Primer pair, kit and method for detecting chlamydia pneumoniae

Abstract

This disclosure provides a primer pair for detecting *Chlamydia pneumoniae*, comprising a antegrade primer and a reverse primer targeting the peptidoglycan-associated lipoprotein (Pal) gene, wherein the Pal gene contains the nucleotide sequence shown in SEQ ID NO:15. The antegrade primer is 15 to 25 nucleotides in length and corresponds to the nucleotide sequence between sites 1 to 33 of SEQ ID NO:15. The reverse primer is 15 to 30 nucleotides in length and corresponds to the nucleotide sequence between sites 64 to 123 of SEQ ID NO:15. This disclosure also provides a kit for detecting *Chlamydia pneumoniae* comprising the aforementioned primer pair, and a method for detecting *Chlamydia pneumoniae* using the aforementioned primer pair.

Description

Technical Field

[0001] This disclosure relates to primer pairs, kits, and methods for detecting Chlamydia spp., and particularly to primer pairs, kits, and methods for detecting Chlamydia pneumoniae. Prior Technology

[0002] Chlamydia pneumoniae is a common respiratory pathogen and a leading cause of atypical pneumonia. It has no specific seasonal pattern of infection and can occur year-round, with a major epidemic occurring approximately every 10 years. Chlamydia pneumoniae infection is widespread globally, accounting for about 20% of community-acquired pneumonia. Serological statistics show that more than half the population has antibodies against Chlamydia pneumoniae. Common symptoms caused by Chlamydia pneumoniae include pharyngitis, and others include rhinitis, hoarseness, fever, abdominal pain, diarrhea, nausea, and vomiting. Recent studies have also shown a high correlation between asthma, arteriosclerosis, and multiple sclerosis and Chlamydia pneumoniae infection. In young children, Chlamydia pneumoniae infection is a major cause of respiratory infections and asthma.

[0003] Atypical pneumonia, in its pathogenesis, easily affects multiple organs, leading to multiple organ dysfunction, including a decrease in white blood cell count and abnormal liver function. Generally, antibiotic treatment within five days is most effective. Because the symptoms of atypical pneumonia are highly similar to those of influenza or the common cold, early diagnosis is difficult, often resulting in missed opportunities for early treatment. Therefore, differential diagnosis of Chlamydia pneumoniae is of great significance for the early diagnosis, early treatment, and control of infection risk in atypical pneumonia.

[0004] In view of this, developing detection tools and methods that can quickly and accurately detect whether someone is infected with Chlamydia pneumoniae is very important for improving the cure rate of the disease, and it is one of the topics that the industry is currently working hard to research. Summary of the Invention

[0005] According to some embodiments disclosed herein, a primer pair for detecting *Chlamydia pneumoniae* is provided, comprising a antegrade primer and a reverse primer targeting the peptidoglycan-associated lipoprotein (Pal) gene, wherein the Pal gene contains the nucleotide sequence shown in SEQ ID NO:15. The antegrade primer is 15 to 25 nucleotides in length and corresponds to the nucleotide sequence between sites 1 to 33 of SEQ ID NO:15. The reverse primer is 15 to 30 nucleotides in length and corresponds to the nucleotide sequence between sites 64 to 123 of SEQ ID NO:15.

[0006] According to some embodiments disclosed herein, a kit for detecting *Chlamydia pneumoniae* is also provided, comprising a antegrade primer, a reverse primer, and a probe. The antegrade primer, reverse primer, and probe are targeted at the peptidoglycan-associated lipoprotein (Pal) gene, and the Pal gene contains the nucleotide sequence shown in SEQ ID NO:15. The antegrade primer is 15 to 25 nucleotides in length and corresponds to the nucleotide sequence between sites 1 to 33 shown in SEQ ID NO:15. The reverse primer is 15 to 30 nucleotides in length and corresponds to the nucleotide sequence between sites 64 to 123 shown in SEQ ID NO:15.

[0007] According to some embodiments disclosed herein, a method for detecting *Chlamydia pneumoniae* is further provided, comprising providing a sample and providing a primer pair, the primer pair comprising a antegrade primer and a reverse primer targeting the peptidoglycan-associated lipoprotein (Pal) gene, and the Pal gene comprising the nucleotide sequence shown in SEQ ID NO:15. The antegrade primer is 15 to 25 nucleotides in length and corresponds to the nucleotide sequence between sites 1 to 33 shown in SEQ ID NO:15. The reverse primer is 15 to 30 nucleotides in length and corresponds to the nucleotide sequence between sites 64 to 123 shown in SEQ ID NO:15. The method for detecting *Chlamydia pneumoniae* further comprises performing a polymerase chain reaction with the sample using the primer pair to obtain a product, and analyzing the product to detect the presence of *Chlamydia pneumoniae*.

[0008] To make the features or advantages of this disclosure more apparent and understandable, some embodiments are described below in detail with reference to the accompanying drawings. Simple Explanation of the Diagram

[0009] Figure 1 shows a partial fragment of the peptidoglycan-associated lipoprotein (Pal) gene sequence (GenBank: LN847257.1) and the designed locations of the antegrade primer, probe, and inverse primer, according to some embodiments of this disclosure; Figure 2 shows temperature profiles of instantaneous quantitative polymerase chain reaction according to some embodiments of this disclosure; Figure 3A shows amplification curves of instantaneous quantitative polymerase chain reaction according to some embodiments of this disclosure; Figure 3B shows the standard curves of instantaneous quantitative polymerase chain reaction according to some embodiments of this disclosure; Figure 4 shows the electrophoresis results of real-time quantitative polymerase chain reaction products according to some embodiments of this disclosure. Implementation

[0010] The primer pairs, kits, and methods for detecting *Chlamydia pneumoniae* according to embodiments of this disclosure are described in detail below. It should be understood that the following description provides many different embodiments for implementing various forms of some embodiments of this disclosure, but this is not the only form for implementing or utilizing the specific embodiments of the invention disclosed herein. The embodiments disclosed herein can be combined or substituted with each other where advantageously possible, and other embodiments can be added to one embodiment without further description or explanation. In the following description, many specific details will be set forth in detail to enable the reader to fully understand the following embodiments. However, the embodiments disclosed in this invention can also be practiced without such specific details.

[0011] In this document, unless otherwise specified in the text, “a” and “the” may refer to one or more. It should be understood that the terms “comprising,” “including,” “having,” and similar terms used herein specify the features, areas, integers, steps, operations, elements, and / or components described herein, but do not exclude other features, areas, integers, steps, operations, elements, and / or components.

[0012] Unless otherwise defined, all terms used herein (including technical and scientific terms) have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. It is understood that these terms, for example, as defined in commonly used dictionaries, should be interpreted as having a meaning consistent with the relevant art and the background or context of this disclosure, and should not be interpreted in an idealized or overly formal manner, unless specifically defined in the embodiments of this disclosure.

[0013] According to embodiments of this disclosure, a primer pair, a kit, and a method for detecting *Chlamydia pneumoniae* are provided. The primer pair detects a specific gene fragment of *Chlamydia pneumoniae*, and performs highly sensitive, highly specific, and rapid detection using this specific gene fragment as the amplification target. According to embodiments of this disclosure, the kit for detecting *Chlamydia pneumoniae* virus can withstand interference from high concentrations of human genomic DNA, maintain the detection sensitivity of the polymerase chain reaction, and achieves a sequence coverage of over 99% for the specific gene fragment of *Chlamydia pneumoniae*.

[0014] According to some embodiments of this disclosure, a primer pair for detecting *Chlamydia pneumoniae* is provided, comprising a forward primer and a reverse primer targeting the peptidoglycan-associated lipoprotein (Pal) gene, wherein the Pal gene contains the nucleotide sequence shown in SEQ ID NO:15. The forward and reverse primers are designed to target the nucleotide sequence shown in SEQ ID NO:15. Specifically, according to some embodiments, the Pal gene contains a fragment corresponding to base pairs 879351 to 879473 of GenBank:LN847257.1 (SEQ ID NO:15).

[0015] Please refer to Figure 1, which shows a partial fragment of the peptidoglycan-associated lipoprotein (Pal) gene sequence (GenBank: LN847257.1) and the designed positions of the antegrade primer, probe, and reverse primer according to some embodiments of this disclosure. As shown in Figure 1, the antegrade primer corresponds to the nucleotide sequence between sites 1 and 33 of SEQ ID NO: 15, and the reverse primer corresponds to the nucleotide sequence between sites 64 and 123 of SEQ ID NO: 15. In other words, the antegrade primer can be designed from the positions between sites 1 and 33 of SEQ ID NO: 15, and the reverse primer can be designed from the positions between sites 64 and 123 of SEQ ID NO: 15.

[0016] Furthermore, the length of the forward primer can be 15 to 25 nucleotides, and the length of the reverse primer can be 15 to 30 nucleotides. According to some embodiments, the length of the forward primer can be 19 to 25 nucleotides, for example, 20, 21, 22, 23, or 24. According to some embodiments, the length of the reverse primer can be 18 to 27 nucleotides, for example, 19, 20, 21, 22, 23, 24, 25, or 26.

[0017] According to some embodiments, the directional primer may comprise a nucleotide sequence as shown in any one of SEQ ID NOs:1-3. According to some embodiments, the directional primer consists of the nucleotide sequence shown in SEQ ID NO:1. According to some embodiments, the directional primer consists of the nucleotide sequence shown in SEQ ID NO:2. According to some embodiments, the directional primer consists of the nucleotide sequence shown in SEQ ID NO:3. According to some embodiments, the nucleotide sequences shown in SEQ ID NOs:1-3 may also allow for some degree of variation. For example, according to some embodiments, the directional primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:1, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:1, but is not limited thereto. According to some embodiments, the forward primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:2, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:2, but is not limited thereto. According to some embodiments, the forward primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:3, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:3, but is not limited thereto.

[0018] According to some embodiments, the reverse primer may comprise a nucleotide sequence as shown in any one of SEQ ID NOs:4-10. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:4. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:5. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:6. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:7. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:8. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:9. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:10. According to some embodiments, the nucleotide sequences shown in SEQ ID NOs:4-10 may also allow for some degree of variation. For example, according to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:4, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:4, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:5, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:5, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:6, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:6, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:7, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:7, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:8, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:8, but is not limited thereto.According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:9, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:9, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:10, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:10, but is not limited thereto.

[0019] Furthermore, according to some embodiments, the forward and reverse primers are used for polymerase chain reaction (PCR). PCR is a molecular biology technique that utilizes primer pairs with oligonucleotide sequences to amplify specific deoxyribonucleic acid (DNA) fragments. It should be understood that the primer pairs provided in this disclosure can be applied to various PCR-based techniques. According to some embodiments, PCR may include, but is not limited to, real-time quantitative PCR.

[0020] According to some embodiments disclosed herein, a kit for detecting *Chlamydia pneumoniae* is provided, comprising a antegrade primer, a reverse primer, and a probe. The antegrade primer, reverse primer, and probe are targeted at the peptidoglycan-associated lipoprotein (Pal) gene, and the Pal gene contains the nucleotide sequence shown in SEQ ID NO:15. The antegrade primer, reverse primer, and probe are designed to target the nucleotide sequence shown in SEQ ID NO:15. As shown in Figure 1, the antegrade primer may correspond to the nucleotide sequence between sites 1 to 33 of SEQ ID NO:15, the reverse primer may correspond to the nucleotide sequence between sites 64 to 123 of SEQ ID NO:15, and the probe may correspond to the nucleotide sequence between sites 34 to 63 of SEQ ID NO:15.

[0021] Furthermore, the length of the forward primer can be 15 to 25 nucleotides, and the length of the reverse primer can be 15 to 30 nucleotides. According to some embodiments, the length of the forward primer can be 19 to 25 nucleotides, for example, 20, 21, 22, 23, or 24. According to some embodiments, the length of the reverse primer can be 18 to 27 nucleotides, for example, 19, 20, 21, 22, 23, 24, 25, or 26. According to some embodiments, the length of the probe can be 20 to 30 nucleotides, for example, 21, 22, 23, 24, 25, 26, 27, 28, or 29.

[0022] According to some embodiments, the directional primer may comprise a nucleotide sequence as shown in any one of SEQ ID NOs:1-3. According to some embodiments, the directional primer consists of the nucleotide sequence shown in SEQ ID NO:1. According to some embodiments, the directional primer consists of the nucleotide sequence shown in SEQ ID NO:2. According to some embodiments, the directional primer consists of the nucleotide sequence shown in SEQ ID NO:3. According to some embodiments, the nucleotide sequences shown in SEQ ID NOs:1-3 may also allow for some degree of variation. For example, according to some embodiments, the directional primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:1, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:1, but is not limited thereto. According to some embodiments, the forward primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:2, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:2, but is not limited thereto. According to some embodiments, the forward primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:3, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:3, but is not limited thereto.

[0023] According to some embodiments, the reverse primer may comprise a nucleotide sequence as shown in any one of SEQ ID NOs:4-10. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:4. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:5. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:6. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:7. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:8. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:9. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:10. According to some embodiments, the nucleotide sequences shown in SEQ ID NOs:4-10 may also allow for some degree of variation. For example, according to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:4, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:4, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:5, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:5, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:6, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:6, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:7, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:7, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:8, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:8, but is not limited thereto.According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:9, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:9, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:10, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:10, but is not limited thereto.

[0024] According to some embodiments, the probe may comprise the nucleotide sequence shown in SEQ ID NO:11. According to some embodiments, the probe consists of the nucleotide sequence shown in SEQ ID NO:11. According to some embodiments, the nucleotide sequence shown in SEQ ID NO:11 may also allow for some degree of variation. For example, according to some embodiments, the probe may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:11, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:11, but is not limited thereto.

[0025] Furthermore, according to some embodiments, the antegrade primer, reverse primer, and probe are used for polymerase chain reaction. According to some embodiments, the polymerase chain reaction may include, but is not limited to, a real-time quantitative polymerase chain reaction. According to some embodiments, the real-time polymerase chain reaction used is a probe-based fluorescence system; therefore, before performing a polymerase chain reaction with the sample using the primer pair to obtain the product, the reaction further includes hybridization of the sample with the probe, causing the probe to adhere to the target sequence. That is, the primer pair, probe, and sample are subjected to a polymerase chain reaction together to obtain the product.

[0026] Specifically, according to some embodiments, the 5' end of the probe can be linked to a reporter dye, and the 3' end of the probe can be linked to a quencher. During the PCR amplification reaction, the probe is cleaved, causing the reporter dye and the quencher to separate, thus allowing the fluorescence emitted by the reporter dye to be detected. According to some embodiments, the reporter dye may contain Fluorescein (FAM), HEX, Texas Red, ROX, Cy5, or other suitable fluorescent groups, and the quencher may contain BHQ, TAMRA, DABCYL, or other suitable groups, but this disclosure is not limited thereto.

[0027] Furthermore, according to some embodiments, the kit for detecting *Chlamydia pneumoniae* further includes a forward primer and a reverse primer targeting the nucleic acid sequence of the human gene, wherein the forward primer contains the nucleotide sequence shown in SEQ ID NO:12, and the reverse primer contains the nucleotide sequence shown in SEQ ID NO:13. According to some embodiments, the kit for detecting *Chlamydia pneumoniae* further includes a probe targeting the nucleic acid sequence of the human gene, used in conjunction with the aforementioned forward and reverse primers targeting the nucleic acid sequence of the human gene. The forward and reverse primers targeting the nucleic acid sequence of the human gene can serve as an internal control to confirm correct sample collection. According to some embodiments, the human gene includes the RNase P gene, which is a housekeeping gene in the human body. The nucleic acid sequence of the human gene may contain a nucleotide sequence encoding ribonuclease P (RNase P).

[0028] According to some embodiments, the forward primer, reverse primer, and probe of the kit for detecting Chlamydia pneumoniae can be in a freeze-dried form and reconstituted in water for use when needed.

[0029] According to some embodiments of this disclosure, a method for detecting *Chlamydia pneumoniae* is provided, comprising the steps of: providing a sample and providing a primer pair. Specifically, the primer pair comprises a forward primer and a reverse primer targeting the peptidoglycan-associated lipoprotein (Pal) gene, and the Pal gene contains the nucleotide sequence shown in SEQ ID NO:15. The forward primer may correspond to the nucleotide sequence between sites 1 to 33 shown in SEQ ID NO:15, while the reverse primer may correspond to the nucleotide sequence between sites 64 to 123 shown in SEQ ID NO:15.

[0030] Furthermore, the length of the forward primer can be 15 to 25 nucleotides, and the length of the reverse primer can be 15 to 30 nucleotides. According to some embodiments, the length of the forward primer can be 19 to 25 nucleotides, for example, 20, 21, 22, 23, or 24. According to some embodiments, the length of the reverse primer can be 18 to 27 nucleotides, for example, 19, 20, 21, 22, 23, 24, 25, or 26.

[0031] According to some embodiments, the directional primer may comprise a nucleotide sequence as shown in any one of SEQ ID NOs:1-3. According to some embodiments, the directional primer consists of the nucleotide sequence shown in SEQ ID NO:1. According to some embodiments, the directional primer consists of the nucleotide sequence shown in SEQ ID NO:2. According to some embodiments, the directional primer consists of the nucleotide sequence shown in SEQ ID NO:3. According to some embodiments, the nucleotide sequences shown in SEQ ID NOs:1-3 may also allow for some degree of variation. For example, according to some embodiments, the directional primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:1, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:1, but is not limited thereto. According to some embodiments, the forward primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:2, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:2, but is not limited thereto. According to some embodiments, the forward primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:3, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:3, but is not limited thereto.

[0032] According to some embodiments, the reverse primer may comprise a nucleotide sequence as shown in any one of SEQ ID NOs:4-10. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:4. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:5. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:6. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:7. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:8. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:9. According to some embodiments, the reverse primer consists of the nucleotide sequence shown in SEQ ID NO:10. According to some embodiments, the nucleotide sequences shown in SEQ ID NOs:4-10 may also allow for some degree of variation. For example, according to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:4, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:4, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:5, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:5, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:6, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:6, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:7, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:7, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:8, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:8, but is not limited thereto.According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:9, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:9, but is not limited thereto. According to some embodiments, the reverse primer may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO:10, for example, it may consist of a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO:10, but is not limited thereto.

[0033] The sample may contain specimens from a variety of different sources. According to some embodiments, the sample may come from sources such as saliva, sputum, nasal swab, throat swab, nasopharyngeal, urine, feces, rectal swab, cerebrospinal fluid (CSF), body fluid, other suitable specimens, or combinations thereof.

[0034] Furthermore, the method for detecting *Chlamydia pneumoniae* further includes the following steps: performing a polymerase chain reaction (PCR) with a sample using a primer pair to obtain a product, and analyzing the product to detect the presence of *Chlamydia pneumoniae*. According to some embodiments, the step of performing a PCR with a sample using a primer pair to obtain a product includes performing a PCR such that the primer pair amplifies the nucleotide sequence of the *Pal* gene in *Chlamydia pneumoniae* to obtain a product. According to some embodiments, the PCR may include, but is not limited to, a real-time quantitative PCR.

[0035] According to some embodiments, the method for detecting *Chlamydia pneumoniae* further includes providing a probe. According to some embodiments, the probe is 20 to 30 nucleotides in length and may correspond to the nucleotide sequence between positions 34 and 63 shown in SEQ ID NO: 15. According to some embodiments, the probe may comprise the nucleotide sequence shown in SEQ ID NO: 11. According to some embodiments, the probe consists of the nucleotide sequence shown in SEQ ID NO: 11. According to some embodiments, the nucleotide sequence shown in SEQ ID NO: 11 may also allow for some degree of variation. For example, according to some embodiments, the probe may consist of a nucleotide sequence having at least 85% sequence similarity to SEQ ID NO: 11, such as a nucleotide sequence having at least 88%, 90%, 92%, 95%, 98%, or 99% sequence similarity to SEQ ID NO: 11, but is not limited thereto.

[0036] According to some embodiments, the 5' end of the probe can be linked to the reporter dye, and the 3' end of the probe can be linked to the quencher. During the PCR amplification reaction, the probe is cleaved, causing the reporter dye and the quencher to separate, thus allowing the fluorescence emitted by the reporter dye to be detected. According to some embodiments, the reporter dye may contain Fluorescein (FAM), HEX, Texas Red, ROX, Cy5, or other suitable fluorescent groups, and the quencher may contain BHQ, TAMRA, DABCYL, or other suitable groups, but this disclosure is not limited thereto.

[0037] Furthermore, according to some embodiments, the method for detecting *Chlamydia pneumoniae* further includes providing a forward primer and a reverse primer targeting a nucleic acid sequence of a human gene, wherein the forward primer contains a nucleotide sequence as shown in SEQ ID NO:12, and the reverse primer contains a nucleotide sequence as shown in SEQ ID NO:13. According to some embodiments, the method for detecting *Chlamydia pneumoniae* further includes providing a probe targeting a nucleic acid sequence of a human gene, used in conjunction with the aforementioned forward and reverse primers targeting a nucleic acid sequence of a human gene. The forward and reverse primers targeting a nucleic acid sequence of a human gene can serve as internal control groups to confirm correct sample collection. According to some embodiments, the human gene includes an RNase P gene, and the nucleic acid sequence of the human gene may contain a nucleotide sequence encoding RNase P.

[0038] To make the above and other objects, features and advantages of this disclosure more apparent and understandable, several embodiments are described in detail below, but they are not intended to limit the scope of this disclosure.

[0039] [Example] [1-] [Selection of primer pairs and probe combinations]

[0040] A 20 µL reaction solution was prepared by premixing 1x qPCR master mix (Biori 1X Neoscript RT premix, #FM5134), 500 nM forward primer, 500 nM reverse primer, and 100 nM probe (SEQ ID NO: 11) with deionized water. Plastid DNA (CP lpD, where the Pal gene fragment template was synthesized externally, approximately 630 bp in length, and the Pal gene fragment sequence was introduced into pBluescript SK(+) using E. coli) was diluted with 40 ng / µL tRNA to concentrations of 0.2*10^6, 0.2*10^4, 0.2*10^2, and 0.2*10^1 copies / µL, respectively.

[0041] The aforementioned 20µL premixed reaction solution was transferred to a Bio-Rad 8-tube (#TLS-0801), and 5µL of positive sample or 5µL of 40ng / µL tRNA (no template control, NTC) for each condition was added to the 8-tube. After addition, the reaction tube was sealed with a Bio-Rad optical transparent cap (#TCS-0803).

[0042] Next, a real-time quantitative polymerase chain reaction (RT-PCR) was performed using a Bio-Rad CFX Opus96 Real-Time PCR instrument (#12011319). Please refer to Figure 2, which shows the temperature curve of the R-PCR. As shown in Figure 2, the reaction conditions were: enzyme activation at 95°C for 30 seconds; 45 cycles of PCR were performed, with each cycle consisting of 5 seconds of denaturation at 95°C and 10 seconds of binding and amplification at 60°C, and fluorescence detection was performed at the end of each cycle.

[0043] After the reaction was completed, the cycle threshold (Cq value) was analyzed and statistically analyzed using CFX Maestro software. The results are shown in Table 1 below.

[0044] Table 1 template CP lpD(082622) (a plastid carrying the CP-Pal gene at a length of 630 bp, which is digested into a strand form of DNA by EcoRV restriction enzyme) Group 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 twenty one Forward Introduction (SED ID NO.) 1 2 3 Reverse Introduction (SED ID NO.) 4 5 6 7 8 9 10 4 5 6 7 8 9 10 4 5 6 7 8 9 10 10^6 cp / rxn 20.38 20.10 20.08 19.98 20.27 20.16 20.13 20.34 20.12 20.20 20.29 20.60 20.16 20.34 21.43 20.42 20.57 20.29 20.63 20.44 20.17 10^4 cp / rxn 27.21 26.70 26.63 26.49 26.98 26.71 26.69 27.42 26.92 26.75 26.92 27.03 27.13 26.83 28.84 26.66 27.02 26.92 27.20 27.13 26.91 10^2 cp / rxn 34.01 33.28 33.14 33.38 33.77 33.72 34.28 34.05 33.58 33.57 33.07 34.53 33.87 33.27 36.05 33.36 33.67 33.34 34.25 34.16 33.53 33.92 33.48 33.26 33.12 34.32 33.97 32.93 34.38 33.87 33.96 33.59 33.30 34.07 33.47 35.87 33.27 32.94 32.65 33.75 34.14 33.11 10^1 cp / rxn 37.17 37.09 36.12 36.31 37.50 37.33 36.69 37.83 37.16 37.41 36.50 36.84 36.92 37.24 39.44 37.12 38.15 36.07 36.62 36.98 37.25 37.70 36.67 37.16 35.94 36.92 36.63 36.33 38.62 36.73 39.07 36.28 37.16 37.26 36.68 39.91 36.77 36.37 36.20 37.14 37.24 36.82 36.41 36.85 37.41 37.31 36.07 36.54 37.26 37.69 37.40 36.97 37.11 36.43 37.19 36.71 39.02 38.25 36.00 36.10 37.21 37.59 36.54 NTC No No No No No No No No NaN NaN NaN NaN NaN NaN NaN NaN NaN NaN NaN NaN NaN

[0045] As shown in Table 1, the screening results of various combinations consisting of the forward primers shown in any of SEQ ID NOs:1-3, the reverse primers shown in any of SEQ ID NOs:4-10, and the probe shown in SEQ ID NO:11 are all excellent.

[0046] [Example] [2-] [Prime pairs and probe combinations] [PCR] [Efficiency Test]

[0047] One qPCR master mix (Biori Neoscript RT premix), 500 nM forward primer, 500 nM reverse primer, and 100 nM probes (primer pairs and probe combinations from groups 11, 12, 16, and 17) were premixed with deionized water to prepare a 20 µL reaction solution. The plastid DNA (CP lpD) containing the synthetic Pal gene fragment template, as described above, was then serially diluted 10-fold, and templates of 10, 10^2, 10^3, 10^4, and 10^5 copies / µL were added to the 20 µL reaction solution, resulting in a final reaction volume of 25 µL.

[0048] Next, a Bio-Rad CFX Opus96 Real-Time PCR instrument was used to perform real-time quantitative polymerase chain reaction. As shown in Figure 2, the reaction conditions were as follows: enzyme activation phase at 95°C for 30 seconds; PCR phase was performed for 45 cycles, with denaturation at 95°C for 5 seconds and binding and amplification at 60°C for 10 seconds per cycle, and fluorescence detection was performed at the end of each cycle.

[0049] After the reaction was completed, the amplification curves (as shown in Figure 3A) and standard curves (as shown in Figure 3B) obtained from the real-time quantitative polymerase chain reaction were analyzed using CFX Maestro software (taking the results of Group 16 as an example). From the amplification curves, it can be seen that the fluorescence values ​​of 10 to 10^6 copy numbers all showed a positive upward trend.

[0050] Furthermore, Cq values, PCR efficiency (E%), R^2, and slope were analyzed and statistically analyzed using CFX Maestro software, and the results are shown in Table 2 below.

[0051] Table 2 CP (ROX) Target Cq value copies / rxn Group 11 Group 12 Group 16 Group 17 10^6 19.80 20.12 19.71 19.75 10^5 23.13 23.36 23.01 23.14 10^4 26.32 26.75 26.48 26.37 10^3 29.38 29.93 29.57 29.72 10^2 32.26 32.72 33.03 33.13 10^1 36.01 36.78 35.74 36.57 36.02 36.44 36.75 35.57 NTC NaN NaN NaN NaN E (%) 100.70 102.30 105.00 102.20 R^2 0.998 0.998 0.999 0.999 Slope -3.31 -3.27 -3.21 -3.27

[0052] Based on the cycle threshold (Cq value) obtained for different copy numbers, the detection range of the primer pair and probe combination designed in this study in *Chlamydia pneumoniae* can be verified. As shown in Table 2, real-time quantitative polymerase chain reaction (RT-PCR) was performed under different template amounts (10~10^6 copy numbers). The R^2 values ​​obtained for groups 11, 12, 16, and 17 were all greater than 0.99, indicating high accuracy of this regression model. Furthermore, the PCR efficiency of the primer pair and probe combination in groups 11, 12, 16, and 17 was all above 100% at all concentrations.

[0053] [Example] [3-] [Conservation analysis of primer pairs and probe sequences with the database]

[0054] The sequences of the forward primers of SEQ ID NOs:1-3, the reverse primers of SEQ ID NOs:4-10, and the probe of SEQ ID NO:11 were compared with the Pal gene sequence in the NCBI database (GenBank:LN847257.1) for sequence coverage analysis. The results are shown in Table 3 below.

[0055] Table 3 SEQ ID NO. of primer and probe. Primer and probe sequences Sequence alignment coverage (NCBI Database) 1 TAAAGCAAGGTTATAGGATGCAG 100.00% 2 CAAGGTTATAGGATGCAGCTC 100.00% 3 GTGCTCCTAAAGCAAGGTTATAG 100.00% 4 TTCTCACGAACTTGGTTCACT 100.00% 5 CTTGCGATTCTCACGAACTTG 100.00% 6 AGAACCTTGCGATTCTCACG 100.00% 7 AAGAAAAACCCGAAAGCTACAC 100.00% 8 CTTGGTTCACTACATGAAGAAAAAC 100.00% 9 ACGAACTTGGTTCACTACATGA 100.00% 10 TCACGAACTTGGTTCACTACA 100.00% 11 ACGCTCGTCAGTATGCCCTTCAATGT 100.00%

[0056] As shown in Table 3, the sequences of the forward primers of SEQ ID NOs:1-3, the reverse primers of SEQ ID NOs:4-10, and the probe of SEQ ID NO:11 all have 100% coverage in the NCBI database.

[0057] [Example] [4-] [Product Analysis of Real-Time Quantitative Polymerase Chain Reaction]

[0058] First, human genomic DNA (gDNA) was prepared by extracting nucleic acids from fresh human whole blood using the Qiagen QIAamp DNA Blood Mini kit (#51104). The extracted nucleic acid eluent was then quantified using the Qubit dsDNA HS Assay Kit (#032851).

[0059] Premix 1x qPCR master mix (Biori Neoscript RT Premix, #FM5134), 500 nM forward primer, 500 nM reverse primer, and 100 nM probe (primer pair and probe combination from group 16) with deionized water to prepare 20 µL of reaction solution. Perform a 10-fold sequence dilution of plasso DNA (CP lpD) containing the synthetic Pal gene fragment template as described above, and add templates of 20, 10^2, and 10^4 copies / µL to 20 µL of reaction solution respectively. Also prepare a separate reaction solution containing 200 ng gDNA and 10^2 copies / µL of template. The final reaction volume is 25 µL.

[0060] Real-time quantitative polymerase chain reaction (PCR) was performed using a Bio-Rad CFX Opus96 Real-Time PCR instrument. As shown in Figure 2, the reaction conditions were: enzyme activation at 95°C for 30 seconds; 45 cycles of PCR were performed, with denaturation at 95°C for 5 seconds and binding and amplification at 60°C for 10 seconds per cycle, and fluorescence detection was performed at the end of each cycle.

[0061] After the reaction, the PCR products were diluted 10X with TE buffer and analyzed by capillary electrophoresis using an Agilent Fragment Analyzer 5300 (#M5311AA) and dsDNA 905 Reagent (#DNF-905-K0500). Finally, fragment size analysis was performed using ProSize data analysis software. The results are shown in Figure 4.

[0062] As shown in Figure 4, the columns from left to right represent the molecular weight marker ladder, template groups of 10^4, 10^2, and 20 copies / µL, template group of 10^2 copies / µL plus 200ng gDNA, and no template control (NTC). The electrophoresis results show that the template groups of 10^4, 10^2, and 20 copies / µL, and the 20 copies / µL template plus 200ng gDNA, all produced specific amplification products (118 bp) of *Chlamydia pneumoniae*. Therefore, the primer pairs and probe combinations in group 16 (SEQ ID NOs: 3, 5, 11_) can accurately identify *Chlamydia pneumoniae* and are resistant to interference from high concentrations of human genomic DNA.

[0063] [Example] [5-] [Sensitivity Analysis of Primitive Pairs and Probe Combinations]

[0064] First, human genomic DNA (gDNA) was prepared by extracting nucleic acids from fresh human whole blood using the Qiagen QIAamp DNA Blood Mini kit (#51104). The extracted nucleic acid eluent was then quantified using the Qubit dsDNA HS Assay Kit (#032851).

[0065] Premix 1x qPCR master mix (Biori Neoscript RT Premix, #FM5134), 500 nM forward primer, 500 nM reverse primer, and 100 nM probes (primer pairs and probe combinations from groups 11, 12, 16, and 17) with deionized water to prepare 20 µL of reaction solution. Perform a 10-fold sequence dilution of plasso DNA (CP lpD) containing the synthetic Pal gene fragment template as described above, and add 10^2 copies / µL of template and 200 ng gDNA to each 20 µL of reaction solution, for a final reaction volume of 25 µL.

[0066] Real-time quantitative polymerase chain reaction (PCR) was performed using a Bio-Rad CFX Opus96 Real-Time PCR instrument. As shown in Figure 2, the reaction conditions were: enzyme activation at 95°C for 30 seconds; 45 cycles of PCR were performed, with denaturation at 95°C for 5 seconds and binding and amplification at 60°C for 10 seconds per cycle, and fluorescence detection was performed at the end of each cycle.

[0067] Furthermore, the Cq value was calculated using CFX Maestro software, and the results are shown in Table 4 below.

[0068] Table 4 CP (ROX) Target Cq value copies / rxn Group 11 Group 12 Group 16 Group 17 H2O 33.08 33.10 33.19 33.02 32.68 32.68 32.98 33.01 100 + 200 ng gDNA 32.49 33.01 33.27 33.34 32.37 33.00 33.16 32.84

[0069] As shown in Table 4, the primer pairs and probe combinations of groups 11, 12, 16 and 17 could still be detected at 100 copies / rxn even under interference from 200 ng gDNA, indicating that they can perform highly sensitive detection of Chlamydia pneumoniae under high concentrations of human genomic DNA interference.

[0070] [Example] [6-] [Analysis of Lyophilized Formulations of Primer Pairs and Probe Combinations]

[0071] 1x qPCR master mix, 500 nM forward primer, 500 nM reverse primer, and 100 nM probe were premixed with deionized water to form a 20 µL reaction solution, which was then dried using a lyophilization program to prepare lyophilized drug cakes.

[0072] 20 µL of TF-1a human erythroblasts (Leadgene, 10^6 cells / mL) were premixed with 380 µL of Copan Universal Transport Medium (#330C). Extraction was performed using the Dagene G1 fully automated nucleic acid detection system. First, 400 µL of the premixed solution was added to Proteinase K for the extraction cartridge, followed by 400 µL of Lysis buffer. All the mixture was then transferred to the extraction cartridge and placed in the instrument for extraction. After the extraction was completed, the eluent was collected for later use.

[0073] The lyophilized drug cake was dissolved in 20 µL of the previously collected extraction eluent. Then, the plastid DNA (CP lpD) containing the artificially synthesized Pal gene fragment template, as described above, was diluted sequentially to 0.2*10^2 and 0.2*10^1 positive samples using tRNA at a concentration of 40 ng / µL.

[0074] Add 20 µL of the reaction reagent dissolved in the lyophilized drug cake to a G1-specific reaction tube, then add 5 µL of the positive sample from each of the aforementioned conditions for mixing, or add 5 µL of 40 ng / µL tRNA from the NTC group to the G1 reaction tube. After addition, seal the G1 reaction tube with the cap.

[0075] The reaction was performed using the Dagene G1 fully automated nucleic acid detection system. The reaction conditions were 95°C for 30 seconds for enzyme activation, followed by 45 cycles of PCR, with each cycle consisting of 5 seconds of denaturation at 95°C and 10 seconds of binding and amplification at 60°C. Fluorescence detection was performed at the end of each cycle.

[0076] After the reaction was completed, the Cq values ​​displayed by the Dagene G1 fully automated nucleic acid detection system were analyzed and statistically analyzed. The results are shown in Table 5 below.

[0077] Table 5 Cp (ROX) Cq value of liquid reagent Cq value of freeze-dried reagent 100 copies / µL 33.41 32.69 33.3 32.87 20 copies / µL 35.95 34.98 35.89 35.79 NTC N / A NaN N / A NaN

[0078] As shown above, the freeze-dried primer pairs and probe combinations, after being reconstituted in water, can achieve the same efficiency as liquid reagents by performing instantaneous quantitative polymerase chain reactions.

[0079] [Example] [7-] [Detection Limits of Primitive Pairs and Probe Combinations] [(limit of Detection)] [,] [LoD] [analyze]

[0080] 1x qPCR master mix, 500 nM forward primer, 500 nM reverse primer, and 100 nM probe were premixed with deionized water to form a 20 µL reaction solution, which was then dried using a lyophilization program to prepare lyophilized drug cakes.

[0081] The lyophilized drug cake was dissolved in 20 µL of deionized water. Then, the plastid DNA (CP lpD) containing the artificially synthesized Pal gene fragment template, as described above, was diluted sequentially to 0.2*20, 0.2*10^1, and 0.2*5 copies / µL using tRNA at a concentration of 40 ng / µL.

[0082] Add 20 µL of the reaction reagent dissolved in the lyophilized drug cake to a G1-specific reaction tube, then add 5 µL of the positive sample from each of the aforementioned conditions for mixing, or add 5 µL of 40 ng / µL tRNA from the NTC group to the G1 reaction tube. After addition, seal the G1 reaction tube with the cap.

[0083] The reaction was performed using the Dagene G1 fully automated nucleic acid detection system. The reaction conditions were 95°C for 30 seconds for enzyme activation, followed by 45 cycles of PCR, with each cycle consisting of 5 seconds of denaturation at 95°C and 10 seconds of binding and amplification at 60°C. Fluorescence detection was performed at the end of each cycle.

[0084] After the reaction was completed, the Cq values ​​displayed by the Dagene G1 fully automated nucleic acid detection system were analyzed and statistically analyzed. The results are shown in Table 6 below.

[0085] Table 6 Hit rate Copy number 20 copies / rxn 10 c copies / rxn 5 copies / rxn NTC LOD 95% IC copy (RNase P gene) 1E+5 copies / rxn (Probit Analysis) Cp (ROX) 6 / 6 6 / 6 6 / 6 0 / 6 5 copies IC (HEX) 6 / 6 6 / 6 6 / 6 0 / 6

[0086] As shown in Table 6, under the condition of high concentration of internal control group (IC), the detection limit (LoD) of the primer pair and probe combination provided in this disclosed embodiment can reach 5 copies / rxn.

[0087] [Example] [8-] [Detection results of primer pairs and probe combinations for Chlamydia pneumoniae]

[0088] 1x qPCR master mix, 500 nM forward primer, 500 nM reverse primer, and 100 nM probe (primer pair and probe combination of group 16) were premixed with deionized water to form a 20 µL reaction solution, which was then dried using a lyophilization program.

[0089] Chlamydia pneumoniae (strain CWL-029) in NATtrol™ Respiratory Verification Panel 2.1 was diluted with PBS buffer to a concentration of 10, 100 cells / µL.

[0090] The entire analysis process (nucleic acid extraction + polymerase chain reaction) was performed using the Dagene G1 fully automated nucleic acid detection system. First, the dried reagents were loaded into the cartridge. Then, 380 µL of Copan Universal Transport Medium (#330C) was mixed with 20 µL of bacterial suspension prepared in the previous step. Next, Proteinase K for the extraction cartridge was added, followed by 400 µL of Lysis buffer. All the mixture was then transferred to the cartridge and placed in the instrument for the entire process.

[0091] The reaction was performed using the Dagene G1 fully automated nucleic acid detection system. The reaction conditions were 95°C for 30 seconds for enzyme activation, followed by 45 cycles of PCR, with each cycle consisting of 5 seconds of denaturation at 95°C and 10 seconds of binding and amplification at 60°C. Fluorescence detection was performed at the end of each cycle.

[0092] After the reaction was completed, the Cq values ​​displayed by the Dagene G1 fully automated nucleic acid detection system were analyzed and statistically analyzed. The results are shown in Table 7 below.

[0093] Table 7 Extraction and processing using Dagene G1. plex RNV multiplex Group Group 16 SEQ ID NO. 3 5 11 virus source NATtrol™ Respiratory Verification Panel 2.1 Strain: CWL-029 sample concentration Sample input volume (400µL) G1-Copan 5000 copies / mL 2000 copies / rxn 35.09 35.85 500 copies / mL 200 copies / rxn 37.21 37.82

[0094] As shown in Table 7, the CWL-029 strain of Chlamydia pneumoniae can be detected by using the Dagene G1 instrument with the primer pair and probe combination provided in the embodiments disclosed herein.

[0095] In summary, according to the embodiments disclosed herein, a primer pair, a kit, and a method for detecting *Chlamydia pneumoniae* are provided. The primer pair detects a specific gene fragment of *Chlamydia pneumoniae*, and performs highly sensitive, highly specific, and rapid detection using this specific gene fragment as the amplification target. According to the embodiments disclosed herein, the kit for detecting *Chlamydia pneumoniae* virus can withstand interference from high concentrations of human genomic DNA, maintain the detection sensitivity of the polymerase chain reaction, and achieves a sequence coverage of over 99% for the specific gene fragment of *Chlamydia pneumoniae*.

[0096] While the embodiments and advantages of this disclosure have been presented above, it should be understood that anyone skilled in the art can make modifications, substitutions, and refinements without departing from the spirit and scope of this disclosure. Furthermore, each claim constitutes an individual embodiment, and the scope of protection of this disclosure also includes combinations of the various claims and embodiments. The scope of protection of this disclosure shall be determined by the appended claims.

[0097] none

[0098] A0101_OR_PSEQ.xml

Claims

1. A primer pair for detecting *Chlamydia pneumoniae*, comprising a antegrade primer and a retrograde primer targeting the peptidoglycan-associated lipoprotein (Pal) gene, wherein the Pal gene comprises the nucleotide sequence shown in SEQ ID NO:15; wherein, The forward primer consists of the nucleotide sequences shown in any one of SEQ ID NOs:1-3, and the reverse primer consists of the nucleotide sequences shown in any one of SEQ ID NOs:4-10.

2. A kit for detecting Chlamydia pneumoniae, comprising: The present invention comprises a antegrade primer, a retrograde primer, and a probe, wherein the antegrade primer, the retrograde primer, and the probe are targeted at the peptidoglycan-associated lipoprotein (Pal) gene, and the Pal gene includes the nucleotide sequence shown in SEQ ID NO:15; wherein the antegrade primer is composed of the nucleotide sequences shown in any one of SEQ ID NOs:1-3, the retrograde primer is composed of the nucleotide sequences shown in any one of SEQ ID NOs:4-10, and the probe is composed of the nucleotide sequence shown in SEQ ID NO:

11.

3. The kit for detecting Chlamydia pneumoniae as described in claim 2, wherein the 5' end of the probe is connected to a reporter dye and the 3' end of the probe is connected to a quencher.

4. The kit for detecting Chlamydia pneumoniae as described in claim 2 further includes a forward primer and a reverse primer targeting a nucleic acid sequence of a human-derived gene, wherein the forward primer includes a nucleotide sequence as shown in SEQ ID NO:12 and the reverse primer includes a nucleotide sequence as shown in SEQ ID NO:

13.

5. A method for detecting *Chlamydia pneumoniae*, comprising the following steps: providing a sample; providing a primer pair comprising a antegrade primer and a reverse primer targeting a peptidoglycan-associated lipoprotein (Pal) gene, wherein the Pal gene comprises a nucleotide sequence as shown in SEQ ID NO:15, wherein the antegrade primer consists of a nucleotide sequence shown in any one of SEQ ID NOs:1-3, and the reverse primer consists of a nucleotide sequence shown in any one of SEQ ID NOs:4-10; providing a probe, wherein the probe consists of a nucleotide sequence shown in SEQ ID NO:11; performing a polymerase chain reaction with the sample using the primer pair to obtain a product; and analyzing the product to detect the presence of *Chlamydia pneumoniae*.

6. The method for detecting Chlamydia pneumoniae as described in claim 5, wherein the 5' end of the probe is connected to a reporter dye and the 3' end of the probe is connected to a quencher.

7. The method for detecting Chlamydia pneumoniae as described in claim 5, wherein the sample is derived from saliva, sputum, nasal swab, throat swab, or nasopharyngeal samples.

8. The method for detecting Chlamydia pneumoniae as described in claim 5, wherein the step of performing the polymerase chain reaction with the sample using the primer pair to obtain the product includes performing the polymerase chain reaction such that the primer pair amplifies the nucleotide sequence of the Pal gene in Chlamydia pneumoniae to obtain the product.

9. The method for detecting Chlamydia pneumoniae as described in claim 5 further includes providing a forward primer and a reverse primer for a nucleic acid sequence of a human-derived gene, wherein the forward primer comprises a nucleotide sequence as shown in SEQ ID NO:12 and the reverse primer comprises a nucleotide sequence as shown in SEQ ID NO:13.

Images