duodenum (the junction of the gastrointestinal tract and small intestine) can be tested separately. Since a target gut microbiota is affected by the overall gut microbiota, a preliminary assessment of the overall gut microbiota health can be made by testing a single or a few species.

[0059] In addition, the process of the systematic evaluation method for the target intestinal flora of pets of the present invention can also be performed as shown in Figure 1B, and in addition to steps (S1) to (S8), further includes the following steps (S9) and (S10):

[0060] (S9) Convert the R value of the target gut microbiota into a disease-related risk index for that target gut microbiota: When the R value is greater than or equal to 0.35, and the target gut bacteria is a probiotic, the risk index of the target gut bacteria is the absolute value of R / 3; When the R value is less than 0.35 and the target gut bacteria is a probiotic, the risk index of the target gut bacteria is the absolute value of R. When the target gut microbiota is a non-probiotic, the risk index of the target gut microbiota is the absolute value of R.

[0061] (S10) The second phase of assessment of the pet's sub-health risk is conducted using the risk index of the target gut microbiota: When the risk index of the target gut microbiota is greater than or equal to 0 and less than 0.35, there is no risk of imbalance in the gut microbiota of the target gut microbiota in the pet. When the risk index of the target gut microbiota is greater than or equal to 0.35 and less than 0.65, the target gut microbiota has a low risk of imbalance in the pet's gut microbiota; and When the risk index of the target intestinal bacterium is greater than or equal to 0.65 and less than or equal to 1, the performance of the target intestinal bacterium in the pet's intestinal flora may be at high risk of imbalance.

[0062] [Example] [1]

[0063] A systematic evaluation was conducted on three probiotics—Lactobacillus acidophilus, B. lactis, and Streptococcus thermophilus—as target gut microbiota.

[0064] First, a fecal sample was obtained from a healthy 13-year-old male Pomeranian (weighing 4 kg). DNA was extracted from the fecal sample using the QIAGEN QIAamp DNA Mini Kit. Then, using the universal primer pair for the 16S rRNA gene and primer pairs for the three probiotics mentioned above (as shown in Table 1), the DNA sample was used as a template for a first real-time qPCR (targeting the 16S rRNA gene) and a second real-time qPCR (targeting the three probiotics respectively). The 16S cycle number threshold (Ct 16S) and the cycle number thresholds for the three probiotics (Ct Lactobacillus acidophilus, Ct Rettella betaecarpa, Ct Streptococcus thermophilus) were obtained, as shown in Table 1. The first and second real-time qPCRs were performed by first reacting at 50°C for 2 minutes, then at 95°C for 5 minutes, for amplification in 40 cycles. Each cycle included a 15-second denaturation reaction at 95°C and a 30-second adhesion and extension reaction at 60°C. After the reaction, the products were stored at 4°C.

[0065] Table 1 Introduction Ct value 16S rRNA Gene Forward induction TCCTACGGGAGGCAGCAGT (SEQ ID NO: 1) 11.46 (Ct 16S) Reverse inductor GGACTACCAGGGTATCTAATCCTGTT (SEQ ID NO: 2) Acid milk Acidobacterium Positive induction GATCGCATGATCAGCTTATA (SEQ ID NO: 3) 19.99 (Ct Lactobacillus acidophilus) Reverse introducing AGTCTTCTCAACTCGGCTATG (SEQ ID NO: 4) Rettella B Forward induction CCACATGATCGCATGTGATTG (SEQ ID NO: 5) 19.32 (Ct Rettella B) Reverse inlet CCGAAGGCTTGCTCCAAA (SEQ ID NO: 6) Streptococcus thermophilus Forward introductory term CCACTACAAGATGGACCTGC (SEQ ID NO: 7) 23.38 (Ct Streptococcus thermophilus) Reverse inlet CCGTTCTTGACTTACAACGA (SEQ ID NO: 8)

[0066] Then, the cycle number thresholds of the three probiotics were substituted into Formula I to calculate the proportion of bacterial count of the three probiotics. Next, the proportion of bacterial count of the three probiotics and the standard bacterial count (obtained from fecal samples of healthy dogs) were substituted into Formula II to calculate the relative error distance of the three probiotics. Then, the relative error distance of the three probiotics was substituted into Formula III to calculate the R value of the three probiotics. The first stage of the sub-health risk of the pet was then assessed, and the results are shown in Table 2, where ΔCt=(Ct target intestinal bacteria – Ct 16S).

[0067] Table 2 ΔCt Bacterial Count Measurement Ratio (1 / ΔCt) Relative error Difference distance R value Phase 1 Sub-health assessment Lactobacillus acidophilus 8.53 0.12 0.85 0.69 High Rettella B 7.86 0.13 0.42 0.39 High Streptococcus thermophilus 11.92 0.08 0.001 0.001 normal

[0068] In addition, the R values ​​of the three probiotics were converted into the risk index of the target intestinal bacteria. Since the three bacteria tested were all probiotics, the R values ​​of Lactobacillus acidophilus and Rettella leucocephala were greater than or equal to 0.35, so the risk index was |R / 3|; while the R value of Streptococcus thermophilus was less than 0.35, so the risk index was |R|. The second phase of the assessment of the pet's sub-health risk was carried out, and the results are shown in Table 3.

[0069] Table 3 strains Related diseases risk index Phase Two Sub-health assessment Lactobacillus acidophilus Oral cavity: such as tooth decay and periodontal disease 0.23 No risk of imbalance Liver: such as cholestatic liver disease Intestinal tract: such as antibiotic enteritis or colitis Rettella B Urinary tract: such as urinary tract infection 0.13 No risk of imbalance Lungs: such as pneumonia and lung infections Streptococcus thermophilus Gastrointestinal tract: such as gastritis or duodenal diseases 0.001 No risk of imbalance Intestinal tract: such as antibiotic enteritis or colitis

[0070] As shown in Table 3, after using reverse transcription quantitative polymerase chain reaction (real-time qPCR) to quantify the target intestinal bacteria using fecal samples from the test pets, and calculating the risk index of the target intestinal bacteria using formulas I to III, there was no risk of imbalance in the intestinal flora of the three target intestinal bacteria: Lactobacillus acidophilus, Rettella betaecarpa, and Streptococcus thermophilus.

[0071] [Example] [2]

[0072] As in Example 1, the target gut microbiota was analyzed, but the sample was initially obtained from a fecal sample of a healthy 8-year-old male mixed-breed cat (weighing 5.5 kg). The results of the first phase of evaluation are shown in Table 4. Since all three bacteria tested were probiotics and their R values ​​were all less than 0.35, their risk indices were all |R|. The results of the second phase of evaluation are shown in Table 5.

[0073] Table 4 ΔCt Bacterial Count Measurement Ratio (1 / ΔCt) Relative error Difference distance R value Phase 1 Sub-health assessment Lactobacillus acidophilus 21.52 0.05 0.001 0.001 normal Rettella B 12.73 0.08 0.001 0.001 normal Streptococcus thermophilus 21.73 0.05 0.001 0.001 normal

[0074] Table 5 strains Related diseases risk index Phase Two Sub-health assessment Lactobacillus acidophilus Oral cavity: such as tooth decay and periodontal disease 0.001 No risk of imbalance Liver: such as cholestatic liver disease Intestinal tract: such as antibiotic enteritis or colitis Rettella B Urinary tract: such as urinary tract infection 0.001 No risk of imbalance Lungs: such as pneumonia and lung infections Streptococcus thermophilus Gastrointestinal tract: such as gastritis or duodenal diseases 0.001 No risk of imbalance Intestinal tract: such as antibiotic enteritis or colitis

[0075] [Example] [3]

[0076] As in Example 1, the target gut microbiota was analyzed, but the sample was initially provided as a fecal sample from a 4-year-old female Himalayan cat (weighing 3.8 kg) suffering from kidney disease. The results of the first phase of assessment are shown in Table 6. The R value of Streptococcus thermophilus was greater than or equal to 0.35, so the risk index was |R / 3|; while the R values ​​of Lactobacillus acidophilus and Rettella leptospirae were less than 0.35, so the risk index was |R|. The results of the second phase of assessment are shown in Table 7.

[0077] Table 6 ΔCt Bacterial Count Measurement Ratio (1 / ΔCt) Relative error Difference distance R value Phase 1 Sub-health assessment Lactobacillus acidophilus 21.04 0.05 0.001 0.001 normal Rettella B -10.81 -0.09 -2.78 -0.99 Too low Streptococcus thermophilus 11.54 0.09 0.74 0.63 High

[0078] Table 7 strains Related diseases risk index Phase Two Sub-health assessment Lactobacillus acidophilus Oral cavity: such as tooth decay and periodontal disease 0.001 No risk of imbalance Liver: such as cholestatic liver disease Intestinal tract: such as antibiotic enteritis or colitis Rettella B Urinary tract: such as urinary tract infection 0.99 High risk of imbalance Lungs: such as pneumonia and lung infections Streptococcus thermophilus Gastrointestinal tract: such as gastritis or duodenal diseases 0.21 No risk of imbalance Intestinal tract: such as antibiotic enteritis or colitis

[0079] As shown in Examples 1-3, in the first stage of assessment, the values ​​of young and healthy pets (Example 2) were significantly better. In the first stage of assessment, some target gut bacteria values ​​were found to be deviated in older pets (Example 1) and pets with illnesses (Example 3). However, after the second stage of assessment, it can be further determined whether there is a risk of imbalance in the target gut bacteria. In Example 3, a high risk of imbalance was detected in Rhesperidone B, which corresponds to the condition of the tested pet suffering from kidney disease (an organ in the urinary system). This shows that the systematic assessment method in this case can indeed be applied to the sub-health risk assessment of pets.

[0080] Therefore, the systematic assessment method for target gut microbiota in pets provided by this invention can easily obtain the R-value and risk index of the target gut microbiota through multiple formula calculations and transformations using data obtained from real-time qPCR, enabling the assessment of sub-health risks in the first and second stages. Compared with traditional gut microbiota analysis, the systematic assessment method for pets provided by this invention is low-cost, easy to operate, and can provide relatively accurate results, making it suitable for daily health management and long-term gut health monitoring in pets.

[0081] none

[0082] none TWI930877B_114103520_SEQL.xml >

Claims

1. A systematic evaluation method for target gut microbiota in pets, comprising the following steps: (S1) providing a fecal sample from a pet; (S2) extracting a deoxyribonucleic acid (DNA) sample from the fecal sample; (S3) performing a first real-time quantitative polymerase chain reaction (RT-PCR) using a universal primer pair of the DNA sample and the 16S ribosomal RNA gene to determine the 16S cycle number threshold (Ct16S) of the DNA sample; (S4) performing a second real-time quantitative polymerase chain reaction (RT-PCR) using a primer pair of the DNA sample and a target gut microbiota to determine the cycle number threshold (Ct target gut microbiota) of the target gut microbiota in the DNA sample, wherein the target gut microbiota is a probiotic, and the probiotic includes Lactobacillus acidophilus, Bifidobacterium lactis, and Streptococcus thermophilus; (S5) Substituting the 16S cycle number threshold and the target intestinal bacteria cycle number threshold into Formula I, the target intestinal bacteria quantity measurement ratio is calculated: Quantity measurement ratio = [1 / (Ct target intestinal bacteria – Ct16S)] Formula I; (S6) Substituting the target intestinal bacteria quantity measurement ratio and the standard value into Formula II, the relative error distance of the target intestinal bacteria is calculated: Relative error distance = [(Quantity measurement ratio – Standard value) / Standard value] Formula II; (S7) Substituting the relative error distance of the target intestinal bacteria into x in Formula III, the R value of the target intestinal bacteria is calculated: R value = tanh x = [(e²x-1) / (e²x+1)] Formula III; and (S8) The first-stage assessment of the pet's sub-health risk is conducted using the R value of the target intestinal bacteria: When the R value is less than -0.75, the quantity of the target gut bacteria is too low, and it is recommended to supplement the target gut bacteria and further test the pet's gut microbiota; when the R value is greater than or equal to -0.75 and less than -0.35, the quantity of the target gut bacteria is low, and it is recommended to supplement the target gut bacteria; when the R value is greater than or equal to -0.35 and less than 0.35, the quantity of the target gut bacteria is normal, and it is recommended to maintain the pet's diet; when the R value is greater than or equal to 0.35 and less than 0.75, the quantity of the target gut bacteria is high, and it is recommended to further test the pet's gut microbiota; and when the R value is greater than or equal to 0.75, the quantity of the target gut bacteria is too high, and it is recommended to further test the pet's gut microbiota. The bacterial count standard value is the bacterial count measurement ratio obtained after performing steps (S1)-(S5) of the method of the present invention on pets with no disease record and no abnormal symptoms; if the number of pets with no disease record and no abnormal symptoms is multiple, the bacterial count standard value is the average or median of the bacterial count measurement ratio values ​​obtained from them.

2. The assessment method as described in claim 1 further includes the following steps: (S9) converting the R value of the target gut microbiota into a risk index of the target gut microbiota: when the R value is greater than or equal to 0.35, the risk index of the target gut microbiota is the absolute value of R / 3; and when the R value is less than 0.35, the risk index of the target gut microbiota is the absolute value of R; and (S10) conducting a second-stage assessment of the pet's sub-health risk using the risk index of the target gut microbiota: when the risk index of the target gut microbiota is greater than or equal to 0 and less than 0.35, there is no risk of imbalance in the performance of the target gut microbiota in the pet's gut microbiota, and it is recommended to maintain the pet's diet; When the risk index of the target gut microbiota is greater than or equal to 0.35 and less than 0.65, the target gut microbiota has a low risk of imbalance in the pet's gut microbiota, and it is recommended to adjust the pet's diet; and when the risk index of the target gut microbiota is greater than or equal to 0.65 and less than or equal to 1, the target gut microbiota has a high risk of imbalance in the pet's gut microbiota, and it is recommended to seek medical assistance regarding the pet's diet.

3. The evaluation method as described in claim 1, wherein steps (S4) to (S8) are repeated multiple times, and each step (S4) to (S8) is performed for a different target gut microbiota.

4. The evaluation method as described in claim 2, wherein steps (S4) to (S9) are repeated multiple times, and each step (S4) to (S9) is performed for a different target gut microbiota.

5. The evaluation method as described in claim 1 or 2, wherein the pet is a dog or a cat.

6. The assessment method as described in claim 2, wherein the risk of imbalance of the target gut microbiota in the pet's gut microbiota is positively correlated with the risk of developing a disease selected from a group consisting of oral diseases, liver diseases, urinary tract diseases, lung diseases, gastric and duodenal diseases, and large and small intestinal diseases.

Images