Uses of platelet exosome solution

TW202633678AActive Publication Date: 2026-08-16BIONET THERAPEUTICS CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
TW114105355
Authority / Receiving Office
TW · TW
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-02-13
Publication Date
2026-08-16
Estimated Expiration
2045-02-12

AI Technical Summary

Technical Problem

There is a demand in the market for products that can improve both internal health and external appearance, particularly focusing on skin and hair health, but existing solutions are inadequate in providing comprehensive benefits.

Method used

A platelet exosome solution with specific concentrations of insulin-like growth factor 1 (IGF-1), platelet-derived growth factor-BB (PDGF-BB), and platelet exosomes, along with microRNA, is developed to enhance skin care, promote hair growth, and provide anti-inflammatory effects.

Benefits of technology

The solution effectively promotes skin repair, hair growth, and reduces inflammation, addressing the dual needs of internal health and external appearance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

This invention provides a platelet exosome solution with a concentration of insulin-like growth factor 1 of 15 pg / ml to 1550 pg / ml; a concentration of platelet-derived growth factor-BB of 230 pg / ml to 23500 pg / ml; and a concentration of platelet exosomes of 1×10¹⁰ particles / ml to 1×10¹⁴ particles / ml. This invention also provides a method for preparing the platelet exosome solution, its pharmaceutical uses, and the resulting product. The platelet exosome solution of this invention has skin care, wound healing promotion, hair growth promotion, and anti-inflammatory effects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a platelet exosome solution. This invention also relates to a method for preparing a platelet exosome solution, its pharmaceutical uses, and the product thereof. Prior Technology

[0002] With the development of science, technology, and the economy, Chinese people are paying increasing attention to their physical health. At the same time, social activities are becoming more frequent, and since appearance is the face of one's personal image, both inner physical health and outward appearance are valued equally in modern life.

[0003] Since the internal health of skin and hair directly affects an individual's external appearance, maintaining healthy skin and hair can effectively maintain a healthy image and even highlight a youthful and energetic appearance, which is beneficial for social activities and improving quality of life. Therefore, products that can simultaneously improve both internal health and external appearance are in high demand in the market. Summary of the Invention

[0004] To meet the aforementioned market demand, this invention provides a platelet exosome solution with an insulin-like growth factor 1 (IGF-1) concentration of 15 pg / ml to 1550 pg / ml; a platelet-derived growth factor-BB (PDGF-BB) concentration of 230 pg / ml to 23500 pg / ml; and a platelet exosome concentration of 1×10¹⁰ particles / ml (EV / ml) ​​to 1×10¹⁴ EV / ml.

[0005] The platelet exosome solution of this invention has a high concentration of platelet exosomes, and also has high concentrations of insulin-like growth factor 1 and platelet-derived growth factor-BB. Furthermore, the platelet exosome solution of this invention has skin care, hair growth promotion, and anti-inflammatory effects. Finally, the concentration range covers the potential concentration range after concentration, dilution, or other adjustments of individual components during the commercialization stage, and the lower limit of the concentration range corresponds to the effective concentration.

[0006] In one embodiment, the platelet exosomes are secreted from platelets. Preferably, the platelets are isolated from peripheral blood of an adult. More preferably, the adult is a healthy volunteer.

[0007] In one embodiment, the platelet exosome solution contains plasma.

[0008] In one embodiment, the platelet exosomes contain small molecule ribonucleic acid (microRNA, miRNA).

[0009] In one embodiment, the miRNA is selected from the group consisting of hsa-let-7c-5p, hsa-miR-100-5p, hsa-miR-1246, hsa-miR-125b-5p, hsa-miR-126-3p, hsa-miR-145-5p, hsa-miR-15a-5p, hsa-miR-192-5p, hsa-miR-19b-3p, hsa-miR-21-5p, hsa-miR-221-3p, hsa-miR-23a-5p, hsa-miR-24-3p, hsa-miR-29a, hsa-miR-31-5p, hsa-miR-3665, hsa-miR-663a, and hsa-miR-762, which can further promote the skin repair effect.

[0010] In one embodiment, the miRNA is selected from the group consisting of hsa-miR-103a-3p, hsa-miR-107, hsa-miR-125b-5p, hsa-miR-130b-3p, hsa-miR-140-5p, hsa-miR-146a-5p, hsa-miR-181a-5p, hsa-miR-195-5p, hsa-miR-19a-3p, hsa-miR-20a-5p, hsa-miR-22-3p, hsa-miR-22-5p, hsa-miR-335-5p, hsa-miR-371b-5p, hsa-miR-433-3p, and hsa-miR-493-3p, which can further promote hair growth.

[0011] In one embodiment, the miRNA is selected from hsa-let-7b, hsa-let-7i-5p, hsa-miR-125b-5p, hsa-miR-142-5p, hsa-miR-145, hsa-miR-146a-5p, hsa-miR-150-3p, hsa-miR-155, hsa-miR-155-5p, hsa-miR-15a, hsa-miR-17-5p, hsa-miR-181b-5p, hsa-miR-182, hsa-miR-183-5p, hsa-miR-186, hsa-miR-18a-3p, and hsa-miR-19a-3p. The group consisting of hsa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-21-5p, hsa-miR-222-3p, hsa-miR-223, hsa-miR-23a, hsa-miR-23a-3p, hsa-miR-24-2, hsa-miR-26b-5p, hsa-miR-29a, hsa-miR-29a-3p, hsa-miR-30b, hsa-miR-31-5p, hsa-miR-326, hsa-miR-330-3p, hsa-miR-424, and hsa-miR-744-5p can further enhance the anti-inflammatory effect.

[0012] In one embodiment, the concentration of insulin-like growth factor 1 is from 150 pg / ml to 310 pg / ml. Preferably, the concentration of insulin-like growth factor 1 is from 200 pg / ml to 270 pg / ml. More preferably, the concentration of insulin-like growth factor 1 is from 220 pg / ml to 250 pg / ml.

[0013] In one embodiment, the concentration of platelet-derived growth factor-BB is from 2300 pg / ml to 4700 pg / ml. Preferably, the concentration of platelet-derived growth factor-BB is from 2500 pg / ml to 4300 pg / ml. More preferably, the concentration of platelet-derived growth factor-BB is from 3200 pg / ml to 3600 pg / ml.

[0014] In one embodiment, the concentration of platelet exosomes is from 1 × 10¹¹ particles / mL (EV / mL) to 1 × 10¹³ EV / mL. Preferably, the concentration of platelet exosomes is from 4 × 10¹¹ EV / mL to 6 × 10¹² EV / mL. More preferably, the concentration of platelet exosomes is from 5 × 10¹¹ EV / mL to 5 × 10¹² EV / mL.

[0015] In one embodiment, the concentration of insulin-like growth factor 1 in the platelet exosome solution is from 15 pg / ml to 310 pg / ml, for example: 15 pg / ml, 50 pg / ml, 100 pg / ml, 150 pg / ml, 200 pg / ml, 250 pg / ml, 300 pg / ml, or 310 pg / ml; and the concentration of platelet-derived growth factor-BB is from 230 pg / ml to 4700 pg / ml, for example: 230 pg / ml, 500 pg / ml, 1000 pg / ml, 1500 pg / ml, 2000 pg / ml, 2500 pg / ml, 3000 pg / ml, 3500 pg / ml, 4000 pg / ml, 4500 pg / ml, or 4700 pg / ml. The platelet exosome concentration is from 1×10¹⁰ particles / mL (EV / mL) to 1×10¹³ EV / mL, for example: 1×10¹⁰ EV / mL, 5×10¹⁰ EV / mL, 1×10¹¹ EV / mL, 5×10¹¹ EV / mL, 1×10¹² EV / mL, 5×10¹² EV / mL, or 1×10¹³ EV / mL. Preferably, the platelet exosome solution contains insulin-like growth factor 1 at a concentration of 20 pg / mL to 27 pg / mL; platelet-derived growth factor-BB at a concentration of 300 pg / mL to 380 pg / mL; and platelet exosome concentrations from 9×10¹⁰ particles / mL (EV / mL) to 1.5×10¹¹ EV / mL.

[0016] In one embodiment, the median particle size of the platelet exosomes is 50 nm to 200 nm. Preferably, the median particle size of the platelet exosomes is 100 nm to 115 nm. More preferably, the median particle size of the platelet exosomes is 105 nm to 110 nm.

[0017] In one embodiment, based on the total number of platelet exosomes contained in the platelet exosome solution, the proportion of platelet exosomes falling within the 50 nm to 200 nm range is 90% to 93%. Preferably, based on the total number of platelet exosomes contained in the platelet exosome solution, the proportion of platelet exosomes falling within the 50 nm to 200 nm range is 91.4% to 92%.

[0018] The present invention further provides a product comprising the platelet exosome solution, wherein the concentration of insulin-like growth factor 1 is from 15 pg / ml to 310 pg / ml; the concentration of platelet-derived growth factor-BB is from 230 pg / ml to 4700 pg / ml; and the concentration of platelet exosomes is from 1×10¹⁰ particles / ml (EV / ml) ​​to 1×10¹³ EV / ml. Preferably, the concentration of insulin-like growth factor 1 is from 20 pg / ml to 27 pg / ml; the concentration of platelet-derived growth factor-BB is from 300 pg / ml to 380 pg / ml; and the concentration of platelet exosomes is from 9×10¹⁰ particles / ml (EV / ml) ​​to 1.5×10¹¹ EV / ml.

[0019] According to the present invention, the concentration range enables the product to have skin care, wound healing promotion, hair growth promotion and anti-inflammatory effects, that is, the effective concentration to exhibit skin care, wound healing promotion, hair growth promotion and anti-inflammatory effects.

[0020] In one embodiment, the product further comprises an exosome isoosmotic agent. Preferably, the exosome isoosmotic agent may be a solution or a gel.

[0021] In one embodiment, the exosome isoosmotic agent comprises physiological saline, phosphate-buffered saline, cell culture medium, glucose aqueous solution, or other suitable liquids or mixtures thereof known to those skilled in the art, for the preparation and preservation of exosomes.

[0022] In one embodiment, the cell culture medium comprises a minimum required culture medium or a complete culture medium.

[0023] In one embodiment, the pH of the product is 7.0 to 8.6. Preferably, the pH of the product is 7.5 to 8.5.

[0024] This invention also provides the use of a platelet exosome solution in the preparation of a skin care product. Preferably, the skin care product contains insulin-like growth factor 1 at a concentration of 15 pg / ml to 310 pg / ml; platelet-derived growth factor-BB at a concentration of 230 pg / ml to 4700 pg / ml; and platelet exosomes at a concentration of 1 × 10¹⁰ particles / ml (EV / ml) ​​to 1 × 10¹³ EV / ml. More preferably, the skin care product further comprises the exosome isoosmolar agent.

[0025] In one embodiment, the skin care includes either or a combination of promoting dermal fibroblast proliferation and promoting collagen production.

[0026] In one embodiment, the dermal fibroblasts are human dermal fibroblasts.

[0027] In one embodiment, promoting collagen production includes increasing collagen content. Preferably, promoting collagen production includes increasing the collagen content in the skin.

[0028] In one embodiment, the skin comprises the dermis.

[0029] In one embodiment, the collagen comprises type I collagen.

[0030] In one embodiment, the product comprises a pharmaceutical product or a cosmetic product. In another embodiment, the cosmetic product comprises a general cosmetic product or a medicated cosmetic product.

[0031] This invention also provides the use of a platelet exosome solution in the preparation of a wound-healing agent. Preferably, the wound-healing agent contains an insulin-like growth factor 1 concentration of 15 pg / ml to 310 pg / ml; a platelet-derived growth factor-BB concentration of 230 pg / ml to 4700 pg / ml; and a platelet exosome concentration of 1 × 10¹⁰ particles / ml (EV / ml) ​​to 1 × 10¹³ EV / ml. More preferably, the wound-healing agent further comprises the exosome isoosmolar agent.

[0032] This invention also provides the use of a platelet exosome solution in the preparation of a hair growth promoting drug. Preferably, the concentration of insulin-like growth factor 1 in the hair growth promoting drug is from 15 pg / ml to 310 pg / ml; the concentration of platelet-derived growth factor-BB is from 230 pg / ml to 4700 pg / ml; and the concentration of platelet exosomes is from 1 × 10¹⁰ particles / ml (EV / ml) ​​to 1 × 10¹³ EV / ml. More preferably, the hair growth promoting drug further comprises the exosome isoosmolar agent.

[0033] In one embodiment, the promotion of hair growth includes any or a combination of increasing hair volume, preventing hair loss, and treating hair loss.

[0034] Preferably, the increase in hair volume includes increasing the number of hair follicles in the growth phase.

[0035] In one embodiment, the hair loss includes baldness.

[0036] In one embodiment, the promotion of hair growth includes promoting the proliferation of either or a combination of follicular mesenchymal stem cells and follicular dermal papillary cells in the hair follicle.

[0037] In one embodiment, the hair growth promotion includes enhancing the expression of the gene (VCAN) for chondroitin sulfate proteoglycan molecules in hair follicle cells.

[0038] Hair follicles in the growth phase will have highly expressed chondroitin sulfate proteoglycan molecules in hair follicle cells. Therefore, the present invention enhances the expression of the VCAN gene, which helps to keep hair follicles in the growth phase and promotes hair growth.

[0039] Preferably, the hair follicle cells include healthy hair follicle cells or damaged hair follicle cells. More preferably, the healthy hair follicle cells refer to those whose hair follicle growth phase falls within the normal time range, for example: the hair follicle growth phase of the scalp is 2 to 6 years, and the growth phase of eyelashes is 2 to 3 months, etc. The damaged hair follicle cells refer to those whose hair follicle growth phase is shorter than the normal time range.

[0040] This invention further provides the use of a platelet exosome solution in the preparation of a medicament for the prevention, treatment, or alleviation of inflammatory diseases. Preferably, the concentration of insulin-like growth factor 1 in the medicament for the prevention, treatment, or alleviation of inflammatory diseases is from 15 pg / ml to 310 pg / ml; the concentration of platelet-derived growth factor-BB is from 230 pg / ml to 4700 pg / ml; and the concentration of platelet exosomes is from 1 × 10¹⁰ particles / ml (EV / ml) ​​to 1 × 10¹³ EV / ml. More preferably, the medicament for the prevention, treatment, or alleviation of inflammatory diseases further comprises the exosome isoosmolar agent.

[0041] Preferably, the inflammatory disease includes rheumatoid arthritis.

[0042] The platelet exosome solution of this invention can reduce the content of interferon-γ induced by phytohemagglutinin, which can treat or alleviate chronic inflammation in the body and can be used to treat rheumatoid arthritis.

[0043] This invention also provides a method for preparing a platelet exosome solution, comprising: First centrifugation step: Centrifuge a separated blood sample to obtain a first layered solution, wherein the layered solution comprises a plasma layer and a red blood cell layer. The second centrifugation step involves centrifuging the plasma layer to obtain a second layered solution, which comprises a supernatant layer and a platelet layer. Suspension step: A portion of the supernatant layer is mixed with the platelet layer to obtain a platelet suspension; Freeze-thaw cycling step: After freezing and thawing the platelet suspension, it is mixed with the remaining supernatant layer to obtain a crude platelet exosome solution; and Filtration step: Filter the crude platelet exosome solution to obtain the platelet exosome solution.

[0044] In one embodiment, the separated blood contains an anticoagulant. Preferably, the anticoagulant comprises citrate-phosphate-dextrose-adenine (CPDA-1).

[0045] In one embodiment, the separated blood is contained in a JMS blood bag.

[0046] In one embodiment, the centrifugal force of the first centrifugation step is 200×g to 500×g, and the centrifugation time is 7 to 30 minutes. Preferably, the centrifugal force of the first centrifugation step is 210×g to 250×g, and the centrifugation time is 8 to 12 minutes.

[0047] In one embodiment, the centrifugal force of the second centrifugation step is from 1000×g to 4000×g, and the centrifugation time is from 7 to 30 minutes. Preferably, the centrifugal force of the second centrifugation step is from 2200×g to 2500×g, and the centrifugation time is from 8 to 12 minutes.

[0048] In one embodiment, during the suspension step, the volume of the partial supernatant layer is 25% to 40% of the total volume of the supernatant layer. Preferably, the volume of the partial supernatant layer is 30% to 35% of the total volume of the supernatant layer.

[0049] In one embodiment, the freeze-thaw cycle step involves 2 to 5 freeze-thaw cycles. Preferably, the number of freeze-thaw cycles is 2 to 4. [ ]

[0050] In one embodiment, the freeze-thaw cycle includes a freezing step and a thawing step; wherein the temperature of the freezing step is below 0°C and the temperature of the thawing step is above 30°C.

[0051] Preferably, the temperature of the freezing step is -30°C to -90°C. More preferably, the temperature of the freezing step is -78°C to -82°C.

[0052] Preferably, the temperature of the thawing step is 30°C to 42°C. More preferably, the temperature of the freezing step is 35°C to 39°C.

[0053] Preferably, the thawing step is performed by thawing in a water bath.

[0054] In one embodiment, during the filtration step, the filtration employs a filtration device with a pore size of 0.1 micrometers to 0.5 micrometers. Preferably, the pore size of the filtration device is 0.15 micrometers to 0.25 micrometers.

[0055] According to the present invention, compared with undisturbed platelets, the method of the present invention destroys platelets to collect platelet exosomes, which can effectively increase the concentration of insulin-like growth factor 1 and platelet-derived growth factor-BB in the platelet exosome solution.

[0056] The platelet exosome solution and its products of this invention have the effects of skin care, promoting wound healing, promoting hair growth and anti-inflammation, which can help meet the needs of modern people for both internal health and external appearance. Simple Explanation of the Diagram

[0057] Figure 1 is a bar graph showing the concentration of insulin-like growth factor 1 in the platelet exosome solution of Example 1. Figure 2 is a bar graph showing the concentration of platelet-derived growth factor-BB in the platelet exosome solution of Example 1. Figure 3 is a bar graph comparing the concentrations of insulin-like growth factor 1 in the platelet exosome solution of Example 1 and the platelet concentrate of Comparative Example 1. Figure 4 is a bar graph comparing the concentrations of platelet exosome solution from Example 1 and insulin-like growth factor 1 (e.g., platelet-derived growth factor-BB) from Comparative Example 1. Figure 5 is a bar chart comparing the cell proliferation rates of each group in the fibroblast proliferation assay. Figure 6 is a bar chart comparing the relative content of type I collagen in each group during the type I collagen increment test. Figure 7 shows a comparison of the healing status of each group in the cell-free area (i.e., the wound site) in the wound healing test. Figure 8 is a bar chart comparing the cell proliferation rates of different groups in the human hair follicle dermal papillary cell proliferation assay. Figure 9 is a bar chart comparing the relative gene expression levels in the gene expression test of the germinal factor (VCAN). Figure 10 is a bar chart comparing the levels of human interferon-γ in each group during the anti-inflammatory trial. Implementation

[0058] The following provides several operating methods to illustrate the implementation of the present invention; those skilled in the art can easily understand the advantages and effects of the present invention through the contents of this specification, and can make various modifications and changes without departing from the spirit of the present invention to implement or apply the contents of the present invention.

[0059] Preparation example: Platelet exosome solution

[0060] Human whole blood isolated from a donor (i.e., adult peripheral blood from a "Jess" blood bag containing an anticoagulant, namely citrate-phosphate-dextrose-adenine (CPDA-1)) is centrifuged at 230×g for 10 minutes to obtain a first layered solution containing a plasma layer and a erythrocyte layer. The plasma layer is then removed and centrifuged at 2330×g for 10 minutes to obtain a second layered solution containing a supernatant layer and a platelet layer. The supernatant layer (i.e., a platelet-rich solution) is removed. Furthermore, one-third of the volume of the platelet-rich solution is mixed with the blood... Platelet-rich plasma is mixed to obtain a platelet suspension, i.e., platelet concentrate. Therefore, each whole blood sample yields one platelet dilute solution and one platelet concentrate, with a volume ratio of approximately 2:1. The platelet concentrate is subjected to three freeze-thaw cycles (placed at -80°C until frozen, and then in a 37°C water bath until liquid) to rupture the platelets. This concentrate is then mixed with the remaining platelet dilute solution to obtain a crude platelet exosome solution. The crude platelet exosome solution is filtered through a 0.22-micron filter to remove cell debris and microorganisms, yielding the platelet exosome solution (suspended in plasma), which is stored at 4°C for later use.

[0061] Analysis 1: Quantitative analysis of insulin-like growth factor 1 (IGF-1)

[0062] This analysis used an IGF-1 ELISA (#ELH-IGF1, purchased from RayBiotech) to detect the protein content of IGF-1. The procedure is as follows:

[0063] Standards: Add 400 μL of 1-fold dilution buffer B to an IGF-1 standard protein vial to obtain a 100 ng / ml IGF-1 standard. Add 150 μL of the IGF-1 standard to 350 μL of 1-fold dilution buffer B to obtain a 30 ng / ml standard solution. Perform a 2.5-fold serial dilution to a minimum concentration of 0.123 ng / ml, and use 1-fold dilution buffer B (0 ng / ml) as a standard solution with a zero IGF-1 protein concentration. Both the dilution buffers and the IGF-1 standard protein vials are provided by the IGF-1 ELISA kit.

[0064] Example 1: Platelet exosome solution: 200 μL of Triton-X 100 and 200 μL of platelet exosome solution were mixed evenly and reacted at room temperature for 30 minutes. Then, the mixture was diluted with 400 μL of diluent B to obtain a test sample.

[0065] Add 100 μL each of standard solutions of different concentrations and the test samples to a 96-well plate, and react with the plate gently agitated at room temperature for 2.5 hours; the test samples are in triplicate. After removing the solution, wash four times with 300 μL of 1x wash buffer; after the last wash, remove all remaining wash buffer. Add 100 μL of IGF-1 antibody solution to each well, and react with the 96-well plate gently agitated at room temperature for 1 hour. After removing the solution, wash four times with 300 μL of 1x wash buffer; after the last wash, remove all remaining wash buffer. Add 100 μL of horseradish peroxidase-streptavidin (HRP-Streptavidin) solution, and react with the 96-well plate gently agitated at room temperature for 45 minutes. After removing the solution, wash four times with 300 μL of 1x wash buffer; after the last wash, remove all remaining wash buffer. Add 100 μL of 3,3',5,5'-tetramethylbenzidine (TMB) colorimetric solution and allow the 96-well plate to react gently in the dark at room temperature for 30 minutes. Add 50 μL of stop solution to stop the colorimetric reaction, and immediately use a microplate analyzer (ELISA reader) to obtain the OD450 reading (absorbance value) at a wavelength of 450 nm. Based on the concentrations of each standard solution and the average absorbance value, obtain the equation for the linear regression line and the R-squared value. Then, calculate the average concentration of IGF-1 in the platelet exosome solution of Example 1 based on the equation and the dilution ratio. The results are shown in Figure 1.

[0066] As shown in Figure 1, the average concentration of IGF-1 in the platelet exosome solution of Example 1 was approximately 235 pg / ml.

[0067] Analysis 2: Quantitative analysis of platelet-derived growth factor-BB (PDGF-BB)

[0068] This analysis used the PDGF-BB ELISA (#DBB00, purchased from R&D Systems) to detect the protein content of PDGF-BB. The procedure is as follows:

[0069] Standards: Distilled water was added to the PDGF-BB standard protein vial to obtain a PDGF-BB standard of 20,000 pg / ml. 100 μL of the PDGF-BB standard was added to 900 μL of calibration diluent RD5K to obtain a standard solution of 2000 pg / ml. The standard solution was serially diluted 2-fold until a minimum concentration of 31.3 pg / ml was achieved. A separate standard solution with a PDGF-BB protein concentration of 0 pg / ml was prepared using calibration diluent RD5K. Both the PDGF-BB standard protein vial and the calibration diluent RD5K were provided by the PDGF-BB ELISA kit.

[0070] Example 1: Platelet exosome solution: 200 μL of Triton-X 100 and 200 μL of platelet exosome solution were mixed evenly and reacted at room temperature for 30 minutes. Then, the mixture was diluted with 1600 μL of calibration diluent RD5K to obtain a test sample.

[0071] Add 100 μL each of standard solutions of different concentrations and the test samples to a 96-well plate, then add 100 μL of assay diluent RD1X to each well, and gently shake the 96-well plate at room temperature for 2 hours; the test samples are in triplicate. After removing the solution, wash four times with 300 μL of 1x wash buffer; after the last wash, remove all remaining wash buffer. Add 200 μL of co-antibody solution to each well, and gently shake the 96-well plate at room temperature for 1.5 hours. After removing the solution, wash four times with 300 μL of 1x wash buffer; after the last wash, remove all remaining wash buffer. Add 200 μL of acceptor solution, and gently shake the 96-well plate in the dark at room temperature for 30 minutes to develop the colorimetric reaction. Add 50 μL of stop solution to stop the colorimetric reaction, and immediately use a microplate analyzer to obtain the OD450 reading (absorbance value) at a wavelength of 450 nm. The equation for the linear regression line and the R-squared value were obtained based on the concentration and average absorbance of each standard solution. Then, the average concentration of PDGF-BB in the platelet exosome solution of Example 1 was calculated based on the equation and the dilution ratio. The results are shown in Figure 2.

[0072] As shown in Figure 2, the average concentration of PDGF-BB in the platelet exosome solution of Example 1 was approximately 3394 pg / ml.

[0073] Analysis 3: Particle size analysis of platelet exosomes

[0074] This analysis used a nanoparticle tracking analysis (NTA) system to analyze the particle size of the platelet exosome solution from Example 1. The procedures are described below:

[0075] The NTA system was calibrated using calibration standard beads. The platelet exosome solution from Example 1 was diluted with phosphate-buffered saline (PBS) until the number of particles in each field of view was approximately 50 to 300, thus obtaining a diluted sample. The diluted sample was injected into the nanoparticle tracking analyzer, taking care to avoid air bubbles and ensure uniform particle distribution. The NTA software was started and the dilution factor was entered. Brownian motion of nanoparticles in different fields of view was tracked to collect data. After analysis, a particle distribution map was obtained to further determine the exosome concentration, median particle size, and purity of exosomes with particle sizes falling within the 50 nm to 200 nm range in the platelet exosome solution from Example 1. After three replicate measurements, the average values ​​were calculated, and the results are shown in Table 1.

[0076] Table 1: Median concentration and particle size of exosomes in platelet exosome solutions from Example 1, and purity of exosomes with particle sizes falling within the range of 50 nm to 200 nm. project Measured values Exosome concentration 1.2 × 10¹² capsules / ml (EV / ml) median particle size 107.9 nanometers Purity of exosomes with particle sizes falling within the range of 50 nanometers to 200 nanometers 91.7%

[0077] As shown in Table 1, in the platelet exosome solution of Example 1, the concentration of exosomes was 1.2 × 10¹² particles / mL, the median particle size was 107.9 nm, and the purity of exosomes with particle sizes falling within the range of 50 nm to 200 nm was 91%. That is, the concentration of exosomes with particle sizes falling within the range of 50 nm to 200 nm was 1.2 × 10¹² particles / mL × 91.7% = 1.1 × 10¹² particles / mL.

[0078] Analysis 4: Comparison of Insulin-like Growth Factor 1 Content

[0079] This analysis includes the platelet exosome solution of Example 1 and the platelet concentrate of Comparative Example 1. The preparation method of the platelet concentrate of Comparative Example 1 is described below: Human whole blood isolated from a donor (i.e., adult peripheral blood in a blood bag containing an anticoagulant) was centrifuged at 230 × g for 10 minutes to obtain a first layered solution containing a plasma layer and a erythrocyte layer. The plasma layer was removed and centrifuged at 2330 × g for 10 minutes to obtain a second layered solution containing a supernatant layer and a platelet layer. The supernatant layer was removed, and the platelet layer was resuspended in PBS to obtain a platelet suspension. The platelet suspension was then subjected to three freeze-thaw cycles to rupture the platelets before mixing to obtain a crude platelet concentrate. The crude platelet concentrate was filtered through a filter with a pore size of 0.22 micrometers to remove cell debris and microorganisms, thereby obtaining a platelet concentrate; wherein, the volume of the platelet concentrate of Comparative Example 1 prepared from the same volume of human whole blood was the same as the volume of the platelet exosome solution of Example 1.

[0080] This analysis quantifies the IGF-1 concentration in the platelet exosome solution of Example 1 and the platelet concentrate of Comparative Example 1 according to the steps shown in Analysis 1, with the platelet concentrate of Comparative Example 1 as the 100% baseline. The results are shown in Figure 3.

[0081] As shown in Figure 3, the IGF-1 concentration in the platelet exosome solution of Example 1 is approximately 6.9 times that of the platelet concentrate of Comparative Example 1. It can be seen that, compared to the platelet concentrate of Comparative Example 1, the present invention retains plasma to obtain "platelet exosomes," resulting in a significantly higher IGF-1 concentration in the platelet exosome solution.

[0082] Analysis 5: Comparison of Platelet-Derived Growth Factor-BB Content

[0083] This analysis included the platelet exosome solution of Example 1 and the platelet concentrate of Comparative Example 1. The PDGF-BB concentration in the platelet exosome solution of Example 1 and the platelet concentrate of Comparative Example 1 were quantified according to the steps shown in Analysis 2. The platelet concentrate of Comparative Example 1 was used as 100% as the baseline. The results are shown in Figure 4.

[0084] As shown in Figure 4, the PDGF-BB concentration of the platelet exosome solution in Example 1 is approximately 2.4 times that of the platelet concentrate in Comparative Example 1. It can be seen that, compared to the platelet concentrate in Comparative Example 1, the present invention retains plasma to obtain "platelet exosomes," resulting in a significantly higher PDGF-BB concentration in the platelet exosome solution.

[0085] Test 1: Fibroblast proliferation test

[0086] This test involved adding different test solutions during the culture of Normal human dermal fibroblasts (NHDF) to analyze the effect of the test solutions on promoting NHDF proliferation. The cells were divided into three groups: (1) Control group: Minimum Essential Medium α (α-MEM), cat#41061037, purchased from Gibco; (2) Comparative Example 2: α-MEM medium supplemented with platelet concentrate from Comparative Example 1, with a concentration of 10% (v / v%); and (3) Example 2: α-MEM medium supplemented with platelet exosome solution from Example 1, with a concentration of 10% (v / v%). The experimental procedures are described below.

[0087] Quantitatively quantified NHDF cells (purchased from BCRC) were suspended in complete culture medium to obtain a cell solution with a concentration of 2 x 10⁴ cells / mL. The complete culture medium contained 5 vol% human platelet lysis buffer (trade name: UltraGROTM-Advanced, purchased from: AventaCell), 1 vol% L-glutamine, 1 vol% non-essential amino acids (cat#11140050, Gibco), 1 vol% sodium pyruvate, 1 vol% penicillin-streptomycin, and the balance being Minimum Essential Medium α (α-MEM) (cat#41061037, Gibco).

[0088] NHDF cells were seeded at a rate of 2 x 10³ cells / 0.1 mL per well in 96-well cell culture dishes and cultured at a constant temperature of 37°C and 5% CO2 for 48 hours. The supernatant was then removed. After washing the NHDF cells with 0.3 mL of Durbecco's Phosphate-Buffered Saline (DPBS) (Cat# 14190144, Gibco) per well, 0.1 mL of test solution was added to each well for each group. After further culturing in a cell culture incubator for 72 hours, the supernatant was removed. The NHDF cells were then washed with 0.3 mL of DPBS per well, and 0.1 mL of MTS working solution (containing 20 μL of MTS stock solution and 100 μL of α-MEM) was added to each well. The cells were then incubated in a cell culture incubator for 3 hours. The OD490 value of optical density (OD) at a wavelength of 490 nanometers (nm) was obtained using a microplate analyzer (ELISA reader). The cell proliferation rate of the remaining groups was calculated using the OD490 value of the control group (i.e., the cell proliferation rate of the control group was 100%) as a baseline. The formula was: Cell proliferation rate (%) = (OD490 value of the treatment group / OD490 value of the control group) × 100%. The results are shown in Figure 5.

[0089] As shown in Figure 5, the platelet exosome solution of Example 1 can increase the cell proliferation rate of NHDF cells by 200%, which is significantly higher than that of the platelet concentrate of Comparative Example 1. This indicates that the platelet exosome solution of Example 1 has a significantly better effect on promoting fibroblast cell proliferation, which is beneficial for skin care.

[0090] Test 2: Type I Collagen Increment Test

[0091] In this test case, different test solutions were added during the NHDF cell culture process, and the supernatant was collected to analyze the effect of the test solutions on promoting the secretion of type I collagen by NHDF cells. The cells were divided into three groups: (1) Control group: Minimum Essential Medium α (α-MEM), cat#41061037, purchased from Gibco; (2) Comparative Example 2: α-MEM medium supplemented with platelet concentrate from Comparative Example 1, with a concentration of 10% by volume; and (3) Example 2: α-MEM medium supplemented with platelet exosome solution from Example 1, with a concentration of 10% by volume. The experimental procedures are described below.

[0092] Quantitatively quantified NHDF cells were suspended in complete culture medium to obtain a cell solution with a concentration of 2 x 10⁴ cells / mL. 2 x 10³ cells / 0.1 mL were seeded into 96-well cell culture dishes and incubated at 37°C and 5% CO₂ for 48 hours. The supernatant was then removed. The NHDF cells were washed with 0.3 mL of DPBS per well. 0.1 mL of test solution was added to each well of each group. After incubation for another 72 hours, the supernatant was collected and centrifuged at 2230 xg to precipitate cell debris. The supernatant was diluted to obtain diluted samples. Using a Collagen ELISA kit (purchased from TAKARA, Cat# MK101), the reconstituted antibodies and standards were prepared according to the manufacturer's instructions: the standards were serially diluted twofold. In the reaction pan of the kit, 100 μL of reconstituted antibody was added to each well, followed by 20 μL of the serially diluted standard and the diluted sample. After incubation at 37°C and 80 rpm for 3 hours, each well was washed four times with 350 μL of DPBS. 100 μL of the TMB chromogenic solution provided in the kit was added to each well, and the reaction was allowed to proceed at room temperature for 15 minutes. Finally, 100 μL of 1N sulfuric acid solution was added to each well to terminate the reaction. The OD490 value at a wavelength of 490 nm was obtained using an enzyme immunoassay analyzer. Using the OD490 value of the blank group as a baseline (i.e., the relative content of type I collagen in the blank group is 100%), the relative content of type I collagen in the other groups was calculated using the formula: Relative content of type I collagen (%) = (OD490 value of the treatment group / OD490 value of the blank group) × 100%. The results are shown in Figure 6.

[0093] As shown in Figure 6, the platelet exosome solution of Example 1 can increase the relative content of type I collagen secreted by NHDF cells to 539%, which is significantly higher than that of the platelet concentrate of Comparative Example 1. It can be seen that the platelet exosome solution of Example 1 has a significantly better effect on increasing the secretion of type I collagen by human dermal fibroblasts, thereby increasing the content of type I collagen in the skin, which can maintain skin health and benefit skin care.

[0094] Test 3: Wound Healing Test

[0095] In this test case, a cell-free area was scraped from the NHDF cell layer, and different test solutions were added during the NHDF cell culture process to analyze the efficacy of the test solutions in promoting the filling of the cell-free area by NHDF cells, i.e., wound healing. The test cases were divided into three groups: (1) Control group: Minimum Essential Medium α (α-MEM), cat#41061037, purchased from Gibco; (2) Comparative Example 2: α-MEM medium supplemented with platelet concentrate from Comparative Example 1, with a concentration of 10% by volume; and (3) Example 2: α-MEM medium supplemented with platelet exosome solution from Example 1, with a concentration of 10% by volume. The experimental procedures are described below.

[0096] A quantitative amount of NHDF was suspended in complete culture medium to obtain a concentration of 1 x 10⁵ cells / mL. Two cells were seeded per well (2 x 10⁵ cells / 2 mL) in 6-well cell culture dishes and cultured at 37°C and 5% CO₂ for 24 hours. The supernatant was then removed. The NHDF cells were washed with 2 mL of DPBS per well, followed by treatment with 2 mL of Mytomycin C (5 μg / mL) solution per well, and incubated for 2 hours. The Mytomycin C solution was removed, and the NHDF cells were washed with 2 mL of DPBS per well, followed by removal of the DPBS. A cell-free zone was scraped out using a Scratcher (SPLScar™, Scratcher, SPL, 201906). Two mL of test solution was added to each group. After photographic recording of the cell-free zone (i.e., the wound site) and its location, the 6-well cell culture dishes were transferred to the cell culture incubator. After 24 hours, the healing status of the wound was observed at the designated location and photographed. The results are shown in Figure 7.

[0097] As shown in Figure 7, the platelet exosome solution of Example 1 can induce NHDF cells to proliferate and migrate to the cell-free area (i.e., the wound site), and almost fill the wound site within 24 hours. Moreover, the healing effect is significantly better than that of the platelet thick solution of Comparative Example 1. It can be seen that the platelet exosome solution of Example 1 has a significantly better wound healing effect and is beneficial to skin care.

[0098] Test 4: Human hair follicle dermal papillary cell proliferation test

[0099] This test involved adding different test solutions during the culture of Human Follicle Dermal Papilla Cells (HFDPC) to analyze the effect of the test solutions on promoting hair growth. The cells were divided into two groups: (1) Control group: Minimum Essential Medium α (α-MEM), cat#41061037, purchased from Gibco; and (2) Example 2: α-MEM medium supplemented with the platelet exosome solution from Example 1, with the platelet exosome solution concentration of Example 1 being 10% by volume. The experimental procedures are described below.

[0100] 1300 HFDPC cells were seeded into 96-well cell culture dishes containing 0.1 mL of Follicle Dermal Papilla Cell Growth Medium (PromoCell) and cultured in a cell culture incubator at 37°C and 5% CO2 for 1 day, after which the supernatant was removed. The HFDPC cells were washed with 0.3 mL of DPBS, and 0.1 mL of test solution was added to each well of each group. After culturing in a cell culture incubator for another 3 days, the supernatant was removed. The HFDPC cells were washed with 0.3 mL of DPBS, and 0.1 mL of MTS reaction solution was added to each well. The cells were then incubated in a cell culture incubator for 3 hours. OD490 values ​​were obtained using an enzyme immunoassay analyzer. The cell proliferation rate of the other groups was calculated using the OD490 value of the control group (i.e., the cell proliferation rate of the control group was 100%) as a baseline (formula same as Test 1). The results are shown in Figure 8.

[0101] As shown in Figure 8, the platelet exosome solution of Example 1 can increase the cell proliferation rate of HFDPC cells by about 3.2 times that of the control group. This indicates that the platelet exosome solution of Example 1 has the effect of promoting the proliferation of human hair follicle mesenchymal stem cells and thus promoting hair growth.

[0102] Test 5: Gene Expression Test of Hair Growth Factor

[0103] This test involved adding different test solutions during the culture of human follicular dermal papillary cells (HFDPC) to analyze the effect of the test solutions on promoting the expression of the versican gene (VCAN) of chondroitin sulfate. Regarding the VCAN gene, it is highly expressed during the growth phase of hair follicles; therefore, increased VCAN gene expression in hair follicle cells is an indicator of hair growth promotion. This test was divided into two groups: (1) Control group: Minimum Essential Medium α (α-MEM), cat#41061037, purchased from Gibco; and (2) Example 2: α-MEM medium supplemented with the platelet exosome solution from Example 1, with the platelet exosome solution concentration of Example 1 being 10% by volume. The experimental procedures are described below.

[0104] Six × 10⁴ HFDPC cells were seeded into 6-well cell culture dishes containing 2 mL of dermal papillary follicle cell growth medium and cultured in a cell culture incubator at 37°C and 5% CO₂ for one day. The supernatant was then removed. The HFDPC cells were washed with 2 mL of DPBS, and 2 mL of test solution was added to each well of each group. After culturing in the cell culture incubator for another 3 days, total RNA was collected from the cells using a Quick-RNA Miniprep kit (R1055, purchased from ZYMO RESEARCH). The RNA was diluted 4-fold with nuclease-free water and used as a template for quantitative reverse transcription polymerase chain reaction (RT-qPCR). The expression of human GAPDH and VCAN genes was detected using the Power SYBR™ Green RNA-to-CT™ 1-Step kit (catalog number: 4389986, purchased from Invitrogen). The primers used for RT-qPCR are shown in Table 2. The purpose of detecting the expression level of GAPDH gene was to standardize the expression of VCAN gene.

[0105] The relative gene expression level in Example 2 was calculated using the control group as a baseline (i.e., the relative gene expression level of the control group was 1). The results of the relative gene expression level of VCAN in each group are shown in Figure 9.

[0106] Table 2: Primers used for reverse transcription quantitative PCR Gene Sequence (5'→3') VCAN F: GGCACAAATTCCAAGGGCAG (SEQ ID NO.1) R: TCATGGCCCACACGATTAACA (SEQ ID NO.2) GAPDH F: GCACCAGGTGGTCTCCTCT (SEQ ID NO.3) R: TGACAAAGTGGTCGTTGAGG (SEQ ID NO.4)

[0107] As shown in Figure 9, the platelet exosome solution of Example 1 can increase the relative expression level of VCAN gene in HFDPC cells by about 1.9 times that of the control group. This indicates that the platelet exosome solution of Example 1 has the effect of promoting VCAN gene expression and thus promoting hair growth.

[0108] Test 6: Anti-inflammatory test

[0109] This test involved different treatments during the culture of peripheral blood mononuclear cells (PBMCs) to analyze the anti-inflammatory effect of the platelet exosome solution from Example 1. The experimental procedures are described below.

[0110] PBMCs isolated from adult peripheral blood were cultured at a concentration of 4 × 10⁵ cells / mL in α-MEM medium in 24-well plates. This test was divided into four groups, and the treatment methods for each group during PBMC cell culture are shown in Table 3. The culture time was 72 hours.

[0111] Table 3: Treatment methods for each group during PBMC culture Group Handling method negative control group No phytohemagglutinin (PHA) added. Only α-MEM medium was available. Positive control group PHA was added, and the concentration of PHA in the culture medium was 10 μg / mL. Comparative Example 2 PHA was added, and the concentration of PHA in the culture medium was 10 μg / mL. Platelet concentrate from Comparative Example 1 was added, and the concentration of platelet concentrate in the culture medium was 10% by volume. Example 2 PHA was added, and the concentration of PHA in the culture medium was 10 μg / mL. The platelet exosome solution from Example 1 was added, and the concentration of the platelet exosome solution in the culture medium was 10% by volume.

[0112] After 72 hours of different treatments, 100 μL of culture medium from each group was added to a 96-well plate of the Human IFN-gamma ELISA Kit (RayBiotech cat#ELH-IFNg-1). Separately, IFN-gamma standards were serially diluted to prepare IFN-gamma standard dilutions of different concentrations, and 100 μL of each was added to the 96-well plate.

[0113] Each group and standard dilution buffer were reacted in a 96-well pan with gentle shaking for 2.5 hours at room temperature. The solution was removed and the pan was washed with washing buffer. The detection antibody anti-IFN-γ from the kit was then added, and the pan was reacted in a 96-well pan with gentle shaking for 1 hour at room temperature. All solution in the wells was removed and the pan was washed with washing buffer. Horseradish peroxidase-labeled solution was then added, and the pan was reacted in a 96-well pan with gentle shaking for 45 minutes at room temperature. The solution was removed and the pan was washed with washing buffer. The TMB chromogenic solution from the kit was then added, and the pan was reacted in a 96-well pan with gentle shaking for 30 minutes at room temperature in the dark to develop the color. The stop solution from the kit was added to stop the color development reaction, and the OD450 value (i.e., absorbance value) at a wavelength of 450 nanometers was immediately measured using a microplate analyzer.

[0114] The equation for the linear regression line and the R-squared value were obtained based on the concentration and average absorbance of each standard dilution. The IFN-γ concentration of each group was then calculated based on the equation. With the concentration of the positive control group as 100%, the percentage of IFN-γ concentration in the other groups was calculated, and the results are shown in Figure 10.

[0115] As shown in Figure 10, the platelet exosome solution of Example 1 can effectively reduce the IFN-γ content, which is only 7% of that in the positive control group and significantly lower than that in the platelet concentrate of Comparative Example 1. This indicates that the platelet exosome solution of Example 1 has significantly better anti-inflammatory effects.

[0116] Analysis 6: MicroRNA Analysis of Platelet Exosomes

[0117] RNA extraction: First, 200 μL of the platelet exosome solution from Example 1 was added to 1 mL of QIAzol and mixed thoroughly, then allowed to stand at room temperature for 3 minutes. Next, 200 μL of 1-bromo-3-chloropropane was added and mixed thoroughly, then allowed to stand for another 3 minutes. Subsequently, the mixture was centrifuged at 12,000 × g for 15 minutes, and 500 μL of the clear aqueous phase was taken and mixed with 750 μL of 100% ethanol to obtain a crude extract. Following the steps indicated in the Qiagen miRNeasy Serum / Plasma Kit, the crude extract was transferred to a purification column (spin column), centrifuged at 10,000 × g for 20 seconds, and the liquid in the collection tube was removed. Next, 700 μL of Buffer RWT was added to the purification column, and the mixture was centrifuged at the same speed for 20 seconds, and the liquid in the collection tube was removed. Next, add 500 μL of Buffer RPE to the purification column and centrifuge at the same speed for 20 seconds. Then, add 500 μL of 80% ethanol to the purification column and centrifuge at 10,000 × g for 2 minutes. Transfer the purification column to a new collection tube, open the cap, and centrifuge at the highest speed for 5 minutes to remove residual liquid. Finally, add 20 μL of nuclease-free water to the purification column, incubate at room temperature for 3 minutes, and then centrifuge at 14,000 × g for 1 minute to dissolve the RNA. After completion, store the RNA sample at -20°C.

[0118] Small RNA Analysis: This analysis used the Thermo Fisher GeneChip™ miRNA 4.0 Assay kit. 2 μL of RNA Spike Control Oligos and 5.0 μL of Poly A Tailing Master Mix were added to the RNA sample, mixed thoroughly by pipetting, and then rapidly centrifuged at 37°C for 15 minutes. Subsequently, 4 μL of 5X FlashTag Biotin HSR Ligation Mix and 2 μL of T4 DNA Ligase were added, mixed thoroughly again, and then rapidly centrifuged at 25°C for 30 minutes. After the reaction was complete, 2.5 μL of HSR Stop Solution was added and mixed thoroughly to terminate the reaction. 20X Hybridization Controls were placed in a dry bath and incubated at 65°C for 5 minutes. Then, 110.5 μL of Hybridization Cocktail was added, mixed thoroughly, and the hybridization program was initiated with the following conditions: heating at 99°C for 20 seconds, holding at 99°C for 5 minutes, and holding at 45°C for 5 minutes. The processed samples were injected into the wafers, which were then placed in a hybridization oven and subjected to hybridization reactions at 48°C and 60 rpm for 16 to 18 hours. After hybridization, the wafers were washed and stained using Fluidics Station 450, then scanned. Finally, the data were analyzed using Transcriptome Analysis Console software to complete the gene expression analysis process and classify the data. The results are shown in Table 5.

[0119] Table 4: Small RNA Analysis Results and Classification of Platelet Exosome Solution Small molecule ribonucleic acid related to promoting skin repair hsa-let-7c-5p, hsa-miR-100-5p, hsa-miR-1246, hsa-miR-125b-5p, hsa-miR-126-3p, hsa-miR-145-5p, hsa-miR-15a-5p, hsa-miR-192-5p, hsa-miR-1 9b-3p, hsa-miR-21-5p, hsa-miR-221-3p, hsa-miR-23a-5p, hsa-miR-24-3p, hsa-miR-29a, hsa-miR-31-5p, hsa-miR-3665, hsa-miR-663a and hsa-miR-762. Small ribonucleic acid molecules related to promoting hair growth hsa-miR-103a-3p, hsa-miR-107, hsa-miR-125b-5p, hsa-miR-130b-3p, hsa-miR-140-5p, hsa-miR-146a-5p, hsa-miR-181a-5p, hsa-miR-195-5 p, hsa-miR-19a-3p, hsa-miR-20a-5p, hsa-miR-22-3p, hsa-miR-22-5p, hsa-miR-335-5p, hsa-miR-371b-5p, hsa-miR-433-3p and hsa-miR-493-3p. Small RNA molecules associated with promoting anti-inflammatory effects hsa-let-7b, hsa-let-7i-5p, hsa-miR-125b-5p, hsa-miR-142-5p, hsa-miR-145, hsa-miR-146a-5p, hsa-miR-150-3p, hsa-miR-155, hsa-mi R-155-5p, hsa-miR-15a, hsa-miR-17-5p, hsa-miR-181b-5p, hsa-miR-182, hsa-miR-183-5p, hsa-miR-186, hsa-miR-18a-3p, hsa-miR-19a-3 p, hsa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-21-5p, hsa-miR-222-3p, hsa-miR-223, hsa-miR-23a, hsa-miR-23a-3p, hsa-miR-24-2, hsa- miR-26b-5p, hsa-miR-29a, hsa-miR-29a-3p, hsa-miR-30b, hsa-miR-31-5p, hsa-miR-326, hsa-miR-330-3p, hsa-miR-424 and hsa-miR-744-5p.

[0120] As shown in Table 4, the platelet exosome solution of the present invention contains abundant small molecule ribonucleic acid, and these small molecule ribonucleic acid are respectively related to "promoting skin repair", "promoting hair growth" and "promoting anti-inflammation".

[0121] In summary, the platelet exosome solution of this invention can promote fibroblast proliferation, collagen secretion, wound healing, proliferation of human hair follicle dermal papillary cells, and gene expression of the hair growth factor VCAN, as well as reduce the content of interferon-γ induced by phytohemagglutinin. Therefore, the platelet exosome solution of this invention has skin care, hair growth promotion, and anti-inflammatory effects, thus possessing multiple functions.

[0122] none

[0123] none TWI928608B_114105355_SEQL.xml

Claims

1. The use of a platelet exosome solution in the preparation of skin care products, wherein, The platelet exosome solution contains insulin-like growth factor 1 at a concentration of 150 pg / ml to 310 pg / ml; platelet-derived growth factor-BB at a concentration of 2500 pg / ml to 4300 pg / ml; and platelet exosomes at a concentration of 4 × 10¹¹ particles / ml (EV / ml) ​​to 6 × 10¹² EV / ml; and the skin care includes promoting collagen production.

2. The platelet exosome solution as described in claim 1, which contains plasma.

3. The platelet exosome solution as described in claim 1, wherein the platelet exosomes comprise small molecular weight ribonucleic acid.

4. The platelet exosome solution as described in claim 1, wherein the median particle size of the platelet exosomes is 50 nanometers to 200 nanometers.

5. The platelet exosome solution as described in claim 3, wherein the small molecule ribonucleic acid is selected from the group consisting of hsa-let-7c-5p, hsa-miR-100-5p, hsa-miR-1246, hsa-miR-125b-5p, hsa-miR-126-3p, hsa-miR-145-5p, hsa-miR-15a-5p, hsa-miR-192-5p, hsa-miR-19b-3p, hsa-miR-21-5p, hsa-miR-221-3p, hsa-miR-23a-5p, hsa-miR-24-3p, hsa-miR-29a, hsa-miR-31-5p, hsa-miR-3665, hsa-miR-663a, and hsa-miR-762.

6. The use as described in claim 1, wherein the skin care further comprises promoting dermal fibroblast proliferation.

7. The use of a platelet exosome solution in the preparation of a drug to promote hair growth; wherein, The concentration of insulin-like growth factor 1 in the platelet exosome solution is from 150 pg / ml to 310 pg / ml; the concentration of platelet-derived growth factor-BB is from 2500 pg / ml to 4300 pg / ml; and the concentration of platelet exosomes is from 4 × 10¹¹ particles / ml (EV / ml) ​​to 6 × 10¹² EV / ml.

8. The use as described in claim 7, wherein the promotion of hair growth comprises promoting the proliferation of dermal papilla cells in the hair follicle or promoting the gene expression of chondroitin sulfate proteoglycan molecules in the hair follicle cells.

9. The use as described in claim 7, wherein the platelet exosomes comprise small ribonucleic acid, and the small ribonucleic acid is selected from the group consisting of hsa-miR-103a-3p, hsa-miR-107, hsa-miR-125b-5p, hsa-miR-130b-3p, hsa-miR-140-5p, hsa-miR-146a-5p, hsa-miR-181a-5p, hsa-miR-195-5p, hsa-miR-19a-3p, hsa-miR-20a-5p, hsa-miR-22-3p, hsa-miR-22-5p, hsa-miR-335-5p, hsa-miR-371b-5p, hsa-miR-433-3p, and hsa-miR-493-3p.

10. The use as described in claim 7, wherein the median particle size of the platelet exosome solution is 50 nanometers to 200 nanometers.