Modified adeno-associated viral capsid proteins for ocular gene therapy and methods of use thereof

Abstract

This document provides modified adeno-associated virus (AAV) capsid proteins, compositions comprising said capsid proteins (e.g., rAAV), and nucleic acids encoding said capsid proteins. The AAV capsids provided herein confer retinal cell tropism and / or corneal cell tropism and mediate improved transduction efficiency in clinically relevant ocular cell types such as photoreceptor cells and / or corneal endothelial cells. Nucleic acids encoding said capsid proteins and AAV particles comprising said capsid proteins are also provided.

Description

[Technical Field]

[0001] This document provides modified adeno-associated virus (AAV) capsid proteins, compositions comprising said capsid proteins (e.g., rAAV), and nucleic acids encoding said capsid proteins. The AAV capsids provided herein confer retinal cell tropism and / or corneal cell tropism and mediate improved transduction efficiency in clinically relevant ocular cell types such as photoreceptor cells and / or corneal endothelial cells. Nucleic acids encoding said capsid proteins and AAV particles comprising said capsid proteins are also provided. [Previous Technology]

[0002] Gene therapy offers hope for curative treatment of human diseases using genetic approaches, which may include introducing a healthy copy of a gene (e.g., a mutated gene) or correcting a gene to restore its biological function. Adeno-associated virus (AAV) vectors derived from non-pathogenic and non-enveloped replication-defective parvoviruses represent ideal vectors for human gene delivery. One advantage of AAV vector systems is the availability of a variety of naturally occurring serotypes, which provide selectivity against a wide range of target cells.

[0003] Although gene therapy is being pursued as a strategy for treating a range of genetic diseases, ocular disorders are a particularly attractive indication for gene therapy. The genetic nature and mechanisms causing various ocular diseases have been identified. Postmitotic cells of the eye, such as retinal cells and corneal endothelial cells, allow for sustained gene expression without the need for gene transfection and integration. Combined with well-defined anatomical features, the eye provides directly visible and accessible tissue, offering advantages for local delivery. Furthermore, the blood-ocular barrier generates immune parity and limits immune responses to gene therapy products delivered to the eye. A large number of ongoing clinical and preclinical studies of ocular gene therapy highlight the utility of AAV vectors as an effective tool for correcting various ocular conditions.

[0004] In the context of retroretinal gene therapy, a drawback of using naturally occurring AAV serotypes is that their delivery requires invasive subretinal surgery. Therefore, to meet the need for less invasive delivery routes, there is a need in the industry to develop AAV vectors that can be transduced into the outer retina (i.e., photoreceptor cells / retinal pigment epithelium (RPE)) after intravitreal injection. Furthermore, there is a need in the industry to develop surgical procedures that are less invasive than intra-anterior chamber delivery or corneal puncture to deliver genes to the anterior chamber of the eye, particularly corneal endothelial cells. [Summary of the Invention]

[0005] This document provides modified adeno-associated virus (AAV) capsid proteins, compositions comprising said capsid proteins (e.g., rAAV), and nucleic acids encoding said capsid proteins. The AAV capsids provided herein confer retinal cell tropism and / or corneal cell tropism and mediate improved transduction efficiency in clinically relevant ocular cell types such as photoreceptor cells and / or corneal endothelial cells. rAAVs comprising the AAV capsid proteins provided herein can be used in non-invasive ocular delivery routes, such as intravitreal administration, and are believed to be well tolerated when administered to human subjects. Therefore, the provided compositions are particularly suitable for gene therapy applications (e.g., ocular gene therapy).

[0006] Therefore, in some aspects, a modified adeno-associated virus (AAV) capsid protein is provided, which contains amino acid substitutions at one or more positions corresponding to amino acids S194, G474, N564 and / or N573, wherein the numbering of said positions is based on the VP1 number of AAV5.

[0007] In some exemplary embodiments, the positions are numbered based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1.

[0008] In some exemplary embodiments, the modified capsid protein is a modified capsid protein of an AAV serotype selected from AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVB1, AAVAnc80, AAV7m8, AAVrh10, AAV2(Y444F), AAV2(Y444+500+730), AAV2(Y252+272+444+500+700+704+730F), AAV8(Y733F), and any variant thereof. In some exemplary embodiments, the modified capsid protein is a modified capsid protein of AAV5.

[0009] In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO: 1. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1.

[0010] In some exemplary embodiments, the amino acid corresponding to amino acid 194 in the capsid protein is G. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 3, wherein the amino acid corresponding to amino acid 194 in the capsid protein is G.

[0011] In some exemplary embodiments, the amino acid corresponding to amino acid 474 in the capsid protein is R. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 5, wherein the amino acid corresponding to amino acid 474 in the capsid protein is R.

[0012] In some exemplary embodiments, the amino acid corresponding to amino acid 564 in the capsid protein is R. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 7, wherein the amino acid corresponding to amino acid 564 in the capsid protein is R.

[0013] In some exemplary embodiments, the amino acid corresponding to amino acid 573 in the capsid protein is R. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 9, wherein the amino acid corresponding to amino acid 573 in the capsid protein is R.

[0014] In some aspects, a modified adeno-associated virus (AAV) capsid protein is provided, comprising: a G at position corresponding to amino acid 194; an R at position corresponding to amino acid 474; an R at position corresponding to amino acid 564; and / or an R at position corresponding to amino acid 573, wherein the numbering of the positions is based on the VP1 number of AAV5.

[0015] In some aspects, a modified adeno-associated virus (AAV) capsid protein is provided, which contains G at a position corresponding to amino acid 194, wherein the numbering of said position is based on the VP1 number of AAV5.

[0016] In some aspects, a modified adeno-associated virus (AAV) capsid protein is provided, which contains an R at a position corresponding to amino acid 474, wherein the numbering of said position is based on the VP1 number of AAV5.

[0017] In some aspects, a modified adeno-associated virus (AAV) capsid protein is provided, which contains an R at a position corresponding to amino acid 564, wherein the position number is based on the VP1 number of AAV5.

[0018] In some aspects, a modified adeno-associated virus (AAV) capsid protein is provided, which contains an R at a position corresponding to amino acid 573, wherein the position is numbered based on the VP1 number of AAV5.

[0019] In some aspects, a modified adeno-associated virus (AAV) capsid protein is provided, comprising the amino acid sequence shown in SEQ ID NO: 3, 5, 7 or 9.

[0020] In some respects, an isolated nucleic acid is provided that encodes the capsid protein described herein.

[0021] In some respects, an isolated nucleic acid is provided, which comprises the nucleotide sequence shown in SEQ ID NO: 4, 6, 8 or 10.

[0022] In some respects, a carrier is provided which contains the nucleic acid described herein.

[0023] In some exemplary embodiments, the vector is a plasmid or an auxiliary viral vector. In some exemplary embodiments, the auxiliary viral vector is a retroviral vector, a herpesvirus vector, a baculovirus vector, or an adenovirus vector. In some exemplary embodiments, the vector is an expression vector.

[0024] In some aspects, a recombinant cell is provided that contains the nucleic acid or the vector described herein.

[0025] In some aspects, a method for producing AAV capsid protein is provided, the method comprising culturing the recombinant cells described herein under conditions that express the nucleic acid and produce the capsid protein.

[0026] In some aspects, a recombinant adeno-associated virus (rAAV) particle is provided, comprising: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and (b) an rAAV vector containing a heterologous nucleic acid.

[0027] In some exemplary embodiments, the numbering of the positions is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1.

[0028] In some exemplary embodiments, the modified capsid protein is a modified capsid protein of an AAV serotype selected from AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVB1, AAVAnc80, AAV7m8, AAVrh10, AAV2(Y444F), AAV2(Y444+500+730), AAV2(Y252+272+444+500+700+704+730F), AAV8(Y733F), and any variant thereof. In some exemplary embodiments, the modified capsid protein is a modified capsid protein of AAV5.

[0029] In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO: 1. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1.

[0030] In some exemplary embodiments, the amino acid corresponding to amino acid 194 in the capsid protein is G. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 3, wherein the amino acid corresponding to amino acid 194 in the capsid protein is G.

[0031] In some exemplary embodiments, the amino acid corresponding to amino acid 474 in the capsid protein is R. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 5, wherein the amino acid corresponding to amino acid 474 in the capsid protein is R.

[0032] In some exemplary embodiments, the amino acid corresponding to amino acid 564 in the capsid protein is R. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 7, wherein the amino acid corresponding to amino acid 564 in the capsid protein is R.

[0033] In some exemplary embodiments, the amino acid corresponding to amino acid 573 in the capsid protein is R. In some exemplary embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 9, wherein the amino acid corresponding to amino acid 573 in the capsid protein is R.

[0034] In some aspects, a recombinant adeno-associated virus (rAAV) particle is provided, comprising: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises: G at position corresponding to amino acid 194, R at position corresponding to amino acid 474, R at position corresponding to amino acid 564 and / or R at position corresponding to amino acid 573, wherein the position numbering is based on the VP1 number of AAV5; and (b) an rAAV vector containing a heterologous nucleic acid.

[0035] In some aspects, a recombinant adeno-associated virus (rAAV) particle is provided, comprising: (a) an rAAV capsid containing a G at a position corresponding to amino acid 194, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing a heterologous nucleic acid.

[0036] In some aspects, a recombinant adeno-associated virus (rAAV) particle is provided, comprising: (a) an rAAV capsid containing an R corresponding to position 474, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing heterologous nucleic acid.

[0037] In some aspects, a recombinant adeno-associated virus (rAAV) particle is provided, comprising: (a) an rAAV capsid containing an R corresponding to position 564 of amino acid 564, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing heterologous nucleic acid.

[0038] In some aspects, a recombinant adeno-associated virus (rAAV) particle is provided, comprising: (a) an rAAV capsid containing an R corresponding to a position of amino acid 573, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing a heterologous nucleic acid.

[0039] In some exemplary embodiments, the heteronucleotide encodes a therapeutic polypeptide or therapeutic nucleic acid. In some exemplary embodiments, the heteronucleotide encodes a polypeptide selected from antioxidants, enzymes, neurotrophic factors, anti-apoptotic factors, anti-angiogenic factors, and anti-inflammatory factors. In some exemplary embodiments, the heteronucleotide encodes a therapeutic nucleic acid. In some exemplary embodiments, the therapeutic nucleic acid is siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozyme, or DNase.

[0040] In some exemplary embodiments, the heterologous nucleic acid is operatively linked to a constitutive promoter. In some exemplary embodiments, the heterologous nucleic acid is operatively linked to a promoter suitable for expressing the therapeutic peptide or therapeutic nucleic acid in ocular tissue. In some exemplary embodiments, the ocular tissue is the retina, and the promoter is suitable for expressing the therapeutic peptide or therapeutic nucleic acid in retinal cells selected from photoreceptor cells, retinal pigment epithelial cells, bipolar cells, horizontal cells, amacrine cells, Miller cells, ganglion cells, and any combination thereof. In some exemplary embodiments, the ocular tissue is the cornea, and the promoter is suitable for expressing the therapeutic peptide or therapeutic nucleic acid in corneal cells selected from epithelial cells, corneal stromal cells, endothelial cells, and any combination thereof.

[0041] In some exemplary embodiments, the AAV vector further comprises an inverted terminal repeat (ITR).

[0042] In some exemplary embodiments, the rAAV vector is a self-complementary rAAV vector (scAAV). In some exemplary embodiments, the scAAV comprises a first nucleic acid encoding the heterologous nucleic acid and a second nucleic acid encoding a complementary sequence of the first nucleic acid, wherein the first nucleic acid may form intra-strand base pairs with the second nucleic acid along most or all of its length. In some exemplary embodiments, the first nucleic acid and the second nucleic acid are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and a mutation in the terminal unwinding sequence.

[0043] In some aspects, a pharmaceutical composition is provided comprising the rAAV particles described herein.

[0044] In some aspects, a method for delivering heterologous nucleic acid to ocular tissue of a subject in need is provided, comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and (b) an rAAV vector containing the heterologous nucleic acid.

[0045] In some aspects, a method for delivering heterologous nucleic acids to the retina of a subject in need is provided, comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein contains an amino acid substitution at a position corresponding to amino acid 194, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing the heterologous nucleic acid.

[0046] In some aspects, a method for delivering heterologous nucleic acid to the cornea of ​​a subject in need is provided, comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and (b) an rAAV vector containing the heterologous nucleic acid.

[0047] In some aspects, a method is provided for improving rAAV transduction in cells of ocular tissue of a subject in need, the method comprising delivering to the subject recombinant adeno-associated virus (rAAV) particles, wherein the rAAV particles comprise: (a) an rAAV capsid comprising a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and (b) an rAAV vector comprising a heterologous nucleic acid.

[0048] In some aspects, a method for improving rAAV transduction in cells of the retina of a subject in need is provided, the method comprising delivering to the subject a recombinant adeno-associated virus (rAAV) particle, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein contains an amino acid substitution at a position corresponding to amino acid 194, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing a heterologous nucleic acid.

[0049] In some aspects, a method is provided for improving rAAV transduction in cells of the cornea of ​​a subject in need, the method comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and (b) an rAAV vector containing a heterologous nucleic acid.

[0050] In some aspects, a method for improving the performance of heterologous nucleic acids in ocular tissue of a subject in need is provided, the method comprising administering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein contains amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and (b) an rAAV vector containing the heterologous nucleic acid.

[0051] In some aspects, a method for improving the performance of heterologous nucleic acids in the retina of a subject in need is provided, the method comprising administering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein contains an amino acid substitution at a position corresponding to amino acid 194, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing heterologous nucleic acid.

[0052] In some aspects, a method for improving the performance of heterologous nucleic acids in the cornea of ​​a subject in need is provided, the method comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein contains amino acid substitutions at one or more positions corresponding to amino acids 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and (b) an rAAV vector containing heterologous nucleic acid.

[0053] In some aspects, a method is provided for treating an eye condition or impairment in a subject in need, the method comprising administering to the subject an effective amount of a composition comprising rAAV particles, wherein the rAAV particles comprise: (a) an rAAV capsid comprising a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and (b) an rAAV vector comprising a heterologous nucleic acid.

[0054] In some exemplary embodiments, the composition is formulated for intravitreal administration.

[0055] In some exemplary embodiments, the heterologous nucleic acid exhibits an increased performance level compared to the performance level of the heterologous nucleic acid containing the wild-type rAAV capsid.

[0056] In some exemplary embodiments, the injection includes injection within the vitreous body.

Implementation Method

[0057] Cross-reference to related applications

[0058] This application claims the benefit of U.S. Provisional Application No. 62 / 967,416, filed on January 29, 2020, the disclosure of which is hereby incorporated by reference in its entirety.

[0059] This document provides a modified AAV capsid protein that imparts improved transduction efficiency in ocular tissues. Compositions comprising the AAV capsid protein and a nucleic acid encoding the AAV capsid protein (e.g., rAAV) are also provided. Methods for delivering heterologous nucleic acids into ocular tissues using the compositions described herein are also provided, as well as methods for improving transduction into ocular tissues and improving the performance of heterologous nucleic acids in ocular tissues. This document also provides methods for treating ocular disorders and conditions.

[0060] Generally, the nomenclature used in conjunction with the cell and tissue culture, molecular biology, biophysics, immunology, microbiology, genetics, and protein and nucleic acid chemistry described herein is well-known and commonly used in the industry. Unless otherwise indicated, the methods and techniques provided herein are generally performed according to conventional methods well-known in the industry and as described in various general and more specific references cited and discussed throughout this specification. Enzymatic reactions and purification techniques are performed according to the manufacturer's instructions, as commonly practiced in the industry or as described herein. The nomenclature used in conjunction with the analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry described herein, as well as their laboratory procedures and techniques, are well-known and commonly used in the industry. Standard techniques are used for chemical synthesis, chemical analysis, drug preparation, formulation and delivery, and patient treatment.

[0061] The techniques and procedures described or referenced herein are generally well understood and used by those skilled in the art, and are commonly employed as conventional methods, such as those widely used in the following literature: Molecular Cloning: A Laboratory Manual (Sambrook et al., 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2012); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 2003); the series Methods in Enzymology (Academic Press, Inc.); PCR 2: A Practical Approach (MJ MacPherson, BD Hames, and GR Taylor, eds., 1995); Antibodies, A Laboratory Manual (Harlow and Lane, eds., 1988); Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications (RI Freshney, 6th ed., J. Wiley and Sons, 2010); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (edited by JE Cellis, Academic Press, 1998); Introduction to Cell and Tissue Culture (JP Mather and PE Roberts, Plenum Press, 1998); Cell and Tissue Culture: Laboratory Procedures (edited by A. Doyle, JB Griffiths and DG Newell, J. Wiley and Sons, 1993-8); Handbook of Experimental Immunology (DM Weir and CCBlackwell (ed., 1996); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos (ed., 1987); PCR: The Polymerase Chain Reaction (Mullis et al. (ed., 1994); Current Protocols in Immunology (JE Coligan et al. (ed., 1991); Short Protocols in Molecular Biology (Ausubel et al. (ed., J. Wiley and Sons, 2002); Immunobiology (CA Janeway et al., 2004); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty. (ed., IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean (ed., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999; The Antibodies (edited by M. Zanetti and JD Capra, Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (edited by VT DeVita et al., JB Lippincott Company, 2011).

[0062] Unless otherwise defined herein, the scientific and technical terms used herein shall have the meanings commonly understood by one of ordinary skill in the art. In any event of potential ambiguity, the definitions provided herein shall prevail over any dictionary or foreign definition. Unless the context otherwise requires, singular terms shall include plural terms, and plural terms shall include singular terms. Unless otherwise stated, the use of "or" means "and / or". The use of the term "including" and other forms such as "includes" and "included" is not restrictive.

[0063] To make the present invention easier to understand, some terms are first defined.

[0064] As used herein, the term "vector" refers to any vector used to clone and / or transfer nucleic acids into host cells. A vector may be a replicon to which another nucleic acid segment may be attached to enable replication of the attached segment. "Replicon" refers to any genetic element (e.g., plasmid, bacteriophage, kinase, chromosome, virus) that functions as an autonomous replication unit in vivo (i.e., capable of replicating under its own control). The term "vector" includes viral and nonviral vectors used to introduce nucleic acids into cells in vitro, ex vivo, or in vivo. Many vectors are known and used in the industry, including, for example, plasmids, modified eukaryotic viruses, or modified bacterial viruses. The insertion of polynucleotides into suitable vectors can be achieved by ligating appropriate polynucleotide fragments into selected vectors with complementary sticky ends.

[0065] As used herein, the terms "polynucleotide" or "nucleic acid" refer to nucleotides (ribonucleotides or deoxyribonucleotides) of any length in polymeric form. Therefore, this term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA; genomic DNA; cDNA; DNA-RNA hybrids; or polymers containing purine and pyrimidine bases or other natural, chemically modified, or biochemically modified, non-natural, or derived nucleotide bases. The backbone of a polynucleotide may contain sugar and phosphate groups (as typically seen in RNA or DNA) or modified or substituted sugar or phosphate groups. Alternatively, the backbone of a polynucleotide may contain polymers of synthetic subunits (such as aminophosphates), and thus may be oligodeoxynucleotide aminophosphates (P-NH2) or mixed aminophosphate-phosphodiester oligomers. Additionally, double-stranded polynucleotides can be obtained from chemically synthesized single-stranded polynucleotide products by synthesizing a complementary strand and annealing the strand under appropriate conditions, or by de novo synthesis of a complementary strand using a DNA polymerase with a suitable primer.

[0066] The terms "peptide" and "protein" are used interchangeably to refer to polymers of amino acid residues and are not limited to a minimum length. Such polymers of amino acid residues may contain native or non-native amino acid residues and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and polymers of amino acid residues. The definition covers both full-length proteins and fragments thereof. The term also includes post-expression modifications of peptides, such as glycosylation, sialylation, acetylation, phosphorylation, etc. Furthermore, for the purposes of this invention, "peptide" refers to a protein that contains modifications (such as deletions, additions, and substitutions) of its native sequence (which are generally conserved in nature) as long as the protein retains the desired activity. These modifications may be intentional (e.g., by site-directed mutagenesis) or accidental (e.g., by mutations in the host that produces the protein or by errors due to PCR amplification).

[0067] As used herein, the term "recombinant viral vector" refers to a recombinant polynucleotide vector containing one or more heterologous sequences (i.e., nucleic acid sequences of non-viral origin). In the case of a recombinant AAV vector, the recombinant nucleic acid flanking sequence is at least one inverted terminal repeat (ITR). In some embodiments, the recombinant nucleic acid flanking sequence is two ITRs.

[0068] As used herein, the term "recombinant AAV vector (rAAV vector)" refers to a polynucleotide vector containing one or more heterologous sequences (i.e., nucleic acid sequences not derived from AAV) flanked by at least one AAV inverted terminal repeat (ITR). Such rAAV vectors can be replicated and packaged in infectious viral particles when present in host cells infected with a suitable helper virus (or exhibiting a suitable helper tool) and exhibiting AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When rAAV vectors are incorporated into larger polynucleotides (e.g., in chromosomes or in another vector such as plastids used for cloning or transfection), the rAAV vector can be referred to as a "pre-vector" which can be "rescued" by replication and capsidation in the presence of AAV packaging function and a suitable helper tool. rAAV vectors can be in any of a variety of forms, including but not limited to plastids, linear artificial chromosomes, lipid complexes, encapsulated in liposomes, and capsidated in viral particles (e.g., AAV particles). The rAAV vector can be packaged in the capsid of an AAV virus to produce "recombinant adeno-associated virus particles (rAAV particles)".

[0069] As used herein, the term "rAAV virus" or "rAAV virus particle" refers to a viral particle consisting of at least one AAV capsid protein and a capsidized rAAV vector genome.

[0070] As used herein, the term "heterologous" means an entity whose genotype differs from the remainder of the entity being compared to or which it has been introduced into or incorporated into. For example, a polynucleotide introduced into a different cell type via genetic engineering is a heterologous polynucleotide (and may encode a heterologous polypeptide upon expression). Similarly, a cellular sequence (e.g., a gene or a portion thereof) incorporated into a viral vector is a heterologous nucleotide sequence relative to said vector.

[0071] As used herein, the term "gene transfection" refers to a polynucleotide introduced into a cell that can be transcribed into RNA and, where appropriate, translated and / or expressed under suitable conditions. In several respects, it endows the cell into which it was introduced with desired properties or otherwise leads to a desired therapeutic or diagnostic outcome. In another respect, it can be transcribed into molecules that mediate RNA interference, such as miRNA, siRNA, or shRNA.

[0072] As used herein, the terms “genomic particle (gp),” “genomic equivalent,” or “genomic copy” as used with respect to viral titer refer to the number of viral particles containing the recombinant AAV DNA genome, regardless of infectivity or functionality. The number of genomic particles in a particular vector formulation can be measured by procedures such as those described in the examples herein or, for example, in Clark et al. (1999) Hum. Gene Ther., 10: 1031-1039; Veldwijk et al. (2002) Mol. Ther., 6:272-278.

[0073] As used herein, the term "vector genome (vg)" can refer to one or more polynucleotides comprising a set of polynucleotide sequences of a vector (e.g., a viral vector). The vector genome may be capsidated within a viral particle. Depending on the specific viral vector, the vector genome may comprise single-stranded DNA, double-stranded DNA, or single-stranded or double-stranded RNA. The vector genome may comprise endogenous sequences associated with the specific viral vector and / or any heterologous sequences inserted into the specific viral vector via recombination techniques. For example, a recombinant AAV vector genome may comprise at least one ITR sequence flanking the promoter, a filler fragment, a target sequence (e.g., RNAi), and a polyadenylated sequence. The complete vector genome may comprise the full set of polynucleotide sequences of the vector. In some embodiments, the nucleic acid titer of the viral vector may be measured in vg / mL. Methods suitable for measuring this titer are known in the art (e.g., quantitative PCR).

[0074] As used herein, the terms “infectious unit (iu),” “infectious particle” or “replication unit” as used with respect to viral titer refer to the number of infectious and replicative recombinant AAV vector particles, as measured by an infection center assay (also known as a replication center assay), as described, for example, in McLaughlin et al. (1988) J. Virol., 62:1963-1973.

[0075] As used herein, the term “transduction unit (tu)” as used with respect to viral titer refers to the number of infectious recombinant AAV vector particles that result in the production of functional gene transfection products, as measured in a functional assay such as those described in the examples herein or in, for example, the following literature: Xiao et al. (1997) Exp. Neurobiol., 144:113-124; or Fisher et al. (1996) J. Virol., 70:520-532 (LFU assay).

[0076] As used herein, the term "inverted terminal repeat" or "ITR" sequence is a well-understood term in the industry, referring to a relatively short sequence in the opposite direction found at the end of a viral genome.

[0077] As used herein, the term "AAV inverted terminal repeat (ITR)" is a well-known term in the industry, referring to a sequence of approximately 145 nucleotides located at both ends of a natural single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two alternative orientations, resulting in heterogeneity between different AAV genomes and between the ends of a single AAV genome. The outermost 125 nucleotides also contain several shorter self-complementary regions (designated as A, A', B, B', C, C', and D regions) that allow intrastrand base pairing to occur within this portion of the ITR.

[0078] As used herein, the term "terminal unwinding sequence" or "trs" refers to a sequence in the D region of the AAV ITR that is cleaved by the AAV rep protein during viral DNA replication. The mutant terminal unwinding sequence is difficult to cleave by the AAV rep protein.

[0079] As used herein, the term "helper virus" for AAV refers to a virus that allows AAV (which is a defective parvovirus) to be replicated and packaged by host cells. Many such helper viruses have been identified, including adenoviruses, herpesviruses, and poxviruses, such as vaccinia. Adenoviruses encompass many different subgroups, but subgroup C5 adenovirus (Ad5) is the most commonly used. Many adenoviruses of human, non-human mammalian, and avian origin are known and available from depositories such as the ATCC. Herpes family viruses also available from depositories such as the ATCC include, for example, herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), and pseudorabies virus (PRV).

[0080] As used herein, the term "percentage of sequence identity (%)" relating to a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical to those in a reference polypeptide or nucleic acid sequence after sequence alignment and the introduction of vacancies (if necessary) to achieve the maximum percentage of sequence identity, and without considering any conserved substitutions as part of sequence identity. Alignments used to determine the percentage of amino acid or nucleic acid sequence identity can be performed in a variety of ways within the scope of industry technology, such as using publicly available computer software programs, such as those described in Current Protocols in Molecular Biology (edited by Ausubel et al., 1987), Supplement 30, Chapter 7.7.18, Table 7.7.1, and including BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. An example of an alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). Those skilled in this technique can determine the appropriate parameters for measuring alignments, including any algorithms required to achieve maximum alignment across the full length of the sequences being compared. For the purposes of this paper, the amino acid sequence identity % of a given amino acid sequence A relative to, and or against, a given amino acid sequence B (which can be alternatively phrased as a given amino acid sequence A having or including a certain amino acid sequence identity % relative to, and or against, a given amino acid sequence B) is calculated as follows: 100 multiplied by the fraction X / Y, where X is the number of amino acid residues scored as identical matches in the A / B alignment by the sequence alignment program, and where Y is the total number of amino acid residues in B. It should be understood that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, the amino acid sequence identity % of A relative to B will not be equal to the amino acid sequence identity of B relative to A. For the purposes of this paper, the % nucleotide sequence identity of a given nucleic acid sequence C relative to, and or against, a given nucleic acid sequence D (which can be alternatively phrased as a given nucleic acid sequence C having or including a certain % nucleotide sequence identity relative to, and or against, a given nucleic acid sequence D) is calculated as follows: 100 multiplied by the fraction W / Z, where W is the number of nucleotides scored as identical matches in the C vs. D alignment by the sequence alignment program, and Z is the total number of nucleotides in D. It should be understood that if the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleotide sequence identity of C relative to D will not be equal to the nucleotide sequence identity of D relative to C.

[0081] As used herein, the term "isolated" molecule (e.g., nucleic acid or protein) or cell means that it has been identified and isolated and / or recovered from components of its natural environment.

[0082] As used herein, the term "effective amount" is an amount sufficient to produce a beneficial or desired outcome, including clinical outcomes (e.g., improvement of symptoms, achievement of clinical endpoints, etc.). An effective amount may be administered once or multiple times. In relation to disease state, an effective amount is an amount sufficient to improve, stabilize, or delay the progression of the disease.

[0083] As used herein, the terms "individual" or "subject" are mammals. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., human and non-human primates, such as monkeys), rabbits, and rodents (e.g., mice and rats). In some embodiments, the individual or subject is a human.

[0084] As used herein, the term "treatment" refers to a means of obtaining a beneficial or desired clinical outcome. For the purposes of this invention, beneficial or desired clinical outcomes include, but are not limited to: symptom relief, reduction in disease severity, stable disease state (e.g., no worsening), prevention of disease spread (e.g., metastasis), delay or slowing of disease progression, improvement or mitigation of disease state, and ablation (whether partial or complete), whether detectable or undetectable. "Treatment" may also mean extended survival compared to expected survival without treatment. The term "treat" is the verb form of "treatment".

[0085] As used herein, the term "preventive treatment" refers to treatment in which an individual is known or suspected of having a disorder or is at risk of developing a disorder, but has not yet shown symptoms of the disorder or has shown the minimum symptoms of the disorder. Individuals who undergo preventive treatment may be treated before symptoms develop.

[0086] As used herein, a "therapeutic" agent (e.g., a therapeutic peptide, nucleic acid, or gene transfer) is a pharmaceutical agent that provides beneficial or desirable clinical results (such as the illustrative clinical results described above). Therefore, the therapeutic agent can be used in the treatments described above.

[0087] As used herein, the term "central retina" refers to the lateral macula and / or medial macula and / or fovea. As used herein, the term "central retinal cell type" refers to the cell type of the central retina, such as retinal pigment epithelial (RPE) cells and photoreceptor cells.

[0088] As used herein, the term "macula" refers to the central retina of primates, which contains a higher relative concentration of photoreceptor cells, particularly rods and cones, compared to the peripheral retina. As used herein, the term "external macula" may also be referred to as "peripheral macula." As used herein, the term "internal macula" may also be referred to as "central macula."

[0089] As used herein, the term "fovea" refers to a small region in the central retina of primates with a diameter of approximately equal to or less than 0.5 mm, which contains a relatively high concentration of photoreceptor cells, particularly cones, compared to the peripheral retina and macula.

[0090] As used herein, the term "subretinal space" refers to the location within the retina between photoreceptor cells and retinal pigment epithelial cells. The subretinal space can be a potential space, such as prior to any subretinal injection of a fluid. The subretinal space can also contain fluid injected into the potential space. In this case, the fluid is "in contact with the subretinal space." Cells "in contact with the subretinal space" include cells at the boundaries of the subretinal space, such as RPEs and photoreceptor cells.

[0091] As used herein, the term "vesicle" refers to a fluid space within the subretinal space of the eye. The vesicles of the present invention can be generated by injecting fluid into a single space, by injecting one or more fluids into the same space multiple times, or by injecting multiple times into multiple spaces, wherein the vesicles, when repositioned, generate a total fluid space that can be used to achieve a therapeutic effect relative to a desired portion of the subretinal space.

[0092] As used herein, the term "cornea" refers to the transparent anterior portion of the eye that covers the iris, pupil, and anterior chamber. Modified AAV capsid protein

[0093] Gene therapy regimens for eye disorders require the local delivery of vectors to cells in the eye (e.g., retinal cells). Cells that will serve as therapeutic targets in these diseases may, in particular, include one or more cells of the eye (e.g., photoreceptor cells, corneal endothelial cells, etc.). The methods described herein are based, at least in part, on the discovery that specific modifications to AAV capsid proteins (e.g., AAV capsid proteins containing one or more amino acid substitutions at one or more sites) allow for widespread vector distribution in ocular cells. Therefore, these capsids can be particularly advantageous for delivering heterologous nucleic acids to an individual's eye, improving rAAV transduction in cells after delivery of rAAV particles to an individual's eye, improving the performance of heterologous nucleic acids after delivery of rAAV particles to an individual's eye, and / or treating an individual's eye disorder with rAAV particles.

[0094] The AAV capsid (e.g., AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, etc.) is composed of three structural proteins, VP1, VP2, and VP3, which are expressed from the same open reading frame in an approximate stoichiometry of 1:1:10, and VP2 and VP3 have alternative start codons. The capsid proteins share most of their amino acid sequences; VP1 and VP2 differ from VP3 in that, depending on the serotype, they share approximately 65 amino acid N-terminal extensions, with VP1 containing an additional approximately 135 unique amino acids (McPherson & Rose. J Virol (1983) 46: 523-529). VP1 is required for viral infectivity, partly due to the presence of a highly conserved N-terminal phospholipase A2 (sPLA2) homologous domain (amino acids 52-97), which is embedded within the capsid but externalized via a pore found at 5 times the axis of symmetry following a conformational change in the acidic endosomal compartment. Although VP2 is not essential for capsid assembly and viral infectivity, any deletion or mutation in VP1 that results in the loss of the phospholipase A2 (PLA2) catalytic domain and its activity leads to a significant reduction in AAV infectivity (Girod et al., Journal of General Virology (2002), 83: 973-9).

[0095] Furthermore, it is speculated that other signals affecting infectivity may be located on the unique VP1 region of AAV-2, as reported for several autonomous parvovirus capsid proteins. Direct liquid chromatography / mass spectrometry (LC / MS) whole-protein analysis has been developed to characterize viral capsid proteins. Using this method, complete characterization of the constituent viral capsid proteins (including their sequences and post-translational modifications (PTMs)) of several AAV vectors can be determined. The N-terminus of all VPs in the six serotypes analyzed (AAV1, 2, 5, 7, 9, and rh10) was confirmed to begin at a residue following the N-terminus predicted based on the DNA sequence, with the exception of VP3 in AAV7. In addition, VP1 and VP3 in AAV serotypes 1, 2, 5, 7, 9, and rh10 were shown to contain N-terminal acetylation. Although N-terminal acetylation of proteins is a well-known phenomenon, the biological significance of N-terminal acetylation of AAV capsid proteins is not fully understood. See PCT Publication No. WO 2018 / 035059, the contents of which are incorporated herein by reference in their entirety.

[0096] In one respect, this document provides modified AAV capsid proteins comprising substitutions that confer improved transduction in retinal cells. For example, substitutions that retain VP1 N-terminal acetylation and reduce VP3 N-terminal acetylation result in a significant improvement in retinal transduction compared to the parental AAV capsid protein. Therefore, without being bound by any theory, it is believed that such substitutions (e.g., retaining VP1 N-terminal acetylation and reducing VP3 N-terminal acetylation) will confer a significant improvement in retinal transduction of AAV capsid proteins compared to the parental AAV capsid protein.

[0097] In some embodiments, the substitution of retaining VP1 N-terminal acetylation and reducing VP3 N-terminal acetylation in the AAV5 capsid protein, compared to the parental AAV5 capsid protein, results in a significant improvement in retinal transduction. In some embodiments, the modified AAV5 capsid protein contains an amino acid substitution at position S194 according to VP1 number. In some embodiments, a modified AAV5 capsid protein is provided herein that contains glycine (G) replacing serine (S) at amino acid position 194 (S194G) according to VP1 number. Those skilled in the art will readily understand that such substitutions can be transferred to capsid proteins of any AAV serotype, and the conferred transductive qualities are expected to transfer to capsid proteins of other AAV serotypes. Using methods known in the art, such as sequence alignment, those skilled in the art will be able to identify the corresponding amino acid positions in other AAV serotypes.

[0098] Modifications to, for example, AAV receptor binding, surface charge, and capsid protein post-translational modifications can confer novel tropisms and transduction in certain cell types. For example, the transduction properties of the AAV2HBKO variant have been shown to be improved in the mouse retina and CNS. See Sullivan et al. (2018) Gen. Ther. 25: 205-219. The AAV2HBKO variant has a key surface arginine mutation in the capsid region that facilitates the binding of AAV2 to its homologous receptor, heparan sulfate proteoglycan. This heparin-binding knockout variant exhibits a novel transduction pattern in the mouse CNS and retina. See PCT Publication No. WO 2015 / 168666, the contents of which are incorporated herein by reference in their entirety. Thus, the AAV2HBKO variant reveals the importance of arginine (and by extending the capsid surface charge) for transduction activity in the retina.

[0099] In one respect, this article provides modified AAV capsid proteins comprising substitutions that confer novel tropism and improved transduction activity in corneal endothelial cells. For example, it has been shown that the addition of arginine (R) residues affects the tropism and transduction activity of AAV5, which has relatively less surface arginine compared to AAV2. Therefore, without being bound by any theory, it is believed that the introduction of arginine at key surface residues will confer a significant improvement in corneal endothelial cell transduction of AAV capsid proteins compared to their parental counterparts.

[0100] In some embodiments, the introduction of arginine substitution at key surface residues in the AAV5 capsid protein leads to a significant improvement in corneal endothelial cell transduction compared to the parental AAV5 capsid protein. In some embodiments, the modified AAV5 capsid protein comprises amino acid substitutions at positions G474, N564, and / or N573 according to VP1 numbers. In some embodiments, a modified AAV5 capsid protein is provided herein comprising arginine (R) replacing glycine (G) at amino acid position 474 (G474R) according to VP1 numbers. In some embodiments, a modified AAV5 capsid protein is provided herein comprising arginine (R) replacing asparagine (N) at amino acid position 564 (N564R) according to VP1 numbers. In some embodiments, this document provides a modified AAV5 capsid protein comprising arginine (R) replacing asparagine (N) at amino acid position 573 (N573R) according to VP1 number. Those skilled in the art will readily understand that such substitution can be transferred to the capsid protein of any AAV serotype, and the conferred transductive qualities are expected to transfer to the capsid protein of other AAV serotypes. Using methods known in the art, such as sequence alignment, those skilled in the art will be able to identify the corresponding amino acid position in other AAV serotypes.

[0101] Therefore, in one aspect, this document provides a polypeptide (e.g., an AAV capsid protein) comprising amino acid substitutions at one or more positions corresponding to amino acids S194, G474, N564, and / or N573, wherein the numbering of said positions is based on the VP1 number of AAV5. In some embodiments, said position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. Therefore, in some embodiments, this document provides a polypeptide (e.g., an AAV capsid protein) comprising amino acid substitutions at one or more positions corresponding to amino acids S194, G474, N564, and / or N573, wherein said position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. In some embodiments, this document provides a modified capsid protein comprising amino acid substitutions at one or more positions corresponding to amino acids S194, G474, N564, and / or N573, wherein said position numbering is based on the VP1 number of AAV5. In some embodiments, the numbering of the positions is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. Therefore, in some embodiments, this document provides a modified capsid protein comprising amino acid substitutions at one or more positions corresponding to amino acids S194, G474, N564, and / or N573, wherein the numbering of said positions is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1.

[0102] In some embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1. In some embodiments, the modified capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO: 1. In some embodiments, the modified capsid protein comprises an amino acid sequence having at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1.

[0103] In some embodiments, this document provides a modified capsid protein comprising an amino acid substitution at a position corresponding to amino acid S194, wherein the position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. In some embodiments, the amino acid corresponding to amino acid 194 in the modified capsid protein is G. In some embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 3, wherein the amino acid corresponding to amino acid 194 in the capsid protein is G. In some embodiments, the modified capsid protein comprises the amino acid sequence shown in SEQ ID NO: 3. In some embodiments, the amino acid sequence of the modified capsid protein consists of the amino acid sequence shown in SEQ ID NO: 3.

[0104] In some embodiments, this document provides a modified capsid protein comprising an amino acid substitution at a position corresponding to amino acid G474, wherein the position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. In some embodiments, the amino acid corresponding to amino acid 474 in the modified capsid protein is R. In some embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 5, wherein the amino acid corresponding to amino acid 474 in the capsid protein is R. In some embodiments, the modified capsid protein comprises the amino acid sequence shown in SEQ ID NO: 5. In some embodiments, the amino acid sequence of the modified capsid protein consists of the amino acid sequence shown in SEQ ID NO: 5.

[0105] In some embodiments, this document provides a modified capsid protein comprising an amino acid substitution at a position corresponding to amino acid N564, wherein the position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. In some embodiments, the amino acid corresponding to amino acid 564 in the modified capsid protein is R. In some embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 7, wherein the amino acid corresponding to amino acid 564 in the capsid protein is R. In some embodiments, the modified capsid protein comprises the amino acid sequence shown in SEQ ID NO: 7. In some embodiments, the amino acid sequence of the modified capsid protein consists of the amino acid sequence shown in SEQ ID NO: 7.

[0106] In some embodiments, this document provides a modified capsid protein comprising an amino acid substitution at a position corresponding to amino acid N573, wherein the position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. In some embodiments, the amino acid corresponding to amino acid 573 in the modified capsid protein is R. In some embodiments, the modified capsid protein comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 9, wherein the amino acid corresponding to amino acid 573 in the capsid protein is R. In some embodiments, the modified capsid protein comprises the amino acid sequence shown in SEQ ID NO: 9. In some embodiments, the amino acid sequence of the modified capsid protein consists of the amino acid sequence shown in SEQ ID NO: 9.

[0107] Therefore, in some embodiments, this document provides a modified adeno-associated virus (AAV) capsid protein comprising a G corresponding to position 194; an R corresponding to position 474; an R corresponding to position 564; and / or an R corresponding to position 573, wherein the position numbering is based on the VP1 number of AAV5 (e.g., based on the VP1 number of the amino acid sequence shown in SEQ ID NO: 1). In some embodiments, the modified capsid protein comprises a G corresponding to position 194, wherein the position numbering is based on the VP1 number of AAV5 (e.g., based on the VP1 number of the amino acid sequence shown in SEQ ID NO: 1). In some embodiments, the modified capsid protein comprises an R corresponding to position 474, wherein the position numbering is based on the VP1 number of AAV5 (e.g., based on the VP1 number of the amino acid sequence shown in SEQ ID NO: 1). In some embodiments, the modified capsid protein includes R corresponding to position 564, wherein the position numbering is based on the VP1 number of AAV5 (e.g., based on the VP1 number of the amino acid sequence shown in SEQ ID NO: 1). In some embodiments, the modified capsid protein includes R corresponding to position 573, wherein the position numbering is based on the VP1 number of AAV5 (e.g., based on the VP1 number of the amino acid sequence shown in SEQ ID NO: 1).

[0108] In some embodiments, this document provides a polypeptide (e.g., a modified adeno-associated virus capsid protein) comprising the amino acid sequence shown in SEQ ID NO: 3. In some embodiments, this document provides a polypeptide (e.g., a modified adeno-associated virus capsid protein) comprising the amino acid sequence shown in SEQ ID NO: 3. In some embodiments, this document provides a polypeptide (e.g., a modified adeno-associated virus capsid protein) comprising the amino acid sequence shown in SEQ ID NO: 5. In some embodiments, this document provides a polypeptide (e.g., a modified adeno-associated virus capsid protein) comprising the amino acid sequence shown in SEQ ID NO: 7. In some embodiments, this document provides a polypeptide (e.g., a modified adeno-associated virus capsid protein) comprising the amino acid sequence shown in SEQ ID NO: 7. In some embodiments, this document provides a polypeptide (e.g., a modified adeno-associated virus capsid protein) comprising the amino acid sequence shown in SEQ ID NO: 9. In some embodiments, this document provides a polypeptide (e.g., a modified adeno-associated virus capsid protein) consisting of the amino acid sequence shown in SEQ ID NO: 9. Table 1: AAV capsid protein sequence AAV5 AA MSFVDHPPDWLEEVGEGLREFLGLEAGPPKPKPNQQHQDQARGLVLPGYNYLGPGNGLDRGEPVNRADEVAREHDISYNEQLEAGDNPYLKYNHADAEFQEKLADDTSFGGNLGKAVFQAKKRVLEPFGLVEEGAKTAPTGKRIDDHFPKRKKARTEEDSKPSTSSDAEAGPSGSQQLQIPAQPASSLGADTMSAGGGGPLGDNNQGADGVGNASGDWHCDSTWMGDRVVTKSTRTWVLPSYNNHQYREIKSGSVDGSNANAYFGYSTPWGYFDFNRFHSHWSPRDWQRLINNYWGFRPRSLRVKIFNIQVKEVTVQDSTTTIANNLTSTVQVFTDDDYQLPYVVGNGTEGCLPAFPPQVFTLPQYGYATLNRDNTENPTERSSFFCLEYFPSKMLRTGNNFEFTYNFEEVPFHSSFAPSQNLFKLANPLVDQYLYRFVSTNNTGGVQFNKNLAGRYANTYKNWFPGPMGRTQGWNLGSGVNRASVSAFATTNRMELEGASYQVPPQPNGMTNNLQGSNTYALENTMIFNSQPANPGTTATYLEGNMLITSESETQPVNRVAYNVGGQMATNNQSSTTAPATGTYNLQEIVPGSVWMERDVYLQGPIWAKIPETGAHFHPSPAMGGFGLKHPPPMMLIKNTPVPGNITSFSDVPVSSFITQYSTGQVTVEMEWELKKENSKRWNPEIQYTNNYNDPQFVDFAPDSTGEYRTTRPIGTRYLTRPL(SEQ ID NO:1) NA AAV5-S194G AA MSFVDHPPDWLEEVGEGLREFLGLEAGPPKPKPNQQHQDQARGLVLPGYNYLGPGNGLDRGEPVNRADEVAREHDISYNEQLEAGDNPYLKYNHADAEFQEKLADDTSFGGNLGKAVFQAKKRVLEPFGLVEEGAKTAPTGKRIDDHFPKRKKARTEEDSKPSTSSDAEAGPSGSQQLQIPAQPASSLGADTMGAGGGGPLGDNNQGADGVGNASGDWHCDSTWMGDRVVTKSTRTWVLPSYNNHQYREIKSGSVDGSNANAYFGYSTPWGYFDFNRFHSHWSPRDWQRLINNYWGFRPRSLRVKIFNIQVKEVTVQDSTTTIANNLTSTVQVFTDDDYQLPYVVGNGTEGCLPAFPPQVFTLPQYGYATLNRDNTENPTERSSFFCLEYFPSKMLRTGNNFEFTYNFEEVPFHSSFAPSQNLFKLANPLVDQYLYRFVSTNNTGGVQFNKNLAGRYANTYKNWFPGPMGRTQGWNLGSGVNRASVSAFATTNRMELEGASYQVPPQPNGMTNNLQGSNTYALENTMIFNSQPANPGTTATYLEGNMLITSESETQPVNRVAYNVGGQMATNNQSSTTAPATGTYNLQEIVPGSVWMERDVYLQGPIWAKIPETGAHFHPSPAMGGFGLKHPPPMMLIKNTPVPGNITSFSDVPVSSFITQYSTGQVTVEMEWELKKENSKRWNPEIQYTNNYNDPQFVDFAPDSTGEYRTTRPIGTRYLTRPL(SEQ ID NO:3) NA AAV5-G474R AA MSFVDHPPDWLEEVGEGLREFLGLEAGPPKPKPNQQHQDQARGLVLPGYNYLGPGNGLDRGEPVNRADEVAREHDISYNEQLEAGDNPYLKYNHADAEFQEKLADDTSFGGNLGKAVFQAKKRVLEPFGLVEEGAKTAPTGKRIDDHFPKRKKARTEEDSKPSTSSDAEAGPSGSQQLQIPAQPASSLGADTMSAGGGGPLGDNNQGADGVGNASGDWHCDSTWMGDRVVTKSTRTWVLPSYNNHQYREIKSGSVDGSNANAYFGYSTPWGYFDFNRFHSHWSPRDWQRLINNYWGFRPRSLRVKIFNIQVKEVTVQDSTTTIANNLTSTVQVFTDDDYQLPYVVGNGTEGCLPAFPPQVFTLPQYGYATLNRDNTENPTERSSFFCLEYFPSKMLRTGNNFEFTYNFEEVPFHSSFAPSQNLFKLANPLVDQYLYRFVSTNNTGGVQFNKNLAGRYANTYKNWFPGPMGRTQRWNLGSGVNRASVSAFATTNRMELEGASYQVPPQPNGMTNNLQGSNTYALENTMIFNSQPANPGTTATYLEGNMLITSESETQPVNRVAYNVGGQMATNNQSSTTAPATGTYNLQEIVPGSVWMERDVYLQGPIWAKIPETGAHFHPSPAMGGFGLKHPPPMMLIKNTPVPGNITSFSDVPVSSFITQYSTGQVTVEMEWELKKENSKRWNPEIQYTNNYNDPQFVDFAPDSTGEYRTTRPIGTRYLTRPL(SEQ ID NO:5) NA AAV5-N564R AA MSFVDHPPDWLEEVGEGLREFLGLEAGPPKPKPNQQHQDQARGLVLPGYNYLGPGNGLDRGEPVNRADEVAREHDISYNEQLEAGDNPYLKYNHADAEFQEKLADDTSFGGNLGKAVFQAKKRVLEPFGLVEEGAKTAPTGKRIDDHFPKRKKARTEEDSKPSTSSDAEAGPSGSQQLQIPAQPASSLGADTMSAGGGGPLGDNNQGADGVGNASGDWHCDSTWMGDRVVTKSTRTWVLPSYNNHQYREIKSGSVDGSNANAYFGYSTPWGYFDFNRFHSHWSPRDWQRLINNYWGFRPRSLRVKIFNIQVKEVTVQDSTTTIANNLTSTVQVFTDDDYQLPYVVGNGTEGCLPAFPPQVFTLPQYGYATLNRDNTENPTERSSFFCLEYFPSKMLRTGNNFEFTYNFEEVPFHSSFAPSQNLFKLANPLVDQYLYRFVSTNNTGGVQFNKNLAGRYANTYKNWFPGPMGRTQGWNLGSGVNRASVSAFATTNRMELEGASYQVPPQPNGMTNNLQGSNTYALENTMIFNSQPANPGTTATYLEGNMLITSESETQPVNRVAYRVGGQMATNNQSSTTAPATGTYNLQEIVPGSVWMERDVYLQGPIWAKIPETGAHFHPSPAMGGFGLKHPPPMMLIKNTPVPGNITSFSDVPVSSFITQYSTGQVTVEMEWELKKENSKRWNPEIQYTNNYNDPQFVDFAPDSTGEYRTTRPIGTRYLTRPL(SEQ ID NO:7) NA AAV5-N573R AA MSFVDHPPDWLEEVGEGLREFLGLEAGPPKPKPNQQHQDQARGLVLPGYNYLGPGNGLDRGEPVNRADEVAREHDISYNEQLEAGDNPYLKYNHADAEFQEKLADDTSFGGNLGKAVFQAKKRVLEPFGLVEEGAKTAPTGKRIDDHFPKRKKARTEEDSKPSTSSDAEAGPSGSQQLQIPAQPASSLGADTMSAGGGGPLGDNNQGADGVGNASGDWHCDSTWMGDRVVTKSTRTWVLPSYNNHQYREIKSGSVDGSNANAYFGYSTPWGYFDFNRFHSHWSPRDWQRLINNYWGFRPRSLRVKIFNIQVKEVTVQDSTTTIANNLTSTVQVFTDDDYQLPYVVGNGTEGCLPAFPPQVFTLPQYGYATLNRDNTENPTERSSFFCLEYFPSKMLRTGNNFEFTYNFEEVPFHSSFAPSQNLFKLANPLVDQYLYRFVSTNNTGGVQFNKNLAGRYANTYKNWFPGPMGRTQGWNLGSGVNRASVSAFATTNRMELEGASYQVPPQPNGMTNNLQGSNTYALENTMIFNSQPANPGTTATYLEGNMLITSESETQPVNRVAYNVGGQMATNRQSSTTAPATGTYNLQEIVPGSVWMERDVYLQGPIWAKIPETGAHFHPSPAMGGFGLKHPPPMMLIKNTPVPGNITSFSDVPVSSFITQYSTGQVTVEMEWELKKENSKRWNPEIQYTNNYNDPQFVDFAPDSTGEYRTTRPIGTRYLTRPL(SEQ ID NO:9) NA In Table 1, AA refers to the amino acid sequence, and NA refers to the nucleic acid sequence of the AAV capsid protein as indicated.

[0109] In some embodiments, the modified capsid protein provided herein is a modified capsid protein of an AAV serotype selected from AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVB1, AAVAnc80, AAV7m8, AAVrh10, AAV2(Y444F), AAV2(Y444+500+730), AAV2(Y252+272+444+500+700+704+730F), AAV8(Y733F), and any variant thereof. Any AAV serotype capsid protein can be modified according to the substitutions described herein. Those skilled in the art will be able to readily identify any other AAV serotype suitable for incorporating the amino acid substitutions described herein (e.g., substitutions at S194, G474, N564, and / or N573, wherein the numbering of said positions is based on the VP1 number of AAV5). In some embodiments, the modified capsid protein is a modified capsid protein of AAV5. In some embodiments, the modified capsid protein is a modified capsid protein of AAV1. In some embodiments, the modified capsid protein is a modified capsid protein of AAV2. In some embodiments, the modified capsid protein is a modified capsid protein of AAV4. In some embodiments, the modified capsid protein is a modified capsid protein of AAV6. In some embodiments, the modified capsid protein is a modified capsid protein of AAV7. In some embodiments, the modified capsid protein is a modified capsid protein of AAV8. In some embodiments, the modified capsid protein is a modified capsid protein of AAV9. In some embodiments, the modified capsid protein is a modified capsid protein of AAVB1. See Choudhury et al. (2016) Mol. Ther., 24(7): 1247-1257, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the modified capsid protein is a modified capsid protein of AVAnc80, including Anc80L65, Anc80L27, and Anc80L121. See Carvalho et al. (2018) Human Gene Therapy, 29(7): 771-784, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the modified capsid protein is a modified capsid protein of AAV7m8. See Dalkara et al. (2013) Sci. Transl. Med., 5(189): 189ra76, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the modified capsid protein is a modified capsid protein of AAVrh10.See Gao et al. (2002) Proc. Natl. Acad. Sci. USA, 99(18): 11854-11859, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the modified capsid protein is a modified capsid protein of AAV2 (Y444F), such as a modified capsid protein of AAV2 containing phenylalanine (F) at position 444. In some embodiments, the modified capsid protein is a modified capsid protein of AAV2 (Y444+500+730), such as a modified capsid protein of AAV2 containing phenylalanine (F) at positions 444, 500, and 730. In some embodiments, the modified capsid protein is a modified capsid protein of AAV2 (Y252+272+444+500+700+704+730F), such as a modified capsid protein of AAV2 containing phenylalanine (F) at positions 252, 272, 444, 500, 700, 704, and 730. In some embodiments, the modified capsid protein is a modified capsid protein of AAV8 (Y733F). See Bogner et al. (2015) PLoS One, 10(6): e0128759 (1-16) and U.S. Patent No. 8,445,267, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the modified capsid protein is a modified capsid protein of any variant of any AAV serotype described herein. Nucleic acids, vectors, and methods of production.

[0110] This document provides nucleic acids (e.g., isolated nucleic acids) encoding polypeptides (e.g., AAV capsid proteins) as described herein.

[0111] Therefore, in one aspect, this document provides a nucleic acid comprising a nucleotide sequence encoding a polypeptide (e.g., an AAV capsid protein) containing amino acid substitutions at one or more positions corresponding to amino acids S194, G474, N564, and / or N573, wherein the numbering of said positions is based on the VP1 number of AAV5. In some embodiments, said position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. Therefore, in some embodiments, this document provides a nucleic acid comprising a nucleotide sequence encoding a polypeptide (e.g., an AAV capsid protein) containing amino acid substitutions at one or more positions corresponding to amino acids S194, G474, N564, and / or N573, wherein said position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1.

[0112] In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, the modified capsid protein comprising an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, the modified capsid protein comprising an amino acid sequence having at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO: 1. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, the modified capsid protein comprising an amino acid sequence having at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1. In some embodiments, a modified capsid protein comprising an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 is encoded by a nucleic acid comprising a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 2.

[0113] In some embodiments, this document provides a nucleic acid comprising a nucleotide sequence encoding a modified capsid protein, said modified capsid protein comprising an amino acid substitution at a position corresponding to amino acid S194, wherein said position is numbered based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. In some embodiments, the amino acid corresponding to amino acid 194 in the modified capsid protein is G. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, the modified capsid protein comprising an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 3, wherein the amino acid in the capsid protein corresponding to amino acid 194 of SEQ ID NO: 3 is G. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, the modified capsid protein comprising the amino acid sequence shown in SEQ ID NO: 3. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, wherein the amino acid sequence of the modified capsid protein consists of the amino acid sequence shown in SEQ ID NO: 3. In some embodiments, a modified capsid protein comprising an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 3 (wherein the amino acid corresponding to amino acid 194 in the capsid protein is G) is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 4. In some embodiments, this document provides an isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 4. In some embodiments, this document provides an isolated nucleic acid consisting of the nucleotide sequence shown in SEQ ID NO: 4.

[0114] In some embodiments, this document provides a nucleic acid comprising a nucleotide sequence encoding a modified capsid protein, said modified capsid protein comprising an amino acid substitution at a position corresponding to amino acid G474, wherein said position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. In some embodiments, the amino acid corresponding to amino acid 474 in the modified capsid protein is R. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, the modified capsid protein comprising an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 5, wherein the amino acid in the capsid protein corresponding to amino acid 474 in SEQ ID NO: 5 is R. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, the modified capsid protein comprising the amino acid sequence shown in SEQ ID NO: 5. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, wherein the amino acid sequence of the modified capsid protein consists of the amino acid sequence shown in SEQ ID NO: 5. In some embodiments, a modified capsid protein comprising an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 5 (wherein the amino acid in the capsid protein corresponding to amino acid 474 of SEQ ID NO: 5 is R) is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 6. In some embodiments, this document provides an isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 6. In some embodiments, this document provides an isolated nucleic acid consisting of the nucleotide sequence shown in SEQ ID NO: 6.

[0115] In some embodiments, this document provides a nucleic acid comprising a nucleotide sequence encoding a modified capsid protein, said modified capsid protein comprising an amino acid substitution at a position corresponding to amino acid N564, wherein said position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. In some embodiments, the amino acid corresponding to amino acid 564 in the modified capsid protein is R. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, the modified capsid protein comprising an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 7, wherein the amino acid in the capsid protein corresponding to amino acid 564 of SEQ ID NO: 7 is R. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, the modified capsid protein comprising the amino acid sequence shown in SEQ ID NO: 7. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, wherein the amino acid sequence of the modified capsid protein consists of the amino acid sequence shown in SEQ ID NO: 7. In some embodiments, a modified capsid protein comprising an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 7 is encoded by a nucleic acid comprising a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 8. In some embodiments, this document provides an isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 8. In some embodiments, this document provides an isolated nucleic acid consisting of the nucleotide sequence shown in SEQ ID NO: 8.

[0116] In some embodiments, this document provides a nucleic acid comprising a nucleotide sequence encoding a modified capsid protein, said modified capsid protein comprising an amino acid substitution at a position corresponding to amino acid N573, wherein said position is numbered based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO: 1. In some embodiments, the amino acid corresponding to amino acid 573 in the modified capsid protein is R. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, the modified capsid protein comprising an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 9, wherein the amino acid in the capsid protein corresponding to amino acid 573 of SEQ ID NO: 9 is R. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, the modified capsid protein comprising the amino acid sequence shown in SEQ ID NO: 9. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a modified capsid protein, wherein the amino acid sequence of the modified capsid protein consists of the amino acid sequence shown in SEQ ID NO: 9. In some embodiments, a modified capsid protein comprising an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 9 (wherein the amino acid in the capsid protein corresponding to amino acid 573 of SEQ ID NO: 9 is R) is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99% sequence identity with the nucleotide sequence shown in SEQ ID NO: 10. In some embodiments, this document provides an isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 10. In some embodiments, this document provides an isolated nucleic acid consisting of the nucleotide sequence shown in SEQ ID NO: 10.

[0117] In some embodiments, nucleic acids can be optimized, for example, by using codon optimization, substitution, and / or removal of certain elements, to improve, for example, the performance of capsid proteins. Various methods for optimizing nucleic acid sequences are generally known to those skilled in the art. For example, the degeneracy of the genetic code can be utilized to mutate certain nucleotides in the nucleic acid without altering the amino acid sequence encoded by the nucleic acid sequence. For example, nucleic acids can be optimized by using alternative codons for the same amino acids. In some embodiments, the optimization method can increase the performance of the encoded capsid protein compared to the performance of the capsid encoded by the unoptimized nucleic acid sequence.

[0118] Many methods for producing rAAV vectors are known in the industry, including transfection, stable cell line production, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al., (1997). Virology 71(11):8780-8789) and baculovirus-AAV hybrids. The rAAV production cultures used to produce rAAV viral particles require: 1) suitable host cells, in the case of a baculovirus production system, including, for example, human cell lines such as HeLa, A549, or 293 cells; or insect cell lines such as SF-9; 2) suitable helper viral function provided by wild-type or mutant adenoviruses (such as temperature-sensitive adenoviruses), herpesviruses, baculoviruses, or plasmoid constructs providing assistive tools (e.g., helper viral vectors selected from retroviral vectors, herpesvirus vectors, baculovirus vectors, or adenovirus vector expression vectors, wherein the vector shown is an expression vector); 3) AAV rep and cap genes and gene products; 4) gene transfection with at least one AAV ITR sequence flanking it (such as therapeutic gene transfection); and 5) suitable culture media and culture media components to support rAAV production. Suitable culture media known in the industry can be used for the production of rAAV vectors. These media include, but are not limited to, media produced by Hyclone Laboratories and JRH, including Modified Eagle Medium (MEM); Dalberg Modified Eagle Medium (DMEM); custom formulations, such as those described in U.S. Patent No. 6,566,118; and Sf-900 II SFM medium as described in U.S. Patent No. 6,723,551, each of which (particularly relating to custom culture medium formulations for the production of recombinant AAV vectors) is incorporated herein by reference in its entirety.

[0119] rAAV particles can be produced using methods known in the industry. See, for example, U.S. Patent Nos. 6,566,118; 6,989,264; and 6,995,006. In practicing this invention, host cells used for producing rAAV particles include mammalian cells, insect cells, plant cells, microorganisms, and yeast. The host cell can also be a packaging cell in which the AAV rep and cap genes are stably maintained within the host cell, or a production cell in which the AAV vector genome is stably maintained. Exemplary packaging and production cells are derived from 293, A549, or HeLa cells. The AAV vector is purified and formulated using standard techniques known in the industry.

[0120] In some embodiments, rAAV particles can be produced by a triple transfection method, such as the exemplary triple transfection method provided below. In short, plastids containing the rep gene and capsid gene, along with helper adenovirus plastids, can be transfected (e.g., using the calcium phosphate method) into a cell line (e.g., HEK-293 cells), and the virus can be collected and purified as appropriate.

[0121] In some embodiments, rAAV particles can be produced by cell line production methods, such as the exemplary cell line production methods provided below (see also (Martin et al., (2013) Human Gene Therapy Methods 24:253-269)). Briefly, cell lines (e.g., HeLa cell lines) can be stably transfected with plastids containing the rep gene, capsid gene, and promoter-gene transfection sequence. Cell lines can be screened to select a lead clone for rAAV production, which can then be amplified in a production reactor and transfected with an adenovirus (e.g., wild-type adenovirus) as a helper to initiate rAAV production. The virus can then be harvested, the adenovirus can be inactivated (e.g., by heat) and / or removed, and the rAAV particles can be purified.

[0122] The suitable rAAV production medium of the present invention can be supplemented with 0.5%-20% (v / v or w / v) serum or serum-derived recombinant protein. Alternatively, as is known in the industry, the rAAV vector can be produced under serum-free conditions, which can also be referred to as a medium free of animal-derived products. Those skilled in the art will understand that commercial or custom-made mediums designed to support the production of rAAV vectors can also be supplemented with one or more cell culture components known in the industry, including but not limited to glucose, vitamins, amino acids and / or growth factors, in order to increase the potency of rAAV in the production culture.

[0123] rAAV production cultures can be grown under a variety of conditions (over a wide range of temperatures, for varying durations, etc.) suitable for the specific host cells used. As is known in the industry, rAAV production cultures include attachment-dependent cultures that can be cultured in suitable attachment-dependent containers (e.g., roller flasks, hollow fiber filters, microcarriers, and packed or fluidized bed bioreactors). rAAV carrier production cultures may also contain suspension-adapted host cells, such as HeLa, 293, and SF-9 cells. These cells can be cultured in a variety of ways, including, for example, rotating flasks, stirred tank bioreactors, and disposable systems such as wave bag systems.

[0124] The rAAV vector particles described herein can be harvested from an rAAV production culture by lysing the host cells of the production culture or by harvesting the used culture medium from the production culture, provided that the cells are cultured under conditions known in the art that cause the release of rAAV particles from intact cells into the culture medium (as more fully described in U.S. Patent No. 6,566,118). In some embodiments, the rAAV vector particles described herein are produced by a method that includes culturing recombinant host cells under conditions that express nucleic acids and produce capsid proteins. Suitable methods for lysing cells are also known in the art and include, for example, multiple freeze / thaw cycles, sonication, microfluidization, and treatment with chemicals such as detergents and / or proteases.

[0125] In another embodiment, the rAAV particles are purified. As used herein, the term "purified" includes an rAAV particle formulation that lacks at least some other components that may also be present where the rAAV particles are naturally present or where they were originally prepared. Thus, for example, isolated rAAV particles can be prepared by enriching them from a source mixture (such as culture lysate or production culture supernatant) using purification techniques. The enrichment can be measured in various ways, such as based on the proportion of DNase-resistant particles (DRP) or genome copies (gc) present in the solution, or based on infectivity; or based on a second potential interfering substance present in the source mixture (such as contaminants, including production culture contaminants or in-process contaminants, including helper viruses, culture medium components, etc.).

[0126] In some embodiments, the rAAV production culture harvest is clarified to remove host cell debris. In some embodiments, the production culture harvest is clarified by filtration via a series of depth filters, including, for example, DOHC-grade Millipore Millistak+ HC Pod filters, AlHC-grade Millipore Millistak+ HC Pod filters, and 0.2 µm Filter Opticap XL 10 Millipore Express SHC hydrophilic membrane filters. Clarification can also be achieved using a variety of other standard techniques known in the industry, such as centrifugation or filtration through any cellulose acetate filter with a pore size of 0.2 μm or larger known in the industry.

[0127] In some embodiments, the rAAV production culture harvest is further treated with Benzonase® to digest any high molecular weight DNA present in the production culture. In some embodiments, Benzonase® digestion is performed under standard conditions known in the industry, which include, for example, a final concentration of 1-2.5 units / ml of Benzonase® for a period of 30 minutes to several hours at a temperature ranging from ambient temperature to 37ºC.

[0128] rAAV particles can be isolated or purified using one or more of the following purification steps: equilibration centrifugation; flow-through anion exchange filtration; tangential flow filtration (TFF) for concentrating rAAV particles; capture of rAAV by apatite chromatography; heat inactivation of the virus; capture of rAAV by hydrophobic interaction chromatography; buffer exchange by size exclusion chromatography (SEC); nanofiltration; and capture of rAAV by anion exchange chromatography, cation exchange chromatography, or affinity chromatography. These steps can be used alone, in various combinations, or in different orders. In some embodiments, the method comprises all steps in the order described below. Methods for purifying rAAV particles are found, for example: Xiao et al., (1998) Journal of Virology 72:2224-2232; U.S. Patent Nos. 6,989,264 and 8,137,948; and WO 2010 / 148143.

[0129] In some embodiments, pharmaceutical compositions comprising the rAAV described herein and a medically acceptable carrier are suitable for administration to humans. Such carriers are well known in the industry (see, for example, Remington's Pharmaceutical Sciences, 15th edition, pp. 1035-1038 and 1570-1580). In some embodiments, pharmaceutical compositions comprising the rAAV described herein and a medically acceptable carrier are suitable for ocular injection. Such medically acceptable carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, plant, or synthetic origin, such as peanut oil, soybean oil, mineral oil, etc. Saline solutions and aqueous solutions of dextran, polyethylene glycol (PEG), and glycerin can also be used as liquid carriers, particularly for injectable solutions. Pharmaceutical compositions may further comprise additional ingredients, such as preservatives, buffers, tensile agents, antioxidants and stabilizers, nonionic wetting or clarifying agents, thickeners, etc. Pharmaceutical compositions described herein may be packaged in single-unit doses or in multiple-dose formulations. The composition is typically formulated as a sterile and substantially isotonic solution. AAV composition and usage.

[0130] In one aspect, this article provides an rAAV particle comprising: an rAAV capsid containing the polypeptide described herein (e.g., a modified capsid protein) and an rAAV vector containing a heterologous nucleic acid.

[0131] The rAAV may comprise a heterologous nucleic acid encoding a polypeptide (e.g., a therapeutic or diagnostic polypeptide) and / or a therapeutic nucleic acid. The heterologous nucleic acid encoding a therapeutic or diagnostic polypeptide and / or a therapeutic nucleic acid may be produced using methods known in the industry, employing standard synthetic and recombinant methods. In some embodiments, the heterologous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the heterologous nucleic acid encodes a diagnostic polypeptide. Non-limiting examples of nucleic acids encoding therapeutic polypeptides include nucleic acids used to replace missing or mutated genes known to cause retinal diseases, such as Prph2, RPE65, MERTK, RPGR, RP2, RPGRIP, CNGA3, CNGB3, and GNAT2. Other non-limiting examples of nucleic acids encoding therapeutic polypeptides include those encoding neurotrophic factors (such as GDNF, CNTF, FGF2, PEDF, EPO), anti-apoptotic genes (such as BCL2, BCL-X, NFKB), anti-angiogenic factors (such as endostatin, angiostatin, sFlt), and anti-inflammatory factors (such as IL10, IL1-ra, TGFfi, IL4). Other therapeutic peptides for eye disorders include, but are not limited to, Myo7a, ABCA4, REP1, GUCY2D, PDE6C, RSI, RPGRIP, Lpcat1, AIPL1, RDH12, and CHM. In some embodiments, the encoded peptide is a human variant of the peptide.

[0132] Heteronucleotides can encode polypeptides that are intracellular proteins, anchored within the cell membrane, retained within the cell, or secreted by cells transduced using vectors as described herein. For polypeptides secreted by cells receiving the vector, the polypeptides can be soluble (i.e., not attached to the cell). For example, soluble polypeptides lack transmembrane regions and are secreted from the cell. Techniques for identifying and removing nucleic acid sequences encoding transmembrane domains are known in the industry.

[0133] This document also provides vectors comprising heterologous nucleic acids encoding RNA (e.g., RNAi, ribozymes, miRNAs, siRNAs, antisense RNAs), which, when transcribed from the nucleic acid of the vector, can treat ocular disorders by interfering with the translation or transcription of abnormal or excessive proteins associated with the disease state of the present invention. For example, the heterologous nucleic acids described herein can encode RNAs that treat diseases by highly specifically eliminating or reducing mRNAs encoding abnormal and / or excessive proteins. Therapeutic RNA sequences include RNAi, small repressive RNAs (siRNAs), microRNAs (miRNAs), and / or ribozymes (such as hammerhead and hairpin ribozymes), which can treat diseases, such as those occurring in various forms of hereditary retinal degeneration, by highly specifically eliminating or reducing mRNAs encoding abnormal and / or excessive proteins. Non-limiting examples of ocular disorders that can be treated with therapeutic RNA sequences include, for example, autosomal dominant retinitis pigmentosa (ADRP) and diabetic retinopathy. Examples of therapeutic RNA sequences and nucleic acids encoding such sequences that can be used in this invention include, for example, those described in U.S. Patent No. 6,225,291, the disclosure of which is incorporated herein by reference in its entirety. In some embodiments, the therapeutic RNA sequence is miR-708. In some embodiments, miR-708 is used in combination with a nucleic acid encoding wild-type rhodopsin, said nucleic acid being part of the same rAAV vector or as part of a second rAAV vector. In some embodiments, the nucleic acid encoding wild-type rhodopsin lacks the miR-708 target sequence located in the 3' untranslated region of the rhodopsin gene. The rAAV vector encoding miR-708 and / or rhodopsin is provided by U.S. Provisional Patent Application Serial No. 61 / 969,027, which is incorporated herein by reference in its entirety.

[0134] Heteronucleotides can encode polypeptides that are intracellular proteins, anchored within the cell membrane, retained within the cell, or secreted by cells transduced using vectors as described herein. For polypeptides secreted by cells receiving the vector, the polypeptides can be soluble (i.e., not attached to the cell). For example, soluble polypeptides lack transmembrane regions and are secreted from the cell. Techniques for identifying and removing nucleic acid sequences encoding transmembrane domains are known in the industry.

[0135] In some embodiments, the heterologous nucleic acid is operatively linked to the promoter. Exemplary promoters include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, simian virus 40 (SV40) promoter and CK6 promoter, transthyretin promoter (TTR), TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter; CMV enhancer / chicken β-actin / rabbit β-globulin promoter (CAG promoter; Niwa et al., Gene, 1991, 108(2): 193-9) and elongation factor 1-α promoter (EFl-α) promoter (Kim et al., Gene, 1990, 91(2):217-23 and Guo et al., Gene Ther., 1996, 3(9):802-10). In some embodiments, the promoter comprises a human β-glucuronidase promoter or a cytomegalovirus enhancer linked to a chicken β-actin (CBA) promoter. The promoter may be a constitutive, inducible, or repressive promoter. In some embodiments, this document provides a recombinant vector comprising nucleic acid encoding a heterologous gene transfected with the present disclosure operatively linked to a CBA promoter. Exemplary promoters and descriptions may be found, for example, in U.S. Pre-Grant Publication 20140335054.

[0136] Examples of constitutive promoters include, but are not limited to, the retrotransmitted Rous sarcoma virus (RSV) LTR promoter (with RSV enhancer as appropriate), the cytomegalovirus (CMV) promoter (with CMV enhancer as appropriate) [see, for example, Boshart et al., Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the 13-actin promoter, the glycerol phosphokinase (PGK) promoter, and the EFi promoter [Invitrogen].

[0137] Inducible promoters allow for the regulation of gene expression and can be regulated by exogenously provided compounds, environmental factors (such as temperature), or the presence of specific physiological states (e.g., acute phase), specific differentiation states of cells, or even when cells are simply replicating. Inducible promoters and inducible systems are available from a variety of commercial sources, including but not limited to Invitrogen, Clontech, and Ariad. Many other systems have been described and can be readily selected by those skilled in the art. Examples of inducible promoters regulated by exogenously provided promoters include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the insect ecdysone promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline repressor system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline inducible system (Gossen et al., Science, 268: 1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518). (1998)), the RU486 inducible promoter system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)), and the rapamycin inducible promoter system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Other types of inducible promoters still available in this context are those regulated by specific physiological states (e.g., temperature, acute phase), specific differentiation states of cells, or those used only when cells are replicating.

[0138] In some embodiments, the heterologous nucleic acid is operatively linked to a promoter suitable for expression in ocular tissues. In some embodiments, the heterologous nucleic acid is operatively linked to a promoter suitable for expression in the retina. In some embodiments, the heterologous nucleic acid is operatively linked to a promoter suitable for expression in retinal cells selected from photoreceptor cells, retinal pigment epithelial cells, bipolar cells, horizontal cells, amacrine cells, Miller cells, ganglion cells, and any combination thereof. In some embodiments, the heterologous nucleic acid is operatively linked to a promoter suitable for expression in the cornea. In some embodiments, the heterologous nucleic acid is operatively linked to a promoter suitable for expression in corneal cells selected from epithelial cells, corneal stromal cells, endothelial cells, and any combination thereof. Other retinal and corneal cell types are known in the art, and those skilled in the art will be able to identify promoters suitable for expression in these cell types.

[0139] This document provides methods for using the rAAV compositions described herein. In some embodiments, a method for delivering heterologous nucleic acids to ocular tissue of a subject is provided, comprising delivering rAAV particles to the subject. In some embodiments, the rAAV particles comprise: an rAAV capsid comprising a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564, and / or 573, wherein the position numbering is based on the VP1 numbering of AAV5; and an rAAV carrier comprising the heterologous nucleic acid. In some embodiments, the method is used for delivering heterologous nucleic acids to the retina of a subject. In such embodiments, the rAAV particles comprise: an rAAV capsid comprising a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at the position corresponding to amino acid 194, wherein the position numbering is based on the VP1 numbering of AAV5; and an rAAV carrier comprising the heterologous nucleic acid. In some embodiments, the method is used for delivering heterologous nucleic acids to the cornea of ​​a subject. In such embodiments, the rAAV particle comprises: an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and an rAAV vector containing a heterologous nucleic acid.

[0140] In some embodiments, a method for improving rAAV transduction in cells of a subject's ocular tissue is provided, comprising delivering rAAV particles to the subject. In some embodiments, the rAAV particles comprise: an rAAV capsid comprising a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions corresponding to one or more positions of amino acids 194, 474, 564, and / or 573, wherein the position numbering is based on the VP1 numbering of AAV5; and an rAAV vector comprising a heterologous nucleic acid. In some embodiments, the method is used to improve rAAV transduction in cells of a subject's retina. In such embodiments, the rAAV particles comprise: an rAAV capsid comprising a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions corresponding to the position of amino acid 194, wherein the position numbering is based on the VP1 numbering of AAV5; and an rAAV vector comprising a heterologous nucleic acid. In some embodiments, the method is used to improve rAAV transduction in cells of a subject's cornea. In such embodiments, the rAAV particle comprises: an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and an rAAV vector containing a heterologous nucleic acid.

[0141] In some embodiments, a method for improving the performance of heterologous nucleic acids in ocular tissue of a subject is provided, comprising delivering rAAV particles to the subject. In some embodiments, the rAAV particles comprise: an rAAV capsid comprising a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564, and / or 573, wherein the position numbering is based on the VP1 numbering of AAV5; and an rAAV carrier comprising heterologous nucleic acids. In some embodiments, the method is used to improve the performance of heterologous nucleic acids in the retina of a subject. In such embodiments, the rAAV particles comprise: an rAAV capsid comprising a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at the position corresponding to amino acid 194, wherein the position numbering is based on the VP1 numbering of AAV5; and an rAAV carrier comprising heterologous nucleic acids. In some embodiments, the method is used to improve the performance of heterologous nucleic acids in the cornea of ​​a subject. In such embodiments, the rAAV particle comprises: an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and an rAAV vector containing a heterologous nucleic acid.

[0142] This article also provides a method for treating an eye condition or disorder in a subject, comprising administering to the subject an effective amount of a composition comprising rAAV particles, wherein the rAAV particles comprise: an rAAV capsid comprising a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564 and / or 573, wherein the position numbering is based on the VP1 number of AAV5; and an rAAV vector comprising a heterologous nucleic acid.

[0143] In the various methods described herein, the heterologous nucleic acids exhibit increased performance levels compared to the performance levels of rAAV particles containing wild-type rAAV capsids. Delivery Method

[0144] Subretinal delivery methods are known in the industry. See, for example, WO 2009 / 105690, which is incorporated herein by reference. In short, a general method for delivering rAAV particles (e.g., modified rAAV particles as described herein) to the subretinal macula and fovea can be illustrated by the following brief overview. This example is intended only to illustrate certain features of the method and is by no means intended to be limiting.

[0145] Typically, rAAV vectors can be delivered in the form of a composition injected intraocularly (subretinal) under direct observation using a surgical microscope. In some embodiments, the vector is capsidated in rAAV particles, wherein the rAAV particles comprise an rAAV capsid as described herein and an rAAV vector comprising a heterologous nucleic acid and at least one AAV inverted terminal repeat sequence. This procedure may involve vitrectomy followed by injection of the rAAV vector suspension into the subretinal space using a thin cannula via one or more mini-retinal incisions.

[0146] In short, the infusion cannula can be sutured in place throughout the procedure to maintain normal spherical volume by infusion (e.g., saline). Vitrectomy is performed using a cannula of appropriate aperture (e.g., size 20 to 27), wherein the volume of the removed vitreous gel is replaced by infusion of saline or other isotonic solutions from the infusion cannula. Vitrectomy is advantageous because (1) removal of its cortex (posterior hyalinous membrane) facilitates cannula penetration of the retina; (2) removal and replacement with fluid (e.g., saline) creates space to accommodate the intraocular injection carrier; and (3) controlled removal of it reduces the likelihood of retinal tears and accidental retinal detachment.

[0147] In some embodiments, the rAAV composition is injected directly into the subretinal space outside the central retina using a cannula of appropriate aperture (e.g., size 27-45), thereby creating vesicles in the subretinal space. In other embodiments, a small volume (e.g., about 0.1 to about 0.5 ml) of an appropriate fluid (such as saline or Ringer's solution) is injected subretinally into the subretinal space outside the central retina prior to the subretinal injection of the rAAV composition. This initial injection into the subretinal space establishes initial fluid vesicles within the subretinal space, thereby causing localized retinal detachment at the location of the initial vesicles. These initial fluid vesicles can facilitate targeted delivery of the rAAV composition into the subretinal space (by defining the injection plane prior to rAAV delivery) and minimize the possibility of possible rAAV delivery into the choroid and injection or refluxing of rAAV into the vitreous cavity. In some embodiments, fluids containing one or more rAAV compositions and / or one or more additional therapeutic agents may be directly delivered to an initial fluid vesicle using the same or additional fine-hole cannula, and these fluids may be further injected into the initial fluid vesicle.

[0148] Intraocular administration of the rAAV composition and / or an initial small volume of fluid can be performed using a fine-aperture cannula (e.g., size 27-45) attached to a syringe. In some embodiments, the plunger of the syringe can be mechanically driven, such as by pressing a foot pedal. The fine-aperture cannula is advanced via sclerotomy, across the vitreous cavity, and into the retina at a predetermined site in each subject according to the retinal region to be targeted (but outside the central retina). Under direct visualization, the carrier suspension is mechanically injected into the subretinal space using a self-sealing, non-expanding retinostomy, causing localized retinal detachment. As noted above, the rAAV composition can be injected directly into the subretinal space to create vesicles outside the central retina, or the carrier can be injected into initial vesicles outside the central retina to expand them (and expand the detached retinal region). In some embodiments, another fluid is injected into the vesicle after the injection of the rAAV composition.

[0149] It is undesirable to be bound by theory; the rate and location of one or more subretinal injections may result in local shear forces that could damage the macula, fovea, and / or underlying RPE cells. Subretinal injections can be performed at a rate that minimizes or avoids shear forces. Those skilled in the art will recognize that the injection rate and timing of the vesicles can be guided by, for example, the volume or size of the rAAV composition required to produce effective retinal detachment to approach the cells of the central retina, the size of the cannula used to deliver the rAAV composition, and the ability to safely maintain cannula position.

[0150] In some embodiments, the method includes delivering (e.g., subretinal and / or intravitreal) an effective amount of recombinant viral particles comprising a vector encoding a heterologous nucleic acid to the eye. In some embodiments, the method described herein results in rAAV transduction in the retina. In some embodiments, the method described herein results in rAAV transduction in retinal cells. In some embodiments, the method described herein results in rAAV transduction in the cornea. In some embodiments, the method described herein results in rAAV transduction in corneal cells.

[0151] To safely and effectively transduce a target retinal region (e.g., the central retina) outside the edge of the vesicle's original location, the vesicle can be manipulated to reposition it to the target region for transduction. The vesicle can be manipulated by: vesicle dependence due to vesicle volume, repositioning of the eye containing the vesicle, repositioning of the head of a person whose one or more eyes contain one or more vesicles, and / or by means of fluid-air exchange. This is particularly relevant to the central retina, as this region is typically resistant to detachment caused by subretinal injection. In some embodiments, fluid-air exchange is used to reposition the vesicle; fluid from the infusion cannula is temporarily replaced with air, for example, by blowing air onto the retinal surface. As the air volume displaces the vitreous cavity fluid from the retinal surface, the fluid in the vitreous cavity can flow out from the cannula. The temporary lack of pressure caused by the vitreous cavity fluid causes the vesicle to move and be drawn to subordinate parts of the eye. By properly positioning the eyeball, the subretinal rAAV composition vesicle is manipulated to involve adjacent areas (e.g., the macula and / or fovea). In some cases, the quality of the vesicle is sufficient for attraction even without fluid-air exchange. Changing the subject's head position can further facilitate the movement of the vesicle to the desired location, allowing it to be attracted to the desired position within the eye. Once the desired vesicle configuration is achieved, fluid is returned to the vitreous cavity. The fluid is a suitable fluid, such as fresh saline. Typically, the subretinal rAAV composition can be retained in situ without retinal adhesion to retinal incision and without intraocular tamponade, and the retina will spontaneously reattach within approximately 48 hours.

[0152] By safely and efficiently transducing ocular cells (e.g., RPE and / or photoreceptor cells of the macula and / or fovea) using a vector containing a therapeutic peptide or RNA sequence, the methods described herein can be used to treat individuals, such as humans, with ocular disorders, wherein the transduced cells produce a therapeutic peptide or RNA sequence in an amount sufficient to treat the ocular disorder. In some embodiments, ocular cell transduction is improved by using rAAV particles containing the AAV capsid protein described herein (e.g., modified rAAV particles as described herein).

[0153] Depending on the treatment objective, an effective amount of rAAV (in particulate form in some embodiments) is administered. For example, where a low percentage of transduction can achieve the desired therapeutic effect, the treatment objective is typically to reach or exceed this transduction level. In some cases, this transduction level can be achieved by transducing only about 1% to 5% of the target cells, at least about 20% of the desired tissue type cells in some embodiments, at least about 50% in some embodiments, at least about 80% in some embodiments, at least about 95% in some embodiments, and at least about 99% of the desired tissue type cells in some embodiments. As discussed above, substitution of one or more amino acids in the rAAV capsid as described herein improves rAAV transduction. The rAAV composition can be administered by one or more subretinal or intravitreal injections during the same procedure or at intervals of days, weeks, months, or years. In some embodiments, multiple carriers can be used to treat humans.

[0154] In some embodiments, delivering an effective amount of rAAV viral particles containing the rAAV capsid described herein to the retina transduces photoreceptor cells at or near the delivery site. In some embodiments, more than 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 100% of photoreceptor cells are transduced. In some embodiments, about 5% to about 100%, about 10% to about 50%, about 10% to about 30%, about 25% to about 75%, about 25% to about 50%, or about 30% to about 50% of photoreceptor cells are transduced. Methods for identifying photoreceptor cells transduced from AAV viral particles containing the rAAV capsid as described herein are known in the art; for example, immunohistochemistry or the use of markers such as enhanced green fluorescent protein can be used to detect transduction of viral particles containing the rAAV capsid as described herein.

[0155] In some embodiments, the method includes delivering an effective amount of AAV viral particles containing an rAAV capsid as described herein to the subretinal space of a mammal (e.g., the subretinal space) for the treatment of an individual with an eye disorder; for example, a person with an eye disorder. In some embodiments, the composition is injected into one or more sites in the subretinal space to allow the expression of heterologous nucleic acids in photoreceptor cells. In some embodiments, the composition is injected into any one, two, three, four, five, six, seven, eight, nine, ten, or more than ten sites in the subretinal space.

[0156] In some embodiments, rAAV viral particles comprising an rAAV capsid as described herein are simultaneously or sequentially delivered to more than one site. In some embodiments, the intervals between multiple injections of rAAV viral particles do not exceed 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 9 hours, 12 hours, or 24 hours.

[0157] A general method for intravitreal injection can be illustrated by the following brief overview. This example is intended only to illustrate certain features of the method and is by no means intended to be limiting. The procedure for intravitreal injection is known in the industry (see, for example, Peyman, GA, et al. (2009) Retina 29(7):875-912 and Fagan, XJ and Al-Qureshi, S. (2013) Clin. Experiment. Ophthalmol. 41(5):500-7).

[0158] In short, a subject undergoing intravitreal injection can be prepared for the procedure by pupillary dilation, sterilization of the eye, and administration of an anesthetic. Any suitable mydriatic agent known in the industry can be used for pupillary dilation. Adequate pupillary dilation can be confirmed prior to treatment. Sterilization can be achieved by administering a sterile eye treatment, such as a solution containing an iodide, such as povidone-iodine (BETADINE®). Similar solutions can also be used to clean the eyelids, eyelashes, and other nearby tissues (e.g., skin). Any suitable anesthetic agent, such as lidocaine or promecaine, at any appropriate concentration can be used. The anesthetic agent can be administered by any method known in the industry, including but not limited to topical drops, gels, or jelly, as well as subconjunctival administration.

[0159] Before injection, eyelashes can be removed from the area using a sterile blepharoscopy. The injection site can be marked with a syringe. The injection site can be selected based on the patient's lens. For example, the injection site can be 3-3.5 mm from the limus of a pseudophakic or aphakic patient and 3.5-4 mm from the rim of a phakic patient. The patient can look in the opposite direction to the injection site.

[0160] During the injection, the needle can be inserted perpendicularly to the sclera and pointed towards the center of the eye. The needle can be inserted such that it terminates in the vitreous humor rather than the subretinal space. Any suitable volume known in the industry for injection can be used. After the injection, the eye can be treated with a sterilizing agent (such as an antibiotic). The eye can also be rinsed to remove excess sterilizing agent.

[0161] It is known that the retina contains multiple layers. The cellular layers in the retina may include the inner limiting membrane, nerve fiber layer, ganglion cell layer, inner plexiform layer, inner nuclear layer, outer plexiform layer, outer nuclear layer, outer limiting membrane, photoreceptor cell layer, and retinal pigment epithelium layer. The layer closest to the vitreous body is the inner limiting membrane. This layer may contain Mueller cells (or Muller cells) (a type of glial cell). The nerve fiber layer may contain axons from ganglion cells, which form the optic nerve. The ganglion cell layer may contain ganglion cells and amacrine cells. The inner plexiform layer may contain synapses between the dendrites of ganglion cells and amacrine cells and the axons of bipolar cells. The inner nuclear layer may contain the nuclei of amacrine cells, bipolar cells, and horizontal cells. The outer plexiform layer may contain synapses between the dendrites of horizontal cells and the processes of photoreceptor cells. The outer nuclear layer may contain photoreceptor cell bodies. The external or external limiting membrane may include cell junctions, such as adhesive junctions between the apical processes of Miller cells and between these processes and the internal segments of photoreceptor cells, and desmosomes. The photoreceptor layer, also known as the rod and cone layers and Jacob's membrane, may contain photoreceptor cells, including rods and cones. The retinal layer furthest from the vitreous body is the retinal pigment epithelium (RPE), which may contain a layer of hexagonal epithelial cells containing pigment granules.

[0162] It is also known that the retina contains many different cell types. Retinal neurons can include photoreceptor cells, bipolar cells, ganglion cells, amacrine cells, and horizontal cells. Photoreceptor cells are sensitive to light. They can sense light and respond by transmitting signals to the optic nerve through bipolar cells and ganglion cells. Photoreceptor cells can include rod cells and cone cells; rod cells typically sense light under dim conditions, while cone cells typically sense color and brighter light. Bipolar cells can receive input from photoreceptor cells and synapse with amacrine cells or ganglion cells. Ganglion cells can receive information from amacrine cells or horizontal cells, and their axons form the optic nerve. Horizontal cells can integrate input from multiple photoreceptor cells and help regulate light levels. Amacrine cells are interneurons that help regulate bipolar cells and provide input to ganglion cells. Glial cells of the retina can include Miller cells, astrocytes, and microglia.

[0163] The cornea is known to contain multiple layers. The cellular layers of the cornea may include the corneal epithelium, Bowman's layer, corneal stroma, Descemet's membrane, and corneal endothelium. The corneal epithelium is a non-keratinized, layered squamous epithelium that forms a thin, multicellular epithelial tissue layer containing rapidly regenerating cells. The anterior limiting membrane, or Bowman's layer, is a layer composed of collagen (e.g., type I collagen fibrils), basement membrane glycans, nestin, laminin, and other heparan sulfate proteoglycans for protecting the corneal stroma. Bowman's layer is known to be the acellular region of the apical stroma. The corneal stroma, or substanceia propria, is a layer containing regularly arranged collagen fibrils and interconnected corneal stromal cells distributed throughout. Descemet's membrane, also known as the posterior limiting membrane, is primarily composed of collagen (e.g., type IV collagen fibrils). The corneal endothelium is a simple squamous or low cuboidal monolayer containing corneal endothelial cells rich in mitochondria.

[0164] The effectiveness of rAAV delivery via subretinal or intravitreal injection can be monitored by several criteria as described herein. For example, after treating a subject with the methods described herein, the subject can be assessed by one or more clinical parameters, including those described herein, to understand the improvement and / or stabilization and / or delay of the progression of one or more signs or symptoms of a disease state. Examples of such tests are known in the industry and include both objective and subjective (e.g., subject-reported) measures. For example, to measure the effectiveness of treatment on a subject's visual function, one or more of the following can be evaluated: the subject's subjective visual quality or improved central visual function (e.g., improved ability to read fluently and recognize faces), the subject's visual activity (e.g., reduced time required for maze navigation), visual acuity (e.g., improved LogMAR score), micro-field testing (e.g., improved dB score), dark-adaptive visual field testing (e.g., improved dB score), fine matrix mapping (e.g., improved dB score), Goldmann visual field testing (e.g., reduced size of dark spot areas (i.e., blind spots) and improved ability to resolve smaller targets), flicker sensitivity (e.g., improved Hertz), spontaneous fluorescence, and electrophysiological measurements (e.g., improved ERG). In some embodiments, visual function is measured by the subject's visual activity. In some embodiments, visual function is measured by the subject's visual acuity. In some embodiments, visual function is measured by micro-field testing. In some embodiments, visual function is measured by dark-adaptive visual field testing. In some embodiments, visual function is measured by ERG. In some embodiments, visual function is measured by the subject’s subjective visual quality.

[0165] In cases of diseases leading to progressive degeneration of visual function, early treatment of subjects can not only slow or halt disease progression, but it can also mitigate or prevent visual function loss due to acquired amblyopia. Amblyopia can have two types. In studies of non-human primates and kittens kept in complete darkness from birth until even a few months of age, these animals experienced irreversible functional blindness even upon subsequent exposure to light, despite having functional signals transmitted by the retina. This blindness occurs because the neural connections and “education” of the cortex are developmentally halted from birth due to the cessation of stimulation. Whether this function can be restored is unknown. In cases of retinal degeneration, normal visual cortical circuits are initially “learned” or develop properly until degeneration causes significant functional impairment. Loss of visual stimulation in signal transmission in the dysfunctional eye results in “acquired” or “learned” functional impairment (“acquired amblyopia”), causing the brain to be unable to interpret signals or “use” the eye. In these cases of "acquired amblyopia," it is unknown whether the improved signaling from the retina due to gene therapy for the amblyopic eye, in addition to a slowed or stable disease progression, can lead to the acquisition of further normal function. In some embodiments, the treated person is under 30 years of age. In some embodiments, the treated person is under 20 years of age. In some embodiments, the treated person is under 18 years of age. In some embodiments, the treated person is under 15 years of age. In some embodiments, the treated person is under 14 years of age. In some embodiments, the treated person is under 13 years of age. In some embodiments, the treated person is under 12 years of age. In some embodiments, the treated person is under 10 years of age. In some embodiments, the treated person is under 8 years of age. In some embodiments, the treated person is under 6 years of age.

[0166] In some ocular disorders, there exists a "neural cell" phenomenon, in which improving the function of one type of cell improves the function of another. For example, transducing the RPE of the central retina via rAAV as described herein can then improve the function of rods, and consequently, the improved rod function leads to improved cone function. Thus, treatment of one type of cell can result in improvement of the function of another type of cell.

[0167] The selection of a specific rAAV carrier and composition depends on many different factors, including but not limited to the individual's medical history and characteristics of the condition and the individual being treated. The assessment of such characteristics and the design of an appropriate treatment regimen ultimately rests with the prescribing physician. In some embodiments, the person to be treated has a hereditary eye disorder but has not yet shown clinical signs or symptoms. In some embodiments, the person to be treated has an eye disorder. In some embodiments, the person to be treated exhibits one or more signs or symptoms of an eye disorder.

[0168] Non-limiting examples of ocular disorders that can be treated with the systems and methods described herein include: autosomal recessive severe early-onset retinal degeneration (Leber's congenital cataract). Amaurosis, congenital achromatopsia, Stargardt disease, Best disease, Doyne disease, cone dystrophy, cone-rod dystrophy, retinitis pigmentosa, X-linked retinoschisis, Usher syndrome, age-related macular degeneration, macular dystrophy, atrophic age-related macular degeneration, neovascular AMD, diabetic macular degeneration, proliferative diabetic retinopathy (PDR), cystoid macular edema, central serous retinopathy, retinal detachment, intraocular inflammation, glaucoma, posterior uveitis, choroidal agenesis, Burke's hereditary optic neuropathy, glaucoma (including open-angle glaucoma, angle-closure glaucoma, normal-tension glaucoma, and pigmentary glaucoma), and Fuchs' keratoplasty (also known as Fuchs' dystrophy). Example 1 - Materials and Methods: Production and Purification of AAV Carriers

[0169] AAV vectors were produced using the transient triple transfection method described above. See Nass et al. (2017) Mol. Ther. Methods Clin. Dev., 9:33-46, the contents of which are incorporated herein by reference in their entirety. Briefly, HEK293 cells were transfected using polyethyleneimine, PEI, and three plastids (ITR vector, AAV rep / cap, and Ad helper plastid) in a 1:1:1 ratio. The vector plastids contained the vector genome CBA-EGFP and an ITR sequence from AAV2. EGFP expression was driven by the CMV enhancer chicken β-actin heterozygous promoter (CBA) as described above. See Miyazaki et al. (1989) Gene, 79(2):269-277, the contents of which are incorporated herein by reference in their entirety. The AAV rep / cap helper plasmids contain the rep sequence from AAV2 and serum-type-specific capsid sequences named rep2 / cap2, rep2 / cap5, rep2 / cap7, etc. The pAd helper plasmids used were pHelper (Stratagene / Agilent Technologies, Santa Clara, CA). AAV vectors were purified by affinity column chromatography (AVB Sepharose high-performance media; GE Healthcare) as previously described (Nass et al. (2017) Mol. Ther. Methods Clin. Dev., 9:33-46). The purity of the rAAV vectors was analyzed using SYPRO Ruby protein gel staining.

[0170] Load the sample from the purified vector onto a NuPage 4%–12% Bis-Tris gel (Invitrogen). Typically, analyze 1–5 x 10¹⁰ vg of the purified vector. Stain the gel with SYPRO Ruby protein gel stain (Life Technologies). LC / MS whole protein analysis.

[0171] As previously described (Jin et al. (2017) Hum. Gene Ther. Methods, 28(5): 255-267, the contents of which are incorporated herein by reference in their entirety), AAV virus particles were first concentrated using an Amicon ultracentrifuge filter (0.5 mL, 10 kDa MWCO) and then washed three times with 25 mM Tris pH 7.1. The concentrated AAV virus particles were denatured with 10% acetic acid, vortexed, and further diluted with an equal volume of HPLC water. The final acetic acid concentration was 5%. 50 μL of AAV solution (approximately 2–5 μg protein) was injected into an Acquity UPLC system coupled to a Xevo G2-XS QTOF MS instrument (Waters, Milford, Massachusetts). Separation was performed on a BEH C8 column (2.1 x 100 mm) at a flow rate of 250 μL / min. Mobile phase A and mobile phase B were 0.1% formic acid in water and acetonitrile, respectively. The final gradient used for the C8 column was as follows: 10% B to 20% B over 6 min, 20% B to 30% B over 10 min, and then 30% B to 38% B over 40 min. The capillary voltage and sampling cone voltage of the mass spectrometer were set to 3.5 kV and 45 V, respectively. Mass spectra were acquired in positive sensitivity mode within the m / z range of 500–4000. Protein deconvolution was performed using MaxEnt1 in MassLynx software version 4.1. Enzymatic digestion of AAV1 and AAV2 VP was performed.

[0172] AAV2-EGFP (approximately 10 µg capsid protein) generated from triple transfection and cell line production was first concentrated using an Amicon Ultra centrifuge filter (10 kDa MWCO) and denatured with 6 M guanidine-HCl and 50 mM Tris (pH 8.5). The protein was reduced in the dark at 60ºC with 5 mM DTT for 30 min and then alkylated with 15 mM iodoacetamide for 30 min at room temperature. The sample was buffer-exchanged to 25 mM Tris at pH 7.1 using a Bio-Spin® 30 Tris column for digestion. After buffer exchange, the sample was aliquoted into two aliquots. Each aliquot was digested with trypsin at a 1:25 enzyme:protein ratio (wt / wt) or Asp-N at a 1:50 enzyme:protein ratio (wt / wt) at 37ºC for 2 h. UPLC / MS / MS peptide profiling analysis was performed.

[0173] Protein digests were analyzed using an Acquity UPLC-Xevo G2-XS qTOF mass spectrometer system (Waters, Milford, Massachusetts) by UPLC / MS / MSE. Separation was achieved using a BEH300 C18 column (2.1 x 150 mm) at a flow rate of 250 µL / min with a linear gradient from 2% to 40% B (0.1% formic acid in acetonitrile) over 68 min. For MS, the capillary voltage and sampling cone voltage were set to 3.0 kV and 30 V, respectively. Mass spectra were acquired in the range of 500–2000 m / z in positive sensitivity MSE mode. The deamination level in AAV VP was determined.

[0174] The deamination level was calculated using the extractive ion chromatography (XIC) of the peptide and its corresponding deamination derivative. Generation of AAV capsid variants.

[0175] The deacetylated variants N57D and G58D were based on pim45BD-cap2, an AAV helper plastid containing both rep and cap sequences from AAV2. A fragment containing the specified mutation (Genscript) was synthesized and subcloned into pim45BD-cap2. The mutation was verified by DNA sequencing (Genewiz). Acetylation variants were constructed as above using pHLP19-cap5.2 (a helper plastid containing a rep from AAV2 and a cap from AAV5) as the parent plastid. AAV2-HBKO and AAV5 arginine mutant capsids were generated by site-directed mutagenesis using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) according to the manufacturer's protocol. AAV2-HBKO was generated using a PCR mutagenesis primer on pIM45BD plastids, the primer being designed to change the codons encoding arginine 585 and 588 on VP3 to alanine. The sequences of the mutagenesis primers used to generate the R585A and R588A mutations are: TATCTACCAACCTCCAGGCAGGCAACGCACAAGCAGCTACCGCAG (SEQ ID NO: 11). Using AAV5 rep / cap plasmids (pHLPcap5.2) as templates and PCR mutagenesis primers designed to convert the corresponding arginine to alanine, AAV5-G474R, AAV5-N564R, and AAV5-N573R mutants were generated. The sequence of the mutagenesis primer used to introduce the G474R mutation is CCAGGTTCCAGCGCTGGGTTCGGCC (SEQ ID NO: 12). The sequence of the mutagenesis primer used to introduce the N564R mutation is CCGCGTGGCGTACCGCGTCGGCGGGCAG (SEQ ID NO: 13). The sequence of the mutagenesis primer used to introduce the N573R mutation is CAGTGGTGGAGCTCTGTCTGTTGGTGGCCATCTG (SEQ ID NO: 14). All mutations were confirmed through DNA sequencing. NHP study.

[0176] Prior to the aforementioned surgical procedure, four adult male cynomolgus macaques (Macaca fascicularis) were screened for neutralizing antibodies against AAV5 and AAV2. Animals considered seronegative (serum titer <1:4) were included in the study. The macaques were assigned to two groups and administered either AAV2-HBKOEGFP or AAV5GFP. On day 1 of the administration phase, the animals were administered a single subretinal injection into both eyes at a volume of 120 µL per eye. The diluent was Alcon® BSS® with 0.014% polysorbate 20. On the day of administration, using aseptic procedures under a laminar flow hood, the administration syringe (1.0 mL Luer Lok™ Becton Dickinson product 309628 or equivalent) was filled and attached to a DORC 23 needle with an extendable 41-gauge subretinal injection needle. The injection was administered within 30 minutes of filling the DORC syringe. Administration was performed in both eyes (OU) of each animal. Animals were anesthetized by intramuscular injection of atropine (0.01 mg / kg), ketamine (2 to 10 mg / kg), and dexmedetomidine (0.25 mg / kg). Following this procedure, anesthesia was reversed with atemexazole (0.25 mg / kg). The anesthesia protocol was adjusted based on the animal's responsiveness and according to Covance veterinary staff. The eyes were cleansed with approximately 1% povidone-iodine solution (prepared with sterile saline and 5% povidone-iodine) and rinsed with sterile saline. Approximately 2.5% povidone-iodine solution was applied to the administration site prior to injection. Injection was performed according to a study-specific procedure, briefly described below. The pupil was dilated with a local mydriatic. Under visual control using a surgical microscope with a modified fundus observation lens placed on the cornea and viewed through the dilated pupil, a DORC disposable two-hole injection needle (size 23) was introduced directly through the sclera into the superior temporal quadrant of the sphere approximately 3 mm posterior to the limbus and moved through the vitreous humor. Advance the 41-gauge cannula tip through the 23-gauge needle and gently touch the retinal surface. Inject the dose through the neuroretina into the subretinal space, creating subretinal vesicles. Retract the 41-gauge cannula tip and withdraw the 23-gauge needle. Following all other post-administration ocular procedures, instill topical antibiotic and steroid ointment (Neo-poly-dex) into each eye. Inject into a small portion of the retina in the central arcuate region. Perform fundus spontaneous fluorescence imaging.

[0177] Fundus autofluorescence imaging was performed once during the pre-drug administration phase and once during weeks 2, 4, and 6 of the administration phase. Animals were anesthetized (and kept under anesthesia for administration) for fundus autofluorescence imaging. Eyes were dilated with a mydriatic agent (1% tropicamide). Fundus autofluorescence images were taken for each eye to include the subretinal administration site and fovea. Images were taken using a Heidelberg SPECTRALIS® instrument. Tissue processing of the NHP retina.

[0178] On day 43 of the dosing phase, all animals that had fasted overnight were anesthetized with sodium pentobarbital, bled, and necropsies were performed. Eyes from each animal were injected with frozen 4% paraformaldehyde and immersed in it, then stored at 2ºC to 8ºC for 48 to 72 hours. The eyes were then embedded in paraffin, sectioned, and slides were prepared for IHC analysis. Twenty consecutive sections were obtained from the temporal calotte, specifically from the fovea. Additionally, twenty consecutive sections were obtained from the remaining temporal calotte in eight steps, each at 250 µm. One slide from the fovea and one slide from each of the eight steps from the temporal calotte were stained with hematoxylin and eosin. Immunohistochemical analysis.

[0179] Examine individual slides passing through the fovea of ​​each eye using bright-field microscopy. Note the presence or absence of photoreceptor cells representing GFP during observation. Tag the antibody identifying GFP with a chromogen that produces a brown precipitate. Tag the antibody identifying rhodopsin with a chromogen that produces a red precipitate. Note the presence or absence of rod photoreceptor cells representing GFP. Record selected representative images. To assess GFP performance, immunohistochemistry is performed. Briefly, wash the slides three times with xylene for 5 min each time. Rehydrate the slides by washing in a fractionated series of alcohols and rehydrating in distilled water. After antigen retrieval, inactivate endogenous peroxidase activity with hydrogen peroxide (blackened) and allow nonspecific protein binding with normal goat serum. Incubate the slides with GFP and rhodopsin antibodies. After washing, incubate the slides with ChromoPlex 1 Dual Detection for bond (Leica, Wetzlar, Germany) according to the manufacturer's instructions for visualization of dual histochemical staining. Sections were counterstained with hematoxylin, dehydrated with ethanol, and then mounted. Paraffin-embedded sections were deparaffinized and rehydrated in graded ethanol. Antigen retrieval was performed, and sections were blocked with protein block serum-free reagent (Dako). Sections were then incubated with mouse anti-GFP overnight at 4ºC, washed, and incubated with anti-mouse Alexa Fluor 488 secondary antibody. Sections were washed in PBS, mounted with a coverslip using mounting solution, and imaged under a microscope. Immunofluorescence was performed.

[0180] The remaining slides were labeled with GFP and DAPI (immunofluorescence). The slides were stained for GFP immunofluorescence detection and co-stained with DAPI for nuclear visualization. Photoreceptor cell counting and transduction quantification were performed.

[0181] Review the slide sets of stepwise sections from each eye and select slides containing the fovea for analysis. Image the photoreceptor layer from one boundary to the other of the subretinal vesicle. Morphometry analysis was performed using NIH ImageJ (version 1.49T) to determine the percentage of photoreceptors expressing GFP gene transfection within the boundaries of the subretinal vesicles. Subretinal and intravitreal injections

[0182] Mice were induced into general anesthesia by intraperitoneal injection of ketamine (90 mg / kg) / toluidine (9 mg / kg) on ​​day 45 after birth. Pupils were dilated by local administration of 1% tropicamide (Akorn Pharmaceuticals, Lake Forest, Illinois). For subretinal injection, aliquots of AAV were thawed on ice, and fluorescein (AK-FLUOR, 10% - Akorn Pharmaceuticals, Lake Forest, Illinois) was added to the viral preparation to improve visibility of AAV delivery. Under visualization using a surgical microscope (PSMT5N, World Precision Instruments, Sarasota, FL, USA), an incision was made through the sclera immediately following the nasal limbus. Through this incision, a 35-gauge blunt needle (NF35BL, World Precision Instruments, Sarasota, Florida, USA) was introduced into the subretinal space. The needle was housed within a SilFlex tube connected to a NanoFil syringe. A foot-pedal-controlled programmable microinjector pump (UMP3, UltraMicroPump, World Precision Instruments, Sarasota, Florida, USA) injected the viral suspension into the subretinal space over 20 seconds. After injection, the needle was held in place for at least 20 seconds. Post-injection fundus and OCT examinations were performed to visualize the injection site and ensure that the AAV carrier was injected into the subretinal space. 3.5% Akten ophthalmic gel (lidocaine hydrochloride ophthalmic gel, Akron Pharmaceuticals, Lake Forest, Illinois) was administered to the cornea as a local anesthetic. A small amount of neomycin / polymyxin B / dexamethasone ophthalmic ointment (Alcon Laboratories Inc., Fort Worth, TD, USA) was applied to the eye, and the animal was then placed in a 37ºC incubator to recover from anesthesia. For intravitreal injection, mice were anesthetized and the eye was dilated as described above. Using a 35G beveled-tip needle (World Precision Instruments, Sarasota, FL, USA) attached to a 10-μL Nanofil syringe inserted through a SilFlex tube, 1 μL of AAV suspension was injected into the vitreous body through the sclera 1 mm from the rim. OCT was performed immediately to examine for any retinal damage following injection. A small amount of Akten and triple antibiotic ophthalmic ointment was applied to the eye, and the eye was then placed at 37ºC. Quantification of rAAV transduction in mouse retinal lesions.

[0183] Following euthanasia, the eyes were collected, immediately frozen on dry ice, and stored at -80ºC for future dissection. All dissection steps were performed under a dissecting microscope using a cold instrument, while the eyes remained frozen during the dissection. The anterior segment was removed using a razor, and excess tissue was removed from the posterior segment of the eye if necessary, followed by the removal of the lens. Retinal lysates were generated by placing frozen vitreous fluid, retina, and eye cup in 200 µl of cell lysis buffer from an EGFP ELISA kit and homogenizing at 4ºC (Fisher Bead Mill). EGFP protein was quantified using an EGFP ELISA kit (Abcam catalog number ab171581). Total protein levels were quantified using a BCA protein detection kit (Pierce). eGFP levels were normalized to total protein. Genomic titer was determined using qRT-PCR (7500 instant PCR system; Applied Biosystems) with TaqMan Universal Master Mix (Thermo Fisher) primers specific for polyadenylation signals. Vector levels were expressed as genome / µg protein. NHP retinal explants

[0184] All animal procedures were performed in accordance with the Animal Welfare Act, the Guide for the Care and Use of Laboratory Animals, the Office of Laboratory Animal Welfare, and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Fresh monkey eyes without known eye diseases were obtained from Biomere (Biomere, Worcester, Massachusetts), and were removed 15 minutes after animal euthanasia. The eyes were placed in neurobasal culture medium and immediately transported on ice. Under aseptic conditions, all extraocular connective tissue was removed, and the eyes were disinfected with 70% ethanol and then washed with PBS. Before starting the experiment, the six-well transwell culture plates were filled with 2 ml of complete neural basal medium (Thermo Fisher Scientific, Waltham, MIT; catalog 21103049, supplemented with 1% N-2 supplement (Thermo Fisher Scientific; catalog 17502048), 2% B-27 supplement (Thermo Fisher Scientific; catalog 17504044), 1% GlutaMAX supplement (Thermo Fisher Scientific; catalog 35050-061), 0.2 μg / mL recombinant human β-NGF (R&D Systems, Minneapolis, MIT; catalog 256-GF-100), and 0.4 μg / mL recombinant human EGF (R&D Systems; catalog 236-EG-200)) and 0.5 ml of transwell inserts in a humidified cell culture incubator at 37ºC and 5% 5% 4000 ml ... Pre-cultured in CO2. An incision was made approximately 5 mm below the optic nerve margin using an 18G needle. Using this incision as the entry point for scissors, the anterior portion of the eye, cornea, lens, and vitreous body were removed from each eye, leaving the posterior eyecup consisting of an intact neuroretina, choroid, and sclera. Next, a three-flap was created to open the eyecup by making three cuts towards the optic nerve head. While the entire eyecup was immersed in complete neurobasal culture medium, the equatorial, full-thickness posterior segment of the explant was cut using an 8 mm biopsy puncturist.The retina was then dissected as follows: a piece of dry, sterile filter paper was gently applied to the ganglion cell layer, the neuroretina was lifted, and the filter paper with the attached retina was placed on the culture insert with the photoreceptor cells facing down. The filter paper was then gently removed with fine forceps. After 24 hours, the culture medium was replaced with fresh, complete neural medium, and half of the AAV was injected directly under each retinal explant to generate vesicles similar to those formed in vivo during therapeutic subretinal injection. The other half of the virus was added to the culture medium, which was then placed under the transwell insert. Finally, the explants were cultured at 37ºC and 5% CO2. Each explant used a dose of AAV vector of 1.8 x 10¹¹ total genome copies. The culture medium was changed every other day, and the medium was maintained for 6 days after transduction. After 7 days of culture, the retinal explants were rinsed in 1X phosphate-buffered saline (PBS) and fixed in 4% paraformaldehyde (PFA) for 3 h. Explants were washed three times with PBS to remove residual PFA and cryoprotected in graded sucrose at 10%–30% concentrations, followed by freezing in compounds at -80°C for optimal cutting temperature. 13 μm thick sections were cut using a cryostat (Cryostar NX70 Cryostat, Thermo Fisher Scientific, Waltham, Massachusetts) and mounted with vector shield DAPI (Vector Lab, Peterborough, UK). Native EGFP expression was observed, and images were captured using an inverted fluorescence microscope (Axio Observer Z1; Carl Zeiss, Inc., Oberkochen, Germany) with appropriate excitation and detection settings. Example 2 – Translational fidelity of AAV2HBKO in NHP retina.

[0185] The transduction activity of a novel AAV2 capsid variant in the mouse retina has been previously reported (Sullivan et al., 2018). The AAV2 variant possesses mutations in the amino acids R585A and R588A required for binding to its receptor (heparin sulfate proteoglycan) to produce a variant called AAV2-HBKO. Compared to parental AAV2, the AAV2-HBKO vector showed low transduction activity upon intravitreal delivery to the mouse eye; however, upon subretinal delivery, AAV2-HBKO resulted in significantly greater photoreceptor transduction. Unbound by any theory, the AAV transduction profile in mice does not always predict transduction potential in NHP; therefore, the performance of AAV2HBKO in the NHP retina was evaluated to determine whether this novel variant demonstrates a similar improvement in retinal transduction in this species. The goal of the study was to compare the performance of enhanced green fluorescent protein (eGFP) in photoreceptor cells from the AAV5 and AAV2HBKO vectors when administered as a single dose via subretinal injection to male cynomolgus monkeys. Male cynomolgus macaques (Macaca fascicularis) were divided into two groups and administered AAV5-eGFP or AAV2-HBKO-eGFP at a dose of 1 x 10¹² vg / eye, as described in Table 2. A series of optimized assays were used to analyze the vector formulation to confirm its quality. Table 2: List of injected NHP and AAV doses Group male number Eyes 5 deal with Dosage level (vg / eye) a Dosage concentration (vg / mL) b 1 2 OU AAV5-eGFP 1.2 x 10 11 1.0 x 10 12 2 2 OU AAV2 HBKO-eGFP 1.2 x 10 11 1.0 x 10 12 In Table 2, OU represents injection into both eyes; a) administration to both eyes of each animal. Administer to the animal at a volume of 120 µL per eye; b) dosage concentration based on the test material supplied.

[0186] Six weeks after vector administration, animals were euthanized and their eyes were processed for tissue sectioning. Sections passing through the fovea were selected for analysis (Fig. 1A). Evaluation of eGFP expression in photoreceptor cells was conducted by FA (fundus autofluorescence) and IHC following administration of AAV5-eGFP or AAV2-HBKO-eGFP. Both vectors contain a human rhodopsin promoter that drives eGFP expression. Animals were euthanized approximately six weeks after vector administration, and their eyes were processed for paraffin embedding and tissue sectioning. Slides were stained for immunofluorescence detection of eGFP (Fig. 1B), and images were collected sequentially from one edge to the other in the subretinal vesicles. The expression of the eGFP gene transfected appeared to be uniform throughout the subretinal vesicles. Unbound by any theory, reduced gene transfected expression was observed in regions with fewer rod photoreceptor cells (adjacent to and within the fovea), confirming the fidelity in limiting expression to the human rhodopsin promoter in rod photoreceptor cells. Previously, AAV5 transduction of cone photoreceptor cells was shown when gene transfection was controlled by a ubiquitous promoter. Quantitative analysis of the percentage of photoreceptor transduction in the subretinal vesicle region revealed that AAV5 and AAV2-HBKO demonstrated equivalent photoreceptor transduction activity in the NHP retina (mean 61% of photoreceptors were transduced by both AAV5 and AAV2-HBKO), Table 3. Table 3: Percentage of photoreceptors transduced in the subretinal vesicle region. Group Processing (vg / eye) Animal ID GFP-positive PR (PR% in subvesicular transduction) OD GFP-positive PR (PR% in subvesicular transduction) OS 1 AAV5: 1.2 x 10 11 P0001 41.7 50.1 P0002 77.1 76.1 2 AAV2 HBKO: 1.2 x 10 11 P0101 59.8 59.1 P0102 50.9 75.9 In Table 3, PR represents photoreceptor cells; OD represents the right eye; and OS represents the left eye.

[0187] In addition, eGFP performance was monitored using sdOCT with spontaneous fluorescence imaging capability, and eGFP was observed two and four weeks after vector administration. In eyes treated with AAV5eGFP, the intensity of the eGFP signal increased over time and was confined to the retina, within the edge of the subretinal vesicle (Fig. 2A). In eyes treated with AAV2-HBKOeGFP, the eGFP performance extended far beyond the edge of the subretinal vesicle (Fig. 2B). Separate slides were co-stained with anti-eGFP and anti-rhodopsin antibodies for immunohistochemical detection of eGFP and rhodopsin to confirm transduction only in rod photoreceptor cells. Fig. 3 shows a histological investigation of the subretinal vesicle. Unbound by any theory, immunohistochemistry for rhodopsin (red) and eGFP (brown) in paraffin-embedded tissue revealed that the transduction of the AAV5 vector did not appear to diffuse from the edge of the subretinal vesicle; the transition at the edge was abrupt (Fig. 3A). Transduction spread from AAV2HBKO-eGFP vesicles and gradually narrowed in areas not lifted during injection (Fig. 3B). Co-localization of eGFP and rhodopsin indicated that the transduced cells were rod photoreceptor cells. The overall architecture of the retina was preserved, although RPE was altered, including hypertrophy, pigment translocation, and cell translocation. Example 3 - Evaluation of the transduction potential of the AAV5 arginine variant in the retina

[0188] The AAV2HBKO variant revealed the importance of arginine (and by extending surface charge) for transduction activity in the retina. The effect of adding surface arginine was further investigated using another capsid AAV5, a serotype with high affinity for photoreceptor cells when delivered subretinal. AAV5 variants AAV5G474R, AAV5N564R, and AAV5N573R were generated, and their tropism in the mouse retina after intravitreal and subretinal delivery was evaluated. The surface maps of AAV2 were compared with those of AAV5, and this helped guide the selection of amino acids to mutate in the AAV5 capsid to generate arginine-rich AAV5 variants. AAV5 variants were generated at yields of 1 / 2 to 1 / 3 of those achieved with parental AAV5, but the variants retained the same capsid protein ratios as parental AAV5. First, subretinal delivery of the AAV5 arginine variant was evaluated in the retina of wild-type mice, and its transduction activity was compared with that of the parental AAV5 capsid. Figure 4A shows the performance of AAV5, AAV5G474R, AAV5N564R, and AAV5N573R after subretinal delivery of 1 x 10⁹ vg of each vector with the same CBA-eGFP expression cassette. There was no significant difference in the ability of the AAV5 arginine variant to transduce the retina compared to parental AAV5, and analysis of native eGFP fluorescence revealed that the AAV5G474R, AAV5N564R, and AAV5N573R variants transduced ONL and RPE cells at the same level as parental AAV5-eGFP (Figure 4A). Furthermore, the AAV5 arginine variant was further evaluated after intravitreal delivery to the mouse retina at the same vector dose of 1 x 10⁹ vg / eye. EGFP fluorescence analysis of the transduced retina (Fig. 4B) confirmed that all AAV5 arginine variants, AAV5G474R, AAV5N564R, and AAV5N573R, acquired novel tropism towards corneal endothelial cells. Parental AAV5 showed no transduction activity upon intravitreal delivery (Fig. 4B). AAV5 variants demonstrated no transduction in the outer retina (including photoreceptor cells and RPE) after intravitreal delivery, and very low eGFP expression levels were observed in INL and Miller cells. Example 4 - Exploring the role of acetylation in AAV transduction

[0189] AAV2HBKO and AAV5 arginine variants were generated using a rational design approach, respectively, based on knowledge of receptor binding and surface charge. Further variants were generated using knowledge derived from LC / MS analysis of the AAV capsid, which identified a novel post-translational modification, the PTM (Jin et al., 2017). N-terminal acetylation of the VP1 and VP3 capsid proteins has been previously reported (Jin et al., 2017). To further investigate this property, a series of AAV5 acetylation variants were generated to elucidate the role of the PTM in AAV5 biology in the retina. Mutations introduced into the AAV5 capsid sequence are described in Table 4; these include changes to amino acids following the initiation methionine from those with a high acetylation frequency (alanine or serine) to those with a low acetylation frequency (glycine or proline). These changes were performed on the AAV5 VP1 and VP3 capsid proteins, respectively. Combined changes were also performed on both AAV capsid proteins. The AAV capsid protein VP2 showed no evidence of acetylation in previous studies (Jin et al. 2017), therefore the VP2 sequence remained unchanged from the parental sequence. The acetylation status of the AAV5 deacetylated variant was confirmed by LC / MS analysis, and the results are shown in Table 4. Table 4: LC / MS of the AAV5 deacetylated variant. swimming lane AAV5 mutant Yield (vg / mL) theory experiment ΔQuality (VP1) theory experiment ΔQuality (VP2) theory experiment ΔQuality (VP3) Note 1 S2G 1.40E+13 80234 nd 65283 65293 10 59463 59472 9 VP1 is undetectable 2 S2P 1.10E+13 80314 80313 1 65283 65291 8 59463 59470 7 Confirmed 3 S194G 1.00E+13 80234 nd 65253 65261 8 59391 59398 7 Confirmed 4 S194P 1.90E+13 80336 80346 10 65293 65292 1 59431 59430 1 Confirmed 5 S2G / S194G 6.00E+12 80234 80243 9 65253 65261 8 59391 59398 7 Confirmed 6 S2P / S194P 1.00E+13 80314 80324 10 65293 65300 7 59431 59438 7 Confirmed Table 4 shows the LC / MS analysis to confirm the quality of VP1, VP2, and VP3 in the AAV5 acetylated mutant (VP1 in AAV5S2G and AAV5S194G was not detected by mass spectrometry due to incomplete chromatographic separation of the capsid protein); nd indicates undetectable. Lanes correspond to those indicated in Figure 5.

[0190] Regardless of amino acid alterations (i.e., glycine or proline), all AAV5 deacetylated mutants were confirmed to have reduced acetylation. LC / MS analysis confirmed the correct molecular weight of each AAV5 capsid protein mutant. No acetylation was observed in the S to P mutants, while 10% acetylation was observed in the S to G mutants. Acetylated mutants showed equivalent packaging efficiency compared to wild-type AAV5, indicating that the novel amino acid changes did not adversely affect AAV vector production or capsid protein ratio (Figure 5).

[0191] After subretinal injection into mice, the transduction efficiency of AAV5 acetylation variants was compared in vivo with wild-type AAV5. Wild-type mice were injected with 1 x 10⁹ vg of AAV5-CBA eGFP or each of the AAV5 acetylation mutants with the same CBA-eGFP expression cassette. As previously shown (Fig. 4A), subretinal injection of AAV5-eGFP resulted in robust eGFP expression in the outer retina (Fig. 6A). The acetylation mutants AAV5S2G, AAV5S2P, AAV5S194P, AAV5S2G / S194G, and AAV5S2P / S194P showed reduced levels of eGFP expression in the retina, as demonstrated by eGFP fluorescence in the injected retina (Fig. 6A) and EGFP protein levels (ELISA) (Fig. 6B). Compared to the parental AAV5-eGFP, the acetylated mutant AAV5S194G-eGFP showed a significant increase in eGFP expression in photoreceptor cells (Figs. 6A and 6B). This was confirmed at the protein level by eGFP ELISA and eGFP fluorescence transduced in the retina. The findings of vector genome copy number / ug retinal protein revealed that the increased retinal transduction was not a function of increased uptake of the AAV5S194G-eGFP vector into retinal cells; the vector genome copy number / ug retinal protein of the acetylated mutant tended to be lower than that of the parental AAV5 eGFP vector in the treated retina (Fig. 6C).

[0192] The transduction properties of the acetylated mutants AAV5-S194G-eGFP and AAV5-S194P-eGFP were further evaluated in a dose-response study, and their performance was compared with that of AAV5-eGFP. Wild-type mice were subretinally administered escalating doses of AAV5-S194G-eGFP, AAV5-S194P-eGFP, or AAV5-eGFP at dose levels ranging from 1 x 10⁸ to 1 x 10⁹ vg. At the 1 x 10⁹ vg dose level, the AAV5 vector showed robust photoreceptor transduction. As seen in previous results, the acetylated mutant AAV5S194P showed significantly reduced performance compared to AAV5, while the AAV5-S194G variant showed a significant increase in photoreceptor transduction (Figure 7A). At lower vector doses (5 x 10⁸ and 1 x 10⁸ vg), eGFP expression was significantly increased in retinas treated with the AAV5-eGFP vector, while retinas transduced with AAV5-S194G-eGFP showed robust eGFP expression in photoreceptor cells, even at doses as low as 1 x 10⁸ vg. AAV5S194P-eGFP showed little photoreceptor transduction at all evaluated doses (Fig. 7A). At all evaluated doses, higher levels of eGFP protein were confirmed in retinas treated with AAV5S194G-eGFP compared to AAV5-eGFP, with the difference being more significant at lower doses. Without being bound by any theory, this could be due to saturation of eGFP expression at higher vector doses (Fig. 7B). Analysis of vector genome copy number / ug retinal tissue revealed dose-response for all evaluated vectors; retinas transduced with the AAV5-eGFP vector had similar vector genome copy number / ug retinal protein levels to those treated with the AAV5S194G-eGFP or AAV5S194P-eGFP acetylated variants (Figure 7C). Unbound by any theory, retinal transduction was significantly improved compared to parental AAV5 when VP1 N-terminal acetylation was retained and VP3 N-terminal acetylation was reduced. Example 5 - Evaluation of the role of deacetylation in AAV2 transduction in the retina.

[0193] Analysis of the quality properties of AAV vectors produced using the production cell line platform (including post-translational modifications of the AAV capsid protein) revealed several observations. Specifically, the production process of the cell line in the context of the AAV2 vector produced an AAV vector formulation that, consistent with similar AAV2 vectors produced via a triple transfection production platform, had a protein running below VP1 (Figure 8B). LC / MS revealed that the protein was a truncated form of the VP1 protein (tVP1) lacking the first 34 amino acids, of which acetylated A35 was confirmed to be the N-terminal amino acid. Without being bound by any theory, it is possible that tVP1 is the result of deacetylation of the adjacent aspartic acid N57, leading to proteolytic cleavage of VP1 at acetylated A35 to produce tVP1 (Figure 8A). LC / MS analysis confirmed that N57 had a higher deamination status (18.4%) in the AAV2 PCL-derived vector, compared to 6.7% in comparable AAV2 vectors generated via triple transfection (Table 5). Table 5: Percentage of deamination in AAV2 determined by LC-MS AAV2 Production Platform External efficacy Deamination % at 3 different N(G) sites N57 N511 N717 TTx 146 6.7 39.6 27.4 PCL 340 18.4 42.3 28 In Table 5, TTx represents the triple transfection production platform; PCL represents the production cell line production platform.

[0194] No significant differences were measured in deamination at other potential NG deamination sites (including N511 or N717) in the AAV2 capsid sequence. The infectivity of the AAV2 PCL vector tended to be low in analytical in vitro assays (Table 5), therefore deamination mutants were generated to further investigate the role of deamination in AAV2 infectivity in the retina. For this purpose, the N57 deamination site was mutated to aspartic acid N57D to produce a capsid that was fully deamination-treated. Additionally, the variant G58D was generated to control the role of introducing aspartic acid into this region of the AAV2 capsid sequence. AAV2N57D-eGFP and AAV2G58D-eGFP variants were generated and produced using a triple transfection production method, where the variants exhibited similar packaging efficiency and capsid proteomic profiles to the parental AAV2 capsid (Figure 8C and Table 6). LC / MS analysis of the deamination variants confirmed that at the N57 site, AAV2G58D-eGFP was 1.1% deamination (converted to aspartic acid), wild-type AAV2-eGFP was 5.7% deamination, while AAV2N57D-eGFP was 100% mutated to aspartic acid (Table 6). Table 6: Quantification of vector yield by qPCR AAV2 N57D G58D Deamination% 5.7 100 1.1 Yield (vg / mL) 8.7 x 10 12 5.46 x 10 12 3.6 x 10 12

[0195] Next, the deamination variant was evaluated in vivo to assess the effect of this post-translational modification on AAV2 transduction activity. In vivo delivery of the AAV2 eGFP vector to wild-type mice resulted in significant transduction of retinal ganglion cells. Similar results were observed in the case of the AAV2G58D-eGFP variant. In vivo delivery of AAV2N57D-eGFP resulted in poor retinal transduction, as measured by EGFP fluorescence (Fig. 9C) or ELISA (Fig. 9A). Reduced gene transfection performance measured in the case of the AAV2N57D-eGFP variant was associated with reduced cell entry; retinal tissue transduced with the AAV2N57D-eGFP variant tended to be lower than that measured with unmodified AAV2eGFP or AAV2G58DeGFP, Fig. 9B. Example 6 - Evaluation of AAV2 and AAV5 capsid variants in NHP retinal explants

[0196] The use of ex vivo NHP organoid explant systems was evaluated to test the transduction efficiency and tropism of novel variants and to assess the transductive fidelity of AAV variants across species. Retinal explants from NHP were constructed, and the transduction efficiency of the deacetylated variants AAV5S194G and AAV5S194P was evaluated. Seven days after plating, the cultured retinas retained their normal architecture, including intact rod and cone photoreceptor segments (intact ONLs) and external-to-internal retinal ligaments (Fig. 10A). The transduction efficiency of AAV5 and the AAV5 deacetylated variant in the retinal explants mimicked that observed in mouse retinas (Fig. 6A), and for unmodified AAV5, it mimicked the transduction activity still seen in NHP retinas (Fig. 3A). The results observed in the mouse retina (Fig. 7) confirmed that the AAV5S194G variant exhibited superior transduction efficiency in ONL compared to the parental AAV5 vector (Fig. 10A and Fig. 10B). The AAV5S194P variant revealed reduced transduction efficiency in NHP retinal explants compared to parental AAV5, similar to its performance in mouse studies (Fig. 7 and Fig. 8). The performance of the AAV5-eGFP parental vector confirmed the authenticity of the organoid culture, demonstrating robust ONL transduction (Fig. 10C and Fig. 10E), similar to the transduction performance seen when the AAV5-eGFP vector was delivered subretinally to the NHP retina (Fig. 3A). Evaluation of the deacetylated mutant in the NHP retinal explant model revealed additional benefits of the AAV5S194G variant compared to unmodified AAV5: this capsid variant selectively transduces photoreceptor cells, and minimal transduction was observed in the retinal ganglion cell layer (Fig. 10A and Fig. 10B). [Simplified Explanation of the Diagram]

[0199] The foregoing and other features and advantages of the invention will be more fully understood from the following detailed description of illustrative embodiments in conjunction with the accompanying drawings.

[0200] Figures 1A-1B depict AAV2-HBKO-mediated GFP expression in the NHP retina 6 weeks after subretinal injection. Figure 1A shows a schematic diagram of the sections collected for GFP expression. The blue lines represent the areas of sections analyzed for native GFP expression (before, during, and after the fovea). Only sections passing through the fovea and vesicles were analyzed. Figure 1B shows an image of the photoreceptor layer at the boundary of subretinal vesicles transduced with AAV5 hOPS-eGFP. Note the comparison between non-transduced cells on the left and transduced cells on the right. ONL: outer nuclear layer, OPL: outer plexiform layer.

[0201] Figures 2A-2B depict AAV-mediated GFP expression in NHP eyes via fundus spontaneous fluorescence (FAF). FAF shows GFP fluorescence in vesicle regions (circled) treated with AAV5 hOPS-eGFP (Figure 2A) or AAV2-HBKO-hOPS-eGFP (Figure 2B). An increase in GFP expression was observed 4 weeks after AAV treatment (Figures 2A and 2B). The AAV2-HBKO-eGFP vector diffused beyond the edge of the subretinal vesicles, while the AAV5 vector remained within the edge of the subretinal vesicles (Figures 2A and 2B).

[0202] Figures 3A-3B depict subretinal injection in NHP, showing that AAV2-HBKO has superior transduction capacity to AAV5 in the retina. The relative transduction efficiencies of AAV5 and AAV2-HBKO in rod photoreceptor cells were compared after subretinal injection. Paraffin-embedded retinal sections were immunolabeled with anti-GFP and anti-rhodopsin antibodies to detect eGFP (brown) and rhodopsin (red). Immunohistochemical analysis around the vesicle region showed that the transduction of the AAV5 vector did not appear to diffuse from the edge of the subretinal vesicle, with an abrupt transition at the edge (Figure 3A). AAV2HBKO-eGFP was highly efficient in transducing photoreceptor cells and showed the ability to diffuse from the vesicle and gradually shrink in areas not lifted during injection (Figure 3B). AAV transduction was confined to rod photoreceptor cells. ONL - outer nuclear layer, INL - inner nuclear layer, RGL - retinal ganglion cell layer.

[0203] Figures 4A-4B depict a comparison of retinal and corneal transduction efficiencies between AAV5 and the AAV5 arginine variant. Figure 4A shows subretinal injection of similar doses of AAV5, AAV5G474R, AAV5N564R, and AAV5N573R into wild-type mice. AAV-mediated native GFP expression in frozen sections was analyzed under a fluorescence microscope. Subretinal injection showed similar transduction efficiencies between AAV5 and the AAV5 arginine variant. Figure 4B shows the transduction efficiencies of AAV5 and the AAV5 arginine variant in the mouse cornea. AAV was delivered via intravitreal injection and analyzed 4 weeks post-transduction. Histological sections showed strong GFP expression in corneal endothelial cells following transduction of the AAV5 arginine variant. Almost undetectable GFP was observed in AAV5 transduction. ONL - outer nuclear layer, INL - inner nuclear layer, RGL - retinal ganglion cell layer.

[0204] Figure 5 depicts the capsid protein performance and vector yield of the AAV5 acetylated mutant while maintaining wild-type levels. Figure 5 shows the SDS-PAGE gel analysis of the genome of the 1x10¹⁰ AAV5 acetylated capsid mutant vector, followed by SYPRO red staining; lanes 1-6 represent AAV5 S2G, S2P, S194G, S194P, S2G / S194G (co-purified with empty particles), and S2P / S194P; VP1, VP2, and VP3 AAV capsid proteins are labeled. Lane 5 shows the co-purification of empty AAV particles.

[0205] Figures 6A-6C depict the effect of AAV5 deacetylation on photoreceptor transduction. Figure 6A shows a comparison of photoreceptor transduction efficiency between AAV5 and AAV5 acetylated variants (AAV5S2G, AAV5S194G, AAV5S2G / S194G, AAV5S2P, AAV5S194P, and AAV5S2P / S194P). Wild-type mice were injected with identical copies of AAV5 and AAV5 acetylated variants, and eyes were collected 4 weeks post-injection for cryosectioning. Fluorescence microscopy analysis showed strong eGFP expression in the ONL of the retina injected with AAV5S194G compared to its parental AAV5 and other variants. ONL: outer nuclear layer, INL: inner nuclear layer, RGL: retinal ganglion cell layer. Figure 6B shows GFP quantification by ELISA of retinas from C57BL / 6 mice 4 weeks after subretinal injection of AAV5 encoding EGFP and AAV5 acetylated variant vectors. Figure 6C shows qPCR analysis of AAV genome copies in transduced retinas after subretinal injection, and is represented as viral genome / ug protein.

[0206] Figures 7A-7C depict a comparison of dose-dependent GFP expression following subretinal delivery of the AAV5 deacetylated variant. Figure 7A shows representative fluorescence images of retinal cryosections at 4 weeks post-injection, illustrating a comparison of transduction in eyes injected with AAV5, AAV5 S194G, and AAV5 S194P at different doses (low 1 x 10⁸, medium 5 x 10⁸, and high 1 x 10⁹) (native GFP expression shown in green). Nuclei were stained with DAPI (blue). ONL: outer nuclear layer, INL: inner nuclear layer, RGL: retinal ganglion cell layer. Figure 7B shows GFP quantification by ELISA of the retinas from C57BL / 6 mice 4 weeks post-subretinal injection of AAV5 encoding EGFP and the AAV5 deacetylated variant vector. Figure 7C shows a qPCR analysis of AAV genome copies in the transduced retina after subretinal injection, and is represented as viral genome / ug protein.

[0207] Figures 8A-8C depict how variations in the deamination level within the PLA2 domain of AAV2 VP1 do not affect capsid protein performance or vector yield, but potentially influence efficacy. Figure 8A shows the protein sequence motif located within the N-terminus of VP1 in AAV2. A35 is the N-terminal amino acid of tVP1. 57NG58 is the classic deamination motif located within the PLA2 domain. Figure 8B shows the SDS-PAGE analysis of 1 x 10¹⁰ AAV2 vectors produced via triple transfection (TTx) or production cell line (PCL). Figure 8C shows the SDS-PAGE gel analysis of the genome of a 1 x 10¹⁰ AAV2 deamination capsid mutant vector, followed by SYPRO red staining.

[0208] Figures 9A-9C depict the effect of AAV2 capsid deamination on retinal transduction. Figure 9A shows GFP quantification by ELISA from the retinas of wild-type mice 4 weeks after intravitreal injection of AAV2 encoding EGFP and AAV2 deamination variants. Figure 9B shows qPCR analysis of AAV genome copies in the transduced retina after intravitreal injection, and is represented as viral genome / ug protein. Figure 9C shows fluorescence analysis, illustrating the native GFP expression patterns in wild-type mice after intravitreal injection of AAV2 and AAV2 deamination mutants. ONL: outer nuclear layer, INL: inner nuclear layer, RGL: retinal ganglion cell layer.

[0209] Figures 10A-10B depict a comparison of native GFP fluorescence in ex vivo NHP retinal tissue after in vitro exposure to AAV5 and AAV5 acetylated variants. Figure 10A shows neuroretinal tissue obtained from post-mortem NHP eyes. Biopsy perforation was performed, and the tissue was cultured on a membrane in 6-well plates and transduced with different AAV variants encoding GFP. Tissue was harvested 6 days after transduction and fixed and imaged to obtain native GFP expression. The efficacy of AAV serotypes was compared by analyzing transduction in each cell type in ONL, INL, and RGL. Figure 10B shows that the AAV5 variant AAV5S194G exhibited higher efficacy in photoreceptor transduction than native AAV5. GFP expression was mainly observed in ONL with AAV5 S194G, while GFP expression was observed in all layers (a and b) with AAV5. ONL: outer nuclear layer, INL: inner nuclear layer, RGL: retinal ganglion cell layer. [Sequence List]

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

Claims

1. A modified adeno-associated virus (AAV) capsid protein comprising amino acid substitutions at one or more positions corresponding to amino acids S194, G474, N564 and / or N573, wherein the positions are numbered based on the VP1 number of AAV5.

2. The modified capsid protein as claimed in claim 1, wherein the position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO:

1.

3. The modified capsid protein as claimed in claim 1 or 2, wherein the modified capsid protein is a modified capsid protein of an AAV serotype selected from the group consisting of: AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVB1, AAVAnc80, AAV7m8, AAVrh10, AAV2(Y444F), AAV2(Y444+500+730), AAV2(Y252+272+444+500+700+704+730F), AAV8(Y733F), and any variant thereof.

4. The modified capsid protein as claimed in claim 3, wherein the modified capsid protein is a modified capsid protein of AAV5.

5. The modified capsid protein as claimed in any one of claims 1 to 4, wherein the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO:

1.

6. The modified capsid protein as claimed in any one of claims 1 to 5, wherein the modified capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO:

1.

7. The modified capsid protein as claimed in any one of claims 1 to 6, wherein the modified capsid protein comprises an amino acid sequence having at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO:

1.

8. The modified capsid protein as claimed in any one of claims 1 to 3, wherein the amino acid corresponding to amino acid 194 in the capsid protein is G.

9. The modified capsid protein as claimed in claim 8, wherein the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 3, wherein the amino acid in the capsid protein corresponding to amino acid 194 of SEQ ID NO: 3 is G.

10. The modified capsid protein as claimed in any one of claims 1 to 3, wherein the amino acid corresponding to amino acid 474 in the capsid protein is R.

11. The modified capsid protein of claim 10, wherein the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 5, wherein the amino acid in the capsid protein corresponding to amino acid 474 of SEQ ID NO: 5 is R.

12. The modified capsid protein as claimed in any one of claims 1 to 3, wherein the amino acid corresponding to amino acid 564 in the capsid protein is R.

13. The modified capsid protein of claim 12, wherein the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 7, wherein the amino acid in the capsid protein corresponding to amino acid 564 of SEQ ID NO: 7 is R.

14. The modified capsid protein as claimed in any one of claims 1 to 3, wherein the amino acid corresponding to amino acid 573 in the capsid protein is R.

15. The modified capsid protein of claim 14, wherein the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 9, wherein the amino acid in the capsid protein corresponding to amino acid 573 of SEQ ID NO: 9 is R.

16. A modified adeno-associated virus (AAV) capsid protein comprising: a G at position corresponding to amino acid 194; an R at position corresponding to amino acid 474; an R at position corresponding to amino acid 564; and / or an R at position corresponding to amino acid 573, wherein the positions are numbered based on the VP1 number of AAV5.

17. A modified adeno-associated virus (AAV) capsid protein comprising a G at a position corresponding to amino acid 194, wherein the position is numbered based on the VP1 number of AAV5.

18. A modified adeno-associated virus (AAV) capsid protein comprising an R corresponding to position 474, wherein the position is numbered based on the VP1 number of AAV5.

19. A modified adeno-associated virus (AAV) capsid protein comprising an R corresponding to position 564 of amino acid 5, wherein the position is numbered based on the VP1 number of AAV5.

20. A modified adeno-associated virus (AAV) capsid protein comprising an R at a position corresponding to amino acid 573, wherein the position is numbered based on the VP1 number of AAV5.

21. A modified adeno-associated virus (AAV) capsid protein comprising the amino acid sequence shown in SEQ ID NO: 3, 5, 7 or 9.

22. An isolated nucleic acid encoding a capsid protein as described in any one of claims 1 to 21.

23. An isolated nucleic acid comprising the nucleotide sequence shown in SEQ ID NO: 4, 6, 8 or 10.

24. A vector comprising the nucleic acid as described in claim 22 or 23.

25. The vector as claimed in claim 24, wherein the vector is a plasmid or an auxiliary viral vector.

26. The vector as claimed in claim 25, wherein the auxiliary viral vector is a retroviral vector, a herpesvirus vector, a baculovirus vector, or an adenovirus vector.

27. The carrier as claimed in any one of claims 24 to 26, wherein the carrier is a presentation carrier.

28. A recombinant cell comprising a nucleic acid as described in claim 22 or 23 or a vector as described in any one of claims 24 to 27.

29. A method for producing AAV capsid protein, the method comprising culturing recombinant cells as described in claim 28 under conditions that express the nucleic acid and produce the capsid protein.

30. A recombinant adeno-associated virus (rAAV) particle comprising: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564 and / or 573, wherein the positions are numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing a heterologous nucleic acid.

31. The rAAV particle as claimed in claim 30, wherein the position numbering is based on the amino acid sequence of wild-type AAV5 VP1 as shown in SEQ ID NO:

1.

32. The rAAV particle as claimed in claim 30 or 31, wherein the modified capsid protein is a modified capsid protein of an AAV serotype selected from the group consisting of: AAV1, AAV2, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVB1, AAVAnc80, AAV7m8, AAVrh10, AAV2(Y444F), AAV2(Y444+500+730), AAV2(Y252+272+444+500+700+704+730F), AAV8(Y733F), and any variant thereof.

33. The rAAV particle as claimed in any one of claims 30 to 32, wherein the modified capsid protein is a modified capsid protein of AAV5.

34. The rAAV particle as claimed in any one of claims 30 to 33, wherein the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO:

1.

35. The rAAV particle as claimed in any one of claims 30 to 34, wherein the modified capsid protein comprises an amino acid sequence having at least 95% sequence identity with the amino acid sequence shown in SEQ ID NO:

1.

36. The rAAV particle as claimed in any one of claims 30 to 35, wherein the modified capsid protein comprises an amino acid sequence having at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO:

1.

37. The rAAV particle as claimed in any one of claims 30 to 32, wherein the amino acid corresponding to amino acid 194 in the capsid protein is G.

38. The rAAV particle as claimed in claim 37, wherein the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 3, wherein the amino acid in the capsid protein corresponding to amino acid 194 of SEQ ID NO: 3 is G.

39. The rAAV particle as claimed in any one of claims 30 to 32, wherein the amino acid corresponding to amino acid 474 in the capsid protein is R.

40. The rAAV particle as claimed in claim 39, wherein the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 5, wherein the amino acid in the capsid protein corresponding to amino acid 474 of SEQ ID NO: 5 is R.

41. The rAAV particle as claimed in any one of claims 30 to 32, wherein the amino acid corresponding to amino acid 564 in the capsid protein is R.

42. The rAAV particle as claimed in claim 41, wherein the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 7, wherein the amino acid in the capsid protein corresponding to amino acid 564 of SEQ ID NO: 7 is R.

43. The rAAV particle as claimed in any one of claims 30 to 32, wherein the amino acid corresponding to amino acid 573 in the capsid protein is R.

44. The rAAV particle as claimed in claim 43, wherein the modified capsid protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence shown in SEQ ID NO: 9, wherein the amino acid in the capsid protein corresponding to amino acid 573 of SEQ ID NO: 9 is R.

45. A recombinant adeno-associated virus (rAAV) particle comprising: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises: a G at position corresponding to amino acid 194, an R at position corresponding to amino acid 474, an R at position corresponding to amino acid 564 and / or an R at position corresponding to amino acid 573, wherein the position numbering is based on the VP1 number of AAV5; and (b) an rAAV vector containing a heterologous nucleic acid.

46. ​​A recombinant adeno-associated virus (rAAV) particle comprising: (a) an rAAV capsid containing a G at a position corresponding to amino acid 194, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing heterologous nucleic acid.

47. A recombinant adeno-associated virus (rAAV) particle comprising: (a) an rAAV capsid containing an R corresponding to position 474, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing heterologous nucleic acid.

48. A recombinant adeno-associated virus (rAAV) particle comprising: (a) an rAAV capsid containing an R corresponding to position 564 of amino acid 564, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing heterologous nucleic acid.

49. A recombinant adeno-associated virus (rAAV) particle comprising: (a) an rAAV capsid containing an R corresponding to position 573 of amino acid 573, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing heterologous nucleic acid.

50. The rAAV particle as claimed in any one of claims 30 to 49, wherein the heterologous nucleic acid encodes a therapeutic polypeptide or a therapeutic nucleic acid.

51. The rAAV particle of claim 50, wherein the heterologous nucleic acid encodes a polypeptide, the polypeptide being selected from antioxidants, enzymes, neurotrophic factors, anti-apoptotic factors, anti-angiogenic factors, and anti-inflammatory factors.

52. The rAAV particle as claimed in any one of claims 30 to 49, wherein the heterologous nucleic acid encodes a therapeutic nucleic acid.

53. The rAAV particle as claimed in claim 52, wherein the therapeutic nucleic acid is siRNA, shRNA, RNAi, miRNA, antisense RNA, ribozyme, or DNase.

54. The rAAV particle as claimed in any one of claims 30 to 53, wherein the heterologous nucleic acid is operatively linked to a constitutive promoter.

55. The rAAV particle as claimed in any one of claims 30 to 53, wherein the heterologous nucleic acid is operatively linked to a promoter suitable for expressing the therapeutic polypeptide or therapeutic nucleic acid in ocular tissue.

56. The rAAV particle as claimed in claim 55, wherein the ocular tissue is the retina, and the promoter is adapted to express the therapeutic polypeptide or therapeutic nucleic acid in retinal cells selected from the group consisting of: photoreceptor cells, retinal pigment epithelial cells, bipolar cells, horizontal cells, amacrine cells, Miller cells, ganglion cells, and any combination thereof.

57. The rAAV particles as claimed in claim 56, wherein the ocular tissue is the cornea, and the promoter is adapted to express the therapeutic polypeptide or therapeutic nucleic acid in corneal cells selected from the group consisting of epithelial cells, corneal stromal cells, endothelial cells, and any combination thereof.

58. The rAAV particle as claimed in any one of claims 30 to 57, wherein the AAV vector further comprises an inverted terminal repeat sequence (ITR).

59. The rAAV particle as claimed in any one of claims 30 to 58, wherein the rAAV carrier is a self-complementary rAAV carrier (scAAV).

60. The rAAV particle of claim 59, wherein the scAAV comprises a first nucleic acid encoding the heterologous nucleic acid and a second nucleic acid encoding a complementary sequence of the first nucleic acid, wherein the first nucleic acid may form an intra-chain base pair with the second nucleic acid along most or all of its length.

61. The rAAV particle of claim 60, wherein the first nucleic acid and the second nucleic acid are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and a mutation of the terminal unwinding sequence.

62. A pharmaceutical composition comprising rAAV particles as described in any one of claims 30 to 61.

63. A method for delivering a heterologous nucleic acid to ocular tissue of a subject in need, comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564 and / or 573, wherein the positions are numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing the heterologous nucleic acid.

64. A method for delivering a heterologous nucleic acid to the retina of a subject in need, comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein contains an amino acid substitution at a position corresponding to amino acid 194, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing the heterologous nucleic acid.

65. A method for delivering a heterologous nucleic acid to the cornea of ​​a subject in need, comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 474, 564 and / or 573, wherein the positions are numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing the heterologous nucleic acid.

66. A method for improving rAAV transduction in cells of ocular tissue of a subject in need, the method comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564 and / or 573, wherein the positions are numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing a heterologous nucleic acid.

67. A method for improving rAAV transduction in cells of the retina of a subject in need, the method comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein contains an amino acid substitution at a position corresponding to amino acid 194, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing a heterologous nucleic acid.

68. A method for improving rAAV transduction in corneal cells of a subject in need, the method comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 474, 564 and / or 573, wherein the positions are numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing a heterologous nucleic acid.

69. A method for improving the performance of a heterologous nucleic acid in ocular tissue of a subject in need, the method comprising administering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564 and / or 573, wherein the positions are numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing the heterologous nucleic acid.

70. A method for improving the performance of heterologous nucleic acids in the retina of a subject in need, the method comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein contains an amino acid substitution at a position corresponding to amino acid 194, wherein the position is numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing heterologous nucleic acids.

71. A method for improving the performance of a heterologous nucleic acid in the cornea of ​​a subject in need, the method comprising delivering a recombinant adeno-associated virus (rAAV) particle to the subject, wherein the rAAV particle comprises: (a) an rAAV capsid containing a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 474, 564 and / or 573, wherein the positions are numbered based on the VP1 number of AAV5; and (b) an rAAV vector containing the heterologous nucleic acid.

72. A method of treating an eye condition or impairment in a subject in need, the method comprising administering to the subject an effective amount of a composition comprising rAAV particles, wherein the rAAV particles comprise: (a) an rAAV capsid comprising a modified capsid protein, wherein the modified capsid protein comprises amino acid substitutions at one or more positions corresponding to amino acids 194, 474, 564 and / or 573, wherein the positions are numbered based on the VP1 number of AAV5; and (b) an rAAV vector comprising a heterologous nucleic acid.

73. The method of claim 72, wherein the composition is formulated for intravitreal administration.

74. The method of any one of claims 63 to 73, wherein the heteronucleotide exhibits an increased performance level compared to the performance level of the heteronucleotide comprising the wild-type rAAV capsid.

75. The method of any one of claims 63 to 74, wherein the administration includes intravitreal administration.