Aav vector, compositions and methods for treating glycogen storage disorders
Patent Information
- Application Number
- TW114116784
- Authority / Receiving Office
- TW · TW
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2020-09-25
- Filing Date
- 2020-10-23
- Publication Date
- 2026-07-01
- Estimated Expiration
- 2040-10-22
Smart Images

Figure IMG-2_DRAW_114116784-A0305-14-0001-1 
Figure IMG-2_DRAW_114116784-A0305-14-0002-2 
Figure IMG-2_DRAW_114116784-A0305-14-0003-3
Abstract
Description
Technical Field
[0001] This disclosure relates to the field of gene therapy and provides compositions and methods for improving genetic diseases. Prior Technology
[0002] Pompe disease is a lysosomal storage disorder caused by mutations in the acid alpha-glucosidase (GAA) gene, which encodes an enzyme responsible for processing lysosomal glycogen. Patients with Pompe disease exhibit clinical phenotypes in various tissues, including glycogen accumulation in cells, defects in cardiac, respiratory, and skeletal muscle function, and central nervous system pathology. Enzyme replacement therapy (ERT) using recombinant human GAA (rhGAA) has significantly improved some of these defects. However, the immunogenicity of hGAA ERT and the lack of rhGAA uptake in some affected tissues have limited its clinical efficacy. Gene therapy has also been investigated as a potential treatment paradigm for this disease. Challenges related to achieving therapeutically effective doses of GAA in affected tissues while simultaneously suppressing toxic side effects have hindered the development of gene therapies for Pompe disease. A composition and method that achieves this balance remains to be developed. Summary of the Invention
[0003] This disclosure provides compositions and methods for treating glycogen storage disorders, such as type II glycogen storage disorder (also referred to herein as Pompe disease). Using the compositions and methods of this disclosure, a viral vector, such as an adeno-associated virus (AAV) vector containing a transgenic gene encoding acid α-glucosidase (GAA), can be administered to a patient with Pompe disease (e.g., a mammalian patient, such as a human patient). The AAV vector can be, for example, a pseudotyped AAV vector, such as an AAV vector containing an AAV2 inverted terminal repeat sequence encapsulated within the capsid protein of AAV8 (AAV2 / 8) or AAV9 (AAV2 / 9). The transgenic gene can, for example, be operatively linked to a transcriptional regulatory element, such as a promoter that induces gene expression in muscle cells and / or neurons. Exemplary promoters that can be used in conjunction with the compositions and methods of this disclosure are, in particular, muscle creatine kinase promoters, desmin promoters, and CMV promoters. The AAV vector can be administered to the patient in a therapeutically effective amount, such as about 1 x 10¹³ vector gene bodies (vg) / kg individual body weight (vg / kg) to about 3 x 10¹⁴ vg / kg (e.g., about 3 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as about 4 x 10¹³ vg / kg to about 1 x 10¹⁴ vg / kg, such as about 4 x 10¹³ vg / kg, 5 x 10¹³ vg / kg, 6 x 10¹³ vg / kg, 7 x 10¹³ vg / kg, 8 x 10¹³ vg / kg, 9 x 10¹³ vg / kg or 1 x 10¹⁴ vg / kg).
[0004] This disclosure is based in part on the discovery of dosages of AAV vectors containing the GAA transgenic gene that achieve therapeutic increases in GAA expression and activity in patients with Pompe disease, while suppressing toxic side effects. For example, it has been found that doses of AAV vectors containing the transgenic gene encoding GAA in the range of approximately 1 x 10¹³ vg / kg to approximately 3 x 10¹⁴ vg / kg (e.g., approximately 3 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as doses of approximately 4 x 10¹³ vg / kg, 5 x 10¹³ vg / kg, 6 x 10¹³ vg / kg, 7 x 10¹³ vg / kg, 8 x 10¹³ vg / kg, 9 x 10¹³ vg / kg, or 1 x 10¹⁴ vg / kg) can induce a beneficial increase in GAA expression and activity in patients with Pompe disease, while avoiding the toxic side effects that may be associated with GAA overexpression or administration of excessive viral vectors. Using the compositions and methods disclosed herein, AAV carriers can be administered to patients in amounts sufficient to enhance their GAA performance and reduce cellular glycogen accumulation in their neurons and muscle tissues without inducing toxic side effects.
[0005] In the first embodiment, this disclosure relates to a method for treating Pompe disease in a human patient by administering an AAV vector containing a transgenic gene encoding acidic GAA to the patient, wherein the AAV vector is administered to the patient in an amount of about 1 x 10¹³ vg / kg to about 5 x 10¹⁴ vg / kg, such as in an amount of about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg. For example, AAV carriers can be administered to patients in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 1014 vg / kg、2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg, 3 x 1014 vg / kg, 3.1 x 1014 vg / kg, 3.2 x 1014 vg / kg, 3.3 x 1014 vg / kg, 3.4 x 1014 vg / kg, 3.5 x 1014 vg / kg, 3.6 x 1014 vg / kg, 3.7 x 1014 vg / kg, 3.8 x 1014 vg / kg, 3.9 x 1014 vg / kg, 4 x 1014 vg / kg, 4.1 x 1014 vg / kg, 4.2 x 1014 vg / kg, 4.3 x 1014 vg / kg, 4.4 x 1014 vg / kg, 4.5 x 1014 vg / kg, 4.6 x 1014 vg / kg, 4.7 x 1014 vg / kg, 4.8 x 1014 vg / kg, 4.9 x 1014 vg / kg or 5 x 1014 vg / kg..
[0006] In another embodiment, this disclosure relates to a method for improving muscle function in a human patient diagnosed with Pompe disease by administering an AAV vector containing a transgenic gene encoding GAA, wherein the patient is administered the AAV vector at an amount of about 1 x 10¹³ vg / kg to about 5 x 10¹⁴ vg / kg, such as at an amount of about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg. For example, AAV carriers can be administered to patients in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 1014 vg / kg、2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg, 3 x 1014 vg / kg, 3.1 x 1014 vg / kg, 3.2 x 1014 vg / kg, 3.3 x 1014 vg / kg, 3.4 x 1014 vg / kg, 3.5 x 1014 vg / kg, 3.6 x 1014 vg / kg, 3.7 x 1014 vg / kg, 3.8 x 1014 vg / kg, 3.9 x 1014 vg / kg, 4 x 1014 vg / kg, 4.1 x 1014 vg / kg, 4.2 x 1014 vg / kg, 4.3 x 1014 vg / kg, 4.4 x 1014 vg / kg, 4.5 x 1014 vg / kg, 4.6 x 1014 vg / kg, 4.7 x 1014 vg / kg, 4.8 x 1014 vg / kg, 4.9 x 1014 vg / kg or 5 x 1014 vg / kg..
[0007] In another embodiment, this disclosure relates to a method for reducing glycogen accumulation in a human patient diagnosed with Pompe disease by administering an AAV vector containing a transgenic gene encoding GAA to the patient, wherein the AAV vector is administered to the patient at an amount of about 1 x 10¹³ vg / kg to about 5 x 10¹⁴ vg / kg, such as at an amount of about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg. For example, AAV carriers can be administered to patients in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 1014 vg / kg, 2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg, 3 x 1014 vg / kg, 3.1 x 1014 vg / kg, 3.2 x 1014 vg / kg, 3.3 x 1014 vg / kg, 3.4 x 1014 vg / kg, 3.5 x 1014 vg / kg, 3.6 x 1014 vg / kg, 3.7 x 1014 vg / kg, 3.8 x 1014 vg / kg, 3.9 x 1014 vg / kg, 4 x 1014 vg / kg, 4.1 x 1014 vg / kg, 4.2 x 1014 vg / kg, 4.3 x 1014 vg / kg, 4.4 x 1014 Vg / kg, 4.5 x 10¹⁴ Vg / kg, 4.6 x 10¹⁴ Vg / kg, 4.7 x 10¹⁴ Vg / kg, 4.8 x 10¹⁴ Vg / kg, 4.9 x 10¹⁴ Vg / kg, or 5 x 10¹⁴ Vg / kg. In some embodiments of this configuration, administration of the AAV carrier to the patient reduces glycogen accumulation in muscle tissue (e.g., cardiac and / or skeletal muscle tissue) and / or neuronal tissue.
[0008] In another embodiment, this disclosure relates to a method for improving lung function in a human patient diagnosed with Pompe disease by administering an AAV vector containing a transgenic gene encoding GAA, wherein the patient is administered the AAV vector at an amount of about 1 x 10¹³ vg / kg to about 5 x 10¹⁴ vg / kg, such as at an amount of about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg. For example, AAV carriers can be administered to patients in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 1014 vg / kg、2.8 x 10^14 vg / kg, 2.9 x 10^14 vg / kg, 3 x 10^14 vg / kg, 3.1 x 10^14 vg / kg, 3.2 x 10^14 vg / kg, 3.3 x 10^14 vg / kg, 3.4 x 10^14 vg / kg, 3.5 x 10^14 vg / kg, 3.6 x 10^14 vg / kg, 3.7 x 10^14 vg / kg, 3.8 x 10^14 vg / kg, 3.9 x 10^14 vg / kg, 4 x 10^14 vg / kg, 4.1 x 10^14 vg / kg, 4.2 x 10^14 vg / kg, 4.3 x 10^14 vg / kg, 4.4 x 10^14 vg / kg, 4.5 x 10^14 vg / kg, 4.6 x 10^14 vg / kg, 4.7 x 10^14 vg / kg, 4.8 x 10^14 vg / kg, 4.9 x 10^14 vg / kg or 5 x 10^14 vg / kg..
[0009] In another embodiment, this disclosure relates to a method for increasing GAA expression in a human patient diagnosed with Pompe disease by administering an AAV vector containing a transgenic gene encoding GAA, wherein the patient is administered the AAV vector at an amount of about 1 x 10¹³ vg / kg to about 5 x 10¹⁴ vg / kg, such as at an amount of about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg. For example, AAV carriers can be administered to patients in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 10^14 vg / kg, 2.8 x 10^14 vg / kg, 2.9 x 10^14 vg / kg, 3 x 10^14 vg / kg, 3.1 x 10^14 vg / kg, 3.2 x 10^14 vg / kg, 3.3 x 10^14 vg / kg, 3.4 x 10^14 vg / kg, 3.5 x 10^14 vg / kg, 3.6 x 10^14 vg / kg, 3.7 x 10^14 vg / kg, 3.8 x 10^14 vg / kg, 3.9 x 10^14 vg / kg, 4 x 10^14 vg / kg, 4.1 x 10^14 vg / kg, 4.2 x 10^14 vg / kg, 4.3 x 10^14 vg / kg, 4.4 x 10^14 vg / kg, 4.5 x 10^14 vg / kg, 4.6 x 10^14 vg / kg, 4.7 x 10^14 vg / kg, 4.8 x 10^14 vg / kg, 4.9 x 10^14 vg / kg or 5 x 10^14 vg / kg..
[0010] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient in amounts ranging from about 2 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as in the following amounts: about 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg, 2.7 x 10¹³ vg / kg, 2.8 x 10¹³ vg / kg, 2.9 x 10¹³ vg / kg, 3 x 10¹³ vg / kg, 3.1 x 10¹³ vg / kg, 3.2 x 10¹³ vg / kg, 3.3 x 10¹³ vg / kg. vg / kg, 3.4 x 1013 vg / kg, 3.5 x 1013 vg / kg, 3.6 x 1013 vg / kg, 3.7 x 1013 vg / kg, 3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 5 x 1013 vg / kg, 5.1 x 1013 vg / kg、5.2 x 1013 vg / kg、5.3 x 1013 vg / kg、5.4 x 1013 vg / kg、5.5 x 1013 vg / kg、5.6 x 1013 vg / kg、5.7 x 1013 vg / kg、5.8 x 1013 vg / kg、5.9 x 1013 vg / kg,6 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 vg / kg, 7.2 x 1013 vg / kg, 7.3 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 1013 vg / kg, 8 x 1013 vg / kg, 8.1 x 1013 vg / kg, 8.2 x 1013 vg / kg, 8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg, 9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 10¹⁴ vg / kg. In some implementations, the AAV carrier is administered to the patient at doses ranging from approximately 2 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg, such as from approximately 2 x 10¹³ vg / kg to approximately 4 x 10¹³ vg / kg (e.g., approximately 3 x 10¹³ vg / kg) or from approximately 5 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg (e.g., approximately 6 x 10¹³ vg / kg).
[0011] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient in amounts ranging from about 3 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as in the following amounts: about 3 x 10¹³ vg / kg, 3.1 x 10¹³ vg / kg, 3.2 x 10¹³ vg / kg, 3.3 x 10¹³ vg / kg, 3.4 x 10¹³ vg / kg, 3.5 x 10¹³ vg / kg, 3.6 x 10¹³ vg / kg, 3.7 x 10¹³ vg / kg, 3.8 x 10¹³ vg / kg, 3.9 x 10¹³ vg / kg, 4 x 10¹³ vg / kg, 4.1 x 10¹³ vg / kg, 4.2 x 10¹³ vg / kg, 4.3 x 10¹³ vg / kg. vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg, 4.8 x 1013 vg / kg, 4.9 x 1013 vg / kg, 5 x 1013 vg / kg, 5.1 x 1013 6 x 1013 vg / kg, 6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg,7 x 1013 vg / kg, 7.9 x 1013 vg / kg, 8 x 1013 vg / kg, 8.1 x 1013 vg / kg, 8.2 x 1013 vg / kg, 8.3 x 1013 vg / kg, 8.4 x 1013 vg / kg, 8.5 x 10^13 vg / kg, 8.6 x 10^13 vg / kg, 8.7 x 10^13 vg / kg, 8.8 x 10^13 vg / kg, 8.9 x 10^13 vg / kg, 9 x 10^13 vg / kg, 9.1 x 10^13 vg / kg, 9.2 x 10^13 vg / kg, 9.3 x 10^13 vg / kg, 9.4 x 10^13 vg / kg, 9.5 x 10^13 vg / kg, 9.6 x 10^13 vg / kg, 9.7 x 10^13 vg / kg, 9.8 x 10^13 vg / kg, 9.9 x 10^13 vg / kg, 1 x 10^14 vg / kg, 1.1 x 10^14 vg / kg, 1.2 x 10^?14 vg / kg, 1.3 x 10^14 vg / kg, 1.4 x 10^14 vg / kg, 1.5 x 10^14 vg / kg, 1.6 x 10^14 vg / kg, 1.7 x 10^14 vg / kg, 1.8 x 10^14 vg / kg, 1.9 x 10^14 vg / kg or 2 x 10^14 vg / kg..
[0012] It seems there is a formatting or content issue in the original with "1.2 x 10^?14 vg / kg", which is likely a typo. I've translated it as best as possible with the available correct content.In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient in amounts ranging from about 4 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as in the following amounts: about 4 x 10¹³ vg / kg, 4.1 x 10¹³ vg / kg, 4.2 x 10¹³ vg / kg, 4.3 x 10¹³ vg / kg, 4.4 x 10¹³ vg / kg, 4.5 x 10¹³ vg / kg, 4.6 x 10¹³ vg / kg, 4.7 x 10¹³ vg / kg, 4.8 x 10¹³ vg / kg, 4.9 x 10¹³ vg / kg, 5 x 10¹³ vg / kg, 5.1 x 10¹³ vg / kg, 5.2 x 10¹³ vg / kg, 5.3 x 10¹³ vg / kg. vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 7 x 1013 vg / kg, 7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg,8 x 1013 vg / kg,8.1 x 1013 vg / kg,8.2 x 1013 vg / kg,8.3 x 1013 vg / kg,8.4 x 1013 vg / kg,8.5 x 1013 vg / kg,8.6 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 10^13 vg / kg, 9.6 x 10^13 vg / kg, 9.7 x 10^13 vg / kg, 9.8 x 10^13 vg / kg, 9.9 x 10^13 vg / kg, 1 x 10^14 vg / kg, 1.1 x 10^14 vg / kg, 1.2 x 10^14 vg / kg, 1.3 x 10^14 vg / kg, 1.4 x 10^14 vg / kg, 1.5 x 10^14 vg / kg, 1.6 x 10^14 vg / kg, 1.7 x 10^14 vg / kg, 1.8 x 10^14 vg / kg, 1.9 x 10^14 vg / kg or 2 x 10^14 vg / kg..
[0013] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient in amounts ranging from about 5 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as in the following amounts: about 5 x 10¹³ vg / kg, 5.1 x 10¹³ vg / kg, 5.2 x 10¹³ vg / kg, 5.3 x 10¹³ vg / kg, 5.4 x 10¹³ vg / kg, 5.5 x 10¹³ vg / kg, 5.6 x 10¹³ vg / kg, 5.7 x 10¹³ vg / kg, 5.8 x 10¹³ vg / kg, 5.9 x 10¹³ vg / kg, 6 x 10¹³ vg / kg, 6.1 x 10¹³ vg / kg, 6.2 x 10¹³ vg / kg, 6.3 x 10¹³ vg / kg. vg / kg, 6.4 x 1013 vg / kg, 6.5 x 1013 vg / kg, 6.6 x 1013 vg / kg, 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 8 x 1013 vg / kg, 8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg,9 x 1013 vg / kg,9.1 x 1013 vg / kg,9.2 x 1013 vg / kg,9.3 x 1013 vg / kg,9.4 x 1013 vg / kg,9.5 x 1013 vg / kg,9.6 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0014] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient in amounts ranging from about 6 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as in the following amounts: about 6 x 10¹³ vg / kg, 6.1 x 10¹³ vg / kg, 6.2 x 10¹³ vg / kg, 6.3 x 10¹³ vg / kg, 6.4 x 10¹³ vg / kg, 6.5 x 10¹³ vg / kg, 6.6 x 10¹³ vg / kg, 6.7 x 10¹³ vg / kg, 6.8 x 10¹³ vg / kg, 6.9 x 10¹³ vg / kg, 7 x 10¹³ vg / kg, 7.1 x 10¹³ vg / kg, 7.2 x 10¹³ vg / kg, 7.3 x 10¹³ vg / kg. vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg,8.2 x 1013 vg / kg, 9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg,1 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg. [ ]
[0015] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient in amounts ranging from about 7 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as in the following amounts: about 7 x 10¹³ vg / kg, 7.1 x 10¹³ vg / kg, 7.2 x 10¹³ vg / kg, 7.3 x 10¹³ vg / kg, 7.4 x 10¹³ vg / kg, 7.5 x 10¹³ vg / kg, 7.6 x 10¹³ vg / kg, 7.7 x 10¹³ vg / kg, 7.8 x 10¹³ vg / kg, 7.9 x 10¹³ vg / kg, 8 x 10¹³ vg / kg, 8.1 x 10¹³ vg / kg, 8.2 x 10¹³ vg / kg, 8.3 x 10¹³ vg / kg. vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0016] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient in amounts ranging from about 8 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as in the following amounts: about 8 x 10¹³ vg / kg, 8.1 x 10¹³ vg / kg, 8.2 x 10¹³ vg / kg, 8.3 x 10¹³ vg / kg, 8.4 x 10¹³ vg / kg, 8.5 x 10¹³ vg / kg, 8.6 x 10¹³ vg / kg, 8.7 x 10¹³ vg / kg, 8.8 x 10¹³ vg / kg, 8.9 x 10¹³ vg / kg, 9 x 10¹³ vg / kg, 9.1 x 10¹³ vg / kg, 9.2 x 10¹³ vg / kg, 9.3 x 10¹³ vg / kg. vg / kg, 9.4 x 1013 vg / kg, 9.5 x 1013 vg / kg, 9.6 x 1013 vg / kg, 9.7 x 1013 vg / kg, 9.8 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0017] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient in amounts ranging from approximately 9 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as in the following amounts: 9 x 10¹³ vg / kg, 9.1 x 10¹³ vg / kg, 9.2 x 10¹³ vg / kg, 9.3 x 10¹³ vg / kg, 9.4 x 10¹³ vg / kg, 9.5 x 10¹³ vg / kg, 9.6 x 10¹³ vg / kg, 9.7 x 10¹³ vg / kg, 9.8 x 10¹³ vg / kg, 9.9 x 10¹³ vg / kg, 1 x 10¹⁴ vg / kg, 1.1 x 10¹⁴ vg / kg, 1.2 x 10¹⁴ vg / kg, 1.3 x 10¹⁴ vg / kg. vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg. [ ]
[0018] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient in amounts ranging from about 1 x 10¹⁴ vg / kg to about 2 x 10¹⁴ vg / kg, such as in amounts of: 1 x 10¹⁴ vg / kg, 1.1 x 10¹⁴ vg / kg, 1.2 x 10¹⁴ vg / kg, 1.3 x 10¹⁴ vg / kg, 1.4 x 10¹⁴ vg / kg, 1.5 x 10¹⁴ vg / kg, 1.6 x 10¹⁴ vg / kg, 1.7 x 10¹⁴ vg / kg, 1.8 x 10¹⁴ vg / kg, 1.9 x 10¹⁴ vg / kg, or 2 x 10¹⁴ vg / kg. [ ]
[0019] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 6 x 10¹³ vg / kg.
[0020] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 7 x 10¹³ vg / kg. [ ]
[0021] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 8 x 10¹³ vg / kg. [ ]
[0022] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 9 x 10¹³ vg / kg. [ ]
[0023] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 1 x 10¹⁴ vg / kg. [ ]
[0024] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 1.1 x 10¹⁴ vg / kg. [ ]
[0025] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 1.2 x 10¹⁴ vg / kg. [ ]
[0026] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 1.3 x 10¹⁴ vg / kg. [ ]
[0027] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 1.4 x 10¹⁴ vg / kg. [ ]
[0028] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient at a dose of 1.5 x 10¹⁴ vg / kg. [ ]
[0029] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 1.6 x 10¹⁴ vg / kg. [ ]
[0030] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient at a dose of 1.7 x 10¹⁴ vg / kg. [ ]
[0031] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to the patient at a dose of 1.8 x 10¹⁴ vg / kg. [ ]
[0032] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 1.9 x 10¹⁴ vg / kg. [ ]
[0033] In some embodiments of any of the above-described forms disclosed herein, the AAV carrier is administered to the patient at a dose of 2 x 10¹⁴ vg / kg. [ ]
[0034] In some embodiments of any of the above-described embodiments of this disclosure, the AAV carrier is administered to a patient in a single dose containing a specified amount. In some embodiments, the AAV carrier is administered to a patient in two or more doses totaling a specified amount. For example, the AAV carrier may be administered to a patient in two to ten doses totaling a specified amount (e.g., two, three, four, five, six, seven, eight, nine, or ten doses totaling a specified amount). In some embodiments, the AAV carrier is administered to a patient in two, three, or four doses totaling a specified amount. In some embodiments, the AAV carrier is administered to a patient in two doses totaling a specified amount.
[0035] In some embodiments, two or more doses of AAV carriers, which together constitute a specified amount, are spaced apart from each other, for example, one year or longer. In some embodiments, two or more doses are administered to the patient over approximately 12 months (e.g., over approximately 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks, 27 weeks, 28 weeks, 29 weeks, 30 weeks, 31 weeks, 32 weeks, 33 weeks, 34 weeks, 35 weeks, 36 weeks, 37 weeks, 38 weeks, 39 weeks, 40 weeks, 41 weeks, 42 weeks, 43 weeks, 44 weeks, 45 weeks, 46 weeks, 47 weeks, 48 weeks, 49 weeks, 50 weeks, 51 weeks, or 52 weeks). For example, in some embodiments, two or more doses are administered to the patient over approximately one week to approximately 48 weeks (e.g., over approximately 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks, 27 weeks, 28 weeks, 29 weeks, 30 weeks, 31 weeks, 32 weeks, 33 weeks, 34 weeks, 35 weeks, 36 weeks, 37 weeks, 38 weeks, 39 weeks, 40 weeks, 41 weeks, 42 weeks, 43 weeks, 44 weeks, 45 weeks, 46 weeks, 47 weeks, or 48 weeks). In some embodiments, two or more doses are administered to the patient over approximately two weeks to approximately 44 weeks (e.g., over approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, or 44 weeks). In some embodiments, two or more doses are administered to the patient over approximately three to approximately 40 weeks (e.g., over approximately 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 weeks).In some embodiments, two or more doses are administered to the patient over approximately four weeks to approximately 36 weeks (e.g., over approximately 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 weeks). In some embodiments, two or more doses are administered to the patient over approximately five to approximately 32 weeks (e.g., over approximately 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 weeks). In some embodiments, two or more doses are administered to the patient over approximately six to approximately 24 weeks (e.g., over approximately 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 weeks). In some embodiments, two or more doses are administered to the patient over approximately 12 to approximately 20 weeks (e.g., over approximately 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks). In some embodiments, two or more doses are administered to the patient over approximately 13, 14, 15, 16, 17, 18, or 19 weeks.
[0036] In some embodiments, the AAV carrier is administered to the patient in two or more doses, each individually containing a specified amount. For example, the AAV carrier may be administered to the patient in two to ten doses, each individually containing a specified amount (e.g., two, three, four, five, six, seven, eight, nine, or ten doses, each individually containing a specified amount). In some embodiments, the AAV carrier is administered to the patient in two, three, or four doses, each individually containing a specified amount. In some embodiments, the AAV carrier is administered to the patient in two doses, each individually containing a specified amount.
[0037] In some embodiments, AAV carriers are administered to patients via intravenous, intrathecal, intracisional, intraventricular, intramuscular, intradermal, transdermal, non-enteric, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and / or oral administration. For example, AAV carriers can be administered to patients via intravenous, intrathecal, intracisional, intraventricular, and / or intramuscular administration. In some embodiments, AAV carriers are administered to patients via intravenous and / or intrathecal administration. In some embodiments, AAV carriers are administered to patients via intravenous administration.
[0038] In some embodiments, the AAV is a serotype of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh74, AAVrh.8, or AAVrh.10. The AAV may be a pseudotype, such as AAV2 / 8 or AAV2 / 9. In some embodiments, the AAV contains a recombinant capsid protein.
[0039] In some embodiments, the transgene encoding GAA is operatively linked to a promoter that induces the expression of the transgene in muscle and / or neuronal cells. The promoter may be, for example, the muscle creatine kinase (MCK) promoter, desmin promoter, chicken β-actin promoter, cell cytomegalovirus (CMV) promoter, myosin light chain-2 promoter, α-actin promoter, troponin 1 promoter, Na+ / Ca2+ exchanger promoter, dystrophin promoter, α7 integrin promoter, brain natriuretic peptide promoter, α-β-crystallin / small heat shock protein promoter, α-myosin heavy chain promoter, or atrial natriuretic factor promoter.
[0040] In some embodiments, the promoter is an MCK promoter. The MCK promoter may have a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 97% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 98% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is 100% identical to SEQ ID NO: 1.
[0041] In some embodiments, the transgene encoding GAA is operatively linked to an enhancer that induces the expression of the transgene in muscle and / or neuronal cells. For example, the transgene encoding GAA may be operatively linked to a CMV enhancer, a myocyte enhancer factor 2 (MEF2) enhancer, or a MyoD enhancer.
[0042] In some embodiments, the GAA has an amino acid sequence that is at least 85% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is identical to SEQ ID NO: 2 at 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). In some embodiments, the GAA has an amino acid sequence that is at least 90% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is identical to SEQ ID NO: 2 at 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). In some embodiments, the GAA has an amino acid sequence that is at least 95% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is identical to SEQ ID NO: 2 at 95%, 96%, 97%, 98%, 99%, or 100%). In some embodiments, the GAA has an amino acid sequence that is at least 97% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2). In some embodiments, the GAA has an amino acid sequence that is at least 98% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is 98%, 99%, or 100% identical to SEQ ID NO: 2). In some embodiments, the GAA has an amino acid sequence that is at least 99% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 2). In some embodiments, the GAA has an amino acid sequence that is 100% identical to SEQ ID NO: 2. In some embodiments, the GAA differs from the human wild-type GAA only in that one or more conserved amino acid substitutions are made. In some embodiments, the difference between GAA and human wild-type GAA is one or more non-conservative amino acid substitutions.
[0043] In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 97% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 98% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is 100% identical to SEQ ID NO: 3.
[0044] In some embodiments, the patient has infantile episodic Pompe disease. The patient may be, for example, from about one month to about one year old (e.g., about one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, or twelve months old). In some embodiments, the patient may be from about one month to about six months old (e.g., about one month, two months, three months, four months, five months, or six months old).
[0045] In some embodiments, prior to administering the AAV carrier to the patient, the patient exhibits symptoms selected from feeding difficulties, growth retardation, hypotonia, progressive weakness, respiratory distress, severe tongue swelling, and myocardial thickening.
[0046] In some embodiments, the patient has late-onset Pompe disease. The patient's endogenous GAA activity may be, for example, about 1% to about 40% of the endogenous GAA activity of individuals of the same sex and similar body mass index who do not have Pompe disease.
[0047] In some embodiments, the patient has not previously received GAA enzyme replacement therapy. In some embodiments, the patient has previously received GAA enzyme replacement therapy.
[0048] In some embodiments, after administration of the AAV carrier to a patient, the patient exhibits endogenous GAA activity of approximately 50% to approximately 200% of the endogenous GAA activity of individuals of the same sex and similar body mass index who do not have Pompe disease.
[0049] In some embodiments, after administration of an AAV carrier to a patient, the patient exhibits a reduction in glycogen in skeletal muscle, cardiac muscle, and / or neuronal tissue.
[0050] In another embodiment, this disclosure relates to a method for treating Pompe disease in a human patient by administering a drug that increases GAA expression to the patient in need. According to this embodiment, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity observed in a human individual of the same sex and similar body mass index after administering an AAV2 / 8 vector containing a transgenic gene encoding GAA at an amount of approximately 1 x 10¹³ vg / kg to approximately 5 x 10¹⁴ vg / kg (e.g., approximately 1 x 10¹³ vg / kg to approximately 3 x 10¹⁴ vg / kg). The transgenic gene encoding GAA is operatively linked to the MCK promoter. For example, the drug can be administered to a patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity observed in human individuals of the same sex and similar body mass index after administration of the AAV carrier in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg. vg / kg, 2.3 x 1013 vg / kg, 2.4 x 1013 vg / kg, 2.5 x 1013 vg / kg, 2.6 x 1013 vg / kg, 2.7 x 1013 vg / kg, 2.8 x 1013 vg / kg, 2.9 x 1013 vg / kg, 3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg、3.5 x 1013 vg / kg、3.6 x 1013 vg / kg、3.7 x 1013 vg / kg、3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 vg / kg, 4.2 x 1013 vg / kg, 4.3 x 1013 vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg, 4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg、5.3 x 1013 vg / kg、5.4 x 1013 vg / kg、5.5 x 1013 vg / kg、5.6 x 1013 vg / kg、5.7 x 1013 vg / kg、5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 10^14 vg / kg, 1.8 x 10^14 vg / kg, 1.9 x 10^14 vg / kg, 2 x 10^14 vg / kg, 2.1 x 10^14 vg / kg, 2.2 x 10^14 vg / kg, 2.3 x 10^14 vg / kg, 2.4 x 10^14 vg / kg, 2.5 x 10^14 vg / kg, 2.6 x 10^14 vg / kg, 2.7 x 10^14 vg / kg, 2.8 x 10^14 vg / kg, 2.9 x 10^14 vg / kg, 3 x 10^14 vg / kg, 3.1 x 10^14 vg / kg, 3.2 x 10^14 vg / kg, 3.3 x 10^14 vg / kg, 3.4 x 10^14 vg / kg, 3.5 x 10^14 vg / kg, 3.6 x 10^14 vg / kg, 3.7 x 10^14 vg / kg, 3.8 x 10^14 vg / kg, 3.9 x 10^14 vg / kg, 4 x 10^14 vg / kg, 4.1 x 10^14 vg / kg, 4.2 x 10^14 vg / kg, 4.3 x 10^14 vg / kg, 4.4 x 10^14 vg / kg, 4.5 x 10^14 vg / kg, 4.6 x 10^14 vg / kg, 4.7 x 10^14 vg / kg, 4.8 x 10^14 vg / kg, 4.9 x 10^14 vg / kg or 5 x 10^14 vg / kg.
[0051] In another embodiment, this disclosure relates to a method for improving muscle function in a human patient diagnosed with Pompe disease by administering a drug that increases GAA expression. According to this embodiment, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity observed in a human individual of the same sex and similar body mass index after administration of an AAV2 / 8 vector containing a transgenic gene encoding GAA at an amount of approximately 1 x 10¹³ vg / kg to approximately 5 x 10¹⁴ vg / kg (e.g., approximately 1 x 10¹³ vg / kg to approximately 3 x 10¹⁴ vg / kg). The transgenic gene encoding GAA is operatively linked to the MCK promoter. For example, the drug can be administered to a patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity observed in human individuals of the same sex and similar body mass index after administration of the AAV carrier in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg. vg / kg, 2.3 x 1013 vg / kg, 2.4 x 1013 vg / kg, 2.5 x 1013 vg / kg, 2.6 x 1013 vg / kg, 2.7 x 1013 vg / kg, 2.8 x 1013 vg / kg, 2.9 x 1013 vg / kg, 3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg、3.5 x 1013 vg / kg、3.6 x 1013 vg / kg、3.7 x 1013 vg / kg、3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 vg / kg, 4.2 x 1013 vg / kg, 4.3 x 1013 vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg、5.3 x 1013 vg / kg、5.4 x 1013 vg / kg、5.5 x 1013 vg / kg、5.6 x 1013 vg / kg、5.7 x 1013 vg / kg、5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 10^14 vg / kg, 1.7 x 10^14 vg / kg, 1.8 x 10^14 vg / kg, 1.9 x 10^14 vg / kg, 2 x 10^14 vg / kg, 2.1 x 10^14 vg / kg, 2.2 x 10^14 vg / kg, 2.3 x 10^14 vg / kg, 2.4 x 10^14 vg / kg, 2.5 x 10^14 vg / kg, 2.6 x 10^14 vg / kg, 2.7 x 10^14 vg / kg, 2.8 x 10^14 vg / kg, 2.9 x 10^14 vg / kg, 3 x 10^14 vg / kg, 3.1 x 10^14 vg / kg, 3.2 x 10^14 vg / kg, 3.3 x 10^14 vg / kg, 3.4 x 10^14 vg / kg, 3.5 x 10^14 vg / kg, 3.6 x 10^14 vg / kg, 3.7 x 10^14 vg / kg, 3.8 x 10^14 vg / kg, 3.9 x 10^14 vg / kg, 4 x 10^14 vg / kg, 4.1 x 10^14 vg / kg, 4.2 x 10^14 vg / kg, 4.3 x 10^14 vg / kg, 4.4 x 10^14 vg / kg, 4.5 x 10^14 vg / kg, 4.6 x 10^14 vg / kg, 4.7 x 10^14 vg / kg, 4.8 x 10^14 vg / kg, 4.9 x 10^14 vg / kg or 5 x 10^14 vg / kg..
[0052] In another embodiment, this disclosure relates to a method for reducing glycogen accumulation in a human patient diagnosed with Pompe disease by administering a drug that increases GAA expression. According to this embodiment, the drug is administered to the patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an AAV2 / 8 vector containing a transgenic gene encoding GAA at an amount of approximately 1 x 10¹³ vg / kg to approximately 5 x 10¹⁴ vg / kg (e.g., approximately 1 x 10¹³ vg / kg to approximately 3 x 10¹⁴ vg / kg), wherein the transgenic gene encoding GAA is operatively linked to the MCK promoter. For example, the drug can be administered to a patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity observed in human individuals of the same sex and similar body mass index after administration of the AAV carrier in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg. vg / kg, 2.3 x 1013 vg / kg, 2.4 x 1013 vg / kg, 2.5 x 1013 vg / kg, 2.6 x 1013 vg / kg, 2.7 x 1013 vg / kg, 2.8 x 1013 vg / kg, 2.9 x 1013 vg / kg, 3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg、3.5 x 1013 vg / kg、3.6 x 1013 vg / kg、3.7 x 1013 vg / kg、3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 vg / kg, 4.2 x 1013 vg / kg, 4.3 x 1013 vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg、5.3 x 1013 vg / kg、5.4 x 1013 vg / kg、5.5 x 1013 vg / kg、5.6 x 1013 vg / kg、5.7 x 1013 vg / kg、5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg, 2 x 1014 vg / kg, 2.1 x 1014 vg / kg, 2.2 x 1014 vg / kg, 2.3 x 1014 vg / kg, 2.4 x 1014 vg / kg, 2.5 x 1014 vg / kg, 2.6 x 1014 vg / kg, 2.7 x 1014 vg / kg, 2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg, 3 x 1014 vg / kg, 3.1 x 1014 vg / kg, 3.2 x 1014 vg / kg, 3.3 x 1014 vg / kg, 3.4 x 1014 vg / kg, 3.5 x 1014 vg / kg, 3.6 x 1014 vg / kg, 3.7 x 1014 vg / kg, 3.8 x 1014 vg / kg, 3.9 x 1014 vg / kg, 4 x 1014 vg / kg, 4.1 x 1014 vg / kg, 4.2 x 1014 vg / kg, 4.3 x 1014 vg / kg, 4.4 x 1014 vg / kg, 4.5 x 1014 vg / kg, 4.6 x 1014 vg / kg, 4.7 x 1014 vg / kg, 4.8 x 1014 vg / kg, 4.9 x 1014 vg / kg or 5 x 1014 vg / kg. In some embodiments of this approach, medication is administered to the patient to reduce glycogen accumulation in muscle tissue (e.g., cardiac and / or skeletal muscle tissue) and / or neuronal tissue.
[0053] In another embodiment, this disclosure relates to a method for improving lung function in a human patient diagnosed with Pompe disease by administering a drug that increases GAA expression. According to this embodiment, the drug is administered to the patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an AAV2 / 8 vector containing a transgenic gene encoding GAA at an amount of approximately 1 x 10¹³ vg / kg to approximately 5 x 10¹⁴ vg / kg (e.g., approximately 1 x 10¹³ vg / kg to approximately 3 x 10¹⁴ vg / kg), wherein the transgenic gene encoding GAA is operatively linked to the MCK promoter. For example, the drug can be administered to a patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity observed in human individuals of the same sex and similar body mass index after administration of the AAV carrier in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg. vg / kg, 2.3 x 1013 vg / kg, 2.4 x 1013 vg / kg, 2.5 x 1013 vg / kg, 2.6 x 1013 vg / kg, 2.7 x 1013 vg / kg, 2.8 x 1013 vg / kg, 2.9 x 1013 vg / kg, 3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg、3.5 x 1013 vg / kg、3.6 x 1013 vg / kg、3.7 x 1013 vg / kg、3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 vg / kg, 4.2 x 1013 vg / kg, 4.3 x 1013 vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg、5.3 x 1013 vg / kg、5.4 x 1013 vg / kg、5.5 x 1013 vg / kg、5.6 x 1013 vg / kg、5.7 x 1013 vg / kg、5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg, 2 x 1014 vg / kg, 2.1 x 1014 vg / kg, 2.2 x 1014 vg / kg, 2.3 x 1014 vg / kg, 2.4 x 1014 vg / kg, 2.5 x 1014 vg / kg, 2.6 x 1014 vg / kg, 2.7 x 1014 vg / kg, 2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg, 3 x 1014 vg / kg, 3.1 x 1014 vg / kg, 3.2 x 1014 vg / kg, 3.3 x 1014 vg / kg, 3.4 x 1014 vg / kg, 3.5 x 1014 vg / kg, 3.6 x 1014 vg / kg, 3.7 x 1014 vg / kg, 3.8 x 1014 vg / kg, 3.9 x 1014 vg / kg, 4 x 1014 vg / kg, 4.1 x 1014 vg / kg, 4.2 x 1014 vg / kg, 4.3 x 1014 vg / kg, 4.4 x 1014 vg / kg, 4.5 x 1014 vg / kg, 4.6 x 1014 vg / kg, 4.7 x 1014 vg / kg, 4.8 x 1014 vg / kg, 4.9 x 1014 vg / kg or 5 x 1014 vg / kg..
[0054] In another embodiment, this disclosure relates to a method for increasing GAA expression in a human patient diagnosed with Pompe disease by administering a drug that increases GAA expression. According to this embodiment, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity observed in a human individual of the same sex and similar body mass index after administration of an AAV2 / 8 vector containing a transgenic gene encoding GAA at an amount of approximately 1 x 10¹³ vg / kg to approximately 5 x 10¹⁴ vg / kg (e.g., approximately 1 x 10¹³ vg / kg to approximately 3 x 10¹⁴ vg / kg), wherein the transgenic gene encoding GAA is operatively linked to the MCK promoter. For example, the drug can be administered to a patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity observed in human individuals of the same sex and similar body mass index after administration of the AAV carrier in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg. vg / kg, 2.3 x 1013 vg / kg, 2.4 x 1013 vg / kg, 2.5 x 1013 vg / kg, 2.6 x 1013 vg / kg, 2.7 x 1013 vg / kg, 2.8 x 1013 vg / kg, 2.9 x 1013 vg / kg, 3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg、3.5 x 1013 vg / kg、3.6 x 1013 vg / kg、3.7 x 1013 vg / kg、3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 vg / kg, 4.2 x 1013 vg / kg, 4.3 x 1013 vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg、5.3 x 1013 vg / kg、5.4 x 1013 vg / kg、5.5 x 1013 vg / kg、5.6 x 1013 vg / kg、5.7 x 1013 vg / kg、5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 10^14 vg / kg, 1.7 x 10^14 vg / kg, 1.8 x 10^14 vg / kg, 1.9 x 10^14 vg / kg, 2 x 10^14 vg / kg, 2.1 x 10^14 vg / kg, 2.2 x 10^14 vg / kg, 2.3 x 10^14 vg / kg, 2.4 x 10^14 vg / kg, 2.5 x 10^14 vg / kg, 2.6 x 10^14 vg / kg, 2.7 x 10^14 vg / kg, 2.8 x 10^14 vg / kg, 2.9 x 10^14 vg / kg, 3 x 10^14 vg / kg, 3.1 x 10^14 vg / kg, 3.2 x 10^14 vg / kg, 3.3 x 10^14 vg / kg, 3.4 x 10^14 vg / kg, 3.5 x 10^14 vg / kg, 3.6 x 10^14 vg / kg, 3.7 x 10^14 vg / kg, 3.8 x 10^14 vg / kg, 3.9 x 10^14 vg / kg, 4 x 10^14 vg / kg, 4.1 x 10^14 vg / kg, 4.2 x 10^14 vg / kg, 4.3 x 10^14 vg / kg, 4.4 x 10^14 vg / kg, 4.5 x 10^14 vg / kg, 4.6 x 10^14 vg / kg, 4.7 x 10^14 vg / kg, 4.8 x 10^14 vg / kg, 4.9 x 10^14 vg / kg or 5 x 10^14 vg / kg..
[0055] In some embodiments of any of the five aforementioned embodiments disclosed herein, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an amount of approximately 2 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administration of the AAV carrier in amounts such as: approximately 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg, 2.7 x 10¹³ vg / kg, 2.8 x 10¹³ vg / kg, 2.9 x 10¹³ vg / kg, etc. 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg、3.5 x 1013 vg / kg、3.6 x 1013 vg / kg、3.7 x 1013 vg / kg,3.8 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg、5.3 x 1013 vg / kg、5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 vg / kg, 6.2 x 1013 vg / kg, 6.3 x 1013 vg / kg, 6.4 x 1013 vg / kg, 6.5 x 1013 vg / kg, 6.6 x 1013 vg / kg, 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 vg / kg, 7.2 x 1013 vg / kg, 7.3 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg、7.8 vg / kg, 8.6 x 1013 vg / kg、8.7 vg / kg,9.5 x 1013 vg / kg,9.6 x 1013 vg / kg,9.7 x 1013 vg / kg,9.8 x 1013 vg / kg,9.9 x 1013 vg / kg,1 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier at amounts ranging from approximately 2 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg, such as approximately 2 x 10¹³ vg / kg to approximately 4 x 10¹³ vg / kg (e.g., approximately 3 x 10¹³ vg / kg) or approximately 5 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg (e.g., approximately 6 x 10¹³ vg / kg).
[0056] In some embodiments of any of the five aforementioned embodiments disclosed herein, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an amount from approximately 3 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administration of the AAV carrier in amounts such as: approximately 3 x 10¹³ vg / kg, 3.1 x 10¹³ vg / kg, 3.2 x 10¹³ vg / kg, 3.3 x 10¹³ vg / kg, 3.4 x 10¹³ vg / kg, 3.5 x 10¹³ vg / kg, 3.6 x 10¹³ vg / kg, 3.7 x 10¹³ vg / kg, 3.8 x 10¹³ vg / kg, 3.9 x 10¹³ vg / kg, etc. 1013 vg / kg、4 vg / kg,4.8 x 1013 vg / kg,4.9 x 1013 vg / kg,5 x 1013 vg / kg,5.1 x 1013 vg / kg,5.2 x 1013 vg / kg,5.3 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 vg / kg, 6.2 x 1013 vg / kg, 6.3 x 1013 vg / kg, 6.4 x 1013 vg / kg,6.5 x 1013 vg / kg,6.6 x 1013 vg / kg,6.7 x 1013 vg / kg,6.8 x 1013 vg / kg,6.9 x 1013 vg / kg,7 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 10^13 vg / kg, 8 x 10^13 vg / kg, 8.1 x 10^13 vg / kg, 8.2 x 10^13 vg / kg, 8.3 x 10^13 vg / kg, 8.4 x 10^13 vg / kg, 8.5 x 10^13 vg / kg, 8.6 x 10^13 vg / kg, 8.7 x 10^13 vg / kg, 8.8 x 10^13 vg / kg, 8.9 x 10^13 vg / kg, 9 x 10^13 vg / kg, 9.1 x 10^13 vg / kg, 9.2 x 10^13 vg / kg, 9.3 x 10^13 vg / kg, 9.4 x 10^13 vg / kg, 9.5 x 10^13 vg / kg, 9.6 x 10^13 vg / kg, 9.7 x 10^13 vg / kg, 9.8 x 10^13 vg / kg, 9.9 x 10^13 vg / kg, 1 x 10^14 vg / kg, 1.1 x 10^14 vg / kg, 1.2 x 10^14 vg / kg, 1.3 x 10^14 vg / kg, 1.4 x 10^14 vg / kg, 1.5 x 10^14 vg / kg, 1.6 x 10^14 vg / kg, 1.7 x 10^14 vg / kg, 1.8 x 10^14 vg / kg, 1.9 x 10^14 vg / kg or 2 x 10^14 vg / kg..
[0057] In some embodiments of any of the five aforementioned embodiments disclosed herein, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an amount from approximately 4 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg to the AAV carrier, such as the following amounts: approximately 4 x 10¹³ vg / kg, 4.1 x 10¹³ vg / kg, 4.2 x 10¹³ vg / kg, 4.3 x 10¹³ vg / kg, 4.4 x 10¹³ vg / kg, 4.5 x 10¹³ vg / kg, 4.6 x 10¹³ vg / kg, 4.7 x 10¹³ vg / kg, 4.8 x 10¹³ vg / kg, 4.9 x 10¹³ vg / kg, etc. 1013 vg / kg、5 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 vg / kg, 6.2 x 1013 vg / kg, 6.3 x 1013 vg / kg, 6.4 x 1013 vg / kg, 6.5 x 1013 vg / kg, 6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg, 8.4 x 1013 vg / kg, 8.5 x 1013 vg / kg, 8.6 x 1013 vg / kg, 8.7 x 1013 vg / kg, 8.8 x 1013 vg / kg, 8.9 x 1013 vg / kg, 9 x 1013 vg / kg, 9.1 x 1013 vg / kg, 9.2 x 1013 vg / kg, 9.3 x 1013 vg / kg, 9.4 x 1013 vg / kg, 9.5 x 1013 vg / kg, 9.6 x 1013 vg / kg, 9.7 x 1013 vg / kg, 9.8 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg..
[0058] In some embodiments of any of the five aforementioned embodiments disclosed herein, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level in the patient, which is equivalent to the GAA activity level observed after administering the AAV carrier to a human individual of the same sex and similar body mass index at an amount of approximately 5 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administering the AAV carrier in the following amounts: 5 x 10¹³ vg / kg, 5.1 x 10¹³ vg / kg, 5.2 x 10¹³ vg / kg, 5.3 x 10¹³ vg / kg, 5.4 x 10¹³ vg / kg, 5.5 x 10¹³ vg / kg, 5.6 x 10¹³ vg / kg, 5.7 x 10¹³ vg / kg, 5.8 x 10¹³ vg / kg, 5.9 ... 1013 vg / kg、6 vg / kg、6.8 x 1013 vg / kg、7.7 vg / kg、8.5 x 1013 vg / kg, 9.4 x 1013 vg / kg, 9.5 x 1013 vg / kg, 9.6 x 1013 vg / kg, 9.7 x 1013 vg / kg, 9.8 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0059] In some embodiments of any of the five aforementioned embodiments disclosed herein, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an amount from approximately 6 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg to the AAV carrier, such as the following amounts: approximately 6 x 10¹³ vg / kg, 6.1 x 10¹³ vg / kg, 6.2 x 10¹³ vg / kg, 6.3 x 10¹³ vg / kg, 6.4 x 10¹³ vg / kg, 6.5 x 10¹³ vg / kg, 6.6 x 10¹³ vg / kg, 6.7 x 10¹³ vg / kg, 6.8 x 10¹³ vg / kg, 6.9 x 10¹³ vg / kg, etc. 1013 vg / kg、7 vg / kg、7.8 x 1013 vg / kg、8.7 vg / kg,9.5 x 1013 vg / kg,9.6 x 1013 vg / kg,9.7 x 1013 vg / kg,9.8 x 1013 vg / kg,9.9 x 1013 vg / kg,1 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg. .
[0060] In some embodiments of any of the five aforementioned embodiments disclosed herein, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an amount from approximately 7 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg to the AAV carrier, such as the following amounts: approximately 7 x 10¹³ vg / kg, 7.1 x 10¹³ vg / kg, 7.2 x 10¹³ vg / kg, 7.3 x 10¹³ vg / kg, 7.4 x 10¹³ vg / kg, 7.5 x 10¹³ vg / kg, 7.6 x 10¹³ vg / kg, 7.7 x 10¹³ vg / kg, 7.8 x 10¹³ vg / kg, 7.9 x 10¹³ vg / kg, etc. 1013 vg / kg、8 vg / kg、8.8 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0061] In some embodiments of any of the five aforementioned embodiments disclosed herein, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an amount from approximately 8 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg to the AAV carrier, such as the following amounts: approximately 8 x 10¹³ vg / kg, 8.1 x 10¹³ vg / kg, 8.2 x 10¹³ vg / kg, 8.3 x 10¹³ vg / kg, 8.4 x 10¹³ vg / kg, 8.5 x 10¹³ vg / kg, 8.6 x 10¹³ vg / kg, 8.7 x 10¹³ vg / kg, 8.8 x 10¹³ vg / kg, 8.9 x 10¹³ vg / kg, etc. 1013 vg / kg、9 vg / kg、9.8 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0062] In some embodiments of any of the five aforementioned embodiments disclosed herein, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level in the patient, which is equivalent to the GAA activity level observed after administering the AAV carrier to a human individual of the same sex and similar body mass index at an amount of approximately 9 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administering the AAV carrier in the following amounts: approximately 9 x 10¹³ vg / kg, 9.1 x 10¹³ vg / kg, 9.2 x 10¹³ vg / kg, 9.3 x 10¹³ vg / kg, 9.4 x 10¹³ vg / kg, 9.5 x 10¹³ vg / kg, 9.6 x 10¹³ vg / kg, 9.7 x 10¹³ vg / kg, 9.8 x 10¹³ vg / kg, 9.9 x 10¹³ vg / kg, etc. 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0063] In some embodiments of any of the five aforementioned embodiments disclosed herein, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level in the patient, which is equivalent to the GAA activity level observed after administering the AAV carrier to a human individual of the same sex and similar body mass index at an amount of approximately 1 x 10¹⁴ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administering the AAV carrier in the following amounts: approximately 1 x 10¹⁴ vg / kg, 1.1 x 10¹⁴ vg / kg, 1.2 x 10¹⁴ vg / kg, 1.3 x 10¹⁴ vg / kg, 1.4 x 10¹⁴ vg / kg, 1.5 x 10¹⁴ vg / kg, 1.6 x 10¹⁴ vg / kg, 1.7 x 10¹⁴ vg / kg, 1.8 x 10¹⁴ vg / kg, 1.9 ...9 x 10¹⁴ vg / kg, 1.9 x 10¹⁴ vg / kg 1014 vg / kg or 2 x 1014 vg / kg.
[0064] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain level of GAA activity in the patient, which is equivalent to the level of GAA activity observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier at an amount of approximately 6 x 10¹³ vg / kg.
[0065] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain level of GAA activity in the patient, which is equivalent to the level of GAA activity observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier at an amount of approximately 7 x 10¹³ vg / kg.
[0066] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain level of GAA activity in the patient, which is equivalent to the level of GAA activity observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier at an amount of approximately 8 x 10¹³ vg / kg.
[0067] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain level of GAA activity in the patient, which is equivalent to the level of GAA activity observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier at an amount of approximately 9 x 10¹³ vg / kg.
[0068] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain level of GAA activity in the patient, which is equivalent to the level of GAA activity observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier at an amount of about 1 x 10¹⁴ vg / kg.
[0069] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level in the patient, which is equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier in an amount of approximately 1.1 x 10¹⁴ vg / kg.
[0070] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain level of GAA activity in the patient, which is equivalent to the level of GAA activity observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier in an amount of approximately 1.2 x 10¹⁴ vg / kg.
[0071] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain level of GAA activity in the patient, which is equivalent to the level of GAA activity observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier in an amount of approximately 1.3 x 10¹⁴ vg / kg.
[0072] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level in the patient, which is equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier in an amount of approximately 1.4 x 10¹⁴ vg / kg.
[0073] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain level of GAA activity in the patient, which is equivalent to the level of GAA activity observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier in an amount of approximately 1.5 x 10¹⁴ vg / kg.
[0074] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level in the patient, which is equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier in an amount of approximately 1.6 x 10¹⁴ vg / kg.
[0075] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level in the patient, which is equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier in an amount of approximately 1.7 x 10¹⁴ vg / kg.
[0076] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain level of GAA activity in the patient, which is equivalent to the level of GAA activity observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier in an amount of approximately 1.8 x 10¹⁴ vg / kg.
[0077] In some embodiments of any of the five states described above in this disclosure, the agent is administered to a patient in an amount sufficient to achieve a certain GAA activity level in the patient, which is equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier in an amount of approximately 1.9 x 10¹⁴ vg / kg.
[0078] In some embodiments of any of the five states described above in this disclosure, the agent is administered to the patient in an amount sufficient to achieve a certain GAA activity level in the patient, which is equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier at an amount of about 2 x 10¹⁴ vg / kg.
[0079] In some embodiments, the drug is administered to the patient in a single dose. In some embodiments, the drug is administered to the patient in two or more doses.
[0080] In some embodiments, the drug is administered to the patient via intravenous, intrathecal, intracisional, intravenous, intramuscular, intradermal, transdermal, non-intestinal, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and / or oral administration.
[0081] In some embodiments, the agent contains (i) a nucleic acid molecule encoding GAA, (ii) one or more interfering RNA molecules that collectively increase the expression of endogenous GAA, (iii) one or more nucleic acid molecules encoding one or more interfering RNA molecules, (iv) a GAA protein, and / or (v) one or more small molecules that collectively increase the expression of endogenous GAA. For example, the agent may be an agent containing one or more interfering RNA molecules, including short interfering RNA (siRNA), short hairpin RNA (shRNA), and / or microRNA (miRNA).
[0082] In some embodiments, the agent contains a nucleic acid molecule encoding GAA. The nucleic acid molecule encoding GAA can be provided to a patient, for example, by administering a viral vector containing that nucleic acid molecule. The viral vector can be, for example, AAV, adenovirus, parvovirus, coronavirus, rod-shaped virus, paramyxovirus, picornavirus, alpha virus, herpesvirus, poxvirus, or retroviral virus.
[0083] In some embodiments, the nucleic acid molecule encoding GAA is provided to the patient by administering an AAV containing that nucleic acid molecule. The AAV may have a serotype, for example, selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAVrh74. In some embodiments, the AAV is a pseudotyped AAV. In some embodiments, the pseudotyped AAV is AAV2 / 8. In some embodiments, the AAV is a pseudotyped AAV. In some embodiments, the pseudotyped AAV is AAV2 / 9. In some embodiments, the AAV contains a recombinant capsid protein.
[0084] In some embodiments, the nucleic acid molecule encoding GAA is operatively linked to a promoter that induces the expression of the transgenic gene in muscle and / or neuronal cells. The promoter may be, for example, the MCK promoter, desmin promoter, chicken β-actin promoter, CMV promoter, myosin light chain-2 promoter, α-actin promoter, troponin 1 promoter, Na+ / Ca2+ exchanger promoter, dystrophin promoter, α7 integrin promoter, brain natriuretic peptide promoter, α-β-crystallin / small heat shock protein promoter, α-myosin heavy chain promoter, or atrial natriuretic factor promoter.
[0085] In some embodiments, the promoter is an MCK promoter. The MCK promoter may have a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 97% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 98% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is 100% identical to SEQ ID NO: 1.
[0086] In some embodiments, the nucleic acid molecule encoding GAA is operatively linked to an enhancer that induces the expression of the transgenic gene in muscle and / or neuronal cells. For example, the nucleic acid molecule encoding GAA may be operatively linked to a CMV enhancer, a MEF2 enhancer, or a MyoD enhancer.
[0087] In some embodiments, the GAA has an amino acid sequence that is at least 85% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is identical to SEQ ID NO: 2 at 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). In some embodiments, the GAA has an amino acid sequence that is at least 90% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is identical to SEQ ID NO: 2 at 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). In some embodiments, the GAA has an amino acid sequence that is at least 95% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is identical to SEQ ID NO: 2 at 95%, 96%, 97%, 98%, 99%, or 100%). In some embodiments, the GAA has an amino acid sequence that is at least 97% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2). In some embodiments, the GAA has an amino acid sequence that is at least 98% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is 98%, 99%, or 100% identical to SEQ ID NO: 2). In some embodiments, the GAA has an amino acid sequence that is at least 99% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 2). In some embodiments, the GAA has an amino acid sequence that is 100% identical to SEQ ID NO: 2. In some embodiments, the GAA differs from the human wild-type GAA only in that one or more conserved amino acid substitutions are made. In some embodiments, the difference between GAA and human wild-type GAA is one or more non-conservative amino acid substitutions.
[0088] In some embodiments, the nucleic acid molecule encoding GAA has a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the nucleic acid molecule encoding GAA has a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the nucleic acid molecule encoding GAA has a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the nucleic acid molecule encoding GAA has a nucleic acid sequence that is at least 97% identical to SEQ ID NO: 3 (e.g., 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the nucleic acid molecule encoding GAA has a nucleic acid sequence that is at least 98% identical to SEQ ID NO: 3 (e.g., 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the nucleic acid molecule encoding GAA has a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 3 (e.g., 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 3). In some embodiments, the nucleic acid molecule encoding GAA has a nucleic acid sequence that is 100% identical to SEQ ID NO: 3.
[0089] In some embodiments, the patient has infantile episodic Pompe disease. The patient may be, for example, from about one month to about one year old (e.g., about one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, or twelve months old). In some embodiments, the patient may be from about one month to about six months old (e.g., about one month, two months, three months, four months, five months, or six months old).
[0090] In some embodiments, prior to administering the AAV carrier to the patient, the patient exhibits symptoms selected from feeding difficulties, growth retardation, hypotonia, progressive weakness, respiratory distress, severe tongue swelling, and myocardial thickening.
[0091] In some embodiments, the patient has late-onset Pompe disease. The patient's endogenous GAA activity may be, for example, about 1% to about 40% of the endogenous GAA activity of individuals of the same sex and similar body mass index who do not have Pompe disease.
[0092] In some embodiments, the patient has not previously received GAA enzyme replacement therapy. In some embodiments, the patient has previously received GAA enzyme replacement therapy.
[0093] In some embodiments, after administration of the AAV carrier to a patient, the patient exhibits endogenous GAA activity of approximately 50% to approximately 200% of the endogenous GAA activity of individuals of the same sex and similar body mass index who do not have Pompe disease.
[0094] In some embodiments, after administration of an AAV carrier to a patient, the patient exhibits a reduction in glycogen in skeletal muscle, cardiac muscle, and / or neuronal tissue.
[0095] In another embodiment, this disclosure relates to a kit containing (i) an AAV vector containing a transgenic gene encoding GAA, for example in the amount specified above, or (ii) a drug that increases GAA expression, for example in the amount specified above. The kit may further contain, for example, instructions for use, that direct the user of the kit to administer the AAV vector or drug to a human patient according to any of the methods described in the above embodiments of this disclosure.
[0096] In another embodiment, this disclosure relates to the use of an AAV vector containing a transgenic gene encoding GAA for the manufacture of a drug for treating Pompe disease in human patients in need, wherein the drug contains an amount of about 1 x 10¹³ vg / kg to about 5 x 10¹⁴ vg / kg (e.g., about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg) of the AAV vector. For example, a drug may contain the following amounts of AAV carrier: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg, etc. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 1014 vg / kg、2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg, 3 x 1014 vg / kg, 3.1 x 1014 vg / kg, 3.2 x 1014 vg / kg, 3.3 x 1014 vg / kg, 3.4 x 1014 vg / kg, 3.5 x 1014 vg / kg, 3.6 x 1014 vg / kg, 3.7 x 1014 vg / kg, 3.8 x 1014 vg / kg, 3.9 x 1014 vg / kg, 4 x 1014 vg / kg, 4.1 x 1014 vg / kg, 4.2 x 1014 vg / kg, 4.3 x 1014 vg / kg, 4.4 x 1014 vg / kg, 4.5 x 1014 vg / kg, 4.6 x 1014 vg / kg, 4.7 x 1014 vg / kg, 4.8 x 1014 vg / kg, 4.9 x 1014 vg / kg or 5 x 1014 vg / kg..
[0097] In another embodiment, this disclosure relates to the use of an AAV vector containing a transgenic gene encoding GAA for the manufacture of a drug for improving muscle function in human patients diagnosed with Pompe disease, wherein the drug contains an amount of about 1 x 10¹³ vg / kg to about 5 x 10¹⁴ vg / kg (e.g., about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg) of the AAV vector. For example, a drug may contain the following amounts of AAV carrier: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg, etc. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 1014 vg / kg、2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg, 3 x 1014 vg / kg, 3.1 x 1014 vg / kg, 3.2 x 1014 vg / kg, 3.3 x 1014 vg / kg, 3.4 x 1014 vg / kg, 3.5 x 1014 vg / kg, 3.6 x 1014 vg / kg, 3.7 x 1014 vg / kg, 3.8 x 1014 vg / kg, 3.9 x 1014 vg / kg, 4 x 1014 vg / kg, 4.1 x 1014 vg / kg, 4.2 x 1014 vg / kg, 4.3 x 1014 vg / kg, 4.4 x 1014 vg / kg, 4.5 x 1014 vg / kg, 4.6 x 1014 vg / kg, 4.7 x 1014 vg / kg, 4.8 x 1014 vg / kg, 4.9 x 1014 vg / kg or 5 x 1014 vg / kg..
[0098] <In another embodiment, this disclosure relates to the use of an AAV vector containing a transgenic gene encoding GAA for the manufacture of a drug for reducing glycogen accumulation in human patients diagnosed with Pompe disease (e.g., in muscle and / or neuronal tissue), wherein the drug contains an amount of about 1 x 10¹³ vg / kg to about 5 x 10¹⁴ vg / kg (e.g., about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg) of the AAV vector. For example, a drug may contain the following amounts of AAV carrier: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg, etc. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 1014 vg / kg, 2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg, 3 x 1014 vg / kg, 3.1 x 1014 vg / kg, 3.2 x 1014 vg / kg, 3.3 x 1014 vg / kg, 3.4 x 1014 vg / kg, 3.5 x 1014 vg / kg, 3.6 x 1014 vg / kg, 3.7 x 1014 vg / kg, 3.8 x 1014 vg / kg, 3.9 x 1014 vg / kg, 4 x 1014 vg / kg, 4.1 x 1014 vg / kg, 4.2 x 1014 vg / kg, 4.3 x 1014 vg / kg, 4.4 x 1014 vg / kg, 4.5 x 1014 vg / kg, 4.6 x 1014 vg / kg, 4.7 x 1014 vg / kg, 4.8 x 1014 vg / kg, 4.9 x 1014 vg / kg or 5 x 1014 vg / kg..
[0099] In another embodiment, this disclosure relates to the use of an AAV vector containing a transgenic gene encoding GAA for the manufacture of a drug for improving lung function in human patients diagnosed with Pompe disease, wherein the drug contains an amount of about 1 x 10¹³ vg / kg to about 5 x 10¹⁴ vg / kg (e.g., about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg) of the AAV vector. For example, a drug may contain the following amounts of AAV carrier: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg, etc. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 1014 vg / kg、2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg, 3 x 1014 vg / kg, 3.1 x 1014 vg / kg, 3.2 x 1014 vg / kg, 3.3 x 1014 vg / kg, 3.4 x 1014 vg / kg, 3.5 x 1014 vg / kg, 3.6 x 1014 vg / kg, 3.7 x 1014 vg / kg, 3.8 x 1014 vg / kg, 3.9 x 1014 vg / kg, 4 x 1014 vg / kg, 4.1 x 1014 vg / kg, 4.2 x 1014 vg / kg, 4.3 x 1014 vg / kg, 4.4 x 1014 vg / kg, 4.5 x 1014 vg / kg, 4.6 x 1014 vg / kg, 4.7 x 1014 vg / kg, 4.8 x 1014 vg / kg, 4.9 x 1014 vg / kg or 5 x 1014 vg / kg..
[0100] In another embodiment, this disclosure relates to the use of an AAV vector containing a transgenic gene encoding GAA for the manufacture of a drug for increasing GAA expression in human patients diagnosed with Pompe disease, wherein the drug contains an amount of about 1 x 10¹³ vg / kg to about 5 x 10¹⁴ vg / kg (e.g., about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg) of the AAV vector. For example, a drug may contain the following amounts of AAV carrier: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg, etc. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 1014 vg / kg, 2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg, 3 x 1014 vg / kg, 3.1 x 1014 vg / kg, 3.2 x 1014 vg / kg, 3.3 x 1014 vg / kg, 3.4 x 1014 vg / kg, 3.5 x 1014 vg / kg, 3.6 x 1014 vg / kg, 3.7 x 1014 vg / kg, 3.8 x 1014 vg / kg, 3.9 x 1014 vg / kg, 4 x 1014 vg / kg, 4.1 x 1014 vg / kg, 4.2 x 1014 vg / kg, 4.3 x 1014 vg / kg, 4.4 x 1014 vg / kg, 4.5 x 1014 vg / kg, 4.6 x 1014 vg / kg, 4.7 x 1014 vg / kg, 4.8 x 1014 vg / kg, 4.9 x 1014 vg / kg or 5 x 1014 vg / kg..
[0101] In some embodiments of any of the five aforementioned samples disclosed herein, the drug contains an amount of about 2 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as the following amounts of AAV carrier: about 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg, 2.7 x 10¹³ vg / kg, 2.8 x 10¹³ vg / kg, 2.9 x 10¹³ vg / kg, 3 x 10¹³ vg / kg, 3.1 x 10¹³ vg / kg, 3.2 x 10¹³ vg / kg, 3.3 x 10¹³ vg / kg. vg / kg, 3.4 x 1013 vg / kg, 3.5 x 1013 vg / kg, 3.6 x 1013 vg / kg, 3.7 x 1013 vg / kg, 3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 5 x 1013 vg / kg, 5.1 x 1013 vg / kg、5.2 x 1013 vg / kg、5.3 x 1013 vg / kg、5.4 x 1013 vg / kg、5.5 x 1013 vg / kg、5.6 x 1013 vg / kg、5.7 x 1013 vg / kg、5.8 x 1013 vg / kg、5.9 x 1013 vg / kg,6 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 vg / kg, 7.2 x 1013 vg / kg, 7.3 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 1013 vg / kg, 8 x 1013 vg / kg, 8.1 x 1013 vg / kg, 8.2 x 1013 vg / kg, 8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg, 9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 10¹⁴ vg / kg. In some embodiments, the drug contains amounts from about 2 x 10¹³ vg / kg to about 7 x 10¹³ vg / kg, such as about 2 x 10¹³ vg / kg to about 4 x 10¹³ vg / kg (e.g., about 3 x 10¹³ vg / kg) or about 5 x 10¹³ vg / kg to about 7 x 10¹³ vg / kg (e.g., about 6 x 10¹³ vg / kg) of AAV carrier.
[0102] In some embodiments of any of the five aforementioned samples disclosed herein, the drug contains an amount of approximately 3 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the following amounts of AAV carrier: approximately 3 x 10¹³ vg / kg, 3.1 x 10¹³ vg / kg, 3.2 x 10¹³ vg / kg, 3.3 x 10¹³ vg / kg, 3.4 x 10¹³ vg / kg, 3.5 x 10¹³ vg / kg, 3.6 x 10¹³ vg / kg, 3.7 x 10¹³ vg / kg, 3.8 x 10¹³ vg / kg, 3.9 x 10¹³ vg / kg, 4 x 10¹³ vg / kg, 4.1 x 10¹³ vg / kg, 4.2 x 10¹³ vg / kg, 4.3 x 10¹³ vg / kg. vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg, 4.8 x 1013 vg / kg, 4.9 x 1013 vg / kg, 5 x 1013 vg / kg, 5.1 x 1013 6 x 1013 vg / kg, 6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg,7 x 1013 vg / kg, 7.9 x 1013 vg / kg, 8 x 1013 vg / kg, 8.1 x 1013 vg / kg, 8.2 x 1013 vg / kg, 8.3 x 1013 vg / kg, 8.4 x 1013 vg / kg, 8.5 x 1013 vg / kg, 8.6 x 1013 vg / kg, 8.7 x 1013 vg / kg, 8.8 x 1013 vg / kg, 8.9 x 1013 vg / kg, 9 x 1013 vg / kg, 9.1 x 1013 vg / kg, 9.2 x 1013 vg / kg, 9.3 x 1013 vg / kg, 9.4 x 1013 vg / kg, 9.5 x 1013 vg / kg, 9.6 x 1013 vg / kg, 9.7 x 1013 vg / kg, 9.8 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg..
[0103] In some embodiments of any of the five aforementioned samples disclosed herein, the drug contains an amount of approximately 4 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the following amounts of AAV carrier: approximately 4 x 10¹³ vg / kg, 4.1 x 10¹³ vg / kg, 4.2 x 10¹³ vg / kg, 4.3 x 10¹³ vg / kg, 4.4 x 10¹³ vg / kg, 4.5 x 10¹³ vg / kg, 4.6 x 10¹³ vg / kg, 4.7 x 10¹³ vg / kg, 4.8 x 10¹³ vg / kg, 4.9 x 10¹³ vg / kg, 5 x 10¹³ vg / kg, 5.1 x 10¹³ vg / kg, 5.2 x 10¹³ vg / kg, 5.3 x 10¹³ vg / kg. vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 7 x 1013 vg / kg, 7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg,8 x 1013 vg / kg,8.1 x 1013 vg / kg,8.2 x 1013 vg / kg,8.3 x 1013 vg / kg,8.4 x 1013 vg / kg,8.5 x 1013 vg / kg,8.6 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 10^13 vg / kg, 9.6 x 10^13 vg / kg, 9.7 x 10^13 vg / kg, 9.8 x 10^13 vg / kg, 9.9 x 10^13 vg / kg, 1 x 10^14 vg / kg, 1.1 x 10^14 vg / kg, 1.2 x 10^14 vg / kg, 1.3 x 10^14 vg / kg, 1.4 x 10^14 vg / kg, 1.5 x 10^14 vg / kg, 1.6 x 10^14 vg / kg, 1.7 x 10^14 vg / kg, 1.8 x 10^14 vg / kg, 1.9 x 10^14 vg / kg or 2 x 10^14 vg / kg..
[0104] In some embodiments of any of the five aforementioned samples disclosed herein, the drug contains an amount of approximately 5 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the following amounts of AAV carrier: approximately 5 x 10¹³ vg / kg, 5.1 x 10¹³ vg / kg, 5.2 x 10¹³ vg / kg, 5.3 x 10¹³ vg / kg, 5.4 x 10¹³ vg / kg, 5.5 x 10¹³ vg / kg, 5.6 x 10¹³ vg / kg, 5.7 x 10¹³ vg / kg, 5.8 x 10¹³ vg / kg, 5.9 x 10¹³ vg / kg, 6 x 10¹³ vg / kg, 6.1 x 10¹³ vg / kg, 6.2 x 10¹³ vg / kg, 6.3 x 10¹³ vg / kg. vg / kg, 6.4 x 1013 vg / kg, 6.5 x 1013 vg / kg, 6.6 x 1013 vg / kg, 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 8 x 1013 vg / kg, 8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg,9 x 1013 vg / kg,9.1 x 1013 vg / kg,9.2 x 1013 vg / kg,9.3 x 1013 vg / kg,9.4 x 1013 vg / kg,9.5 x 1013 vg / kg,9.6 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0105] In some embodiments of any of the five aforementioned samples disclosed herein, the drug contains an amount of approximately 6 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the following amounts of AAV carrier: approximately 6 x 10¹³ vg / kg, 6.1 x 10¹³ vg / kg, 6.2 x 10¹³ vg / kg, 6.3 x 10¹³ vg / kg, 6.4 x 10¹³ vg / kg, 6.5 x 10¹³ vg / kg, 6.6 x 10¹³ vg / kg, 6.7 x 10¹³ vg / kg, 6.8 x 10¹³ vg / kg, 6.9 x 10¹³ vg / kg, 7 x 10¹³ vg / kg, 7.1 x 10¹³ vg / kg, 7.2 x 10¹³ vg / kg, 7.3 x 10¹³ vg / kg. vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg,8.2 x 1013 vg / kg, 9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg,1 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0106] In some embodiments of any of the five aforementioned samples disclosed herein, the drug contains an amount of approximately 7 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the following amounts of AAV carrier: approximately 7 x 10¹³ vg / kg, 7.1 x 10¹³ vg / kg, 7.2 x 10¹³ vg / kg, 7.3 x 10¹³ vg / kg, 7.4 x 10¹³ vg / kg, 7.5 x 10¹³ vg / kg, 7.6 x 10¹³ vg / kg, 7.7 x 10¹³ vg / kg, 7.8 x 10¹³ vg / kg, 7.9 x 10¹³ vg / kg, 8 x 10¹³ vg / kg, 8.1 x 10¹³ vg / kg, 8.2 x 10¹³ vg / kg, 8.3 x 10¹³ vg / kg. vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0107] In some embodiments of any of the five aforementioned samples disclosed herein, the drug contains an amount of approximately 8 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the following amounts of AAV carrier: approximately 8 x 10¹³ vg / kg, 8.1 x 10¹³ vg / kg, 8.2 x 10¹³ vg / kg, 8.3 x 10¹³ vg / kg, 8.4 x 10¹³ vg / kg, 8.5 x 10¹³ vg / kg, 8.6 x 10¹³ vg / kg, 8.7 x 10¹³ vg / kg, 8.8 x 10¹³ vg / kg, 8.9 x 10¹³ vg / kg, 9 x 10¹³ vg / kg, 9.1 x 10¹³ vg / kg, 9.2 x 10¹³ vg / kg, 9.3 x 10¹³ vg / kg. vg / kg, 9.4 x 1013 vg / kg, 9.5 x 1013 vg / kg, 9.6 x 1013 vg / kg, 9.7 x 1013 vg / kg, 9.8 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0108] In some embodiments of any of the five aforementioned samples disclosed herein, the drug contains an amount of approximately 9 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the following amounts of AAV carrier: approximately 9 x 10¹³ vg / kg, 9.1 x 10¹³ vg / kg, 9.2 x 10¹³ vg / kg, 9.3 x 10¹³ vg / kg, 9.4 x 10¹³ vg / kg, 9.5 x 10¹³ vg / kg, 9.6 x 10¹³ vg / kg, 9.7 x 10¹³ vg / kg, 9.8 x 10¹³ vg / kg, 9.9 x 10¹³ vg / kg, 1 x 10¹⁴ vg / kg, 1.1 x 10¹⁴ vg / kg, 1.2 x 10¹⁴ vg / kg, 1.3 x 10¹⁴ vg / kg, etc. vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0109] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of about 1 x 10¹⁴ vg / kg to about 2 x 10¹⁴ vg / kg, such as the following amounts of AAV carrier: about 1 x 10¹⁴ vg / kg, 1.1 x 10¹⁴ vg / kg, 1.2 x 10¹⁴ vg / kg, 1.3 x 10¹⁴ vg / kg, 1.4 x 10¹⁴ vg / kg, 1.5 x 10¹⁴ vg / kg, 1.6 x 10¹⁴ vg / kg, 1.7 x 10¹⁴ vg / kg, 1.8 x 10¹⁴ vg / kg, 1.9 x 10¹⁴ vg / kg or 2 x 10¹⁴ vg / kg.
[0110] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 6 x 10¹³ vg / kg.
[0111] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 7 x 10¹³ vg / kg.
[0112] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 8 x 10¹³ vg / kg.
[0113] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 9 x 10¹³ vg / kg.
[0114] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 1 x 10¹⁴ vg / kg.
[0115] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 1.1 x 10¹⁴ vg / kg.
[0116] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 1.2 x 10¹⁴ vg / kg.
[0117] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 1.3 x 10¹⁴ vg / kg.
[0118] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 1.4 x 10¹⁴ vg / kg.
[0119] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 1.5 x 10¹⁴ vg / kg.
[0120] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 1.6 x 10¹⁴ vg / kg.
[0121] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 1.7 x 10¹⁴ vg / kg.
[0122] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 1.8 x 10¹⁴ vg / kg.
[0123] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 1.9 x 10¹⁴ vg / kg.
[0124] In some embodiments of any of the five states described above in this disclosure, the drug contains an amount of AAV carrier of about 2 x 10¹⁴ vg / kg.
[0125] In some embodiments, the AAV carrier is dispensed for administration to a patient in a single dose containing the specified amount. In some embodiments, the AAV carrier is dispensed for administration to a patient in two or more doses totaling the specified amount (e.g., two, three, four, five, six, seven, eight, nine, or ten doses totaling the specified amount). In some embodiments, the AAV carrier is dispensed for administration to a patient in two or more doses, each individually containing the specified amount (e.g., two, three, four, five, six, seven, eight, nine, or ten doses each individually containing the specified amount).
[0126] In some embodiments, AAV carriers are prepared for intravenous, intrathecal, intracisional, intraventricular, intramuscular, intradermal, transdermal, non-enteric, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and / or oral administration to a patient. For example, AAV carriers can be prepared for intravenous, intrathecal, intracisional, intraventricular, and / or intramuscular administration to a patient. In some embodiments, AAV carriers are prepared for intravenous and / or intrathecal administration to a patient. For example, AAV carriers can be prepared for intravenous administration to a patient.
[0127] In some embodiments, the AAV is a serotype of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh74, AAVrh.8, or AAVrh.10. In some embodiments, the AAV is a pseudotype of AAV, such as AAV2 / 8 or AAV2 / 9. In some embodiments, the AAV contains a recombinant capsid protein.
[0128] In some embodiments, the transgene encoding GAA is operatively linked to a promoter that induces the expression of the transgene in muscle and / or neuronal cells. The promoter may be, for example, the MCK promoter, desmin promoter, chicken β-actin promoter, CMV promoter, myosin light chain-2 promoter, α-actin promoter, troponin 1 promoter, Na+ / Ca2+ exchanger promoter, dystrophin promoter, α7 integrin promoter, brain natriuretic peptide promoter, α-β-crystallin / small heat shock protein promoter, α-myosin heavy chain promoter, or atrial natriuretic factor promoter.
[0129] In some embodiments, the promoter is an MCK promoter. The MCK promoter may have a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 97% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 98% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 98%, 99%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 1 (e.g., a nucleic acid sequence that is 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 1). In some embodiments, the MCK promoter has a nucleic acid sequence that is 100% identical to SEQ ID NO: 1.
[0130] In some embodiments, the transgene encoding GAA is operatively linked to an enhancer that induces the expression of the transgene in muscle and / or neuronal cells. For example, the transgene encoding GAA may be operatively linked to a CMV enhancer, a MEF2 enhancer, or a MyoD enhancer.
[0131] In some embodiments, the GAA has an amino acid sequence that is at least 85% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is identical to SEQ ID NO: 2 at 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). In some embodiments, the GAA has an amino acid sequence that is at least 90% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is identical to SEQ ID NO: 2 at 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%). In some embodiments, the GAA has an amino acid sequence that is at least 95% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is identical to SEQ ID NO: 2 at 95%, 96%, 97%, 98%, 99%, or 100%). In some embodiments, the GAA has an amino acid sequence that is at least 97% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2). In some embodiments, the GAA has an amino acid sequence that is at least 98% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is 98%, 99%, or 100% identical to SEQ ID NO: 2). In some embodiments, the GAA has an amino acid sequence that is at least 99% identical to SEQ ID NO: 2 (e.g., an amino acid sequence that is 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 2). In some embodiments, the GAA has an amino acid sequence that is 100% identical to SEQ ID NO: 2. In some embodiments, the GAA differs from the human wild-type GAA only in that one or more conserved amino acid substitutions are made. In some embodiments, the difference between GAA and human wild-type GAA is one or more non-conservative amino acid substitutions.
[0132] In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 97% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 98% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 98%, 99%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is at least 99% identical to SEQ ID NO: 3 (e.g., a nucleic acid sequence that is 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical to SEQ ID NO: 3). In some embodiments, the transgenic gene encoding GAA has a nucleic acid sequence that is 100% identical to SEQ ID NO: 3.
[0133] In some embodiments, the patient has infantile episodic Pompe disease. The patient may be, for example, from about one month to about one year old (e.g., about one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, ten months, eleven months, or twelve months old). In some embodiments, the patient may be from about one month to about six months old (e.g., about one month, two months, three months, four months, five months, or six months old).
[0134] In some embodiments, prior to administering the AAV carrier to the patient, the patient exhibits symptoms selected from feeding difficulties, growth retardation, hypotonia, progressive weakness, respiratory distress, severe tongue swelling, and myocardial thickening.
[0135] In some embodiments, the patient has late-onset Pompe disease. The patient's endogenous GAA activity may be, for example, about 1% to about 40% of the endogenous GAA activity of individuals of the same sex and similar body mass index who do not have Pompe disease.
[0136] In some embodiments, the patient has not previously received GAA enzyme replacement therapy. In some embodiments, the patient has previously received GAA enzyme replacement therapy.
[0137] In some embodiments, after administration of the AAV carrier to a patient, the patient exhibits endogenous GAA activity of approximately 50% to approximately 200% of the endogenous GAA activity of individuals of the same sex and similar body mass index who do not have Pompe disease.
[0138] In some embodiments, after administration of an AAV carrier to a patient, the patient exhibits a reduction in glycogen in skeletal muscle, cardiac muscle, and / or neuronal tissue. Simple Explanation of the Diagram
[0139] [picture] [1A] [and] [1B] As described in Example 1 below, the graphs show the changes in the expression and activity levels of acid α-glucosidase (GAA) protein in the muscles of mice treated with the AAV2 / 8 vector containing a GAA transgene operatively linked to the muscle creatine kinase (MCK) promoter. [picture] [2A](Week 12) [、] [2B] [and] [2C] is a graph and representative image showing the changes in liver glycogen content in the muscle of mice treated with the AAV2 / 8 vector, as described in Example 1 below. The AAV2 / 8 vector contains a GAA transgenic gene operatively linked to the MCK promoter. [。] [picture] [3] As described in Example 1 below, this shows a graph of the change in motor function over time as measured by a continuous grip strength test in mice treated with the AAV2 / 8 vector, which contains a GAA transgene operatively linked to the MCK promoter. [picture] [4A] (Male) [and] [4B] (Female) is a graph showing the changes in alanine transaminase (ALT) activity in non-human primates treated with the AAV2 / 8 vector containing a GAA transgene operatively linked to the MCK promoter, as described in Example 2 below. [picture] [5A] (Male) [and] [5B] (Female) is a graph showing the changes in aspartate transaminase (AST) activity in non-human primates treated with the AAV2 / 8 vector containing a GAA transgene operatively linked to the MCK promoter, as described in Example 2 below. [picture] [6A] (Male) [、] [6B](Female) [and] [6C] is a graph showing the changes in troponin-I expression in non-human primates (male, female, and sex combination data) treated with the AAV2 / 8 vector containing a human GAA transgene operatively linked to the MCK promoter, as described in Example 2 below. [picture] [7] As described in Example 2 below, this figure shows the changes in troponin-I expression in non-human primates treated with the AAV2 / 8 vector containing the cynomolgus monkey GAA transgenic gene operatively linked to the MCK promoter. [ ] [picture] [8A] (Male) [and] [8B] (female) is a graph showing changes in brain natriuretic peptide (BNP) expression in non-human primates treated with an AAV2 / 8 vector containing a GAA transgene operatively linked to the MCK promoter, as described in Example 2 below. [picture] [9A] [and] [9B] is a graph showing the changes in the expression of human or cynomolgus monkey GAA proteins in the muscle of non-human primates treated with AAV2 / 8 vectors, as described in Example 2 below, which contain human or cynomolgus monkey GAA transgenic genes operatively linked to the MCK promoter. [picture] [10A] [and] [10B] is a graph showing the changes in the expression of human or cynomolgus monkey GAA protein in the serum of non-human primates treated with AAV2 / 8 vectors, which contain human or cynomolgus monkey GAA transgenic genes operatively linked to the MCK promoter, as described in Example 2 below. Implementation
[0140] [ ] [Sequence List] [ ] This application contains a sequence list, which has been electronically submitted in ASCII format and is incorporated herein by reference in its entirety. A copy of this ASCII file, created on September 30, 2020, is named 51037-054TW3_Sequence_Listing_10_01_20_ST25 and is 13,144 bytes in size. [definition] [ ]
[0141] As used herein, the term "about" refers to a value that is within 5% higher or lower than the stated value. For example, as used in the context of viral vectors described herein, "about 1 x 10¹³ vg / kg" includes amounts within 5% higher or lower than 1 x 10¹³ vg / kg. Furthermore, when used in the context of a list of numerical quantities, it should be understood that when the term "about" precedes the list of numerical quantities, it applies to each individual quantity listed in the list. For example, "about 1 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, or 3 x 10¹³ vg / kg" should be interpreted as equivalent to individually listing "about 1 x 10¹³ vg / kg", "about 2 x 10¹³ vg / kg", and "about 3 x 10¹³ vg / kg".
[0142] As used in this paper in the case of proteins of interest, such as acid α-glucosidase (GAA), the term "activity" refers to the biological function associated with the wild-type form of the protein. For example, in the case of enzymes, the term "activity" refers to the ability of a protein to perform mass turnover in a manner that produces the products of a corresponding chemical reaction. Mass turnover assays known in this technique can, for example, be used to detect and quantify the activity levels of enzymes such as GAA.
[0143] As used herein, the terms “administration,” “drug administration,” and similar terms refer to the direct administration of a therapeutic agent (e.g., a viral vector) to a patient by any effective route. Exemplary routes of administration are described herein and include systemic administration routes, such as intravenous injection, and direct administration routes to the patient’s central nervous system, particularly such as intrathecal or intraventricular injection.
[0144] As used herein, "codon optimization" refers to the process of modifying a nucleic acid sequence based on the principle that the frequency of synonymous codons (e.g., codons encoding the same amino acid) in encoding DNA is biased across species. This codon degeneracy allows the same polypeptide to be encoded by multiple nucleotide sequences. A sequence modified in this manner is referred to herein as "codon-optimized". This process can be performed on any of the sequences described in this specification to enhance performance or stability. Codon optimization can be performed in the manner described in, for example, U.S. Patents Nos. 7,561,972, 7,561,973, and 7,888,112, each of which is incorporated herein by reference in its entirety. Sequences around translation start sites can be converted into common Kozak sequences using known methods. See, for example, Kozak et al., Nucleic Acids Res. 15 (20): 8125-8148, which is incorporated herein by reference in its entirety. Multiple stop codons can be incorporated.
[0145] As used herein, the terms “conservative mutation,” “conservative substitution,” “conservative amino acid substitution,” and similar terms refer to the substitution of one or more amino acids to exhibit similar physicochemical properties, such as polarity, electrostatic charge, and steric volume of one or more different amino acids. Table 1 below summarizes these properties for each of twenty naturally occurring amino acids. [surface] [1.] [Representative Physicochemical Properties of Naturally Occurring Amino Acids] [Amino acids] [3] [Letter Code] [1] [Letter Code] [Sidechain polarity] [physiological] [pH (7.4)] [The following are the characteristics of electrostatic discharge] [Spatial Volume] [ † ] alanine Ala A nonpolar neutral Small Arginine Arg R polarity cationic big Aspartic acid Asn N polarity neutral middle Aspartic acid Asp D polarity anionic middle Cysteine Cys C nonpolar neutral middle glutamic acid Glu E polarity anionic middle glutamine Gln Q polarity neutral middle Glycine Gly G nonpolar neutral Small histidine His H polarity The neutral and cationic forms are in equilibrium at pH 7.4. big Isoleucine Ile I nonpolar neutral big Leucine Leu L nonpolar neutral big lysine Lys K polarity cationic big Methionine Met M nonpolar neutral big Phenylan Phe F nonpolar neutral big proline Pro P nonpolar neutral middle serine Ser S polarity neutral Small threonine Thr T polarity neutral middle tryptophan Trp W nonpolar neutral huge Tyrosine Tyr Y polarity neutral big Valine Val V nonpolar neutral middle †Based on volume (A3): 50-100 is small, 100-150 is medium. 150-200 is considered large, and >200 is considered enormous.
[0146] From this table, it should be understood that conserved amino acid families include (i) G, A, V, L, and I; (ii) D and E; (iii) C, S, and T; (iv) H, K, and R; (v) N and Q; and (vi) F, Y, and W. Therefore, a conserved mutation or substitution is a conserved mutation or substitution in which an amino acid replaces a member of the same amino acid family (e.g., Ser replacing Thr or Lys replacing Arg).
[0147] As used herein, the term "dosage" refers to an amount of a therapeutic agent, such as a viral vector, administered to an individual at a specific time to treat a condition or ailment, such as treating or improving one or more symptoms of glycogen storage disorders (e.g., Pompe disease) as described herein. As defined herein, a therapeutic agent as described herein may be administered in a single dose or in multiple doses during the course of treatment. In each case, one or more unit dosage forms of the therapeutic agent may be used to administer the therapeutic agent; a unit dosage form is a term referring to one or more discrete compositions containing the agent that collectively constitute a single dose of the therapeutic agent. For example, two 0.5 x 10¹³ vg unit dosage forms of a viral vector may be used to administer a single dose of 1 x 10¹³ vector genomes (vg).
[0148] As used herein, the terms "effective amount," "therapeutic effective amount," and similar terms, when used to refer to a therapeutic composition, such as the carrier constructs described herein, mean an amount sufficient to achieve a beneficial or desired outcome, such as a clinical outcome, when administered to an individual, including mammals such as humans. For example, in the treatment of glycogen storage disorders, such as Pompe disease, these terms refer to an amount of composition sufficient to achieve a therapeutic response compared to a response obtained without administration of the composition of interest. The terms "effective amount," "therapeutic effective amount," or similar terms for a composition, such as the carrier constructs of this disclosure, also include an amount that produces a beneficial or desired outcome in an individual compared to a control.
[0149] As used herein, the term "enzyme replacement therapy" refers to the administration of medication to individuals (e.g., mammals, such as humans) suffering from a genetic disorder caused by a naturally occurring or deficient protein. For example, in the case of an individual with Pompe disease, enzyme replacement therapy refers to the administration of the GAA protein. Typically, enzyme replacement therapy involves the long-term administration of a therapeutic protein to an individual over multiple doses throughout their lifetime.
[0150] As used herein, in the case of genes, the terms "expression" and "expression" refer to one or more of the following: (1) the generation of an RNA template from a DNA sequence (e.g., by transcription); (2) the processing of RNA transcripts (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing); (3) the translation of RNA into a polypeptide or protein; and (4) post-translational modifications of the polypeptide or protein. In the case of genes encoding protein products, the terms "gene expression" and similar terms are used interchangeably with the terms "protein expression" and similar terms. The expression of a gene or protein of interest in an individual can be demonstrated, for example, by detecting the following: an increase in the amount or concentration of mRNA encoding the corresponding protein (e.g., assessed using RNA detection procedures described herein or known in this technique, such as quantitative polymerase chain reaction (qPCR) and RNA seq); an increase in the amount or concentration of the corresponding protein (e.g., assessed using protein detection methods described herein or known in this technique, particularly enzyme-linked immunosorbent assay (ELISA)); and / or an increase in the activity of the corresponding protein in a sample obtained from the individual (e.g., assessed using enzyme activity assays described herein or known in this technique in the case of enzymes). As used herein, if one or more or all of the above events can be detected in cells or the culture medium in which the cells are contained, the cell is considered to "express" the gene or protein of interest. For example, if (i) the corresponding RNA transcript, such as an mRNA template, is produced by a cell or cell population (e.g., using the RNA detection procedure described herein); (ii) processing of the RNA transcript (e.g., splicing, editing, 5' cap formation, and / or 3' end processing, such as using the RNA detection procedure described herein); (iii) the RNA template is translated into a protein product (e.g., using the protein detection procedure described herein); and / or (iv) post-translational modifications of the protein product (e.g., using the protein detection procedure described herein), then the gene or protein of interest is considered to be "expressed" by a cell or cell population.
[0151] As used herein, the term "operably linked" refers to a first molecule linked to a second molecule, wherein the molecules are arranged such that the first molecule influences the function of the second molecule. The two molecules may or may not be parts of a single, continuous molecule, and may or may not be adjacent. For example, if a promoter regulates the transcription of a transcribed polynucleotide molecule of interest in a cell, then the promoter is operably linked to that transcribed polynucleotide molecule. Additionally, if two parts of a transcriptional regulatory element are linked such that the transcriptional activation function of one part is not adversely affected by the presence of the other part, then the two parts are operably linked to each other. Two transcriptional regulatory elements may be operably linked to each other via a linker nucleic acid (e.g., an intermediate non-coding nucleic acid), or they may be operably linked to each other in the absence of an intermediate nucleotide.
[0152] The "percentage (%) sequence identity" of a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to those in the reference polynucleotide or polypeptide sequence after alignment and, where necessary, the introduction of gaps to achieve maximum percentage sequence identity. Alignment for determining percentage nucleic acid or amino acid sequence identity can be achieved in various ways within the capabilities of those skilled in the art, such as using publicly available computer software, such as BLAST, BLAST-2, or Megalign. Those skilled in the art can determine the appropriate parameters for alignment, including any algorithms required to achieve maximum alignment across the full length of the sequences being compared. For example, the percentage sequence identity value can be generated using the sequence comparison computer program BLAST. As an illustration, the percentage sequence identity of a given nucleic acid or amino acid sequence A with respect to, and / or relative to, a given nucleic acid or amino acid sequence B (which can be alternatively expressed as the percentage sequence identity of a given nucleic acid or amino acid with respect to, and / or relative to, a given nucleic acid or amino acid sequence B with respect to A) is calculated as follows: 100 × (fraction X / Y) Where X represents the number of nucleotides or amino acids that are identified as identical matches by sequence alignment programs (such as BLAST) in the alignment of A and B, and Y represents the total number of nucleic acids in B. It should be understood that if the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the percentage sequence similarity between A and B will not be equal to the percentage sequence similarity between B and A.
[0153] As used herein, the term "medical composition" refers to a mixture containing therapeutic compounds intended to be administered to an individual, such as a mammal, like a human, to prevent, treat, or control a particular disease or ailment that affects or may affect that individual.
[0154] As used herein, the term "medically acceptable" means that such compounds, materials, compositions and / or dosage forms are suitable for contact with the tissues of an individual, such as a mammal (e.g., a human), without excessive toxicity, irritation, allergic reactions and other problematic complications, and are commensurate with a reasonable benefit / risk ratio.
[0155] As used herein, the term "promoter" refers to a recognition site on DNA that is bound by RNA polymerase. Polymerase drives the transcription of transgenic genes. Exemplary promoters suitable for use in the compositions and methods described herein are described, for example, in Sandelin et al., Nature Reviews Genetics 8:424 (2007), whose disclosures regarding nucleic acid regulatory elements are incorporated herein by reference. Additionally, the term "promoter" may refer to a synthetic promoter, which is a regulatory DNA sequence not naturally present in a biological system. Synthetic promoters contain portions of naturally occurring promoters combined with polynucleotide sequences not present in nature, which can be optimized to express recombinant DNA using a variety of transgenic genes, vectors, and target cell types.
[0156] As used herein, the therapeutic agent is considered to be "provided" to the patient if it is administered directly to the patient, or if a substance that has been processed or metabolized in vivo to produce the therapeutic agent endogenously is administered to the patient. For example, nucleic acid molecules encoding therapeutic proteins (e.g., GAA) can be provided to patients, such as those with glycogen storage disease as described herein, by administering nucleic acid molecules directly or by administering substances that have been processed in vivo to produce the desired nucleic acid molecules (e.g., viral vectors or cells).
[0157] As used herein, the term "sample" refers to a sample isolated from an individual (e.g., blood, blood components (e.g., serum or plasma), urine, saliva, amniotic fluid, cerebrospinal fluid, tissue (e.g., placenta or skin), pancreatic juice, chorionic villus sample, or cells). An individual may be, for example, a patient suffering from a disease described herein, such as lysosomal storage disease (e.g., Pompe disease).
[0158] As used herein, the terms "individual" and "patient" refer to an organism receiving treatment for a specific disease or ailment described herein (such as lysosomal storage diseases, e.g., Pompe disease). Examples of individuals and patients include mammals, such as humans, receiving treatment for a specific disease or ailment described herein.
[0159] As used herein, the term "transcriptional regulatory element" refers to a nucleic acid that at least partially controls the transcription of a gene of interest. Transcriptional regulatory elements may include promoters, enhancers, and other nucleic acids (e.g., polyadenylation signals) that control or help control gene transcription. Examples of transcriptional regulatory elements are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990).
[0160] As used herein, the term "transgenic gene" refers to a recombinant nucleic acid (e.g., DNA or cDNA) encoding a gene product (e.g., the gene product described herein). The gene product may be RNA, a peptide, or a protein. In addition to the coding region of the gene product, the transgenic gene may include or be operatively linked to one or more elements for promoting or enhancing expression, such as promoters, enhancers, destabilizing domains, reactive elements, reporter elements, insulator elements, polyadenylation signaling elements, and / or other functional elements. Embodiments of this disclosure may utilize any known suitable promoters, enhancers, destabilizing domains, reactive elements, reporter elements, insulator elements, polyadenylation signaling elements, and / or other functional elements.
[0161] As used herein, the term "treat" or "treatment" refers to a therapeutic approach aimed at preventing or slowing (alleviating) inappropriate physiological changes or conditions, such as lysosomal storage disorders, particularly the progression of Pompe disease. Beneficial or desired clinical outcomes include, but are not limited to, symptom relief, reduction in disease severity, stabilization of the disease state (i.e., no worsening), delay or slowing of disease progression, improvement or reduction of the disease state, and remission (whether partial or complete), whether detectable or undetectable. In lysosomal storage diseases, such as Pompe disease, treatment may manifest as one or more detectable changes, such as increased concentrations of GAA protein or nucleic acids encoding GAA (e.g., DNA or RNA, such as mRNA), or increased GAA activity (e.g., 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, or greater). Protein detection assays known in this technique, including the ELISA assay described herein, can be used to determine the concentration of GAA protein. Nucleic acid detection assays described herein (e.g., RNA) can be used. Seq assays are used to determine the concentration of nucleic acids encoding GAA. Additionally, treatment for patients with lysosomal storage diseases, such as Pompe disease, can manifest as improvements in muscle function (e.g., cardiac or skeletal muscle function) and muscle coordination.
[0162] As used herein, the term "vector" refers to a nucleic acid, such as DNA or RNA, which can be used as a vector to deliver a gene of interest into cells (e.g., mammalian cells, such as human cells), for purposes such as replication and / or expression. Exemplary vectors that can be used in conjunction with the compositions and methods described herein are plastids, DNA vectors, RNA vectors, virions, or other suitable replicons (e.g., viral vectors). Various vectors have been developed for delivering polynucleotides encoding foreign proteins into prokaryotic or eukaryotic cells. Examples of such expression vectors are disclosed, for example, in WO 1994 / 11026, the disclosure of which is incorporated herein by reference. The expression vectors described herein contain polynucleotide sequences and additional sequence elements, for example, for expressing proteins and / or integrating such polynucleotide sequences into the genome of mammalian cells. Some vectors that can be used to express the transgenic genes described herein include plastids containing regulatory sequences that guide gene transcription, such as promoter and enhancer regions. Other vectors available for expressing transfected genes contain polynucleotide sequences that enhance the translation rate of such genes or improve the stability of mRNA transcribed from the genes or nuclear export. These sequence elements include, for example, 5' and 3' untranslated regions, internal ribosome entry sites (IRES), and polyadenylation signaling sites to guide efficient transcription of the gene carried on the expression vector. The expression vectors described herein may also contain polynucleotides encoding markers for selecting cells containing such vectors. Examples of suitable markers include genes encoding antibiotic resistance, such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.
[0163] As used herein in the context of therapeutic proteins, such as GAA, those skilled in the art will understand that, depending on the context, the use of the protein name refers to the gene encoding the protein or the corresponding protein product. The term "GAA" includes the wild-type form of the GAA gene or protein, as well as wild-type GAA protein variants (especially splice variants, truncated, tandem, and fusion constructs) that retain the therapeutic activity of the wild-type GAA protein, and the nucleic acid encoding the aforementioned. Examples of such variants are proteins with an amino acid sequence of at least 70% sequence identity (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9%, or higher) with the following SEQ ID NO: 2: MGVRHPPCSHRLLAVCALVSLATAALLGHILLHDFLLVPRELSGSSPVLEETHPAHQQGASRPGPRDAQAHPGRPRAVPTQCDVPPNSRFDCAPDKAITQEQCEARGCCYIPAKQGLQGAQMGQPWCFFPPSYPSYKLENLSSSEMGYTATLTRTTPTFFPKDILTLRLDVMMETENRLHFTIKDPANRRYEVPLETPHVHSRAPSPLYSVEFSEEPFGVIVRRQLDGRVLLNTTVAPLFFADQFLQLSTSLPSQYITGLAEHLSPLMLSTSWTRITLWNRDLAPTPGANLYGSHPFYLALEDGGSAHGVFLLNSNAMDVVLQPSPALSWRSTGGILDVYIFLGPEPKSVVQQYLDVVGYPFMPPYWGLGFHLCRWGYSSTAITRQVVENMTRAHFPLDVQWNDLDYMDSRRDFTFNKDGFRDFPAMVQELHQGGRRYMMIVDPAISSSGPAGSYRPYDEGLRRGVFITNETGQPLIGKVWPGSTAFPDFTNPTALAWWEDMVAEFHDQVPFDGMWIDMNEPSNFIRGSEDGCPNNELENPPYVPGVVGGTLQAATICASSHQFLSTHYNLHNLYGLTEAIASHRALVKARGTRPFVISRSTFAGHGRYAGHWTGDVWSSWEQLASSVPEILQFNLLGVPLVGADVCGFLGNTSEELCVRWTQLGAFYPFMRNHNSLLSLPQEPYSFSEPAQQAMRKALTLRYALLPHLYTLFHQAHVAGETVARPLFLEFPKDSSTWTVDHQLLWGEALLITPVLQAGKAEVTGYFPLGTWYDLQTVPVEALGSLPPPPAAPREPAIHSEGQWVTLPAPLDTINVHLRAGYIIPLQGPGLTTTESRQQPMALAVALTKGGEARGELFWDDGESLEVLERGAYTQVIFLARNNTIVNELVRVTSEGAGLQLQKVTVLGVATAPQQVLSNGVPVSNFTYSPDTKVLDICVSLLMGEQFLVSWC (SEQ ID NO: 2)
[0164] Similarly, as used herein in the context of transcriptional regulatory elements, the term "MCK promoter" refers to a wild-type MCK promoter, such as a wild-type human or mouse MCK promoter, and variants (e.g., variants containing the insertion, deletion, and / or substitution of one or more nucleic acid residues), to the extent that the promoter retains the ability to induce the expression of an operable gene in muscle and / or neuronal cells. Exemplary MCK promoters that can be used in conjunction with the compositions and methods of this disclosure are shown in SEQ ID NO: 1 below: CCACTACGGGTCTAGGCTGCCCATGTAAGGAGGCAAGGCCTGGGGACACCCGAGATGCCTGGTTATAATTAACCCAGACATGTGGCTGCCCCCCCCCCAACACCTGCTGCCTGAGCCTCACCCCCACCCCGGTGCCTGGGTCT TAGGCTCTGTACACCATGGAGGAGAAGCTCGCTCTAAAAATAACCCTGTCCCTGGTGGATCCCCTGCATGCCCAATCAAGGCTGTGGGGGACTGAGGGCAGGCTGTAACAGGCTTGGGGGCCAGGGCTTATACGTGCCTGGGACTC CCAAAGTATTACTGTTCCATGTTCCCGGCGAAGGGCCAGCTGTCCCCCGCCAGCTAGACTCAGCACTTAGTTTAGGAACCAGTGAGCAAGTCAGCCCTTGGGGCAGCCCATACAAGGCCATGGGGCTGGGCAAGCTGCACGCCTGG GTCCGGGTGGGCACGGTGCCCGGGCAACGAGCTGAAAGCTCATCTGCTCTCAGGGGGCCCCTCCCTGGGGACAGCCCCTCCTGGCTAGTCACACCCTGTAGGCTCCTCTATATAACCCAGGGGCACAGGGGCTGCCCCCGGGTCAC (SEQ ID NO: 1)
[0165] This disclosure provides compositions and methods for treating glycogen storage disorders, particularly type II glycogen storage disorders, also known as Pompe disease. According to the compositions and methods described herein, a viral vector, such as an adeno-associated virus (AAV) vector, containing a transgenic gene encoding acid α-glucosidase (GAA) can be administered to a patient with Pompe disease (e.g., a human patient). The AAV vector can be, for example, a pseudo-AAV vector, such as an AAV vector containing an AAV2 inverted terminal repeat sequence encapsulated within the capsid protein of AAV8 (AAV2 / 8) or AAV9 (AAV2 / 9). In some embodiments, the transgenic gene is operatively linked to a transcriptional regulatory element, such as a promoter that induces gene expression in muscle cells and / or neurons. Exemplary promoters that can be used in conjunction with the compositions and methods of this disclosure include, in particular, muscle creatine kinase promoters, desmin promoters, and CMV promoters.
[0166] This disclosure is based in part on the discovery that specific doses of AAV vectors containing the GAA transgenic gene can achieve a therapeutic increase in GAA expression and activity in patients with Pompe disease while suppressing toxic side effects. Specifically, doses of AAV vectors containing the GAA transgenic gene in the range of about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg (e.g., about 3 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as about 4 x 10¹³ vg / kg, 5 x 10¹³ vg / kg, 6 x 10¹³ vg / kg, 7 x 10¹³ vg / kg, 8 x 10¹³ vg / kg, 9 x 10¹³ vg / kg, or 1 x 10¹⁴ vg / kg) can induce a beneficial increase in GAA expression and activity in patients with Pompe disease while avoiding toxic side effects that may be associated with GAA overexpression or administration of excessive viral vector. Using the compositions and methods disclosed herein, AAV carriers can be administered to patients in amounts sufficient to enhance their GAA performance and reduce cellular glycogen accumulation in their neurons and muscle tissues without inducing toxic side effects.
[0167] In some embodiments, the AAV vector is administered to the patient at an amount of about 1 x 10¹³ vector gene bodies (vg) / kg individual body weight (vg / kg) to about 3 x 10¹⁴ vg / kg (e.g., about 3 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as about 4 x 10¹³ vg / kg to about 1 x 10¹⁴ vg / kg, such as about 4 x 10¹³ vg / kg, 5 x 10¹³ vg / kg, 6 x 10¹³ vg / kg, 7 x 10¹³ vg / kg, 8 x 10¹³ vg / kg, 9 x 10¹³ vg / kg or 1 x 10¹⁴ vg / kg).
[0168] The following sections provide descriptions of therapeutic agents and dosing regimens that produce the beneficial properties described above. The following sections also describe various transgenic genes, transcriptional regulatory elements, and transducers that can be used in combination with the compositions and methods disclosed herein. [Treatment methods] [ ] Pompe disease
[0169] Pompe disease (also known as type II glycogen storage disease or GSD II) is caused by a deficiency of the lysosomal enzyme GAA. This disease is a congenital metabolic disorder in which GAA deficiency ultimately leads to glycogen accumulation in all tissues, especially skeletal muscle cells. Furthermore, the effects of glycogen accumulation on the central nervous system and its influence on skeletal muscle function have been documented.
[0170] Three clinical forms of this disease are known: infantile, childhood, and adult. Infantile Pompe disease presents shortly after birth with progressive muscle weakness and heart failure. Infantile Pompe disease is also characterized by rapid progression of cardiomyopathy, and patients often exhibit myopathy and neuropathy, typically leading to death within the first year of life. Symptoms in adult and childhood patients occur later in life and primarily involve skeletal muscles and neurons. Patients presenting with this form of Pompe disease eventually die from respiratory failure. Exceptionally, patients may survive for more than sixty years. Disease severity is associated with residual acid α-glucosidase activity, which is 10-20% of normal in late-onset cases and less than 2% in early-onset cases. Human acid α-glucosidase
[0171] An exemplary wild-type GAA amino acid sequence is listed in SEQ ID NO: 2: MGVRHPPCSHRLLAVCALVSLATAALLGHILLHDFLLVPRELSGSSPVLEETHPAHQQGASRPGPRDAQAHPGRPRAVPTQCDVPPNSRFDCAPDKAITQEQCEARGCCYIPAKQGLQGAQMGQPWCFFPPSYPSYKLENLSSSEMGYTATLTRTTPTFFPKDILTLRLDVMMETENRLHFTIKDPANRRYEVPLETPHVHSRAPSPLYSVEFSEEPFGVIVRRQLDGRVLLNTTVAPLFFADQFLQLSTSLPSQYITGLAEHLSPLMLSTSWTRITLWNRDLAPTPGANLYGSHPFYLALEDGGSAHGVFLLNSNAMDVVLQPSPALSWRSTGGILDVYIFLGPEPKSVVQQYLDVVGYPFMPPYWGLGFHLCRWGYSSTAITRQVVENMTRAHFPLDVQWNDLDYMDSRRDFTFNKDGFRDFPAMVQELHQGGRRYMMIVDPAISSSGPAGSYRPYDEGLRRGVFITNETGQPLIGKVWPGSTAFPDFTNPTALAWWEDMVAEFHDQVPFDGMWIDMNEPSNFIRGSEDGCPNNELENPPYVPGVVGGTLQAATICASSHQFLSTHYNLHNLYGLTEAIASHRALVKARGTRPFVISRSTFAGHGRYAGHWTGDVWSSWEQLASSVPEILQFNLLGVPLVGADVCGFLGNTSEELCVRWTQLGAFYPFMRNHNSLLSLPQEPYSFSEPAQQAMRKALTLRYALLPHLYTLFHQAHVAGETVARPLFLEFPKDSSTWTVDHQLLWGEALLITPVLQAGKAEVTGYFPLGTWYDLQTVPVEALGSLPPPPAAPREPAIHSEGQWVTLPAPLDTINVHLRAGYIIPLQGPGLTTTESRQQPMALAVALTKGGEARGELFWDDGESLEVLERGAYTQVIFLARNNTIVNELVRVTSEGAGLQLQKVTVLGVATAPQQVLSNGVPVSNFTYSPDTKVLDICVSLLMGEQFLVSWC (SEQ ID NO: 2)
[0172] Exemplary genes encoding GAA polypeptides that can be used in conjunction with the compositions and methods described herein include genes encoding the wild-type GAA protein listed in SEQ ID NO: 2, and functional GAA enzymes that are at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the amino acid sequence of SEQ ID NO: 2. Genes encoding GAA polypeptides that can be used in conjunction with the compositions and methods described herein further include genes having one or more amino acid substitutions relative to the amino acid sequence listed in SEQ ID NO: 2, such as genes having one or more conserved amino acid substitutions. For example, GAA peptides that can be used in conjunction with the compositions and methods described herein include peptides having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or more conserved amino acid substitutions relative to the amino acid sequence of SEQ ID NO: 2.
[0173] For example, in some embodiments of this disclosure, the gene encoding the GAA polypeptide has a nucleic acid sequence that is at least 85% identical (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% identical) to the nucleic acid sequence of SEQ ID NO: 3. The nucleic acid sequence of SEQ ID NO: 3 encodes a GAA polypeptide having the amino acid sequence of SEQ ID NO: 2 described above. The nucleic acid sequence of SEQ ID NO: 3 is as follows: (SEQ ID NO: 3)
[0174] The transcriptional regulatory elements described herein can be operatively linked to transgenic genes, such as GAA, lacking in patients with lysosomal storage diseases, such as those with Pompe disease. An construct containing a lysosomal enzyme, under the transcriptional control of the regulatory elements described herein, can be incorporated into a vector (or other transfection agent described herein) and administered to the patient to treat lysosomal storage diseases. Advantageously, therapeutic agents containing the transgenic genes described herein (e.g., viral vectors) can promote the transcription of genes encoding deficient lysosomal enzymes (e.g., GAA) in disease-affected cells, such as muscle cells and central nervous system cells. Furthermore, the therapeutic agents described herein offer the additional benefit of avoiding toxicity that may be associated with overexpression of GAA or administration of large amounts of viral vectors encoding GAA. The advantageous characteristics of the viral vectors and administration regimens described herein are further detailed in Example 1 below. [Dosage Regimen] [ ] Dosing regimens involving AAV-GAA carriers
[0175] Using the compositions and methods disclosed herein, patients with glycogen storage disorders (e.g., Pompe disease) may be administered an AAV vector containing a transgenic gene encoding GAA at an amount of about 1 x 10¹³ vg / kg to about 5 x 10¹⁴ vg / kg (e.g., about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg). For example, AAV carriers can be administered to patients in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 1014 vg / kg、2.8 x 10¹⁴ vg / kg, 2.9 x 10¹⁴ vg / kg, or 3 x 10¹⁴ vg / kg. Administering the carrier to patients at these doses can achieve a beneficial increase in GAA expression, for example, up to 50% or 200% of wild-type levels, without inducing toxic side effects.
[0176] As an example, in one practical example, the amount for patients to be about 2 x 1013 vg / kg to about 2 x 1014 vg / kg, the amount below AAV loading: about 2 x 1013 vg / kg, 2.1 x 1013 vg / kg, 2.2 x 1013 vg / kg, 2.3 x 1013 vg / kg, 2.4 x 1013 vg / kg, 2.5 x 1013 vg / kg, 2.6 x 1013 vg / kg, 2.7 x 1013 vg / kg, 2.8 x 1013 vg / kg, 2.9 x 1013 vg / kg, 3 x 1013 vg / kg, 3.1 x 1013 vg / kg, 3.2 x 1013 vg / kg, 3.3 x 1013 vg / kg, 3.4 x 1013 vg / kg, 3.5 x 1013 vg / kg, 3.6 x 1013 vg / kg, 3.7 x 1013 vg / kg, 3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 vg / kg, 4.2 x 1013 vg / kg, 4.3 x 1013 vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg, 4.8 x 1013 vg / kg, 4.9 x 1013 vg / kg, 5 x 1013 vg / kg, 5.1 x 1013 vg / kg, 5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 vg / kg, 7.2 x 1013 vg / kg, 7.3 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 1013 vg / kg, 8 x 1013 vg / kg, 8.1 x 1013 vg / kg, 8.2 x 1013 vg / kg, 8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg, 9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 10¹⁴ vg / kg. In some implementations, the AAV carrier is administered to the patient at doses ranging from approximately 2 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg, such as from approximately 2 x 10¹³ vg / kg to approximately 4 x 10¹³ vg / kg (e.g., approximately 3 x 10¹³ vg / kg) or from approximately 5 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg (e.g., approximately 6 x 10¹³ vg / kg).
[0177] In one practical example, the amount for the patient is about 3 x 1013 vg / kg to about 2 x 1014 vg / kg, and the amount given by AAV is about 3 x 1013 vg / kg, 3.1 x 1013 vg / kg, 3.2 x 1013 vg / kg, 3.3 x 1013 vg / kg, 3.4 x 1013 vg / kg, 3.5 x 1013 vg / kg, 3.6 x 1013 vg / kg, 3.7 x 1013 vg / kg, 3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 vg / kg, 4.2 x 1013 vg / kg, 4.3 x 1013 vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg, 4.8 x 1013 vg / kg, 4.9 x 1013 vg / kg, 5 x 1013 vg / kg, 5.1 x 1013 vg / kg, 5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 vg / kg, 6.2 x 1013 vg / kg, 6.3 x 1013 vg / kg, 6.4 x 1013 vg / kg, 6.5 x 1013 vg / kg, 6.6 x 1013 vg / kg, 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 vg / kg, 7.2 x 1013 vg / kg, 7.3 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 1013 vg / kg, 8 x 1013 vg / kg, 8.1 x 1013 vg / kg, 8.2 x 1013 vg / kg, 8.3 x 1013 vg / kg, 8.4 x 1013 vg / kg, 8.5 x 10^13 vg / kg, 8.6 x 10^13 vg / kg, 8.7 x 10^13 vg / kg, 8.8 x 10^13 vg / kg, 8.9 x 10^13 vg / kg, 9 x 10^13 vg / kg, 9.1 x 10^13 vg / kg, 9.2 x 10^13 vg / kg, 9.3 x 10^13 vg / kg, 9.4 x 10^13 vg / kg, 9.5 x 10^13 vg / kg, 9.6 x 10^13 vg / kg, 9.7 x 10^13 vg / kg, 9.8 x 10^13 vg / kg, 9.9 x 10^13 vg / kg, 1 x 10^14 vg / kg, 1.1 x 10^14 vg / kg, 1.2 x 10^14 vg / kg, 1.3 x 10^14 vg / kg, 1.4 x 10^14 vg / kg, 1.5 x 10^14 vg / kg, 1.6 x 10^14 vg / kg, 1.7 x 10^14 vg / kg, 1.8 x 10^14 vg / kg, 1.9 x 10^14 vg / kg or 2 x 10^14 vg / kg..
[0178] In one practical example, the amount for the patient is about 4 x 1013 vg / kg to about 2 x 1014 vg / kg, and the amount given by AAV is about 4 x 1013 vg / kg, 4.1 x 1013 vg / kg, 4.2 x 1013 vg / kg, 4.3 x 1013 vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg, 4.8 x 1013 vg / kg, 4.9 x 1013 vg / kg, 5 x 1013 vg / kg, 5.1 x 1013 vg / kg, 5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 vg / kg, 6.2 x 1013 vg / kg, 6.3 x 1013 vg / kg, 6.4 x 1013 vg / kg, 6.5 x 1013 vg / kg, 6.6 x 1013 vg / kg, 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 vg / kg, 7.2 x 1013 vg / kg, 7.3 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 1013 8.8 x 1013 vg / kg, 8.9 x 1013 vg / kg, 9 x 1013 vg / kg, 9.1 x 1013 vg / kg, 9.2 x 1013 vg / kg, 9.3 x 1013 vg / kg, 9.4 x 1013 vg / kg, 9.5 x 10^13 vg / kg, 9.6 x 10^13 vg / kg, 9.7 x 10^13 vg / kg, 9.8 x 10^13 vg / kg, 9.9 x 10^13 vg / kg, 1 x 10^14 vg / kg, 1.1 x 10^14 vg / kg, 1.2 x 10^14 vg / kg, 1.3 x 10^14 vg / kg, 1.4 x 10^14 vg / kg, 1.5 x 10^14 vg / kg, 1.6 x 10^14 vg / kg, 1.7 x 10^14 vg / kg, 1.8 x 10^14 vg / kg, 1.9 x 10^14 vg / kg or 2 x 10^14 vg / kg..
[0179] In one practical example, the amount for the patient is about 5 x 1013 vg / kg to about 2 x 1014 vg / kg, and the amount given by AAV is about 5 x 1013 vg / kg, 5.1 x 1013 vg / kg, 5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 vg / kg, 6.2 x 1013 vg / kg, 6.3 x 1013 vg / kg, 6.4 x 1013 vg / kg, 6.5 x 1013 vg / kg, 6.6 x 1013 vg / kg, 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 vg / kg, 7.2 x 1013 vg / kg, 7.3 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 1013 vg / kg, 8 x 1013 vg / kg, 8.1 x 1013 vg / kg, 8.2 x 1013 vg / kg, 8.3 x 1013 vg / kg, 8.4 x 1013 vg / kg, 8.5 x 1013 vg / kg, 8.6 x 1013 vg / kg, 8.7 x 1013 vg / kg, 8.8 x 1013 vg / kg, 8.9 x 1013 vg / kg, 9 x 1013 vg / kg, 9.1 x 1013 vg / kg, 9.2 x 1013 vg / kg, 9.3 x 1013 vg / kg, 9.4 x 1013 vg / kg, 9.5 x 1013 vg / kg, 9.6 x 1013 vg / kg, 9.7 x 1013 vg / kg, 9.8 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg..
[0180] In one practical example, the amount for the patient is about 6 x 1013 vg / kg to about 2 x 1014 vg / kg, and the amount given by AAV is about 6 x 1013 vg / kg, 6.1 x 1013 vg / kg, 6.2 x 1013 vg / kg, 6.3 x 1013 vg / kg, 6.4 x 1013 vg / kg, 6.5 x 1013 vg / kg, 6.6 x 1013 vg / kg, 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 vg / kg, 7.2 x 1013 vg / kg, 7.3 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 1013 vg / kg, 8 x 1013 vg / kg, 8.1 x 1013 vg / kg, 8.2 x 1013 vg / kg, 8.3 x 1013 vg / kg, 8.4 x 1013 vg / kg, 8.5 x 1013 vg / kg, 8.6 x 1013 vg / kg, 8.7 x 1013 vg / kg, 8.8 x 1013 vg / kg, 8.9 x 1013 vg / kg, 9 x 1013 vg / kg, 9.1 x 1013 vg / kg, 9.2 x 1013 vg / kg, 9.3 x 1013 vg / kg, 9.4 x 1013 vg / kg, 9.5 x 1013 vg / kg, 9.6 x 1013 vg / kg, 9.7 x 1013 vg / kg, 9.8 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg. [ ]
[0181] In some embodiments, the AAV carrier is administered to the patient in amounts from about 7 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as in the following amounts: about 7 x 10¹³ vg / kg, 7.1 x 10¹³ vg / kg, 7.2 x 10¹³ vg / kg, 7.3 x 10¹³ vg / kg, 7.4 x 10¹³ vg / kg, 7.5 x 10¹³ vg / kg, 7.6 x 10¹³ vg / kg, 7.7 x 10¹³ vg / kg, 7.8 x 10¹³ vg / kg, 7.9 x 10¹³ vg / kg, 8 x 10¹³ vg / kg, 8.1 x 10¹³ vg / kg, 8.2 x 10¹³ vg / kg, 8.3 x 10¹³ vg / kg, 8.4 x 10¹³ vg / kg. vg / kg、8.5 vg / kg,9.3 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0182] In some embodiments, the AAV carrier is administered to the patient in amounts from about 8 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as in the following amounts: about 8 x 10¹³ vg / kg, 8.1 x 10¹³ vg / kg, 8.2 x 10¹³ vg / kg, 8.3 x 10¹³ vg / kg, 8.4 x 10¹³ vg / kg, 8.5 x 10¹³ vg / kg, 8.6 x 10¹³ vg / kg, 8.7 x 10¹³ vg / kg, 8.8 x 10¹³ vg / kg, 8.9 x 10¹³ vg / kg, 9 x 10¹³ vg / kg, 9.1 x 10¹³ vg / kg, 9.2 x 10¹³ vg / kg, 9.3 x 10¹³ vg / kg, 9.4 x 10¹³ vg / kg. vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0183] In some embodiments, the AAV carrier is administered to the patient in amounts from about 9 x 10¹³ vg / kg to about 2 x 10¹⁴ vg / kg, such as in the following amounts: 9 x 10¹³ vg / kg, 9.1 x 10¹³ vg / kg, 9.2 x 10¹³ vg / kg, 9.3 x 10¹³ vg / kg, 9.4 x 10¹³ vg / kg, 9.5 x 10¹³ vg / kg, 9.6 x 10¹³ vg / kg, 9.7 x 10¹³ vg / kg, 9.8 x 10¹³ vg / kg, 9.9 x 10¹³ vg / kg, 1 x 10¹⁴ vg / kg, 1.1 x 10¹⁴ vg / kg, 1.2 x 10¹⁴ vg / kg, 1.3 x 10¹⁴ vg / kg, 1.4 x 10¹⁴ vg / kg. vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg. [ ]
[0184] In some embodiments, the AAV carrier is administered to the patient in amounts from about 1 x 10¹⁴ vg / kg to about 2 x 10¹⁴ vg / kg, such as in amounts of 1 x 10¹⁴ vg / kg, 1.1 x 10¹⁴ vg / kg, 1.2 x 10¹⁴ vg / kg, 1.3 x 10¹⁴ vg / kg, 1.4 x 10¹⁴ vg / kg, 1.5 x 10¹⁴ vg / kg, 1.6 x 10¹⁴ vg / kg, 1.7 x 10¹⁴ vg / kg, 1.8 x 10¹⁴ vg / kg, 1.9 x 10¹⁴ vg / kg, or 2 x 10¹⁴ vg / kg. [ ]
[0185] In some embodiments, the AAV carrier is administered to the patient at a dose of 6 x 10¹³ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 7 x 10¹³ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 8 x 10¹³ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 9 x 10¹³ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 1 x 10¹⁴ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 1.1 x 10¹⁴ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 1.2 x 10¹⁴ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 1.3 x 10¹⁴ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 1.4 x 10¹⁴ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 1.5 x 10¹⁴ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 1.6 x 10¹⁴ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 1.7 x 10¹⁴ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 1.8 x 10¹⁴ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 1.9 x 10¹⁴ vg / kg. In some embodiments, the AAV carrier is administered to the patient at a dose of 2 x 10¹⁴ vg / kg.
[0186] The AAV carrier described herein can be administered to a patient in a single dose containing a specified amount. In some embodiments, the AAV carrier can be administered to a patient in two or more doses totaling a specified amount. For example, the AAV carrier can be administered to a patient in two to ten doses totaling a specified amount (e.g., two, three, four, five, six, seven, eight, nine, or ten doses totaling a specified amount). In some embodiments, the AAV carrier can be administered to a patient in two, three, or four doses totaling a specified amount. In some embodiments, the AAV carrier can be administered to a patient in two doses totaling a specified amount.
[0187] In some embodiments, two or more doses of AAV carriers, which together constitute a specified amount, are spaced apart from each other, for example, one year or longer. In some embodiments, two or more doses are administered to the patient over approximately 12 months (e.g., over approximately 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks, 27 weeks, 28 weeks, 29 weeks, 30 weeks, 31 weeks, 32 weeks, 33 weeks, 34 weeks, 35 weeks, 36 weeks, 37 weeks, 38 weeks, 39 weeks, 40 weeks, 41 weeks, 42 weeks, 43 weeks, 44 weeks, 45 weeks, 46 weeks, 47 weeks, 48 weeks, 49 weeks, 50 weeks, 51 weeks, or 52 weeks). For example, in some embodiments, two or more doses are administered to the patient over approximately one week to approximately 48 weeks (e.g., over approximately 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 13 weeks, 14 weeks, 15 weeks, 16 weeks, 17 weeks, 18 weeks, 19 weeks, 20 weeks, 21 weeks, 22 weeks, 23 weeks, 24 weeks, 25 weeks, 26 weeks, 27 weeks, 28 weeks, 29 weeks, 30 weeks, 31 weeks, 32 weeks, 33 weeks, 34 weeks, 35 weeks, 36 weeks, 37 weeks, 38 weeks, 39 weeks, 40 weeks, 41 weeks, 42 weeks, 43 weeks, 44 weeks, 45 weeks, 46 weeks, 47 weeks, or 48 weeks). In some embodiments, two or more doses are administered to the patient over approximately two weeks to approximately 44 weeks (e.g., over approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, or 44 weeks). In some embodiments, two or more doses are administered to the patient over approximately three to approximately 40 weeks (e.g., over approximately 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 weeks).In some embodiments, two or more doses are administered to the patient over approximately four weeks to approximately 36 weeks (e.g., over approximately 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 weeks). In some embodiments, two or more doses are administered to the patient over approximately five to approximately 32 weeks (e.g., over approximately 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 weeks). In some embodiments, two or more doses are administered to the patient over approximately six to approximately 24 weeks (e.g., over approximately 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 weeks). In some embodiments, two or more doses are administered to the patient over approximately 12 to approximately 20 weeks (e.g., over approximately 12, 13, 14, 15, 16, 17, 18, 19, or 20 weeks). In some embodiments, two or more doses are administered to the patient over approximately 13, 14, 15, 16, 17, 18, or 19 weeks.
[0188] In some embodiments, the AAV carrier is administered to the patient in two or more doses, each individually containing a specified amount. For example, the AAV carrier may be administered to the patient in two to ten doses, each individually containing a specified amount (e.g., two, three, four, five, six, seven, eight, nine, or ten doses, each individually containing a specified amount). In some embodiments, the AAV carrier is administered to the patient in two, three, or four doses, each individually containing a specified amount. In some embodiments, the AAV carrier is administered to the patient in two doses, each individually containing a specified amount. Dosing regimens involving drugs that achieve GAA performance levels similar to AAV2 / 8-MCK-GAA.
[0189] Using the compositions and methods disclosed herein, a certain amount of an agent that promotes GAA expression can be administered to human patients with glycogen storage disorders (e.g., Pompe disease), such amount being sufficient to stimulate the GAA expression observed when human individuals of the same sex and similar body mass index are administered an AAV2 / 8 vector containing a GAA transgenic gene under the control of the MCK promoter. For example, the drug can be administered to a patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity observed in human individuals of the same sex and similar body mass index after administration of the AAV carrier in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg. vg / kg, 2.3 x 1013 vg / kg, 2.4 x 1013 vg / kg, 2.5 x 1013 vg / kg, 2.6 x 1013 vg / kg, 2.7 x 1013 vg / kg, 2.8 x 1013 vg / kg, 2.9 x 1013 vg / kg, 3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg、3.5 x 1013 vg / kg、3.6 x 1013 vg / kg、3.7 x 1013 vg / kg、3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg、4.1 x 1013 vg / kg、4.2 x 1013 vg / kg、4.3 x 1013 vg / kg、4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg, 4.9 x 1013 vg / kg, 5 x 1013 vg / kg, 5.1 x 1013 vg / kg, 5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg、5.7 x 1013 vg / kg、5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg, 2.6 x 1014 vg / kg, 2.7 x 1014 vg / kg, 2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg or 3 x 1014 vg / kg.
[0190] For example, in some embodiments, the agent is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to that observed in a human individual of the same sex and similar body mass index, at an amount of approximately 2 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administration of the AAV carrier in the following amounts: approximately 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg, 2.7 x 10¹³ vg / kg, 2.8 x 10¹³ vg / kg, 2.9 x 10¹³ vg / kg, 3 x 1013 vg / kg、3.1 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 vg / kg, 4.2 x 1013 vg / kg, 4.3 x 1013 vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg、5.3 x 1013 vg / kg、5.4 x 1013 vg / kg、5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 vg / kg, 6.2 x 1013 vg / kg, 6.3 x 1013 vg / kg, 6.4 x 1013 vg / kg, 6.5 x 1013 vg / kg, 6.6 x 1013 vg / kg, 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 vg / kg, 7.2 x 1013 vg / kg, 7.3 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 1013 vg / kg、8 vg / kg, 8.8 x 1013 vg / kg、8.9 vg / kg,9.7 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier at amounts ranging from approximately 2 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg, such as approximately 2 x 10¹³ vg / kg to approximately 4 x 10¹³ vg / kg (e.g., approximately 3 x 10¹³ vg / kg) or approximately 5 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg (e.g., approximately 6 x 10¹³ vg / kg).
[0191] In some embodiments, the agent is administered to the patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index, at an amount of approximately 3 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity level observed after administration of the AAV carrier at amounts such as: approximately 3 x 10¹³ vg / kg, 3.1 x 10¹³ vg / kg, 3.2 x 10¹³ vg / kg, 3.3 x 10¹³ vg / kg, 3.4 x 10¹³ vg / kg, 3.5 x 10¹³ vg / kg, 3.6 x 10¹³ vg / kg, 3.7 x 10¹³ vg / kg, 3.8 x 10¹³ vg / kg, 3.9 x 10¹³ vg / kg, 4 x 10¹³ vg / kg, etc. vg / kg、4.1 x 1013 vg / kg、4.2 x 1013 vg / kg、4.3 x 1013 vg / kg、4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg,4.9 x 1013 vg / kg, 5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg,6.7 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 1013 vg / kg, 8 x 1013 vg / kg, 8.1 x 1013 vg / kg, 8.2 x 1013 vg / kg, 8.3 x 1013 vg / kg, 8.4 x 1013 vg / kg, 8.5 x 1013 vg / kg, 8.6 x 1013 vg / kg, 8.7 x 1013 vg / kg, 8.8 x 1013 vg / kg, 8.9 x 1013 vg / kg, 9 x 1013 vg / kg, 9.1 x 1013 vg / kg, 9.2 x 1013 vg / kg, 9.3 x 1013 vg / kg, 9.4 x 1013 vg / kg, 9.5 x 1013 vg / kg, 9.6 x 1013 vg / kg, 9.7 x 1013 vg / kg, 9.8 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg..
[0192] In some embodiments, the agent is administered to the patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index, at an amount of approximately 4 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity level observed after administration of the AAV carrier at amounts such as: approximately 4 x 10¹³ vg / kg, 4.1 x 10¹³ vg / kg, 4.2 x 10¹³ vg / kg, 4.3 x 10¹³ vg / kg, 4.4 x 10¹³ vg / kg, 4.5 x 10¹³ vg / kg, 4.6 x 10¹³ vg / kg, 4.7 x 10¹³ vg / kg, 4.8 x 10¹³ vg / kg, 4.9 x 10¹³ vg / kg, 5 x 10¹³ vg / kg, etc. vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg、5.3 x 1013 vg / kg、5.4 x 1013 vg / kg、5.5 x 1013 vg / kg、5.6 x 1013 vg / kg、5.7 x 1013 vg / kg、5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 vg / kg, 6.2 x 1013 vg / kg, 6.3 x 1013 vg / kg, 6.4 x 1013 vg / kg, 6.5 x 1013 vg / kg, 6.6 x 1013 vg / kg, 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg, 8.6 x 1013 vg / kg, 8.7 x 1013 vg / kg, 8.8 x 1013 vg / kg, 8.9 x 1013 vg / kg, 9 x 1013 vg / kg, 9.1 x 1013 vg / kg, 9.2 x 1013 vg / kg, 9.3 x 1013 vg / kg, 9.4 x 1013 vg / kg, 9.5 x 1013 vg / kg, 9.6 x 1013 vg / kg, 9.7 x 1013 vg / kg, 9.8 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0193] In some embodiments, the agent is administered to the patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index, at an amount of approximately 5 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administration of the AAV carrier at the following amounts: 5 x 10¹³ vg / kg, 5.1 x 10¹³ vg / kg, 5.2 x 10¹³ vg / kg, 5.3 x 10¹³ vg / kg, 5.4 x 10¹³ vg / kg, 5.5 x 10¹³ vg / kg, 5.6 x 10¹³ vg / kg, 5.7 x 10¹³ vg / kg, 5.8 x 10¹³ vg / kg, 5.9 x 10¹³ vg / kg, 6 x 10¹³ vg / kg. vg / kg,6.1 vg / kg,6.9 x 1013 vg / kg, 7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg, 9.6 x 1013 vg / kg, 9.7 x 1013 vg / kg, 9.8 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg..
[0194] In some embodiments, the agent is administered to the patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index, at an amount of approximately 6 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administration of the AAV carrier at the following amounts: approximately 6 x 10¹³ vg / kg, 6.1 x 10¹³ vg / kg, 6.2 x 10¹³ vg / kg, 6.3 x 10¹³ vg / kg, 6.4 x 10¹³ vg / kg, 6.5 x 10¹³ vg / kg, 6.6 x 10¹³ vg / kg, 6.7 x 10¹³ vg / kg, 6.8 x 10¹³ vg / kg, 6.9 x 10¹³ vg / kg, 7 x 10¹³ vg / kg, etc. vg / kg, 7.1 vg / kg,7.9 x 1013 vg / kg, 8.8 x 1013 vg / kg、8.9 vg / kg,9.7 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0195] In some embodiments, the agent is administered to the patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index, at an amount of approximately 7 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administration of the AAV carrier at the following amounts: approximately 7 x 10¹³ vg / kg, 7.1 x 10¹³ vg / kg, 7.2 x 10¹³ vg / kg, 7.3 x 10¹³ vg / kg, 7.4 x 10¹³ vg / kg, 7.5 x 10¹³ vg / kg, 7.6 x 10¹³ vg / kg, 7.7 x 10¹³ vg / kg, 7.8 x 10¹³ vg / kg, 7.9 x 10¹³ vg / kg, 8 x 10¹³ vg / kg, etc. vg / kg、8.1 vg / kg,8.9 x 1013 vg / kg,9 x 1013 vg / kg,9.1 x 1013 vg / kg,9.2 x 1013 vg / kg,9.3 x 1013 vg / kg, 9.8 x 1013 vg / kg, 9.9 x 1013 vg / kg, 1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0196] In some embodiments, the agent is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to that observed in a human individual of the same sex and similar body mass index, at an amount of approximately 8 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administration of the AAV carrier at amounts such as: approximately 8 x 10¹³ vg / kg, 8.1 x 10¹³ vg / kg, 8.2 x 10¹³ vg / kg, 8.3 x 10¹³ vg / kg, 8.4 x 10¹³ vg / kg, 8.5 x 10¹³ vg / kg, 8.6 x 10¹³ vg / kg, 8.7 x 10¹³ vg / kg, 8.8 x 10¹³ vg / kg, 8.9 x 10¹³ vg / kg, 9 x 10¹³ vg / kg. vg / kg, 9.1 vg / kg,9.9 x 1013 vg / kg,1 x 1014 vg / kg,1.1 x 1014 vg / kg,1.2 x 1014 vg / kg,1.3 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0197] In some embodiments, the agent is administered to the patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index, at an amount of approximately 9 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administration of the AAV carrier at the following amounts: approximately 9 x 10¹³ vg / kg, 9.1 x 10¹³ vg / kg, 9.2 x 10¹³ vg / kg, 9.3 x 10¹³ vg / kg, 9.4 x 10¹³ vg / kg, 9.5 x 10¹³ vg / kg, 9.6 x 10¹³ vg / kg, 9.7 x 10¹³ vg / kg, 9.8 x 10¹³ vg / kg, 9.9 x 10¹³ vg / kg, 1 x 10¹⁴ ... vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg.
[0198] In some embodiments, the agent is administered to the patient in an amount sufficient to achieve a certain GAA activity level equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an amount from about 1 x 10¹⁴ vg / kg to about 2 x 10¹⁴ vg / kg, such as the GAA activity level observed after administration of the AAV carrier in amounts such as: about 1 x 10¹⁴ vg / kg, 1.1 x 10¹⁴ vg / kg, 1.2 x 10¹⁴ vg / kg, 1.3 x 10¹⁴ vg / kg, 1.4 x 10¹⁴ vg / kg, 1.5 x 10¹⁴ vg / kg, 1.6 x 10¹⁴ vg / kg, 1.7 x 10¹⁴ vg / kg, 1.8 x 10¹⁴ vg / kg, 1.9 x 10¹⁴ vg / kg, or 2 x 10¹⁴ vg / kg. vg / kg.
[0199] In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at a dose of approximately 6 x 10¹³ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at a dose of approximately 7 x 10¹³ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at a dose of approximately 8 x 10¹³ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at a dose of approximately 9 x 10¹³ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at a dose of approximately 1 x 10¹⁴ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at a dose of approximately 1.1 x 10¹⁴ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at a dose of approximately 1.2 x 10¹⁴ vg / kg. In some embodiments, the agent is administered to the patient in an amount sufficient to achieve a certain GAA activity level in the patient, which is equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier at an amount of about 1.3 x 10¹⁴ vg / kg.In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at a dose of approximately 1.4 x 10¹⁴ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at a dose of approximately 1.5 x 10¹⁴ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at an amount of approximately 1.6 x 10¹⁴ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at an amount of approximately 1.7 x 10¹⁴ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at a dose of approximately 1.8 x 10¹⁴ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at a dose of approximately 1.9 x 10¹⁴ vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain GAA activity level equivalent to the GAA activity level observed in a human individual of the same sex and similar body mass index after administration of the AAV carrier at an amount of approximately 2 x 10¹⁴ vg / kg.
[0200] In some embodiments, the drug is administered to the patient in a single dose. In some embodiments, the drug is administered to the patient in two or more doses. [A method for delivering exogenous nucleic acids to target cells] [ ] Transfection technology
[0201] Techniques for introducing transgenic genes, such as the GAA transgenic gene described herein, into target cells are known in this field. For example, electroporation can be used to permeate mammalian cells (e.g., human target cells) by applying an electrostatic potential to the cells of interest. Subsequently, mammalian cells (e.g., human cells) subjected to an external electric field in this manner readily absorb exogenous nucleic acids. Electroporation of mammalian cells is described in detail, for example, in Chu et al., Nucleic Acids Research 15:1311 (1987), the disclosure of which is incorporated herein by reference. A similar technique, Nucleofection™, utilizes an applied electric field to stimulate the uptake of exogenous polynucleotides into the nucleus of eukaryotic cells. Nucleofection™ and methods for performing this technique are described in detail, for example, in Distler et al., Experimental Dermatology 14:315 (2005) and US 2010 / 0317114, the respective disclosures of which are incorporated herein by reference.
[0202] Additional techniques that can be used to transfect target cells include squeeze puncture. This technique induces rapid mechanical deformation of cells to stimulate the uptake of exogenous DNA through membrane pores formed in response to applied stress. The advantage of this technique is that it eliminates the need for vectors to deliver nucleic acids to cells, such as human target cells. Squeeze puncture is described in detail, for example, in Sharei et al., Journal of Visualized Experiments 81:e50980 (2013), the disclosure of which is incorporated herein by reference.
[0203] Lipid transfection represents another technique that can be used to transfect target cells. This method involves loading nucleic acids into liposomes, which often present cationic functional groups, such as quaternary or protonated amines, to their exterior. Due to the anionic nature of the cell membrane, this promotes electrostatic interactions between the liposome and the cell, ultimately leading to the uptake of exogenous nucleic acids, for example, through direct fusion of the liposome with the cell membrane or through phagocytosis of the complex. Lipid transfection is described in detail in, for example, U.S. Patent No. 7,442,386, the disclosure of which is incorporated herein by reference. Similar techniques that utilize ionic interactions with the cell membrane to induce the uptake of exogenous nucleic acids include contacting cells with cationic polymer-nucleic acid complexes. Exemplary cationic molecules associated with polynucleotides to impart a positive charge conducive to interaction with the cell membrane are activated dendritic polymers (described, for example, in Dennig, Topics in Current Chemistry 228:227 (2003), the disclosure of which is incorporated herein by reference); and diethylaminoethyl (DEAE)-glucan, the use of which as a transfection agent is described in detail, for example, in Gulick et al., Current Protocols in Molecular Biology 40:I:9.2:9.2.1 (1997), the disclosure of which is incorporated herein by reference. Magnetic beads are another tool that can be used to transfect target cells in a gentle yet effective manner because this method utilizes an applied magnetic field to guide the uptake of nucleic acids. This technique is described in detail, for example, in US 2010 / 0227406, the disclosure of which is incorporated herein by reference.
[0204] Another available tool for inducing target cells to take up exogenous nucleic acids is laser transfection, a technique that involves exposing cells to electromagnetic radiation of a specific wavelength to gently permeate the cells and allow polynucleotides to penetrate the cell membrane. This technique is described in detail, for example, in Rhodes et al., Methods in Cell Biology 82:309 (2007), the contents of which are incorporated herein by reference.
[0205] Microvesicles represent another potential vector for modifying the genome of target cells using the methods described herein. For example, microvesicles induced by co-overexpression of the glycoprotein VSV-G with, for example, genome-modifying proteins (such as nucleases) can be used to efficiently deliver proteins into cells, subsequently catalyzing site-specific cleavage of endogenous polynucleotide sequences to prepare the cell's genome for covalent incorporation of polynucleotides of interest, such as genes or regulatory sequences. The use of such vesicles, also known as gesicles, for genetic modification of eukaryotic cells is described in detail in, for example, Quinn et al., Genetic Modification of Target Cells by Direct Delivery of Active Protein [Abstract]; Methylation changes in early embryonic genes in cancer [Abstract]; Proceedings of the 18th Annual Meeting of the American Society of Gene and Cell Therapy; May 13, 2015, Abstract 122. Incorporating target genes using gene editing technology
[0206] In addition to the above, various tools have been developed for incorporating genes of interest into target cells, such as human cells. One such method for incorporating polynucleotides encoding target genes into target cells involves the use of transposons. A transposon is a polynucleotide sequence of interest or a gene containing a translocase flanked by 5' and 3' excision sites. Once the transposon has been delivered into the cell, the translocase gene begins to express and produces an active enzyme that cleaves the gene of interest from the transposon. This activity is mediated by the site-specific recognition of the translocase excision site. In some cases, these excision sites may be terminal repeat sequences or inverted terminal repeat sequences. Once the transposon is excised, the gene of interest can be integrated into the mammalian cell genome by catalytic cleavage catalyzed by a translocase present at a similar excision site within the cell's nuclear genome. This allows the gene of interest to be inserted into the cleaved nuclear DNA at a complementary excision site, and the subsequent covalent bonding of the gene of interest to the phosphodiester bonds of the mammalian cell genome completes the incorporation process. In some cases, transposons can be reverse transposons, such that the gene encoding the target gene is first transcribed into an RNA product, then reverse transcribed into DNA, and subsequently incorporated into the mammalian cell genome. Exemplary transposon systems are the piggybac transposon (described in detail, for example, WO 2010 / 085699) and the sleeping beauty transposon (described in detail, for example, US 2005 / 0112764), the disclosures of which regarding the use of transposons in gene delivery to cells of interest are incorporated herein by reference.
[0207] Another tool for integrating target genes into the target cell genome is the CRISPR / Cas system, originally developed as an adaptive defense mechanism against viral infection in bacteria and archaea. The CRISPR / Cas system comprises palindromic repeats within plastid DNA and the associated Cas9 nuclease. This assembly of DNA and protein guides site-specific DNA cleavage of the target sequence by first incorporating the foreign DNA into the CRISPR locus. Polynucleotides containing these foreign sequences and repeat spacer elements of the CRISPR locus are then transcribed in the host cell to produce guide RNA, which subsequently attaches to the target sequence and localizes the Cas9 nuclease to this site. In this manner, highly site-specific Cas9-mediated DNA cleavage can be induced in the foreign polynucleotide because the interaction that brings Cas9 close to the target DNA molecule is dominated by RNA:DNA hybridization. Therefore, CRISPR / Cas systems can be designed to cleave any target DNA molecule of interest. This technology has been developed for editing eukaryotic genomes (Hwang et al., Nature Biotechnology 31:227 (2013)) and can be used as an effective means of site-specific editing of target cell genomes to cleave DNA before incorporating genes encoding target genes. The use of CRISPR / Cas in regulating gene expression has been described, for example, in U.S. Patent No. 8,697,359, the disclosure of which regarding the use of the CRISPR / Cas system for genome editing is incorporated herein by reference. Alternative methods for site-specific cleavage of genomic DNA before incorporating genes of interest into target cells include the use of zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs). Unlike the CRISPR / Cas system, these enzymes do not contain guide polynucleotides for targeting specific target sequences. Target specificity is instead controlled by DNA-binding domains within these enzymes. The uses of ZFN and TALEN in genome editing applications are described in, for example, Urnov et al., Nature Reviews Genetics 11:636 (2010); and Joung et al., Nature Reviews Molecular Cell Biology 14:49 (2013), the disclosures of their respective compositions and methods for genome editing are incorporated herein by reference. [ ]
[0208] Additional genome editing techniques that can be used to incorporate polynucleotides encoding target genes into the genome of target cells include the use of ARCUSTM meganucleases, which can be rationally designed to specifically cleave genomic DNA at specific sites. Given the established structure-activity relationships for such enzymes, it is advantageous to use these enzymes to incorporate genes encoding target genes into the genome of mammalian cells. Single-stranded meganucleases can be modified at certain amino acid sites to produce nucleases that selectively cleave DNA at desired sites, thereby enabling site-specific incorporation of target genes into the nuclear DNA of target cells. Such single-stranded nucleases have been extensively described, for example, in U.S. Patent Nos. 8,021,867 and 8,445,251, the disclosures of which regarding compositions and methods for genome editing are incorporated herein by reference. [ ] [A vector used to deliver exogenous nucleic acids to target cells] [ ] Viral vectors for nucleic acid delivery
[0209] Viral genomes provide a rich source of vectors for the efficient delivery of genes of interest into the genome of target cells, such as mammalian cells, including human cells. Viral genomes are particularly useful vectors for gene delivery because the polynucleotides contained within such genomes are typically incorporated into the genome of the target cell via generalized or specific transduction. This process occurs as part of the natural viral replication cycle and does not require the addition of proteins or reagents to induce gene integration. Examples of viral vectors include AAV; retroviruses; adenoviruses (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48); parvoviruses (e.g., adeno-associated virus); coronaviruses; negative-strand RNA viruses, such as orthomyxoviruses (e.g., influenza virus), rod-shaped viruses (e.g., rabies and vesicular stomatitis virus), paramyxoviruses (e.g., measles and Sendai virus); positive-strand RNA viruses, such as piconemaviruses and alpha viruses; and double-stranded DNA viruses, including adenoviruses, herpesviruses (e.g., herpes simplex virus type 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., cowpox, modified vaccinia Ankara (MVA), fowlpox, and canarypox). Other viruses that can be used to deliver polynucleotides encoding the antibody light and heavy chains or antibody fragments of the present invention include, for example, Norwalk virus, chlamydia virus, flavivirus, Rio virus, polyvacuovirus, hepatotropic DNA virus, and hepatitis virus. Examples of retroviruses include: avian leukosis sarcoma, mammalian type C, type B, type D virus, HTLV-BLV group, lentivirus, and foam virus (Coffin, JM, Retroviridae: The viruses and their replication, In Fundamental Virology, 3rd edition, BN Fields et al., eds., Lippincott-Raven Publishers, Philadelphia, 1996). Other examples include murine leukemia virus, murine sarcoma virus, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, gibbon leukemia virus, Mason-Fischer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus, and lentiviruses. Other examples of vectors are described, for example, in U.S. Patent No. 5,801,030, the disclosure of which regarding viral vectors for use in gene therapy is incorporated herein by reference. AAV vector for nucleic acid delivery
[0210] In some embodiments, nucleic acids of the compositions and methods described herein are incorporated into rAAV vectors and / or virions to facilitate their introduction into cells. rAAV vectors that can be used in this invention are recombinant nucleic acid constructs comprising (1) a transgenic gene to be expressed (e.g., a polynucleotide encoding a GAA protein) and (2) viral nucleic acids that facilitate the integration and expression of the heterologous gene. The viral nucleic acid may include the desired AAV sequences for cis-replication and encapsulation (e.g., functional ITR) of DNA into the virion. In typical applications, the transgenic gene encodes GAA, which can be used to correct GAA deficiency in patients with lysosomal storage diseases such as Pompe disease. Such rAAV vectors may also contain biomarkers or reporter genes. Available rAAV vectors have one or more of the AAV WT genes that are wholly or partially missing, but retain a functional flanking ITR sequence. The AAV ITR can be any serotype suitable for a particular application (e.g., derived from serotype 2). Methods using rAAV vectors are described, for example, in Tal et al., J. Biomed. Sci. 7:279-291 (2000) and Monahan and Samulski, Gene Delivery 7:24-30 (2000), the respective disclosures of which regarding AAV vectors for gene delivery are incorporated herein by reference.
[0211] The nucleic acids and vectors described herein can be incorporated into rAAV virions to facilitate the introduction of nucleic acids or vectors into cells. The capsid protein of AAV constitutes the outer non-nucleic acid portion of the virion and is encoded by the AAV cap gene. The cap gene encodes three viral capsid proteins, VP1, VP2, and VP3, required for virion assembly. The construction of rAAV virions has been described, for example, in U.S. Patents 5,173,414, 5,139,941, 5,863,541, 5,869,305, 6,057,152, and 6,376,237; and in Rabinowitz et al., J. Virol. 76:791-801 (2002) and Bowles et al., J. Virol. 77:423-432 (2003), the disclosures of which regarding AAV vectors for gene delivery are incorporated herein by reference.
[0212] The rAAV virions that can be used in conjunction with the compositions and methods described herein include those derived from various AAV serotypes, including AAV 1, 2, 3, 4, 5, 6, 7, 8, and 9. For targeting muscle cells, rAAV virions containing at least one serotype 1 capsid protein may be particularly useful. rAAV virions containing at least one serotype 6 capsid protein may also be particularly useful because the serotype 6 capsid protein is structurally similar to the serotype 1 capsid protein and is therefore expected to induce high GAA expression in muscle cells. rAAV serotype 9 has also been found to be an effective transducer for muscle cells. The construction and use of AAV vectors and AAV proteins for different serotypes are described in, for example, Chao et al., Mol. Ther. 2:619-623 (2000); Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428-3432 (2000); Xiao et al., J. Virol. 72:2224-2232 (1998); Halbert et al., J. Virol. 74:1524-1532 (2000); Halbert et al., J. Virol. 75:6615-6624 (2001); and Auricchio et al., Hum. Molec. Genet. 10:3075-3081 (2001). Their respective disclosures on AAV vectors for gene delivery are incorporated herein by reference.
[0213] Pseudotyped rAAV vectors can also be used in conjunction with the compositions and methods described herein. Pseudotyped vectors include AAV vectors that pseudotype a given serotype (e.g., AAV9) using a capsid gene pseudotyped from a serotype other than a given serotype (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). For example, a representative pseudotyped vector is an AAV8 or AAV9 vector encoding a therapeutic protein pseudotyped from a capsid gene derived from AAV serotype 2. Techniques relating to the construction and use of pseudotyped rAAV virions are known in this art and described, for example, in Duan et al., J. Virol. 75:7662-7671 (2001); Halbert et al., J. Virol. 74:1524-1532 (2000); Zolotukhin et al., Methods, 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet., 10:3075-3081 (2001).
[0214] AAV virions with mutations within the virospinal capsid can infect specific cell types more effectively than non-mutated capsid virions. For example, suitable AAV mutants may possess ligand insertion mutations to facilitate AAV targeting of specific cell types. The construction and characterization of AAV capsid mutants, including insertion mutants, alanine selection mutants, and antigenic determinant tag mutants, are described in Wu et al., J. Virol. 74:8635-45 (2000). Other rAAV virions that can be used in the methods of this invention include capsid hybrids produced by molecular breeding of the virus and by exon shuffling. See, for example, Soong et al., Nat. Genet., 25:436-439 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19:423-428 (2001). [Pharmaceutical Compositions and Administration Routes] [ ]
[0215] The therapeutic agents described herein may contain transgenic genes, such as those encoding lysosomal enzymes (e.g., GAA), and may be incorporated into vectors for administration to patients, such as human patients with lysosomal storage diseases (e.g., Pompe disease). Pharmaceutical compositions containing vectors, such as viral vectors, operatively linked to the therapeutic transgenic gene as described herein, can be prepared using methods known in this art. For example, such compositions may be prepared using, for instance, physiologically acceptable carriers, excipients, or stabilizers (Remington's Pharmaceutical Sciences, 16th edition, Osol, A. ed. (1980); incorporated herein by reference), and in a desired form, such as a lyophilized formulation or an aqueous solution.
[0216] Viral vectors containing transcriptional regulatory elements operatively linked to therapeutic transgenic genes, such as AAV vectors and other vectors described herein, can be administered to patients (e.g., human patients) via a variety of routes of administration. The routes of administration may vary depending on, for example, the onset and severity of the disease, and may include, for example, intradermal, transdermal, non-enteric, intravenous, intramuscular, intranasal, subcutaneous, percutaneous, tracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration. Intravascular administration includes delivery to the patient's vascular system. In some embodiments, administration is made into a vessel considered a vein (intravenous), and in some administrations, into a vessel considered an artery (intraarterial). Veins include, but are not limited to, the internal jugular vein, peripheral veins, coronary veins, hepatic veins, portal vein, great saphenous vein, pulmonary veins, superior vena cava, inferior vena cava, gastric vein, splenic vein, inferior mesenteric vein, superior mesenteric vein, cephalic vein, and / or femoral vein. Arteries include, but are not limited to, the coronary arteries, pulmonary artery, brachial artery, internal carotid artery, aortic arch, femoral artery, peripheral arteries, and / or ciliary arteries. Delivery is intended to cross or reach arterioles or capillaries.
[0217] The mixtures of nucleic acids and viral vectors described herein can be prepared by suitably mixing in water with one or more excipients, carriers, or diluents. Dispersions can also be prepared in glycerol, liquid polyethylene glycol and mixtures thereof, and oils. Under normal storage and use conditions, these formulations may contain preservatives to prevent microbial growth. Suitable pharmaceutical forms for injection include sterile aqueous solutions or dispersions and sterile powders for the immediate preparation of sterile injectable solutions or dispersions (described in US 5,466,468, the disclosure of which is incorporated herein by reference). In any case, the formulation may be sterile and may be fluid to facilitate injection. The formulation may be stable under manufacturing and storage conditions and may be preservative-treated to resist contamination by microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol and the like), suitable mixtures thereof, and / or vegetable oils. For example, coating with lecithin can maintain the desired particle size in the case of a dispersion, and surfactants can maintain appropriate flowability. Microbial activity can be prevented by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, isotonic agents, such as sugars or sodium chloride, are preferred. Extended absorption of injectable compositions can be achieved by using delayed absorption agents, such as aluminum monostearate and gelatin, in the composition.
[0218] For example, where necessary, solutions containing the pharmaceutical compositions described herein may be appropriately buffered, and the liquid diluent may be first made isotonic with sufficient saline or glucose. Such specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, the sterile aqueous media that may be used according to this disclosure will be known to those skilled in the art. For example, a dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous infusion fluid or injected at the recommended infusion site. Dosage variations will inevitably occur depending on the individual being treated. In any case, the person administering the medication will determine the appropriate dose for the individual. Furthermore, for human administration, the formulation may meet the sterility, pyrogenicity, general safety, and purity standards required by the FDA Office of Biologics. [Example] [ ]
[0219] The following examples are provided to provide a description of how the compositions and methods described herein can be used, prepared, and evaluated to those skilled in the art, and are intended to be merely examples of the invention and not to limit the scope of the invention. [Example] [1.] [Establishing an acidic environment in a mouse model of Pompe disease] [α] [-] [Therapeutic effects of glucosidase, while avoiding toxic side effects] [ ] [Purpose] [ ]
[0220] Pompe disease (type II glycogen storage disease, acid maltase deficiency) is an autosomal recessive disorder caused by a deficiency of the lysosomal enzyme acid alpha-glucosidase (GAA). GAA breaks down glycogen into glucose in lysosomes. Severely reduced or absent GAA activity leads to glycogen accumulation in lysosomes and cytoplasm. This can ultimately result in death in severely affected individuals due to impaired cardiac and respiratory function.
[0221] The purpose of this study was to evaluate the pharmacodynamic response and potential toxicity of the AAV2 / 8 vector (referred to herein as "AAV2 / 8-MCK-GAA") containing a GAA transgene operatively linked to the muscle creatine kinase (MCK) promoter in adult Gaa- / - mice over a 12-week period following administration. [Materials and Methods] [ ]
[0222] Seventy-two Gaa- / - mice and 18 wild-type littermates were included in the study. Eighteen mice in each group (nine males and nine females; 10–12 weeks old) were administered a single intravenous injection (via tail vein) of the carrier or AAV2 / 8-MCK-GAA (rAAV8-eMCK-hGAA) at doses of 0.3 x 10¹⁴, 1.0 x 10¹⁴, or 3.0 x 10¹⁴ vg / kg. Of these, Group 1 (five males and five females in each dose group, plus a carrier control) was designated for safety evaluation.
[0223] Monitor the animals' general health status daily; conduct detailed clinical observations, weight and functional assessments weekly. Euthanize the animals at week 12 or 13 after administration for clinicopathological and histopathological evaluation. Identify clinical chemistry, hematology, and anti-GAA antibodies, and collect a complete set of tissues for histopathological evaluation. [result] [ ] mortality rate
[0224] All wild-type and AAV2 / 8-MCK-GAA-treated animals survived until the end of the study. Two Gaa- / - mice in Group 2 (one female, 2506; and one male, 2005) died on days 35 and 66, respectively, and were sent for full histopathological analysis.
[0225] During the 12-week study, all animals showed steady weight gain. Dosage assurance and biocompatibility
[0226] A dose assurance analysis was performed to determine whether the material used for AAV2 / 8-MCK-GAA infusion impaired drug delivery and exposure in this study by evaluating the vector genome titer and capsid titer of the test articles that flowed through them.
[0227] Dosage assurance was achieved by simulating the maximum potential exposure time by holding the drug product AAV2 / 8-MCK-GAA within the infusion device for 0, 3, or 6 hours. The results showed that exposure to the infusion device over time had no significant effect on product concentration. These data confirm that the AAV2 / 8-MCK-GAA drug product has minimal binding affinity to the exposed device surface. Clinical Pathology
[0228] Mediator-treated Pompe disease (Gaa- / -) mice exhibited the smallest increase in aspartate transaminase (AST) compared to wild-type mice. Elevated AST is an indicator of muscle damage and a phenotypic characteristic of Gaa- / - mice. In Gaa- / - mice, following a single intravenous injection of AAV2 / 8-MCK-GAA at doses of 0.3 x 10¹⁴, 1.0 x 10¹⁴, or 3.0 x 10¹⁴ vg / kg, the increase in AST was least pronounced in the 0.3 x 10¹⁴ vg / kg dose group over a 3-month observation period. This reduction or normalization of AST in treated Gaa- / - mice relative to WT control mice at all AAV2 / 8-MCK-GAA dose levels was considered a positive effect of the test substance.
[0229] Due to the limited number of samples obtained, a clear explanation cannot be given from hematological data. Immunology
[0230] Humoral immunity to human GAA proteins was evaluated using qualified ELISA-based assays on serum samples obtained at the end of the study. A summary of the data is presented in Table 2.
[0231] Mediator-treated Gaa- / - mice were negative for anti-GAA antibodies at the end of the study, while mice treated with AAV2 / 8-MCK-GAA showed a strong but highly variable anti-GAA response. Mice treated with a low dose (0.3 x 10¹⁴ vg / kg) of AAV2 / 8-MCK-GAA had a higher overall anti-GAA titer compared to mice treated with medium and high doses. These data confirm that administration of AAV2 / 8-MCK-GAA drives a robust immune response against human GAA proteins in mice, which lasts up to 12 weeks. [surface] [2] [:]
[12] [In the serum of mice during the week] [AAV2 / 8-MCK-GAA] [Total resistance] [GAA] [Antibody] [ ] [Group] [deal with] [dose] [(vg / kg)] [gender] [Filter Explanation] [N] [anti] [GAA] [Valence] [average value] [SD] 2 Mediator 0 male Negative 8 BLQ - female Negative 8 BLQ - 3 AAV2 / 8-MCK-GAA 0.3 x 10¹⁴ male Positive 4 3,840,000 3,169,993 female Positive 4 1,792,000 512,000 4 AAV2 / 8-MCK-GAA 1.0 x 1014 male Positive 4 220,000 120,000 female Positive 4 440,000 240,000 5 AAV2 / 8-MCK-GAA 3.0 x 1014 male Positive 4 60,800 38,400 female Positive 4 280,000 80,000 Histopathology
[0232] In both males and females, there was no AAV2 / 8-MCK-GAA-related mortality or macroscopic findings associated with AAV2 / 8-MCK-GAA. Adverse findings associated with the AAV2 / 8-MCK-GAA test item were present in the hearts of Pompe disease (Gaa- / -) mice, consisting of minimal to mild fibrosis with associated minimal myofiber degeneration / necrosis in the hearts of males at ≥ 3 x 10¹³ vg / kg (1 / 5 of males at 0.3 x 10¹⁴ vg / kg, 3 / 5 of males at 1 x 10¹⁴ vg / kg, and 1 / 5 of males at 3 x 10¹⁴ vg / kg). Other microscopic findings related to the test item included: minimal mononuclear cell infiltration in the hearts of females at ≥ 1 x 10¹³ vg / kg and males at 0.3 x 10¹⁴ vg / kg; minimal mixed leukocyte infiltration in the hearts of one male and one female at 1 x 10¹⁴ vg / kg; and minimal to mild mononuclear cell infiltration in one or more skeletal muscles of males and females at ≥ 0.3 x 10¹⁴ vg / kg. Microscopic findings related to the test item in the livers of males at ≥ 0.3 x 10¹⁴ vg / kg included reduced vacuolation compared to the Pompeii vector control, while increased vacuolation was observed in females at ≥ 0.3 x 10¹⁴ vg / kg compared to the Pompeii vector control. The positive effects of AAV2 / 8-MCK-GAA include the absence of vacuolation (a hallmark of Pompe disease) in multiple tissues, including: absence of myofibril vacuolation in the quadriceps, triceps, and diaphragm of all animals at 3 x 10¹⁴ vg / kg; a slight reduction in the incidence and / or severity of vacuolation in the choroid plexus of the brain at ≥ 0.3 x 10¹⁴ vg / kg; a slight reduction in the severity of neuronal vacuolation in the spinal cord of males at 3 x 10¹⁴ vg / kg and females at ≥ 1 x 10¹⁴ vg / kg; a reduction in both the severity and incidence of neuronal vacuolation in the dorsal root ganglia; a reduction or absence of axonal / myelin degeneration in animals treated with AAV2 / 8-MCK-GAA; a reduction in the incidence of vacuolation in the interstitial cells of the prostate and seminal vesicles; and a slight decreasing trend in the incidence and / or severity of vacuolation in the principal cells of the parathyroid gland associated with AAV2 / 8-MCK-GAA treatment. GAA protein and GAA activity
[0233] On average, mice treated with low-dose (0.3 x 10¹⁴ vg / kg) AAV2 / 8-MCK-GAA had higher levels of GAA protein in the heart and quadriceps muscles compared to controls. Compared to controls and low-dose treated animals, the medium-dose (1 x 10¹⁴ vg / kg) and high-dose (3 x 10¹⁴ vg / kg) groups had even higher levels of GAA protein in both muscle groups examined (Figure 1A). These data indicate a dose-dependent increase in GAA in muscles following administration of AAV2 / 8-MCK-GAA.
[0234] The same dose-dependent pattern of results was observed at the levels of GAA enzyme activity. On average, mice treated with low doses (0.3 x 10¹⁴ vg / kg) of AAV2 / 8-MCK-GAA had higher GAA enzyme activity in the diaphragm, heart, and quadriceps muscle compared to controls. Again, compared to these groups, mice treated with medium doses (1 x 10¹⁴ vg / kg) and high doses (3 x 10¹⁴ vg / kg) of AAV2 / 8-MCK-GAA had even higher GAA enzyme activity in all tissues examined (Figure 1B). These data indicate that GAA enzyme activity in muscle increases in a dose-dependent manner after administration of AAV2 / 8-MCK-GAA. Tissue glycogen accumulation
[0235] Analysis of diaphragmatic, cardiac, and quadriceps biopsies revealed a dose-dependent decrease in liver glycogen concentration in mice treated with AAV2 / 8-MCK-GAA. The overall pattern of results was consistent in muscle, regardless of the tissue tested. All three doses of AAV2 / 8-MCK-GAA induced a reduction in liver glycogen compared to the cadaverized Gaa- / - control, with the highest dose causing the greatest reduction. Specifically, in the cardiac and quadriceps muscles, all doses restored liver glycogen to levels comparable to the cadaverized WT control (Fig. 2A). This pattern was further supported by periodic acid Schiff and hematoxylin and eosin (H&E) staining in the quadriceps muscles (Figs. 2B and 2C). In the diaphragm, medium and high doses restored liver glycogen to control levels. These results reveal a stable dose-dependent clearance of liver glycogen in muscle. Grasping response test:
[0236] To evaluate the effects of AAV2 / 8-MCK-GAA treatment on isotonic / isometric muscle strength and sensorimotor coordination, a grasping response test was performed. This test evaluated the mice's ability to grasp an inverted mesh screen for a sustained period of 60 seconds. Time-dependent functional correction was observed using this test. Specifically, 5–6 weeks after administration of the mediator or AAV2 / 8-MCK-GAA, the four gene knockout groups (mediator treatment; low, medium, and high doses of AAV2 / 8-MCK-GAA treatment) performed worse than the WT control (in seconds of fall) (Figure 3). Although the Gaa- / -mediator treatment control showed the worst functional performance, superior function was observed in AAV2 / 8-MCK-GAA-treated mice in a dose-dependent manner. The high-dose AAV2 / 8-MCK-GAA treatment group performed closest to the WT control. At 12 weeks post-viral vector administration, the high-dose group was comparable to the WT control. These results indicate that AAV2 / 8-MCK-GAA can improve functional motor deficits. [in conclusion] [ ]
[0237] Early death in cadaverized Gaa- / - animals may be related to disease progression in this model, possibly attributed to progressive neurodegeneration and loss of muscle function. A recent study by Keeler in 2019 reported that Gaa- / - mice of the same strain used in this study began to die at approximately 22 weeks of age, with about 50% of the Gaa- / - mice dying prematurely by 36 weeks of age.
[0238] Dosage assurance studies confirmed the compatibility of the delivery device with the drug product AAV2 / 8-MCK-GAA, without loss due to nonspecific binding to the device. These data confirmed successful delivery of all doses of AAV2 / 8-MCK-GAA to Gaa- / - without loss. In all tissues examined, GAA protein and enzyme activity levels increased in a dose-dependent manner.
[0239] Clinical pathology showed that AAV2 / 8-MCK-GAA had a positive effect on AST in Gaa- / - mice at all dose levels, but the effect was most significant at the lowest dose of 0.3 x 10¹⁴ vg / kg, thereby normalizing AST in these mice.
[0240] Histopathological examination revealed minimal to mild fibrosis in the hearts of male Gaa- / - mice in all AAV2 / 8-MCK-GAA dose groups. Minimal to mild mononuclear cell infiltration was observed in the hearts and skeletal muscle of some AAV2 / 8-MCK-GAA-treated animals. The test substance was observed to have a positive effect on reducing intracellular vacuolation in skeletal muscle, brain, spinal cord, dorsal root ganglia, peripheral axons, androgens, and parathyroid glands.
[0241] The sex bias observed in the pathological findings of AAV2 / 8-MCK-GAA-treated males may be partly attributable to the previously reported higher AAV transduction in male mice compared to females (Davidoff, 2003). Davidoff and colleagues previously showed that after systemic delivery of AAV2 or AAV5 vectors, male mice had 5 to 13 times more AAV particles than females.
[0242] AAV2 / 8-MCK-GAA treatment was observed to have a positive effect on glycogen clearance in all tested dose groups and in all examined tissues. The greatest improvement was observed in the medium and high dose treatment groups, with glycogen levels normalized to those observed in the WT control group.
[0243] AAV2 / 8-MCK-GAA treatment also mediated the correction of grasping function. In a time- and dose-dependent manner, complete functional recovery was observed in the high-dose group 12 weeks after administration of AAV2 / 8-MCK-GAA. [Example] [2.] [Establishing an acidic environment in a juvenile crab-eating macaque model of Pompe disease] [α] [-] [Therapeutic effects of glucosidase, while avoiding toxic side effects] [ ] [Purpose] [ ]
[0244] The purpose of this GLP study was to examine the potential toxicity and safety pharmacology of AAV2 / 8-MCK-GAA in juvenile cynomolgus monkeys over a 12-week period following administration. [Materials and Methods] [ ]
[0245] Twenty-five juvenile monkeys aged 2–4 years (14 males and 11 females) with low serum anti-AAV8 neutralizing antibody levels (titer 5 or lower for AAV2 / 8-MCK-GAA treatment) were included in the study. Table 3 summarizes the study design. On day 1 of the study, the animals were administered a single intravenous infusion of either the mediator, one of three doses of AAV2 / 8-MCK-human GAA (0.6 x 10¹⁴, 2 x 10¹⁴, or 5 x 10¹⁴ vg / kg), or one dose of AAV2 / 8-MCK-cynomolgus macaque GAA (2 x 10¹⁴ vg / kg). [surface] [3] [Research Design] [ ] [Group] [Animal ID] [Test Materials] [Dosage Level] [(vg / kg / )] [sky] [)] [Dose-volume] [(ml / kg)] [Dose Concentration] [(vg / mL)] [Number of animals] [male] [female] 1 1001, 1002; 1501, 1502 Mediator 0 twenty three 0 2 2 2 3001, 3002, 3003; 3501, 3502, 3503 AAV2 / 8-MCK-GAA 0.6 x x1014 twenty three 2.6 x 10¹² 3 3 3 3001, 3002, 3003; 3501, 3502, 3503 2.0 x x1014 twenty three 0.86 x 10¹³ 3 3 4 4001, 4002, 4003; 4501, 4502, 4503 5.0 x x1014 twenty three 2.16 x 1013 3 3 5 AAV2 / 8-MCK-Crab-eating Macaque GAA 2.0 x x1014 3 0
[0246] Monitor the animals' general health status daily. Perform detailed clinical observation and weight assessment at least weekly. Perform ophthalmological examinations before administration and at weeks 4 and 12. Collect ECG waveforms using clip-on external telemetry before administration and at weeks 4, 8, and 12; data are captured using Ponemah software (version 5.0). Parameters derived from the ECG waveforms include heart rate and RR, PR, QRS, and QT intervals. Correct each animal's QT based on individual correction factors determined from pre-administration data (QTca). Perform qualitative evaluation of the ECG recordings by a qualified veterinary cardiologist. Assess blood pressure before administration and at weeks 3, 4, 8, and 12. Obtain echocardiograms before administration and at weeks 4, 8, and 12, and have them evaluated by a qualified veterinary cardiologist. Neurological examinations (general attitude, behavior, motor function, cranial nerves, proprioception and postural responses, and spinal nerves) were performed before administration and during weeks 4, 8, and 12.
[0247] Clinicopathological samples were collected before administration and on days 3 (hematology only), 7, 14, 21, 28, 56, 73, and 84 for the evaluation of hematology, coagulation, clinical chemistry, urinalysis, and cardiac biomarkers (troponin-I, BNP, and CK-MB, CK-MM, CK-BB). Bioanalytical samples were collected to evaluate anti-AAV8 neutralizing antibodies (NAb) at baseline and anti-GAA total IgG antibodies (TAb) at baseline and on days 14, 35, and 84. Whole blood was also collected at baseline and on days 28 and 84 for peripheral blood mononuclear cell (PBMC) isolation and evaluation of T cell responses to human GAA and AAV8 capsids.
[0248] The animals were euthanized on day 85. All animals underwent a full necropsy, and the weight of selected organs was recorded. A complete set of tissue samples was collected for histopathological evaluation. [result] [ ] mortality rate
[0249] Two animals in the high-dose group (5 x 10¹⁴ vg / kg), one male (animal 4003) and one high-dose female (animal 4501), underwent unplanned necropsy on days 82 and 79, respectively. The remaining twenty animals, 10 males and 10 females, survived until the planned final euthanasia on day 85. Clinical observation
[0250] Of the 22 animals that survived until the end of the study, 20 showed no clinical signs associated with AAV2 / 8-MCK-GAA. During the week prior to the end of the study, two animals (male 4003 and female 4501) in the high-dose (5.0 x 10¹⁴ vg / kg) group exhibited significant clinical signs. No relevant clinical signs were observed in male 4003, but due to problems found on the echocardiogram, the animal was sent for early euthanasia 3 days earlier than planned. For female 4501, clinical signs were not observed until day 77. On day 78, the animal was hunched over and weak. On day 79, following an echocardiogram, the animal was cold and untouchable, lying on its side, and unable to recover from anesthesia. Due to its deteriorating condition, the animal was euthanized on day 79 (6 days earlier than planned).
[0251] All clinical observations occurring in the remaining animals during the study were considered unrelated to the test item, as these clinical observations occurred in all dose groups, including the control, and were isolated occurrences, considered procedure-related, and / or incidental findings common in laboratory-bred cynomolgus monkeys undergoing similar study procedures. These clinical signs included skin discoloration, abrasions, and bruising. [ ] weight
[0252] There were no AAV2 / 8-MCK-GAA-related effects on body weight, except in the week prior to the autopsy. However, such changes occurred in all dose groups and were not considered to be related to the test item.
[0253] The duration of the study, including weight gain or maintenance in all animals. Fluctuations in weight were considered accidental and / or had the range of variation typically observed in cynomolgus monkeys. Safety pharmacology assessment Neurological assessment
[0254] The duration of the study did not show any changes in AAV2 / 8-MCK-GAA related to neurological assessments. ECG and heart rate via jacketed external telemetry
[0255] Qualitatively, based on a comparison of pre- and post-administration echocardiographic recordings, no AAV2 / 8-MCK-GAA-related rhythm or waveform morphology abnormalities were found at any dose level. A generalized non-dose-responsive increase in heart rate was observed in all AAV2 / 8-MCK-GAA treatment groups, which is not considered adverse. Echocardiogram
[0256] AAV2 / 8-MCK-GAA doses ≥ 2.0 x 10¹⁴ vg / kg showed adverse changes in cardiac function via echocardiography, leading to early termination in two animals: one female on day 79 and one male on day 82. At low doses of AAV2 / 8-MCK-GAA (0.6 x 10¹⁴ vg / kg), some animals showed subtle but significant differences in echocardiographic parameters on day 79 compared to pre-administration levels. One animal in the low-dose (0.6 x 10¹⁴ vg / kg) group (2003) had pre-existing pulmonary regurgitation, which was not adversely affected by AAV2 / 8-MCK-GAA. It is unclear whether these represent incidental biological variations within cynomolgus macaques or fluctuations related to individual variability in anesthesia depth (Sleeper, 2008). [ ] hematology
[0257] No significant changes were observed in hematological parameters. The total white blood cell count was highly variable, but no specific pattern was observed indicating changes related to AAV2 / 8-MCK-GAA.
[0258] Differences indicated in hematological parameters are not considered to be related to AAV2 / 8-MCK-GAA and are attributed to biological variation, as such differences are sporadic, similar to fluctuations in control and / or previous study values, and / or have the magnitude of variation commonly observed in cynomolgus monkeys under similar study conditions. Blood clotting
[0259] No coagulation changes were observed when AAV2 / 8-MCK-GAA was administered at any dose.
[0260] Differences noted in the coagulation parameters are not considered to be related to AAV2 / 8-MCK-GAA and are attributed to biological variation, as these differences are sporadic, similar to fluctuations in control and / or previous study values, and / or have the magnitude of variation commonly observed in cynomolgus monkeys under similar study conditions. Clinical Chemistry
[0261] In clinical chemistry, the time-dependent increase in alanine transaminase (ALT) activity was minimal to slight. In all males in the AAV2 / 8-MCK-GAA dose groups and in females in the medium-dose (1 x 10¹⁴ vg / kg) and high-dose (5 x 10¹⁴ vg / kg) groups, ALT showed a transient increase on day 7, decreased on day 14, and then increased variablely until day 84. The increase in aspartate transaminase (AST) activity was minimal, with a smaller magnitude and fewer time points compared to ALT. The increases in ALT and AST may be related to inflammation reported in histopathology of skeletal and cardiac muscle, with minimal contribution from hepatocytes (if any). No other indicators of hepatocyte function were noted. In males, but not females, ALT and AST values were variable and dose-dependent (Figures 4A, 4B, 5A, and 5B).
[0262] From day 56 to day 84, this was primarily observed in males, and also in females receiving the high dose (5 x 10¹⁴ vg / kg) of AAV2 / 8-MCK-GAA, showing minimal to slight decreases in albumin, minimal to slight increases in globulins, and minimal decreases in AGR, indicating a minimal acute-phase response, without noting other significant indicators. Triglyceride levels showed a slight to moderate increase at most time points in males and occasional time points in females. This may be related to the acute-phase response and other possibilities, given the potential hepatocellular effects during the study. Blood urea nitrogen showed minimal to slight increases at many time points, but creatinine did not increase accordingly; therefore, this is considered pre-renal. Calcium concentrations showed minimal to slight decreases during the study, possibly as a result of decreased albumin concentrations, since albumin is a systemic carrier of calcium. Phosphorus showed a slight increase (+48%) on day 84 at the high dose (5 x 10¹⁴ vg / kg females), but the cause is uncertain and the value at this time point was lower than the highest pre-study value.
[0263] The remaining differences in clinical chemistry parameters are not considered to be related to AAV2 / 8-MCK-GAA and are attributed to biological variation, as these differences are sporadic, similar to fluctuations in control and / or previous study values, and / or have the magnitude of variation commonly observed in cynomolgus monkeys under similar study conditions. Cardiac biomarkers
[0264] In animals treated with the catalyst (Group 1), low-dose (0.6 x 10¹⁴ vg / kg) AAV2 / 8-MCK-GAA treatment (Group 2), or AAV2 / 8-MCK-cynomolgus macaque GAA treatment (Group 5), no change in troponin-I was observed (Figures 6A, 6B, 6C, and 7). At medium-dose (2.0 x 10¹⁴ vg / kg) and high-dose (5.0 x 10¹⁴ vg / kg) treatments, troponin-I showed the lowest to significantly increased levels in both sexes, with a significant increase beginning on day 21 in some animals and remaining significant in all animals up to day 56. Peak values were generally observed between days 21 and 56, with the high-dose male 4001 reaching a peak on day 84. After the peak, most animals gradually decreased by day 73, but some animals maintained a similar peak until day 84. Increased troponin-I indicates myocardial injury and corresponds to inflammation as indicated in myocardial histopathology. Generally speaking, increased troponin-I corresponds to a significant increase in BNP, but not to any significant change in CK-MB. [ ]
[0265] On day 84, brain natriuretic peptide (BNP) levels were significantly increased in medium-dose females (3501) (+363%) and high-dose males (4001) (+697%) (Figures 8A and 8B). Compared to pre-study values, although creatine kinase (CK) was slightly higher in high-dose males (4001), creatine kinase-MB (CK-MB) was not increased in either animal, indicating any cardiac activity at this time point. Furthermore, high-dose males (4003) showed the lowest increase in BNP on day 56, but by unplanned day 82, BNP levels decreased and were only slightly above the pre-study low limit of measurement. Medium-dose males (3003) showed the lowest increases on days 7 and 14, returning to pre-study levels by day 21, followed by a minimal increase on day 84 (+92%, +97%, and +35%, respectively). Medium-dose females (3503) showed the lowest increase in BNP on day 84 (+81%). On day 84, female 3501 showed the lowest increase in blood urea nitrogen (+230%), while creatinine did not increase accordingly. In these animals, the increase in BNP generally corresponds to an increase in troponin-I and indicates myocardial damage, and corresponds to myocardial inflammation as indicated in histopathology. No significant increases were observed in CK-MM, CK-MB, or CK-BB. Variability was indeed observed, but this variability was also noted in the control group. Urine analysis
[0266] No changes were observed in urine analysis parameters after administration of AAV2 / 8-MCK-GAA at any dose.
[0267] Differences in urinary analysis parameters are not considered to be related to AAV2 / 8-MCK-GAA and are attributed to biological variations or contaminant interference, as these differences are sporadic, similar to fluctuations in control and / or previous study values, lack relevant changes in other clinicopathological parameters, and / or have the magnitude of variation typically observed in cynomolgus monkeys under similar study conditions. Dosage assurance and biocompatibility
[0268] A dose assurance analysis was performed to determine whether the material used for AAV2 / 8-MCK-GAA infusion impaired drug delivery and exposure in this GLP study by evaluating the vector genome titer and capsid titer of the test articles that flowed through them.
[0269] Dosage assurance was achieved by holding the drug product AAV2 / 8-MCK-GAA within the infusion device for 0, 3, or 6 hours to simulate the maximum potential exposure time. The results showed that prolonged exposure to the dosing device had no significant effect on product concentration. These data confirm that the AAV2 / 8-MCK-GAA drug product has minimal binding affinity to the exposed device surface and ensures accurate dosing. GAA protein and GAA activity
[0270] On average, animals treated with low-dose (0.6 x 10¹⁴ vg / kg) AAV2 / 8-MCK-GAA showed approximately 1-2 times higher human GAA enzyme activity in quadriceps muscle and approximately 2-5 times higher activity in the heart compared to controls. Medium-dose (2.0 x 10¹⁴ vg / kg) showed approximately 42-52 times higher human GAA activity in quadriceps muscle and approximately 84-89 times higher activity in the heart. In contrast, high-dose (5.0 x 10¹⁴ vg / kg) animals showed, on average, approximately 53-69 times higher human GAA activity in quadriceps muscle and approximately 47-88 times higher activity in the heart (Figure 9A). These data indicate that the expression and activity of human GAA enzyme protein increased in a dose-dependent manner after administration of AAV2 / 8-MCK-GAA.
[0271] On average, animals treated with AAV2 / 8-MCK-cynomolgus macaques had higher levels of cynomolgus macaque GAA in their quadriceps and heart compared to the control group (Fig. 9B). Immunology Anti-AAV8 antibody
[0272] At baseline prior to the study, animals were assessed for anti-AAV8 neutralizing antibody (NAb) to guide randomization to treatment groups, such that animals treated with AAV2 / 8-MCK-GAA had a titer of 5 or lower and animals treated with the mordant had a titer of 10 or >20. Humoral response to hGAA
[0273] Humoral immunity to human or cynomolgus macaque GAA protein was evaluated using qualified ELISA-based assays obtained from serum samples before administration, at 14 or 15 days, 35 days, and 84 days post-administration. Figure 10A and Table 4 present a summary of data on the human GAA protein response to hGAA.
[0274] All animals had anti-GAA titers <80 before administration and on day 14. Anti-GAA titers increased dose-dependently in all AAV2 / 8-MCK-GAA-treated animals on day 35 (range 349–2,400), with a more robust increase on day 84 (range 7,760–54,400). Significant differences in anti-GAA titers were observed between males and females on days 35 and 84, with males exhibiting a higher average titer. These data confirm that intravenous delivery of AAV2 / 8-MCK-GAA targeting GAA muscle cell expression induces systemic exposure, thereby triggering a humoral immune response to human GAA in cynomolgus monkeys. [surface] [4] [From the serum of crab-eating macaques] [AAV2 / 8-MCK-GAA] [anti] [GAA] [Antibody] [ ] [Group] [Treatment Dosage] [(vg / kg)] [anti] [GAA] [Valence] [sky] [male] [female] [n +ive] [average value] [SD] [n +ive] [average value] [SD] [1] [Mediator] [Before administration] 0 / 2 - - 0 / 2 - -
[14] 0 / 2 - - 0 / 2 - -
[35] 0 / 2 - - 0 / 2 - -
[84] 0 / 2 - - 0 / 2 - - [2] [0.6 x 10, 14 ] [Before administration] 1 / 3 64 - 1 / 3 80 -
[14] 1 / 3 64 - 3 / 3 - -
[35] 3 / 3 610.67 860.90 3 / 3 88 102.14
[84] 3 / 3 6,533.33 6,201.08 2 / 3 9,600 4,525.48 [3] [2.0 x 10, 14 ] [Before administration] 3 / 3 - - 3 / 3 - -
[14] 3 / 3 - - 3 / 3 - -
[35] 3 / 3 1,101.33 1,818.13 3 / 3 577.33 886.31
[84] 3 / 3 68,933.33 117,665.51 3 / 3 10,666.66 12,932.64 [4] [5.0 x 10, 14 ] [Before administration] 3 / 3 - - 3 / 3 - -
[14] 3 / 3 - - 3 / 3 - -
[35] 3 / 3 2,400 1,385.64 3 / 3 2,400 1,385.64
[84] 2 / 3 76,800 36,203.86 2 / 3 32,000 27,152.90 kg = kilogram; N = number; +ive = positive sample; SD = standard deviation; vg = vector genome
[0275] Humoral immunity to GAA protein in cynomolgus monkeys was evaluated using serum samples obtained at 15, 35, and 84 days post-drug administration via a qualified ELISA-based assay. All animals exhibited an anti-GAA titer <1. No change in anti-GAA titer was observed over time (Figure 10B). These results indicate that the cynomolgus monkey GAA protein does not elicit an immune response. Cellular immune response to AAV8 and hGAA
[0276] Cellular immunity against the AAV8 capsid peptide library (A, B, C) and the human GAA peptide library (A, B, C, and D) was evaluated using a qualified IFN-γ ELISPOT assay, obtained from isolated peripheral blood mononuclear cell (PBMC) samples at pre-dose, 28-day, and 84-day post-dose administration. In the isolated PBMCs, spotted-unit (SFU) peripheral T cell responses were observed as early as day 28 at all dose levels. Summary data are presented in Tables 1 and 6.
[0277] Some catalyst-treated animals showed positive T-cell responses to the AAV8 capsid peptide library, consistent with their known pre-selection AAV8 NAb titers. None of the animals assigned to the AAV2 / 8-MCK-GAA treatment group showed a positive response prior to administration (Table). On days 28 and 84, all animals treated with the low dose (0.6 x 10¹⁴ vg / kg) remained negative for AAV8 in T-cell responses. On day 28, but not day 84, animals treated with the medium dose (2.0 x 10¹⁴ vg / kg) showed positive ELISpot signals in one-third of males and two-thirds of females. At the high dose (5.0 x 10¹⁴ vg / kg), males showed positive T-cell responses on day 28, but not day 84, while females showed positive signals on both days 28 and 84. These data indicate that when a T cell response to AAV8 is present, the response most often occurs on day 28, especially when the vector load is high, ≥ 2.0 x 10¹⁴ vg / kg.
[0278] Throughout the study period, all cadaver-treated animals showed negative hGAA T-cell responses. At the low dose (0.6 x 10¹⁴ vg / kg), one-third of males had positive SFU for Cu A, C, and D on day 28, increasing to two-thirds of males by day 84. One-third of low-dose females showed positive ELISpot signals. At the medium dose (2.0 x 10¹⁴ vg / kg), one-third of males and one-third of females had positive SFU on day 28, and two-thirds of males and one-third of females were positive by day 84. At the high dose (5.0 x 10¹⁴ vg / kg), one-third of males and one-third of females had positive ELISpot signals on day 28, and by day 84, up to three-thirds of males and two-thirds of females had positive SFU. The only consistent pattern in T-cell responses to GAA was the responsiveness to peptide libraries A and D in the medium- and high-dose groups up to day 84. Response to libraries B and C varied between males and females. [surface] [5] [From crab-eating macaques] [PBMC] [Of] [AAV2 / 8-MCK-GAA IFN-] [γ] [AAV8 T] [Cellular Response] [ ] [Group] [Treatment Dosage] [(vg / kg)] [right] [AAV8] [Peptide Library] [T] [Cellular Response] [sky] [male] [female] [N] [Positive] [ / ] [total] [N] [Positive] [ / ] [total] [A] [B] [C] [A] [B] [C] [1] [Mediator] [Before administration] 1 / 2 1 / 2 0 / 2 0 / 2 1 / 2 0 / 2
[28] 1 / 2 0 / 2 0 / 2 2 / 2 1 / 2 0 / 2
[84] 0 / 2 0 / 2 0 / 2 0 / 2 1 / 2 0 / 2 [2] [0.6 x 10, 14 ] [Before administration] 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3
[28] 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3
[84] 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 [3] [2.0 x 10, 14 ] [Before administration] 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3
[28] 1 / 3 0 / 3 0 / 3 2 / 3 2 / 3 1 / 3
[84] 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 [4] [5.0 x 10, 14 ] [Before administration] 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3
[28] 1 / 3 3 / 3 1 / 3 1 / 3 1 / 3 0 / 3
[84] 0 / 3 0 / 3 0 / 3 1 / 3 2 / 3 1 / 3 A, B, C = AAV8 peptide library; Kg = kilogram; N = number; SD = standard deviation; vg = vector genome [surface] [6] [From crab-eating macaques] [PBMC] [Of] [AAV2 / 8-MCK-GAA IFN-γ GAA T] [Cellular Response] [ ] [Group] [Treatment Dosage] [(vg / kg)] [right] [hGAA] [Peptide Library] [T] [Cellular Response] [sky] [male] [female] [N] [Positive] [ / ] [total] [N] [Positive] [ / ] [total] [A] [B] [C] [D] [A] [B] [C] [D] [1] [Mediator] [Before administration] 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2
[28] 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2
[84] 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2 0 / 2 [2] [0.6 x 10, 14 ] [Before administration] 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3
[28] [1 / 3] 0 / 3 [1 / 3] [1 / 3] 0 / 3 0 / 3 0 / 3 0 / 3
[84] [2 / 3] 0 / 3 [2 / 3] [2 / 3] 0 / 3 0 / 3 0 / 3 0 / 3 [3] [ ] [2.0 x 10, 14 ] [Before administration] 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 1 / 3 0 / 3
[28] 0 / 3 [1 / 3] 0 / 3 0 / 3 [1 / 3] 0 / 3 0 / 3 1 / 3
[84] [1 / 3] 0 / 3 [2 / 3] [2 / 3] [1 / 3] 0 / 3 [1 / 3] [1 / 3] [4] [5.0 x 10, 14 ] [Before medication administration] 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3 0 / 3
[28] 0 / 3 [1 / 3] [1 / 3] [1 / 3] 0 / 3 0 / 3 0 / 3 [2 / 3]
[84] [3 / 3] [1 / 3] [2 / 3] [1 / 3] [2 / 3] [2 / 3] 0 / 3 [2 / 3] A, B, C, D = hGAA peptide library; kg = kilograms; N = number; +ive = positive sample; SD = standard deviation; vg = vector genome [ ] Gross pathology
[0279] No gross findings were found related to the test item. Multifocal dark red discoloration in the lungs of one male (animal number 2002) administered 0.6 x 10¹⁴ vg / kg, accompanied by widespread minimal alveolar hemorrhage and mild pigmented alveolar macrophages, was considered background variation and was most likely associated with Pneumonyssus sp. and was unrelated to AAV2 / 8-MCK-GAA administration. [ ] organ weight
[0280] It was noted that no organ weight changes were observed that were relevant to the test article. Isolated organ weight values (absolute and / or relative) differed from their respective controls. However, no patterns, trends, or relevant data indicated that these values were toxicologically relevant. Therefore, the observed differences in organ weight were considered to be within the normal range of biological variability and thus unrelated to the administration of AAV2 / 8-MCK-GAA. [ ] Histopathology
[0281] Histological staining was performed using H&E and Masson's Trichrome. In primary studies and early-death animals, the main AAV2 / 8-MCK-GAA-related microscopic findings observed in both males and females at ≥ 2 x 10¹⁴ vg / kg consisted of: mixed intercellular inflammation with amphiphilic intercellular granular material and occasional myofiber degeneration in the heart, skeleton, and smooth muscle; mixed cellular inflammation in the liver; mixed cellular inflammation in adipose tissue with rare degeneration of brown adipocytes; and gliomatosis with rare neuronal degeneration of dorsal root ganglia. Findings concerning major organ systems are discussed. Heart, bones and smooth muscle
[0282] Changes in the heart, skeletal muscles (diaphragm, esophagus, biceps brachii, pectoralis major – attached to the sternum, vagina – attached skeletal muscles, levator ani and external anal sphincter – attached to the rectum, triceps brachii, quadriceps brachii, retroocular – rectus muscles of the eye and eyelid muscles, brachialis at intravenous administration sites), and rarely smooth muscle (muscle layers of the esophagus and rectum) range from minimal to significant mixed interstitial inflammation, characterized by variable numbers of lymphocytes, plasma cells, and histiocytes accompanied by interstitial amphiphilic granular material and occasional myofibril degeneration. These changes are generally observed in both males and females at ≥2 x 10¹⁴ vg / kg, with the exception that changes in the rectum are primarily limited to males within the same dose range; and that changes in the triceps brachii and quadriceps brachii are similar across all dose groups, but more frequent and severe in males. Changes in the heart are most prominent in the ventricles, but also evident in the atria. Changes in skeletal muscle were more severe in the diaphragm, esophagus, rectum, and sternum (attached muscles), accompanied by occasional myofibril regeneration and individual myofibrils encapsulated by inflammatory cells. Smooth muscle in the esophagus was similarly affected, but generally less severely, compared to skeletal muscle in the rectum (colororectal junction). In submitted cardiac sections, no increase in Masson's trichrome staining was observed compared to individual controls, indicating the absence of increased collagen associated with the degeneration / necrosis of affected cardiomyocytes discussed above.
[0283] The minimal inflammatory infiltration in the myocardium of a control female (animal 1502) was considered an incidental finding, as focal, minimal lymphocytic / histocyte / plasma cell infiltration in the heart has been reported as a common background finding in cynomolgus monkeys (Chamanza, 2010; Chamanza, 2006; Gaillot-Drevon, 2006). These changes are typically characterized by a focal interstitial distribution of idiopathic inflammatory infiltration with minimal to mild degeneration or necrosis of myocytes; in the heart, such infiltration is generally confined to the subendocardium or subepicardium, as also observed in a control female in this study. liver
[0284] The changes in the liver are generally limited to males with a blood glucose level ≥ 0.6 x 10¹⁴ vg / kg and consist of: minimal to moderate mixed cellular inflammation, characterized by variable numbers of lymphocytes and histiocytes; and fewer plasma cells and neutrophils, all arranged in the general portal vein (and rarely subcapsular) distribution that often destroys the liver plates, with individual hepatocyte separation and occasional individual cell necrosis and bridging inflammatory patterns (females, animal 3503). Adipose tissue
[0285] Generally, at doses ≥ 2 x 10¹⁴ vg / kg per day in both males and females, changes in adipose tissue consist of: minimal to moderate mixed-cell (lymphocytes, histiocytes, and plasma cells) inflammation and occasional adipocyte degeneration, characterized by undesirable microvesicle formation into irregularly shaped adipocytes, accompanied by membrane rupture observed in brown adipose tissue adjacent to the esophagus, thyroid gland, sternum, thymus, heart, aorta, and kidneys; these changes are most pronounced in the thyroid and thymus. Minimal mixed-cell inflammation in the pericardial white adipose tissue was also observed in a high-dose male (Animal 4002). Dorsal root ganglion
[0286] The changes in the dorsal root ganglion consist of the following: dose-independent, ranging from the lowest to the mildest gliomatosis (monocytes), with occasional degeneration of individual neurons.
[0287] The remaining microscopic findings were considered incidental, possessing properties commonly observed in cynomolgus monkeys (Sato, 2012; Chamanza, 2010; Chamanza, 2006; Gaillot-Drevon, 2006), and / or having similar incidence and severity in control and treated animals, and were therefore considered unrelated to the administration of AAV2 / 8-MCK-GAA. [ ] [in conclusion] [ ]
[0288] The maximum tolerated dose of AAV2 / 8-MCK-GAA administered intravenously was 0.6 x 10¹⁴ vg / kg, but the highest dose of 5 x 10¹⁴ vg / kg resulted in the unplanned euthanasia of two animals: a female (animal 4501) on day 79 and a male (animal 4003) on day 82. Dosage assurance confirmed that administration of the test item was not affected by the infusion device. Bioanalytical data confirmed the expression of GAA mRNA translated into GAA protein, and functional GAA enzyme activity was confirmed in all animals across all dose groups. GAA protein and enzyme activity levels, as well as total anti-GAA antibody, increased in a dose-responsive manner in all tissues examined, with males appearing to have a higher rate than females. Furthermore, in animals treated with AAV2 / 8-MCK-cynomolgus macaque GAA, cynomolgus macaque GAA protein levels were also increased in all tissues examined. Compared to the mediator control, in the two early-death animals, females (4501) showed approximately 33-fold higher GAA activity in the heart, while males (4003) showed approximately 61-fold higher GAA activity levels in the heart. T-cell-mediated anti-AAV8 / GAA and total anti-GAA antibodies did not appear to have a negative impact on GAA protein or tissue enzyme activity levels.
[0289] Doses ≥ 2 x 10¹⁴ vg / kg resulted in clinical, functional, and microscopic changes in the heart. At doses ≥ 2 x 10¹⁴ vg / kg, troponin-I and BNP were consistent with myocardial injury. Changes in ALT and AST were considered to be associated with peripheral muscle myofibril degeneration / regeneration and were not associated with the liver. Echocardiography showed adverse impairment of cardiac function at doses ≥ 2.0 x 10¹⁴ vg / kg and caused early termination in two animals in the high-dose group (5.0 x 10¹⁴ vg / kg), one female on day 79 and one male on day 82. Dose-dependent minimal to moderate microscopic changes were observed in the heart, skeletal muscle, and smooth muscle, consisting of mixed intercellular and interstitial inflammation characterized by variable numbers of lymphocytes, plasma cells, and histiocytes accompanied by interstitial amphiphilic granular material and occasional myofibril degeneration. Additional histological changes typically observed in animals that died early and during the primary study phase consist of the following: mixed cellular inflammation in the liver (males at ≥ 0.6 x 10¹⁴ vg / kg / day and females at ≥ 2 x 10¹⁴ vg / kg / day); mixed cellular inflammation and edema in the gallbladder of one female given 5 x 10¹⁴ vg / kg / day; mixed cellular inflammation and occasional degeneration of brown adipocytes around organs (esophagus, thyroid, sternum, thymus, heart, kidneys, and aorta) in both males and females at ≥ 2 x 10¹⁴ vg / kg / day, with higher incidence and severity in the primary study animals; and dose-independent gliomatosis in both males and females with rare neuronal degeneration in the dorsal root ganglia.
[0290] In summary, low-dose (0.6 x 10¹⁴ vg / kg) AAV2 / 8-MCK-GAA was well tolerated, while doses ≥ 2 x 10¹⁴ vg / kg were associated with myocardial damage in muscle and mixed cellular inflammation with occasional myofibril degeneration, as well as in the liver, adipose tissue, and dorsal root ganglia. The dose of AAV2 / 8-MCK-GAA at 0.6 x 10¹⁴ vg / kg was defined as the no-adverse-effect limit (NOAEL). [Example] [3.] [Administration via dispensing according to the drug administration protocol disclosed in this disclosure] [AAV-GAA] [Vacuum-based therapy for Pompe disease in human patients] [ ]
[0291] Using the compositions and methods disclosed herein, patients with glycogen storage disorders (e.g., Pompe disease) can be administered an AAV vector containing a transgenic gene encoding GAA at an amount of about 1 x 10¹³ vg / kg to about 3 x 10¹⁴ vg / kg. For example, AAV carriers can be administered to patients in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg. vg / kg、2.7 x 1013 vg / kg、2.8 x 1013 vg / kg、2.9 x 1013 vg / kg、3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg,3.5 x 1013 vg / kg, 4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 vg / kg, 6.2 x 1013 vg / kg, 6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg、2.7 x 1014 vg / kg、2.8 x 1014 vg / kg、2.9 x 10¹⁴ vg / kg or 3 x 10¹⁴ vg / kg. Administering the carrier to patients at these doses can achieve a beneficial increase in GAA expression, for example, up to 50% or 200% of wild-type levels, without inducing toxic side effects.
[0292] As an example, in one practical example, the amount for patients to be about 2 x 1013 vg / kg to about 2 x 1014 vg / kg, the amount below AAV loading: about 2 x 1013 vg / kg, 2.1 x 1013 vg / kg, 2.2 x 1013 vg / kg, 2.3 x 1013 vg / kg, 2.4 x 1013 vg / kg, 2.5 x 1013 vg / kg, 2.6 x 1013 vg / kg, 2.7 x 1013 vg / kg, 2.8 x 1013 vg / kg, 2.9 x 1013 vg / kg, 3 x 1013 vg / kg, 3.1 x 1013 vg / kg, 3.2 x 1013 vg / kg, 3.3 x 1013 vg / kg, 3.4 x 1013 vg / kg, 3.5 x 1013 vg / kg, 3.6 x 1013 vg / kg, 3.7 x 1013 vg / kg, 3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 vg / kg, 4.2 x 1013 vg / kg, 4.3 x 1013 vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg, 4.8 x 1013 vg / kg, 4.9 x 1013 vg / kg, 5 x 1013 vg / kg, 5.1 x 1013 vg / kg, 5.2 x 1013 vg / kg, 5.3 x 1013 vg / kg, 5.4 x 1013 vg / kg, 5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 vg / kg, 7.2 x 1013 vg / kg, 7.3 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 1013 vg / kg, 8 x 1013 vg / kg, 8.1 x 1013 vg / kg, 8.2 x 1013 vg / kg, 8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg, 9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg, 1.1 x 1014 vg / kg, 1.2 x 1014 vg / kg, 1.3 x 1014 vg / kg, 1.4 x 1014 vg / kg, 1.5 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 10¹⁴ vg / kg. In some implementations, the AAV carrier is administered to the patient at doses ranging from approximately 2 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg, such as from approximately 2 x 10¹³ vg / kg to approximately 4 x 10¹³ vg / kg (e.g., approximately 3 x 10¹³ vg / kg) or from approximately 5 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg (e.g., approximately 6 x 10¹³ vg / kg).
[0293] Alternatively, human patients with glycogen storage disorders (such as Pompe disease) may be given an amount of a drug that promotes GAA expression, sufficient to stimulate the GAA expression observed when human individuals of the same sex and similar body mass index are given an AAV2 / 8 vector containing a GAA transgenic gene under the control of the MCK promoter. For example, the drug can be administered to a patient in an amount sufficient to achieve a certain level of GAA activity equivalent to the GAA activity observed in human individuals of the same sex and similar body mass index after administration of the AAV carrier in the following amounts: approximately 1 x 10¹³ vg / kg, 1.1 x 10¹³ vg / kg, 1.2 x 10¹³ vg / kg, 1.3 x 10¹³ vg / kg, 1.4 x 10¹³ vg / kg, 1.5 x 10¹³ vg / kg, 1.6 x 10¹³ vg / kg, 1.7 x 10¹³ vg / kg, 1.8 x 10¹³ vg / kg, 1.9 x 10¹³ vg / kg, 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg. vg / kg, 2.3 x 1013 vg / kg, 2.4 x 1013 vg / kg, 2.5 x 1013 vg / kg, 2.6 x 1013 vg / kg, 2.7 x 1013 vg / kg, 2.8 x 1013 vg / kg, 2.9 x 1013 vg / kg, 3 x 1013 vg / kg、3.1 x 1013 vg / kg、3.2 x 1013 vg / kg、3.3 x 1013 vg / kg、3.4 x 1013 vg / kg、3.5 x 1013 vg / kg、3.6 x 1013 vg / kg、3.7 x 1013 vg / kg、3.8 x 1013 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg、4.1 x 1013 vg / kg、4.2 x 1013 vg / kg、4.3 x 1013 vg / kg、4.4 x 1013 vg / kg、4.5 x 1013 vg / kg、4.6 x 1013 vg / kg、4.7 x 1013 vg / kg、4.8 x 1013 vg / kg,4.97 x 1013 vg / kg、5.8 x 1013 vg / kg、5.9 x 1013 vg / kg、6 x 1013 vg / kg、6.1 x 1013 vg / kg、6.2 x 1013 vg / kg、6.3 x 1013 vg / kg、6.4 x 1013 vg / kg、6.5 x 1013 vg / kg、6.6 x 1013 vg / kg、6.7 x 1013 vg / kg、6.8 x 1013 vg / kg、6.9 x 1013 vg / kg、7 x 1013 vg / kg、7.1 x 1013 vg / kg、7.2 x 1013 vg / kg、7.3 x 1013 vg / kg、7.4 x 1013 vg / kg、7.5 x 1013 vg / kg、7.6 x 1013 vg / kg、7.7 x 1013 vg / kg、7.8 x 1013 vg / kg、7.9 x 1013 vg / kg、8 x 1013 vg / kg、8.1 x 1013 vg / kg、8.2 x 1013 vg / kg、8.3 x 1013 vg / kg、8.4 x 1013 vg / kg、8.5 x 1013 vg / kg、8.6 x 1013 vg / kg、8.7 x 1013 vg / kg、8.8 x 1013 vg / kg、8.9 x 1013 vg / kg、9 x 1013 vg / kg、9.1 x 1013 vg / kg、9.2 x 1013 vg / kg、9.3 x 1013 vg / kg、9.4 x 1013 vg / kg、9.5 x 1013 vg / kg、9.6 x 1013 vg / kg、9.7 x 1013 vg / kg、9.8 x 1013 vg / kg、9.9 x 1013 vg / kg、1 x 1014 vg / kg、1.1 x 1014 vg / kg、1.2 x 1014 vg / kg、1.3 x 1014 vg / kg、1.4 x 1014 vg / kg、1.5 x 1014 vg / kg、1.6 x 1014 vg / kg、1.7 x 1014 vg / kg、1.8 x 1014 vg / kg、1.9 x 1014 vg / kg、2 x 1014 vg / kg、2.1 x 1014 vg / kg、2.2 x 1014 vg / kg、2.3 x 1014 vg / kg、2.4 x 1014 vg / kg、2.5 x 1014 vg / kg、2.6 x 1014 vg / kg, 2.7 x 1014 vg / kg, 2.8 x 1014 vg / kg, 2.9 x 1014 vg / kg or 3 x 1014 vg / kg.
[0294] For example, in some embodiments, the agent is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to that observed in a human individual of the same sex and similar body mass index, at an amount of approximately 2 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as the GAA activity levels observed after administration of the AAV carrier in the following amounts: approximately 2 x 10¹³ vg / kg, 2.1 x 10¹³ vg / kg, 2.2 x 10¹³ vg / kg, 2.3 x 10¹³ vg / kg, 2.4 x 10¹³ vg / kg, 2.5 x 10¹³ vg / kg, 2.6 x 10¹³ vg / kg, 2.7 x 10¹³ vg / kg, 2.8 x 10¹³ vg / kg, 2.9 x 10¹³ vg / kg, 3 x 1013 vg / kg、3.1 vg / kg, 3.9 x 1013 vg / kg, 4 x 1013 vg / kg, 4.1 x 1013 vg / kg, 4.2 x 1013 vg / kg, 4.3 x 1013 vg / kg, 4.4 x 1013 vg / kg, 4.5 x 1013 vg / kg, 4.6 x 1013 vg / kg, 4.7 x 1013 vg / kg、4.8 x 1013 vg / kg、4.9 x 1013 vg / kg、5 x 1013 vg / kg、5.1 x 1013 vg / kg、5.2 x 1013 vg / kg、5.3 x 1013 vg / kg、5.4 x 1013 vg / kg、5.5 x 1013 vg / kg, 5.6 x 1013 vg / kg, 5.7 x 1013 vg / kg, 5.8 x 1013 vg / kg, 5.9 x 1013 vg / kg, 6 x 1013 vg / kg, 6.1 x 1013 vg / kg, 6.2 x 1013 vg / kg, 6.3 x 1013 vg / kg, 6.4 x 1013 vg / kg, 6.5 x 1013 vg / kg, 6.6 x 1013 vg / kg, 6.7 x 1013 vg / kg, 6.8 x 1013 vg / kg, 6.9 x 1013 vg / kg, 7 x 1013 vg / kg, 7.1 x 1013 vg / kg, 7.2 x 1013 vg / kg, 7.3 x 1013 vg / kg, 7.4 x 1013 vg / kg, 7.5 x 1013 vg / kg, 7.6 x 1013 vg / kg, 7.7 x 1013 vg / kg, 7.8 x 1013 vg / kg, 7.9 x 1013 vg / kg、8 vg / kg, 8.8 x 1013 vg / kg、8.9 vg / kg,9.7 x 1014 vg / kg, 1.6 x 1014 vg / kg, 1.7 x 1014 vg / kg, 1.8 x 1014 vg / kg, 1.9 x 1014 vg / kg or 2 x 1014 vg / kg. In some embodiments, the drug is administered to the patient in an amount sufficient to achieve a certain level of GAA activity equivalent to that observed in a human individual of the same sex and similar body mass index after administration of an AAV carrier at amounts ranging from approximately 2 x 10¹³ vg / kg to approximately 2 x 10¹⁴ vg / kg, such as approximately 2 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg, such as approximately 2 x 10¹³ vg / kg to approximately 4 x 10¹³ vg / kg (e.g., approximately 3 x 10¹³ vg / kg), or approximately 5 x 10¹³ vg / kg to approximately 7 x 10¹³ vg / kg (e.g., approximately 6 x 10¹³ vg / kg).
[0295] To assess a patient’s GAA performance level after administration of the treatment described above, a person skilled in this technique may analyze one or more of the following events: (1) the generation of an RNA template from a DNA sequence encoding GAA; (2) the processing of RNA transcripts encoding GAA proteins (e.g., by splicing, editing, 5' cap formation and / or 3' end processing); (3) the translation of RNA into GAA peptides or proteins; and (4) post-translational modifications of GAA peptides or proteins. GAA performance can be assessed, for example, by detecting the following: an increase in the amount or concentration of mRNA encoding the corresponding protein (e.g., using RNA detection procedures described herein or known in this technique, such as quantitative polymerase chain reaction (qPCR) and RNA seq), an increase in the amount or concentration of the corresponding protein (e.g., using protein detection methods described herein or known in this technique, particularly such as enzyme-linked immunosorbent assay (ELISA)), and / or an increase in the activity of GAA proteins in samples obtained from the individual. [Other Embodiments] [ ]
[0296] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference as if each individual publication or patent application specifically and individually indicated to be incorporated by reference.
[0297] Although the invention has been described in conjunction with specific embodiments thereof, it should be understood that the invention is capable of further modifications, and this application is intended to cover any variations, uses or alterations of the invention that generally follow the principles of the invention and include deviations from the invention, such deviations being within the known or customary practice in the art to which the invention pertains and applicable to the essential features set forth above, and falling within the scope of the claims.
[0298] Other embodiments are within the scope of the patent application.
[0299]
[0300]
[0301]
[0302]
[0303]
[0304]
[0305]
[0306]
Claims
1. An adeno-associated virus (AAV) vector comprising a transgene encoding an acidic alpha-glucosidase (GAA), wherein the AAV vector is an AAV2 / 8 vector, and wherein the transgene encoding GAA is operatively linked to a muscle creatine kinase (MCK) promoter having the amino acid sequence of SEQ ID NO: 2, and the MCK promoter having the sequence of SEQ ID NO:
1.
2. The AAV vector of claim 1, wherein the AAV vector contains a recombinant capsid protein.
3. The AAV vector of claim 1, wherein the transgene encoding GAA is operatively linked to an enhancer that induces the expression of the transgene in muscle and / or neuronal cells.
4. The AAV vector as claimed in claim 3, wherein the enhancer is a CMV enhancer, a myocyte enhancer factor 2 (MEF2) enhancer, or a MyoD enhancer.
5. The AAV vector of claim 1, wherein, after administration of the AAV vector to a human patient diagnosed with Pompe disease, the human patient exhibits endogenous GAA activity that is 50% to 200% of the endogenous GAA activity of a person of the same sex and similar body mass index who does not have Pompe disease.
6. The AAV vector of claim 1, wherein, after administration of the AAV vector to a human patient diagnosed with Pompe disease, the human patient exhibits a reduction in glycogen in skeletal muscle, cardiac muscle and / or neuronal tissue.