Methods for making flow cells

Abstract

In one example, the flow cell includes a substrate support and a protrusion located on the substrate support, wherein the material of the protrusion is different from that of the substrate support. The flow cell further includes a first functionalized layer on a first portion of the protrusion, a second functionalized layer on a second portion of the protrusion, and first and second sets of initiators respectively attached to the first and second functionalized layers.

Description

Technical Field

[0001] none Cross-reference of related applications

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 084,983, filed on September 29, 2020, the contents of which are incorporated herein by reference in their entirety. References to sequence lists

[0003] The sequence list submitted with this document via EFS-Web is incorporated herein by reference in its entirety. The file is named ILI197BTW_IP-2001-TW_Sequence_Listing_ST25.txt, is 544 bytes in size, and was created on September 23, 2021. Prior Technology

[0004] Some available platforms for nucleic acid sequencing utilize synthetic sequencing methods. These methods involve synthesizing new strands and optically and / or electronically detecting the addition of monomers (e.g., nucleotides) to the growing strand. Because the template strand guides the synthesis of the new strand, the sequence of the template DNA can be deduced from the sequence of nucleotide monomers added to the growing strand during synthesis. In some instances, sequential pairwise end sequencing can be used, where the forward strand is sequenced and removed, followed by the construction and sequencing of the reverse strand. In other instances, simultaneous pairwise end sequencing can be used, where both the forward and reverse strands are sequenced simultaneously. Summary of the Invention

[0005] The first state disclosed herein is a flow cell comprising a substrate support; a protrusion on the substrate support, the protrusion being made of a material different from the substrate support; a first functionalized layer on a first portion of the protrusion; a second functionalized layer on a second portion of the protrusion; and first and second initiator sets respectively attached to the first and second functionalized layers.

[0006] In one example of the first state, the flow cell further includes a hydrophobic layer located between the substrate support and the protrusion. In one example, the flow cell includes a plurality of protrusions; and each of the plurality of protrusions is spatially separated from another of the plurality of protrusions by a gap region of the hydrophobic layer. In one example, the gap region of the hydrophobic layer does not substantially contain the first and second functionalized layers and the first and second initiator sets.

[0007] In one example of the first state, the substrate support includes a substrate transparent to ultraviolet light; the protrusions include tantalum pentoxide; and the flow cell further includes a masking layer located between the substrate support and the protrusions. In one example, the flow cell includes a plurality of protrusions; and each of the plurality of protrusions is spatially separated from another of the plurality of protrusions by a gap region of the substrate support. In one example, the flow cell further includes a deactivated portion covering the gap region of the substrate support, the deactivated portion including a deactivated first functionalized layer or a deactivated first initiator set.

[0008] In one instance of the first state, the first primer set includes a non-splitable first primer and a splitable second primer; and the second primer set includes a splitable first primer and a non-splitable second primer.

[0009] It should be understood that any feature of the first state can be combined together in any desired manner and / or can be combined with any of the examples disclosed herein to achieve the benefits described in the invention, including, for example, flow pools for simultaneous paired end reads.

[0010] The second aspect disclosed herein is a method comprising: imprinting a multilayer stacked resin layer to form a multi-height protrusion region including a first region having a first height and a second region having a second height less than the first height, wherein the multilayer stack includes, from top to bottom, a resin layer, a sacrificial layer, a transparent layer and at least one additional layer; selectively etching a portion of the multilayer stack surrounding the multi-height protrusion region to expose the at least one additional layer; selectively etching the multi-height protrusion region to remove a portion of the resin layer and the sacrificial layer below the second region of the multi-height protrusion region, thereby forming a protrusion including at least a transparent layer and exposing a portion of the transparent layer; applying a first functionalized layer on the multilayer stack; peeling off the sacrificial layer and the first functionalized layer thereon, thereby exposing a second portion of the transparent layer; and applying a second functionalized layer on the second portion of the transparent layer.

[0011] One instance of the second state further includes attaching individual primer sets to the first and second functionalized layers.

[0012] In one example of the second state, at least one additional layer is a substrate support transparent to ultraviolet light; the multilayer stack further includes a masking layer located between the substrate support and the transparent layer; the application of the first functionalized layer covers the portion of the sacrificial layer and the transparent layer and the exposed portion of the substrate support; and the method further includes guiding ultraviolet light through the substrate support, wherein the masking layer blocks the ultraviolet light from reaching the transparent layer, and the substrate support transmits the ultraviolet light to portions of the first functionalized layer on the exposed portions of the substrate support, wherein the ultraviolet light deactivates the portions of the first functionalized layer or deactivates a first set of initiators at the portions of the first functionalized layer. In one example, the ultraviolet light deactivates the portions of the first functionalized layer, and the method further includes attaching individual sets of initiators to activated portions of the first and second functionalized layers.

[0013] In one example of the second state, at least one additional layer comprises a hydrophobic layer; the multilayer stack further includes a substrate support; and the application of the first functionalized layer covers that portion of the sacrificial layer and the transparent layer, but does not cover the exposed portion of the hydrophobic layer. In one example, the method further comprises attaching respective sets of primers to the first and second functionalized layers.

[0014] It should be understood that any feature of the second state sample can be combined in any desired manner. Furthermore, it should be understood that any combination of features of the first and / or second state samples can be used together, and / or combined with any of the examples disclosed herein to achieve the benefits described in this invention, including, for example, simplified methods for patterning various flow cell surfaces.

[0015] The third embodiment disclosed herein is a method comprising: applying a release material to a first portion of a recess defined in a substrate, wherein a second portion of the recess remains exposed; applying a blocking material to a gap region adjacent to the recess, wherein the blocking material is different from the release material; applying a first functionalized layer to the second portion of the recess; peeling off the release material, thereby exposing the first portion of the recess; applying a second functionalized layer to the first portion of the recess; and attaching respective sets of initiators to the first and second functionalized layers.

[0016] In one example of the third state, the application of the first functionalized layer involves activating the second portion of the recess to generate surface groups that react with the first functionalized layer; and depositing the first functionalized layer. In one example, the release material is peeled off after activating the second portion of the recess and before depositing the first functionalized layer. In another example, the release material is peeled off after activating the second portion of the recess and depositing the first functionalized layer.

[0017] In one example of the third state, the application of the second functionalized layer involves activating the first portion of the depression to generate surface groups that react with the second functionalized layer; and depositing the second functionalized layer.

[0018] In one example of the third state, the blocking layer comprises a second release material, and the method further comprises releasing the blocking layer. In one example, i) the release material comprises a metal sacrificial layer, and the second release material comprises a photoresist; or ii) the release material comprises a photoresist, and the second release material comprises a metal sacrificial layer.

[0019] In one instance of the third state, the blocking layer contains a hydrophobic material.

[0020] In one example of the third state, a blocking material is selectively applied to the gap region before the release material is applied; and before the release material is applied, the method further includes activating the recess to generate surface groups that react with each of the first and second functionalized layers.

[0021] In one example of the third state, the substrate includes a transparent layer located on a substrate support; and before applying a release material and a blocking material, the method further includes generating an insoluble photoresist in the recess; removing the transparent layer from the gap region adjacent to the recess when the insoluble photoresist is present; and removing the insoluble photoresist from the recess.

[0022] It should be understood that any feature of the third state sample can be combined in any desired manner. Furthermore, it should be understood that any combination of features of the first and / or second and / or third state samples can be used together, and / or combined with any of the examples disclosed herein to achieve the benefits described in this invention, including, for example, simplified methods for patterning various flow cell surfaces.

[0023] The fourth state disclosed herein is a method comprising: applying a silanized layer on a substrate including recesses separated by gap regions; filling the recesses with a sacrificial material; plasma etching the silanized layer in the gap regions; removing a portion of the sacrificial material from the recesses to expose a first portion of the silanized layer in the recesses; applying a first functionalized layer on the first portion of the silanized layer in the recesses; removing a second portion of the sacrificial material from the recesses to expose a second portion of the silanized layer in the recesses; applying a second functionalized layer on the second portion of the silanized layer in the recesses; and attaching respective sets of initiators to the first and second functionalized layers.

[0024] It should be understood that any feature of the fourth state sample can be combined in any desired manner. Furthermore, it should be understood that any combination of features of the first and / or second and / or third and / or fourth state samples can be used together, and / or combined with any of the examples disclosed herein to achieve the benefits described in this invention, including, for example, simplified methods for patterning various flow cell surfaces.

[0025] The fifth state disclosed herein is a method comprising: applying a protective substrate to a first portion of a recess defined in a substrate, wherein a second portion of the recess remains exposed; applying a release material to a gap region adjacent to the recess; applying a first functionalized layer to the second portion of the recess, wherein the protective substrate blocks the application of the first functionalized layer to the first portion of the recess; i) removing the protective substrate or ii) reversing the blocking state of the protective substrate; applying a second functionalized layer to the first portion of the recess; and attaching respective initiator sets to the first and second functionalized layers.

[0026] In one instance of the fifth state, removing the protecting group involves cleaving the protecting group.

[0027] In one instance of the fifth state, the reversal of the blocking state involves either an initial thiol-disulfide exchange or exposing the protecting group to water.

[0028] It should be understood that any feature of the fifth state sample can be combined in any desired manner. Furthermore, it should be understood that any combination of features of the first and / or second and / or third and / or fourth and / or fifth state samples can be used together, and / or combined with any of the examples disclosed herein to achieve the benefits described in this invention, including, for example, a simplified method for patterning various flow cell surfaces.

[0029] The sixth state disclosed herein is a method comprising: applying a photoresist to a substrate including a recessed region having a deeper portion and a shallower portion defined by a stepped portion; dry etching the photoresist to expose the surface of the stepped portion, wherein a portion of the photoresist remains in the deeper portion; applying a first functionalized layer to the substrate and the portion of the photoresist; removing the photoresist and the first functionalized layer thereon to expose the substrate at the deeper portion; applying a second functionalized layer to the substrate at the deeper portion; and attaching respective sets of leads to the first and second functionalized layers.

[0030] In one example of the sixth state, the substrate further includes a gap region adjacent to the recessed region; a first functionalized layer is applied to the gap region; and the method further includes removing the first functionalized layer from the gap region.

[0031] In one example of the sixth state, the method further includes etching a stepped portion before applying the first functionalized layer to define a recessed portion of photoresist adjacent to the deeper portion.

[0032] In one example of the sixth state, the substrate further includes a gap region adjacent to the recessed region; a first functionalized layer is applied to the gap region; and the method further includes polishing the first functionalized layer of the gap region.

[0033] In one example of the sixth state, the substrate comprises a multilayer stack including a resin layer and an underlying transparent substrate; and prior to applying the first functionalized layer, the method further comprises etching stepped portions to expose the surface of the transparent substrate and define recessed portions of photoresist adjacent to deeper portions. In one example, after etching, the resin layer includes a gap region adjacent to the photoresist and the recessed portions; the first functionalized layer is applied to the gap region; and the method further comprises polishing the first functionalized layer of the gap region.

[0034] It should be understood that any feature of the sixth state sample can be combined in any desired manner. Furthermore, it should be understood that any combination of features of the first and / or second and / or third and / or fourth and / or fifth and / or sixth state samples can be used together, and / or combined with any of the examples disclosed herein to achieve the benefits described in this invention, including, for example, a simplified method for patterning various flow cell surfaces.

[0035] The seventh state disclosed herein is a method comprising: activating the surface of a resin layer, the resin layer including a recessed region having a deeper portion and a shallower portion defined by a stepped portion, wherein the resin layer is disposed on a tantalum pentoxide substrate support, and wherein a transparent substrate support is exposed at the deeper portion; applying a first functionalized layer to the activated resin layer, wherein the transparent substrate support remains exposed at the deeper portion; applying a silanized layer to the transparent substrate support exposed at the deeper portion; applying a second functionalized layer to the silanized layer; and attaching respective initiator sets to the first and second functionalized layers.

[0036] In one example of the seventh state, the resin layer further includes a gap region adjacent to the recessed region; a first functionalized layer is applied to the gap region; and the method further includes polishing the first functionalized layer of the gap region.

[0037] In one example of the seventh state, prior to activating the resin layer, the method further includes: imprinting the resin layer to form a recessed area; and dry etching the resin layer to expose a transparent substrate support at a deeper portion.

[0038] It should be understood that any feature of the seventh state sample can be combined in any desired manner. Furthermore, it should be understood that any combination of features of the first and / or second and / or third and / or fourth and / or fifth and / or sixth and / or seventh state samples can be used together, and / or combined with any of the examples disclosed herein to achieve the benefits described in this invention, including, for example, a simplified method for patterning various flow cell surfaces.

[0039] The eighth state disclosed herein is a method comprising: introducing variable polymer beads into a deeper portion of a recessed region defined in a substrate, wherein the recessed region also includes a shallower portion defined by a stepped portion, and wherein the substrate includes a gap region adjacent to the recessed region; altering the variable polymer beads to at least partially fill the deeper portion; applying a first functionalized layer to the substrate and the altered polymer beads; removing the altered polymer beads and the first functionalized layer thereon, thereby exposing the substrate at the deeper portion; applying a second functionalized layer to the substrate at the deeper portion; and attaching respective sets of initiators to the first and second functionalized layers.

[0040] In one example of the eighth state, the substrate includes a resin layer, and the method further includes: imprinting the resin layer to form a recessed area including a deeper portion and a shallower portion.

[0041] One example of the eighth state further includes a first functionalized layer in the polishing gap region after the second functionalized layer is applied to the deeper portion.

[0042] In one example of the eighth state, the method further includes polishing a first functionalized layer in the gap region before applying a second functionalized layer to the deeper portion; applying a second functionalized layer to the gap region; and the method further includes polishing a second functionalized layer in the gap region.

[0043] In one instance of the eighth state sample, removing the modified polymer beads involves dissolving the modified polymer beads.

[0044] In one instance of the eighth state, changing the variable polymer beads involves expanding or annealing the variable polymer beads.

[0045] It should be understood that any feature of the eighth state sample can be combined in any desired manner. Furthermore, it should be understood that any combination of features of the first and / or second and / or third and / or fourth and / or fifth and / or sixth and / or seventh and / or eighth state samples can be used together, and / or combined with any of the examples disclosed herein to achieve the benefits described in this invention, including, for example, a simplified method for patterning various flow cell surfaces.

[0046] The ninth state disclosed herein is a method comprising: applying a first functionalized layer on a substrate including a recessed region and a gap region adjacent to the recessed region, the recessed region including a deeper portion and a shallower portion defined by a stepped portion; introducing variable polymer beads on the first functionalized layer in the deeper portion; modifying the variable polymer beads to at least partially fill the deeper portion; removing an exposed portion of the first functionalized layer, thereby exposing a portion of the substrate; applying a second functionalized layer on the substrate and the modified polymer beads; removing the modified polymer beads and the second functionalized layer thereon, thereby exposing the first functionalized layer in the deeper portion; and attaching respective sets of initiators to the first and second functionalized layers.

[0047] In one example of the ninth state, the substrate includes a resin layer, and the method further includes: imprinting the resin layer to form a recessed area including a deeper portion and a shallower portion.

[0048] One example of the ninth state further includes a second functionalized layer in the polishing gap region.

[0049] In one instance of the ninth state, removing the modified polymer beads involves dissolving the modified polymer beads.

[0050] In one example of the ninth state, changing the variable polymer beads involves expanding or annealing the variable polymer beads.

[0051] It should be understood that any feature of the ninth state sample can be combined in any desired manner. Furthermore, it should be understood that any combination of features of the first and / or second and / or third and / or fourth and / or fifth and / or sixth and / or seventh and / or eighth and / or ninth state samples can be used together, and / or combined with any of the examples disclosed herein to achieve the benefits described in this invention, including, for example, a simplified method for patterning various flow cell surfaces.

[0052] The tenth state disclosed herein is a method comprising: applying a sacrificial layer to a first portion of a recess defined in a substrate and a gap region adjacent to the recess, wherein a second portion of the recess remains exposed, wherein the sacrificial layer on the gap region has a first height, and wherein the sacrificial layer on the first portion of the recess has a second height less than the first height; applying a first functionalized layer to the second portion of the recess; reducing the thickness of the second height of the sacrificial layer, thereby exposing the first portion of the recess and leaving some of the sacrificial layer on the gap region; applying a second functionalized layer to the second portion of the recess; and removing the sacrificial layer from the gap region.

[0053] One example of the tenth state further includes attaching individual primer sets to the first and second functionalized layers.

[0054] In one example of the tenth state, reducing the thickness of the sacrificial layer involves timed wet etching.

[0055] It should be understood that any feature of the tenth state sample can be combined in any desired manner. Furthermore, it should be understood that any combination of features of the first and / or second and / or third and / or fourth and / or fifth and / or sixth and / or seventh and / or eighth and / or ninth and / or tenth state samples can be used together, and / or combined with any of the examples disclosed herein to achieve the benefits described in this invention, including, for example, a simplified method for patterning various flow cell surfaces.

[0056] The eleventh aspect disclosed herein is a method comprising: applying a sacrificial layer on a substrate, the substrate including a recessed region having a deeper portion and a shallower portion defined by a stepped portion; etching the sacrificial layer to expose the substrate at the deeper and shallower portions; applying a first functionalized layer on the remaining portion of the sacrificial layer and the exposed portion of the substrate; applying a photoresist on the first functionalized layer; dry etching the photoresist and the first functionalized layer to expose the substrate surface at the shallower portion and a portion of the sacrificial layer, wherein a portion of the photoresist and a portion of the first functionalized layer remain in the deeper portion; applying a second functionalized layer on the exposed portion of the substrate and the exposed portion of the sacrificial layer; and peeling off the remaining portion of the sacrificial layer and that portion of the photoresist.

[0057] One example of the eleventh state further includes attaching individual primer sets to the first and second functionalized layers.

[0058] One example of the eleventh state further includes a second functionalized layer in the gap region of the polished substrate.

[0059] It should be understood that any feature of the eleventh state sample can be combined in any desired manner. Furthermore, it should be understood that any combination of features of the first and / or second and / or third and / or fourth and / or fifth and / or sixth and / or seventh and / or eighth and / or ninth and / or tenth and / or eleventh state samples can be used together, and / or combined with any of the examples disclosed herein to achieve the benefits described in this invention, including, for example, a simplified method for patterning various flow cell surfaces.

[0060] The twelfth state disclosed herein is a method comprising: applying a sacrificial layer on a first portion of a recess defined in a substrate, wherein a second portion of the recess remains exposed; applying a first functionalized layer on a gap region adjacent to the recess, on the sacrificial layer, and on the second portion of the recess; applying a photoresist on the first functionalized layer; removing a portion of the photoresist and a portion of the first functionalized layer to expose the gap region and the sacrificial layer; removing the sacrificial layer thereby exposing the first portion of the recess; applying a second functionalized layer on the first portion of the recess; and peeling off the remaining portion of the photoresist.

[0061] One example of the twelfth state further includes attaching individual primer sets to the first and second functionalized layers.

[0062] One example of the twelfth state further includes a second functionalized layer in the gap region of the polished substrate.

[0063] It should be understood that any feature of the twelfth state sample can be combined in any desired manner. Furthermore, it should be understood that any combination of features of the first and / or second and / or third and / or fourth and / or fifth and / or sixth and / or seventh and / or eighth and / or ninth and / or tenth and / or eleventh and / or twelfth state samples can be used together, and / or combined with any of the examples disclosed herein to achieve the benefits described in this invention, including, for example, a simplified method for patterning various flow cell surfaces. Simple Explanation of the Diagram

[0064] The features of embodiments of the present invention will become apparent from the following embodiments and figures, in which similar reference numerals correspond to similar but perhaps different components. For the sake of brevity, reference numerals or features having the functions described above may or may not be described in conjunction with other figures showing such reference numerals or features.

[0065] [Figure 1A] is a top view of the example flow cell;

[0066] [Figures 1B to 1E] are enlarged partial cross-sectional views of different examples of flow channels in a flow cell;

[0067] [Figures 2A to 2D] are schematic diagrams of different examples of the first and second initiator groups used in the flow cell disclosed herein;

[0068] [Figures 3A to 3R] are schematic diagrams illustrating three examples of a method for generating the flow cell architecture shown in Figure 1B;

[0069] [Figures 4A to 4I] are schematic diagrams illustrating another example of a method for generating the flow cell architecture shown in Figure 1B;

[0070] [Figures 5A to 5C] are schematic diagrams illustrating the formation of a multilayer stack including a self-aligned photomask in one example.

[0071] [Figure 5D] is a top view of an example of the sacrificial layer of the self-aligned photomask in Figure 5C;

[0072] [Figure 5E] is a top view of another example of the sacrificial layer of the self-aligned photomask in Figure 5C;

[0073] [Figures 6A to 6L] are schematic diagrams illustrating two examples of a method for generating the flow cell architecture shown in Figure 1B;

[0074] [Figures 7A to 7C] are schematic diagrams illustrating the formation of another example of a multilayer stack including another example of a self-aligned photomask;

[0075] [Figure 7D] is a top view of an example of the sacrificial layer of the self-aligned photomask in Figure 7C;

[0076] [Figure 7E] is a top view of another example of the sacrificial layer of the self-aligned photomask in Figure 7C;

[0077] [Figures 8A to 8G] are schematic diagrams illustrating an example of a method for generating the flow cell architecture shown in Figure 1B;

[0078] [Figures 9A to 9M] are schematic diagrams illustrating two examples of a method for generating the flow cell architecture shown in Figure 1C;

[0079] [Figures 10A to 10J] are schematic diagrams illustrating two examples of a method for generating the flow cell architecture shown in Figure 1D;

[0080] [Figure 11] is a schematic diagram of a flow cell recess including a protective base that can be used to generate the flow cell architecture shown in Figure 1D;

[0081] [Figures 12A to 12E] are schematic diagrams illustrating another example of a method for generating the flow cell architecture shown in Figure 1D;

[0082] [Figures 13A to 13H] are schematic diagrams illustrating another example of a method for generating the flow cell architecture shown in Figure 1D;

[0083] [Figures 14A to 14I] are schematic diagrams illustrating another example of a method for generating the flow cell architecture shown in Figure 1D;

[0084] [Figures 15A to 15D] are schematic diagrams illustrating another example of a method for generating the flow cell architecture shown in Figure 1D;

[0085] [Figures 16A to 16F] are schematic diagrams illustrating another example of a method for generating the flow cell architecture shown in Figure 1E;

[0086] [Figures 17A to 17G] are schematic diagrams illustrating yet another example of a method for generating the flow cell architecture shown in Figure 1E;

[0087] [Figures 18A to 18M] are schematic diagrams illustrating two example methods for generating the flow pool architecture shown in Figure 1E;

[0088] [Figures 19A to 19C] are schematic diagrams illustrating the formation of a multilayer stack, including another example of a self-aligned photomask;

[0089] [Figure 19D] is a top view of one of the sacrificial layers of the self-aligned photomask in Figure 19C;

[0090] [Figure 19E] is a top view of the other sacrificial layer in the self-aligned photomask of Figure 19C;

[0091] [Figures 20A to 20M] are schematic diagrams illustrating two examples of methods for generating the flow cell architecture shown in Figure 1B or Figure 1D;

[0092] [Figures 21A to 21I] are schematic diagrams illustrating another example of a method for generating the flow cell architecture shown in Figure 1B;

[0093] [Figures 22A to 22G] are schematic diagrams illustrating another example method for generating the flow pool architecture shown in Figure 1E;

[0094] [Figures 23A to 23G] are schematic diagrams illustrating another example method for generating the flow pool architecture shown in Figure 1D;

[0095] [Figures 24A to 24L] are schematic diagrams illustrating two example methods for generating the flow pool architecture shown in Figure 1B;

[0096] [Figure 25] is a scanning electron microscope (SEM) image of an example of a glass substrate having a patterned aluminum sacrificial layer and insoluble photoresist pillars formed in the patterned regions;

[0097] [Figure 26A] shows scanning electron microscopy (SEM) images of examples of different layers patterned using different etching techniques;

[0098] [Figure 26B] is an example cross-sectional view of the layer in Figure 26A;

[0099] [Figure 27A] is a scanning electron microscopy (SEM) image of an example of a multilayer depression formed in a nanoimprint lithography resin, which has a gel material selectively applied to certain areas; and

[0100] [Figure 27B] is a fluorescence micrograph of an example of multi-layered depressions in Figure 27A that are reproduced in black and white, confirming that the gel material was selectively applied. Implementation

[0101] The flow cell examples disclosed herein can be used for sequencing, such as simultaneous pairwise terminal nucleic acid sequencing. These flow cells include different sets of primers attached to different regions of a patterned structure. In these examples, the primer sets can be controlled such that the cleavage (linearization) chemicals are orthogonal in different regions. Orthogonal cleavage chemistry can be achieved via the same cleavage site attached to different primers in different sets, or via different cleavage sites attached to different primers in different sets. This allows forward strand clusters to be generated in one region of the patterned structure and reverse strand clusters to be generated in another region of the patterned structure. In one example, these regions are directly adjacent to each other. In another example, any space between these regions is small enough that the clusters can span both regions. In some flow cell configurations disclosed herein, the forward and reverse strands are spatially separated, which separates the fluorescent signal from the two reads while allowing simultaneous base recognition of each read. Therefore, some examples of flow cells disclosed herein enable the acquisition of simultaneous pairwise terminal reads. Describe several instance methods for generating such flow pools.

[0102] [, definition , ]

[0103] It should be understood that, unless otherwise specified, the terms used herein will take their common meaning in the relevant field. Several terms used herein and their meanings are explained below.

[0104] Unless the context clearly indicates otherwise, the singular forms of “a”, “an” and “the” include plural indicators.

[0105] The terms comprising, including, containing, and various forms of these terms are synonymous with each other and mean equally broadly.

[0106] The terms top, bottom, lower, upper, and on are used herein to describe the flow cell and / or its components. It should be understood that these directional terms are not intended to suggest a particular orientation, but rather to indicate the relative orientation between components. The use of directional terms should not be construed as limiting the instances disclosed herein to any particular orientation.

[0107] The terms first, second, etc., do not imply a specific direction or order, but are used to distinguish one component from another.

[0108] "Acrylamide monomer" is a type of monomer with a specific structure. The monomer may be a monomer comprising an acrylamide group. Examples of monomers comprising an acrylamide group include azidoacetylammono ... and N-isopropylacrylamide: Other acrylamide monomers can be used.

[0109] As used herein, the term "activation" refers to the process of generating reactive groups on the surface of a substrate support or at the outermost layer of a multilayer structure. Activation can be achieved using silanization or plasma ashing. Although activation can be performed in any of the methods disclosed herein, some of the figures do not depict separated layers. In these cases, it should be understood that a silanized layer or -OH groups (from plasma ashing) are present to covalently attach the functionalized layer to the underlying support or layer. In other cases, a silanized layer is depicted.

[0110] As used herein, aldehydes are organic compounds containing a functional group with the structure -CHO, comprising a carbonyl center (i.e., a carbon double bonded to oxygen) and carbon atoms also bonded to hydrogen and an R group, such as an alkyl group or other side chain. The general structure of aldehydes is: .

[0111] As used herein, "alkyl" refers to a fully saturated (i.e., without double or triple bonds) straight or branched hydrocarbon chain. Alkyl groups can have 1 to 20 carbon atoms. Examples of alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, and the like. As an example, the term "C1-4 alkyl" indicates that the alkyl chain contains one to four carbon atoms; that is, the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, tert-butyl, and methyl butyl.

[0112] As used herein, "alkenyl" refers to a straight-chain or branched hydrocarbon chain containing one or more double bonds. Alkenyl groups can have 2 to 20 carbon atoms. Examples of alkenyl groups include vinyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0113] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more linkages. Alkynes can have 2 to 20 carbon atoms.

[0114] As used herein, "aryl" refers to an aromatic ring or ring system (i.e., two or more fused rings sharing two adjacent carbon atoms) containing only carbon in its ring backbone. When an aryl is a ring system, each ring in the system is an aromatic ring. Aryl groups can have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulel, and anthracene.

[0115] The "amine" functional group refers to the -NRaRb group, where Ra and Rb are each independently selected from hydrogen (e.g., ), C1-6 alkyl, C2-6 alkenyl, C2-6 ynyl, C3-7 carbocyclic, C6-10 aryl, 5 to 10 member heteroaryl and 5 to 10 member heterocyclic, as defined herein.

[0116] As used herein, the term "attached" refers to a state in which two things are directly or indirectly joined, fastened, adhered, connected, or bound together. For example, nucleic acids can be attached to functionalized polymers via covalent or non-covalent bonds. Covalent bonds are characterized by the sharing of electron pairs between atoms. Non-covalent bonds are physical bonds that do not involve the sharing of electron pairs and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0117] The "azide" or "azido" functional group refers to -N 3.

[0118] As used herein, a "bonding region" refers to a region of a patterned structure to which a material is bonded. This other material may be, for example, a separator, a cover plate, another patterned structure, or a combination thereof (e.g., a separator and a cover plate, or a separator and another patterned structure). The bond formed in the bonding region may be a chemical bond (as described above) or a mechanical fastener (e.g., using fasteners).

[0119] As used herein, "carbocyclyl" refers to a non-aromatic ring or cyclic system whose main chain contains only carbon atoms. When a carbocyclyl is a cyclic system, two or more rings may be joined together by fusion, bridging, or spirolinking. Carbocyclyls can have any degree of saturation, provided that at least one ring in the cyclic system is not an aromatic ring. Therefore, carbocyclyls include cycloalkyl, cycloalkenyl, and cycloynyl groups. Carbocyclyls can have 3 to 20 carbon atoms. Examples of carbocyclyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octyl, adamantyl, and spiro[4.4]nonyl.

[0120] As used herein, the terms "carboxylic acid" or "carboxyl" refer to -COOH.

[0121] As used herein, "cycloalkylene" means a fully saturated carbocyclic ring or ring system attached to the rest of the molecule via two attachment sites.

[0122] As used herein, "cycloalkenyl" or "cycloalkene" means a carbocyclic ring or ring system having at least one double bond, wherein the ring in the ring system is not an aromatic ring. Examples include cyclohexenyl or cyclohexene and norcamphenyl or norcamphene. Also as used herein, "heterocycloalkenyl" or "heterocycloalkene" means a carbocyclic ring or ring system having at least one heteroatom in the ring backbone, having at least one double bond, wherein the ring in the ring system is not an aromatic ring.

[0123] As used herein, "cycloalkynyl" or "cycloalkyne" refers to a carbocyclic ring or ring system having at least one triple bond, wherein the ring system does not contain an aromatic ring. An example is cyclooctyne. Another example is bicyclic nonyne. Also as used herein, "heterocycloalkynyl" or "heterocycloalkyne" refers to a carbocyclic ring or ring system having at least one heteroatom in the ring backbone, having at least one triple bond, wherein the ring system does not contain an aromatic ring.

[0124] As used herein, the term "depositing" refers to any suitable application technique, which may be manual or automated, and in some cases causes changes in surface properties. Generally, deposition can be performed using vapor deposition, coating, grafting, or similar techniques. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, dip coating or immersion coating, blade coating, puddle dispensing, flow-through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, or similar techniques.

[0125] As used herein, the term "depression" refers to a discrete recessed feature in a substrate support or multilayer stack with a surface opening, which is at least partially surrounded by gaps in the substrate support or multilayer stack. The opening of a depression in the surface can have any of a variety of shapes, including, for example, circular, elliptical, square, polygonal, star-shaped (with any number of vertices), etc. The cross-section of a depression obtained orthogonally to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. As an example, a depression can be a hole or two interconnecting holes. Depressions can also have more complex structures, such as ridges, stepped features, etc.

[0126] When referring to a set of items, the term "each" is intended to identify an individual item in the set, but not necessarily every single item in the set. Exceptions may exist if the explicit content or context clearly specifies otherwise.

[0127] As used herein, the term "epoxy" (also known as glycidyl or ethylene oxide) refers to... or .

[0128] As used herein, the term "flow cell" is intended to mean a container having a flow channel through which a reaction can occur, an inlet for delivering reagents to the flow channel, and an outlet for removing reagents from the flow channel. In some instances, a flow cell allows the detection of reactions occurring within the flow cell. For example, a flow cell may include one or more transparent surfaces that allow for optical detection arrays, optically labeled molecules, or the like.

[0129] As used herein, a "flow channel" or "channel" can be a region defined between two bound components that selectively receives a liquid sample. In some instances, a flow channel can be defined between two patterned structures and thus in fluid communication with the surface chemicals of the patterned structures. In other instances, a flow channel can be defined between a patterned structure and a cover plate and thus in fluid communication with the surface chemicals of the patterned structure.

[0130] As used herein, a “functionalized layer” or “functionalized layer pad” refers to a gel material applied to at least a portion of a flow cell substrate. The gel material includes functional groups that can be attached to trap initiators. The functionalized layer may be disposed within a recess defined in the substrate or on a protrusion defined on the substrate. The functionalized layer pad is located on a substantially planar substrate surface. The term “functionalized layer” also refers to a gel material applied to all or a portion of the substrate and exposed for further processing to define a functionalized layer in the recessed portion, a functionalized layer on the protruding portion, or a functionalized layer pad on a substantially planar substrate surface.

[0131] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings sharing two adjacent atoms) containing one or more heteroatoms in the ring backbone. The heteroatoms are elements other than carbon, including (but not limited to) nitrogen, oxygen, and sulfur. When a heteroaryl is a ring system, each ring in the system is an aromatic ring. Heteroaryls can have 5 to 18 ring members.

[0132] As used herein, "heterocyclyl" refers to a non-aromatic ring or ring system containing at least one heteroatom in the ring backbone. Heterocyclyl groups can be joined together by fusion, bridging, or spirolinking. Heterocyclyl groups can have any degree of saturation, provided that at least one ring in the ring system is not an aromatic ring. In the ring system, the heteroatom can be present in either a non-aromatic or aromatic ring. Heterocyclyl groups can have 3 to 20 ring members (i.e., the number of atoms constituting the ring backbone, including carbon atoms and heteroatoms). In some instances, the heteroatom (one or more) is O, N, or S.

[0133] As used herein, the terms "hydrazine" or "hydrazinyl" refer to the -NHNH2 group.

[0134] As used herein, the terms "hydrazone" or "hydrazonyl" refer to... Groups, wherein Ra and Rb are each independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 ynyl, C3-7 carbocyclic, C6-10 aryl, 5-10 heteroaryl and 5-10 heterocyclic, as defined herein.

[0135] As used in this article, "hydroxyl" or "hydroxyl" refers to the -OH group.

[0136] As used herein, the term "gap region" refers to a region, such as a substrate support or a multilayer stack, that separates recesses (recesses) or protrusions (raised areas). For example, a gap region can separate an array of recesses from another recess in the same array. The two recesses or protrusions that are separated from each other can be discrete, i.e., not in physical contact with each other. In many instances, the gap region is continuous, but the recesses or protrusions are discrete, such as in the case of a plurality of recesses or protrusions defined in or on a previously continuous surface. In other instances, the gap region and features are discrete, such as in the case of a plurality of groove-shaped recesses separated by individual gap regions. The separation provided by the gap region can be partial or complete. The gap region can have a surface material different from the surface material of the recesses or protrusions. For example, a recess may have a polymer and a first initiator set thereon, and a gap region may have a polymer and a second initiator set thereon.

[0137] As used herein, "negative photoresist" refers to a photosensitive material in which the portion exposed to light of a specific wavelength becomes insoluble in the developer. In such examples, the insoluble negative photoresist has a solubility of less than 5% in the developer. In the case of negative photoresist, exposure alters the chemical structure, making the exposed portion of the material less soluble in the developer (compared to the unexposed portion). Although insoluble in the developer, the insoluble negative photoresist may be at least 99% soluble in a remover different from the developer. The remover may be, for example, a solvent or solvent mixture used in a stripping process.

[0138] Compared to insoluble negative photoresists, at least 95% of the portion of a negative photoresist not exposed to light is soluble in the developer. In some instances, at least 98%, such as 99%, 99.5%, or 100%, of the portion of the negative photoresist not exposed to light is soluble in the developer.

[0139] As used herein, "nitrile oxide" means "RaC≡N +O-" group, where Ra is as defined herein. Examples of the preparation of nitrile oxides include in-situ generation from an aldoxime or from a reaction between hydroxylamine and an aldehyde via treatment with chloral-formamide-T or via the action of amide-imino chloride [RC(Cl)=NOH].

[0140] As used in this article, "nitrone" means... The groups, wherein R1, R2 and R3 can be any of the Ra and Rb groups as defined herein, but R3 is not hydrogen (H).

[0141] As used herein, "nucleotide" includes a nitrogenous heterocyclic base, a sugar, and one or more phosphate groups. A nucleotide is a monomeric unit of a nucleic acid sequence. In RNA, the sugar is ribose, and in DNA, the sugar is deoxyribose, i.e., a sugar lacking the hydroxyl group present at the 2' position of the ribose. The nitrogenous heterocyclic base (i.e., the nucleobase) can be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G) and their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U) and their modified derivatives or analogs. The C-1 atom of the deoxyribose is bonded to the N-1 of the pyrimidine or the N-9 of the purine. Nucleic acid analogs may have alterations to any of the phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include, for example, universal base or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNA).

[0142] In some instances, "over" can mean that one component or material is placed directly on top of another component or material. When one is directly on top of the other, the two are in contact with each other. In Figure 1C, layer 18 is applied to substrate support 14 such that it is directly on and in contact with substrate support 14.

[0143] In other instances, "on" can mean that one component or material is indirectly disposed on top of another component or material. "Indirectly on" means that a gap or additional component or material is disposed between the two components or materials. In Figure 1E, functionalized layers 24 and 26 are disposed on the substrate support 14 such that they are in indirect contact. More specifically, functionalized layers 24 and 26 are indirectly on the substrate support 14 because resin layer 18 is disposed between the two components 24 or 26 and 14.

[0144] "Patterned resin" refers to any material that may have recesses and / or protrusions defined therein. Specific examples of resins and techniques for patterning resins will be further described below.

[0145] "Patterned structure" refers to a single-layer substrate support or a multi-layer stack having a patterned surface chemical substance, such as in recesses, on protrusions, or disposed on the surface of a support or layer. The surface chemical substance may include functionalized layers and trapping / amplifying agents. In some instances, the single-layer substrate support or the layers of the multi-layer stack have been exposed to patterning techniques (e.g., etching, photolithography, etc.) to generate a pattern of the surface chemical substance. However, the term "patterned structure" is not intended to imply that such patterning techniques must be used to generate a pattern. For example, the substrate support may be a substantially flat surface with a pattern of functionalized layers. Patterned structures can be generated via any of the methods disclosed herein.

[0146] As used herein, a "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers, referred to herein as amplification primers, serve as the starting point for template amplification and cluster generation. Other primers, referred to herein as sequencing primers, serve as the starting point for DNA synthesis. The 5' end of the primer may be modified to allow coupling with the functional groups of a polymer. Primer length can be any number of bases and may include a variety of non-natural nucleotides. In one example, the sequencing primer is a short strand, ranging from 10 to 60 bases or 20 to 40 bases.

[0147] As used herein, "positive photoresist" refers to a photosensitive material in which the portion exposed to light of a specific wavelength becomes soluble in the developer. In these examples, at least 95% of any portion of the positive photoresist exposed to light is soluble in the developer. In some examples, at least 98%, such as 99%, 99.5%, or 100%, of the portion of the positive photoresist exposed to light is soluble in the developer. In the case of positive photoresist, exposure alters the chemical structure, making the exposed portion of the material more soluble in the developer (compared to the unexposed portion).

[0148] Compared to soluble positive photoresists, positive photoresists are insoluble in developer (less than 5% soluble) in any part of them that is not exposed to light. Although insoluble in developer, insoluble positive photoresists are at least 99% soluble in a remover that is different from the developer. In some instances, insoluble positive photoresists are at least 98%, such as 99%, 99.5%, or 100%, soluble in a remover. The remover can be a solvent or solvent mixture used in the stripping process.

[0149] As used herein, a "spacer layer" refers to a material that binds two components together. In some instances, the spacer layer may be a radiation-absorbing material that facilitates binding, or it may be in contact with a radiation-absorbing material that facilitates binding.

[0150] The term "substrate" refers to a single-layer substrate support or a multi-layer structure on which surface chemicals are introduced.

[0151] The term "tantalum pentoxide" refers to an inorganic compound having the formula Ta₂O₅. This compound is transparent and has a transmittance in the range of about 0.25 (25%) to 1 (100%) and a wavelength in the range of about 0.35 µm (350 nm) to at least 1.8 µm (1800 nm). A "tantalum pentoxide base support" or "tantalum pentoxide layer" may contain, be substantially composed of, or be composed of Ta₂O₅. In instances where it is desired that the tantalum pentoxide base support or tantalum pentoxide layer transmits electromagnetic energy having any of these wavelengths, the base support or layer may be composed of Ta₂O₅, or may contain Ta₂O₅ and other components that do not interfere with the desired transmittance of the base support or layer, or may be substantially composed of, Ta₂O₅.

[0152] The functional group of "thiol" refers to -SH.

[0153] As used in this article, the term "four" (tetrazine) and "four "Tetrazinyl" refers to a six-membered heteroaryl group containing four nitrogen atoms. It may be replaced as appropriate.

[0154] As used herein, "tetraazole" refers to a five-membered heterocyclic group comprising four nitrogen atoms. Tetraazole may be substituted as appropriate.

[0155] The terms "transparent base support" or "transparent layer" refer to a material, such as a substrate or layer, that is transparent to a specific wavelength or wavelength range. For example, the material may be transparent to wavelengths used to chemically modify positive or negative photoresists. Transparency can be quantified using transmittance (i.e., the ratio of light energy falling on an object to light energy transmitted through the object). The transmittance of a transparent base support or transparent layer will depend on the thickness of the base support or layer and the wavelength of light. In the examples disclosed herein, the transmittance of a transparent base support or transparent layer may range from 0.25 (25%) to 1 (100%). The material of the base support or layer may be a pure material, a material with some impurities, or a mixture of materials, as long as the resulting base support or layer has the desired transmittance. In addition, depending on the transmittance of the substrate support or layer, the exposure time and / or the output power of the light source can be increased or decreased to deliver a suitable amount of light energy through the transparent substrate support and / or layer, thereby achieving the desired effect (e.g., producing soluble or insoluble photoresist).

[0156] [, Flow pool , ]

[0157] An example of a flow cell for simultaneous pairwise end-sequencing typically includes a patterned structure comprising: a substrate; two functionalized layers located on at least a portion of the substrate; and different sets of initiators attached to the two functionalized layers.

[0158] Figure 1A shows an example of a flow cell 10 from a top-down view. The flow cell 10 may include two patterned structures joined together or a patterned structure attached to a cover plate. Flow channels 12 are located between the two patterned structures or the patterned structure and the cover plate. The example shown in Figure 1A includes eight flow channels 12. Although eight flow channels 12 are shown, it should be understood that any number of flow channels 12 may be included in the flow cell 10 (e.g., a single flow channel 12, four flow channels 12, etc.). Each flow channel 12 may be separated from another flow channel 12 such that fluid introduced into a flow channel 12 does not flow into an adjacent flow channel 12. Some examples of fluids introduced into the flow channels 12 may include reaction components (e.g., DNA samples, polymerases, sequencing primers, nucleotides, etc.), washing solutions, deblocking agents, etc.

[0159] The flow channel 12 is defined at least in part by a patterned structure. The patterned structure may include a substrate, such as a single-layer substrate support 14 (as shown in FIG. 1B) or a multi-layer structure 16 (as shown in FIG. 1C, FIG. 1D and FIG. 1E).

[0160] Examples of suitable single-layer substrate supports 14 include epoxy siloxanes, glass, modified or functionalized glass, plastics (including acrylic resins, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutene, polyurethane, polytetrafluoroethylene (such as TEFLON® from Chemours), cyclic olefin / cyclic olefin polymers (COP) (such as ZEONOR® from Zeon), polyimide, etc.), nylon (polyamide), ceramics / ceramic oxides, silicon dioxide, fused silicon dioxide or silicon dioxide-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaOx), hafnium oxide (HfO2), carbon, metals, inorganic glass or the like.

[0161] Examples of the multilayer structure 16 include a substrate support 14 and at least one other layer 18 thereon, as shown in Figures 1C, 1D and 1E. Some examples of the multilayer structure 16 include glass or silicon as the substrate support 14, with a coating (e.g., layer 18) of tantalum oxide (e.g., tantalum pentoxide or another tantalum oxide (TaO x)) or another ceramic oxide on the surface.

[0162] Other examples of the multilayer structure 16 include a substrate support 14 (e.g., glass, silicon, tantalum pentoxide, or any other substrate support material 14) and a patterned resin as another layer 18. It should be understood that any material that can be selectively deposited or deposited and patterned to form the recesses 20 and gap regions 22 can be used for the patterned resin.

[0163] As an example of a patterning resin, inorganic oxides can be selectively applied to the substrate support 14 via vapor deposition, aerosol printing, or inkjet printing. Examples of suitable inorganic oxides include tantalum oxide (e.g., Ta₂O₅), aluminum oxide (e.g., Al₂O₃), silicon oxide (e.g., SiO₂), hafnium oxide (e.g., HfO₂), etc.

[0164] As another example of a patterning resin, a polymeric resin can be applied to a substrate support 14 and then patterned. Suitable deposition techniques include chemical vapor deposition, dip coating, immersion coating, spin coating, spray coating, liquid coating, ultrasonic spraying, blade coating, aerosol printing, screen printing, microcontact printing, etc. Suitable patterning techniques include photolithography, nanoimprint lithography (NIL), stamping, embossing, molding, micro-etching, etc. Some examples of suitable resins include polyhedral oligomeric silsesquioxane resins, non-POSS epoxy resins, poly(ethylene glycol) resins, polyether resins (e.g., ring-opening epoxy resins), acrylic resins, acrylate resins, methacrylate resins, amorphous fluoropolymer resins (e.g., CYTOP® from Bellex), and combinations thereof.

[0165] As used herein, the term "polyhedral oligomeric silsesquioxane" (available from Hybrid Plastics under the trademark POSS) refers to a chemical composition that serves as a hybrid intermediate (e.g., RSiO 1.5) between silicon dioxide (SiO 2) and polysiloxane (R 2SiO) chemical compositions. An example of a polyhedral oligomeric silsesquioxane is the polyhedral oligomeric silsesquioxane described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-778, which is incorporated herein by reference in its entirety. In one example, the composition is an organosilicone compound having the chemical formula [RSiO 3 / 2]n, wherein the R groups may be the same or different. Examples of polyhedral oligomeric silsesquioxanes: R groups include epoxy groups, azido / azido groups, thiols, poly(ethylene glycol), norcamphenyl groups, tetrakisyl groups, etc. Acrylates and / or methacrylates, or other compounds such as alkyl, aryl, alkoxy and / or haloalkyl.

[0166] Other examples of multilayer structures include a transparent substrate support 14' (see, for example, FIG. 6A); a patterned sacrificial layer 48 on the transparent substrate support 14' (see FIG. 6A); and a transparent layer 72 on the patterned sacrificial layer 48 (see FIG. 6A). In some examples, the transparent layer 72 is capable of transmitting ultraviolet light and has a transmittance in the range of about 0.5 to about 1, for example, about 0.75 to about 1, about 0.9 to about 0.99. Some examples of suitable materials for the transparent layer 72 include tantalum pentoxide, indium tin oxide, titanium dioxide, or other UV-transparent materials.

[0167] In one example, the single substrate support 14 (whether used alone or as part of a multilayer structure 16) can be an annular sheet, panel, wafer, die, etc., having a diameter in the range of about 2 mm to about 300 mm, for example, about 200 mm to about 300 mm, or it can be a rectangular sheet, panel, wafer, die, etc., with a maximum size of about 10 feet (about 3 meters). For example, a die can have a width in the range of about 0.1 mm to about 10 mm. Although example dimensions have been provided, it should be understood that a single substrate support 14 with any suitable size can be used.

[0168] In one example, the flow channel 12 has a substantially rectangular configuration with two rounded ends. The length and width of the flow channel 12 can be selected such that a portion of a single base support 14 or the outermost layer of a multi-layer structure 16 surrounds the flow channel 12 and can be used for attachment to a cover plate (not shown) or another patterned structure.

[0169] When microcontact, aerosol, or inkjet printing is used to deposit a single material defining the walls of the flow channel 12, the depth of the flow channel 12 can be as small as the thickness of a single layer. For other examples, the depth of the flow channel 12 can be about 1 μm, about 10 μm, about 50 μm, about 100 μm, or deeper. In one example, the depth can be in the range of about 10 μm to about 100 μm. In another example, the depth can be in the range of about 10 μm to about 30 μm. In yet another example, the depth is about 5 μm or shallower. It should be understood that the depth of the flow channel 12 can be greater than, less than, or between the values ​​specified above.

[0170] Figures 1B, 1C, 1D, and 1E depict examples of the architecture within the flow channel 12. As shown in Figure 1B, the architecture may include functionalized pads 24' and 26' located on the substrate support 14 (or on the multilayer structure 16). As shown in Figure 1C, the architecture may include protrusions 28 located on the multilayer structure 16 (or on the substrate support 14) and functionalized layers 24 and 26 located on the protrusions 28. As shown in Figures 1D and 1E, the architecture may include recesses 20 defined in layers 18 of the multilayer structure 16 (or in the substrate support 14) and functionalized layers 24 and 26 within the recesses 20. The recesses 20 shown in Figure 1E may also be referred to herein as multilayer recesses 20' (see, for example, Figure 16F).

[0171] Various arrangements of the functionalized pads 24', 26', recesses 20, and / or protrusions 28 are conceivable, including regular, repeating, and irregular patterns. In one example, to achieve tight packing and improve density, the functionalized pads 24', 26', recesses 20, and / or protrusions 28 are arranged in a hexagonal grid. Other arrangements may include, for example, linear (rectangular) arrangements, triangular arrangements, etc. In some examples, the arrangement or pattern may be in an xy format of columns and rows. In some other examples, the arrangement or pattern may be a repeating arrangement of the functionalized pads 24', 26', recesses 20, and / or protrusions 28 and gap areas 22. In other examples, the arrangement or pattern may be a random arrangement of the functionalized pads 24', 26', recesses 20, and / or protrusions 28 and gap areas 22.

[0172] The layout or pattern can be defined by the density (number) of the functionalized pads 24', 26', recesses 20, and / or protrusions 28 within the defined area. For example, the functionalized pads 24', 26', recesses 20, and / or protrusions 28 may be present at a density of approximately 2 million per square millimeter. The density can be adjusted to different densities, including, for example, the following densities: approximately 100 per square millimeter, approximately 1,000 per square millimeter, approximately 100,000 per square millimeter, approximately 1 million per square millimeter, approximately 2 million per square millimeter, approximately 5 million per square millimeter, approximately 10 million per square millimeter, approximately 50 million per square millimeter, or greater or less. It should be further understood that the density may be between one of the lower and upper limits selected from the above ranges, or other densities (outside the given range) may be used. As examples, a high-density array may be characterized by having functionalized pads 24', 26', recesses 20 and / or protrusions 28 separated by less than about 100 nm; a medium-density array may be characterized by having functionalized pads 24', 26', recesses 20 and / or protrusions 28 separated by about 400 nm to about 1 µm; and a low-density array may be characterized by having functionalized pads 24', 26', recesses 20 and / or protrusions 28 separated by more than about 1 µm.

[0173] The layout or pattern of the functionalized pads 24', 26', recesses 20, and / or protrusions 28 may also be defined, or alternatively, by the following: the average spacing or interval (center spacing) from the center of one group having functionalized pads 24', 26', a recess 20, and / or a protrusion 28 to the center of an adjacent group having functionalized pads 24', 26', a recess 20, and / or protrusions 28, or the average spacing or interval (side spacing) from the right side of one group having functionalized pads 24', 26', a recess 20, and / or a protrusion 28 to the left side of an adjacent group having functionalized pads 24', 26', a recess 20, and / or protrusions 28. The pattern may be regular, such that the coefficient of variation around the average spacing is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In any case, the average spacing can be, for example, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or longer or shorter. The average spacing of a particular pattern can be between one of the lower and upper limits selected from the above ranges. In one example, the distance between the recesses 20 (center-to-center spacing) is about 1.5 μm. Although example average spacing values ​​have been provided, it should be understood that other average spacing values ​​may be used.

[0174] The size of each recess 20 can be characterized by its volume, opening area, depth, and / or diameter or length and width. For example, the volume can range from about 1 × 10⁻³ μm³ to about 100 μm³, such as about 1 × 10⁻² μm³, about 0.1 μm³, about 1 μm³, about 10 μm³, or larger or smaller. For another example, the opening area can range from about 1 × 10⁻³ μm² to about 100 μm², such as about 1 × 10⁻² μm², about 0.1 μm², about 1 μm², at least about 10 μm², or larger or smaller. For yet another example, the depth can range from about 0.1 μm to about 100 μm, such as about 0.5 μm, about 1 μm, about 10 μm, or larger or smaller. In another instance, the depth may be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm or greater or smaller. In another instance, the diameter or length and width may each be in the range of about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm or greater or smaller.

[0175] The size of each functionalized pad 24', 26', or protrusion 28 may be characterized by its top surface area, height, and / or diameter or length and width. In one example, the top surface area may range from about 1 × 10⁻³ μm² to about 100 μm², for example, about 1 × 10⁻² μm², about 0.1 μm², about 1 μm², at least about 10 μm², or greater or less. In another example, the height may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or greater or less. In another example, the diameter of each of the length and width may range from about 0.1 μm to about 100 μm, for example, about 0.5 μm, about 1 μm, about 10 μm, or greater or less.

[0176] Each of these architectures also includes functionalized layers 24, 26 or functionalized pads 24', 26'. In each instance, functionalized layers 24, 26 or functionalized pads 24', 26' represent different regions to which different primer groups 30, 32 are attached.

[0177] In some examples disclosed herein, functionalized layers 24 and 26 are chemically identical or functionalized pads 24' and 26' are chemically identical, and any of the techniques disclosed herein can be used to sequentially attach primer sets 30 and 32 to desired layers 24 and 26 or pads 24' and 26'. In other examples disclosed herein, functionalized layers 24 and 26 are chemically different or functionalized pads 24' and 26' are chemically different (e.g., layers 24 and 26 or pads 24' and 26' include different functional groups for attachment of individual primer sets 30 and 32), and any of the techniques disclosed herein can be used to attach primer sets 30 and 32 to individual layers 24 and 26 or pads 24' and 26'. In other examples disclosed herein, the material applied to form functionalized layers 24, 26 or functionalized pads 24', 26' may have separate initiator sets 30, 32 pre-grafted thereon, and thus the fixation chemicals of functionalized layers 24, 26 or functionalized pads 24', 26' may be the same or different.

[0178] In some instances, the functionalized layers 24, 26, or the functionalized pads 24', 26', can be any gel material that expands when absorbing liquid and contracts when the liquid is removed, for example, by drying. In one instance, the gel material is a polymeric hydrogel. In one instance, the polymeric hydrogel includes acrylamide copolymers, such as poly(N-(5-azidoacetylammonopentyl)acrylamide-co-acrylamide PAZAM. PAZAM and some other forms of acrylamide copolymers are represented by the following structure (I): in: RA is selected from the following groups: azido, substituted amino, substituted alken, substituted alkyne, halogen, substituted hydrazone, substituted hydrazine, carboxyl, hydroxyl, substituted tetrazolium, substituted tetra- Nitriles, nitrile esters, sulfates, and thiols; RB is H or, where applicable, a substituted alkyl group; RC, RD, and RE are each independently selected from the group consisting of H and, where appropriate, substituted alkyl groups; Each of the components in -(CH 2) p- can be substituted as appropriate; p is an integer in the range of 1 to 50; n is an integer in the range of 1 to 50,000; and m is an integer in the range of 1 to 100,000.

[0179] Those skilled in the art will recognize that the arrangement of repeating “n” and “m” features in structure (I) is representative, and that monomeric subunits can exist in the polymer structure in any order (e.g., random, block, patterned, or a combination thereof).

[0180] The molecular weight of PAZAM and other forms of acrylamide copolymers can range from about 5 kDa to about 1500 kDa or from about 10 kDa to about 1000 kDa, or in certain instances, about 312 kDa.

[0181] In some instances, PAZAM and other forms of acrylamide copolymers are linear polymers. In other instances, PAZAM and other forms of acrylamide copolymers are mildly crosslinked polymers.

[0182] In other instances, the gel material can be a variation of structure (I). In one instance, the acrylamide unit can be via N,N-dimethylacrylamide (... ) replacement. In this example, the acrylamide unit in structure (I) can be... The substitution is performed, wherein RD, RE, and RF are each H or C1-C6 alkyl, and RG and RH are each C1-C6 alkyl (instead of H as in the case of acrylamide). In this example, q can be an integer in the range of 1 to 100,000. In another example, N,N-dimethylacrylamide can be used in addition to the acrylamide unit. In this example, structure (I) may include, except for the repeated "n" and "m" features. , wherein RD, RE, and RF are each H or C1-C6 alkyl, and RG and RH are each C1-C6 alkyl. In this example, q can be an integer in the range of 1 to 100,000.

[0183] As another example of polymer hydrogels, the repeating "n" features in structure (I) can be replaced by monomers including heterocyclic azide groups having structure (II): Wherein R1 is H or a C1-C6 alkyl group; R2 is H or a C1-C6 alkyl group; L is a linker comprising a straight chain having 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and 10 substituents present, if applicable, on the carbon and any nitrogen atoms in the chain; E is a straight chain comprising 1 to 4 atoms selected from the group consisting of carbon, oxygen, and nitrogen, and substituents present, if applicable, on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide, wherein H or a C1-C4 alkyl group is attached to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 ring members present in a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidyl, pyridyl, or pyrimidinyl.

[0184] As another example, the gel material may include repeating units of each of structures (III) and (IV): and Each of R1a, R2a, R1b and R2b is independently selected from hydrogen, substituted alkyl, or substituted phenyl; each of R3a and R3b is independently selected from hydrogen, substituted alkyl, substituted phenyl, or substituted C7-C14 aralkyl; and each of L1 and L2 is independently selected from substituted alkyl linkers or substituted heteroalkyl linkers.

[0185] It should be understood that other molecules can be used to form functionalized layers 24, 26 or functionalized pads 24', 26', provided they are functionalized to allow grafting of oligonucleotide primers. Some examples of suitable functionalized layer materials include functionalized silanes, such as norcamphene silanes, azidosilanes, alkyne-functionalized silanes, amine-functionalized silanes, maleic anhydride-imine silanes, or any other silane having functional groups capable of attaching the desired primer set 30, 32. Other examples of suitable functionalized layer materials include those having a colloidal structure, such as agarose; or a polymeric network structure, such as gelatin; or a cross-linked polymeric structure, such as polyacrylamide polymers and copolymers, silane-free acrylamide (SFA), or an azide-form of SFA. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or vinyl-containing acrylic acid, or from monomers that form a [2+2] photoinduced cycloaddition reaction. Other examples of suitable polymeric hydrogels include mixed copolymers of acrylamide and acrylates. Various polymer structures containing acrylic monomers (e.g., acrylamide, acrylates, etc.) can be used in the examples disclosed herein, such as branched polymers, including star polymers, star or star block copolymers, dendritic polymers, and the like. For example, monomers (e.g., acrylamide, acrylamide containing a catalyst, etc.) can be randomly or block-incorporated into the branches (arms) of a star polymer.

[0186] The gel material comprising functionalized layers 24, 26 or functionalized pads 24', 26' can be formed using any suitable copolymerization process. The gel material can also be deposited using any of the methods disclosed herein.

[0187] Functionalized layers 24, 26 or functionalized pads 24', 26' can be covalently bonded to the substrate support 14 or layer 18 of the underlying multilayer structure 16 (e.g., metal oxide coating, resin, etc.). In some cases, the underlying substrate support 14 or layer 18 may first be activated, for example, by silanization or plasma ashing. Covalent bonding helps maintain the initiator sets 30, 32 in the desired region throughout the various applications of the flow cell 10's lifetime.

[0188] Each of these architectures also includes primer sets 30, 32 attached to the respective functionalized layers 24, 26 or pads 24', 26'. In one example, the first primer set 30 includes a non-splitable first primer and a splittable second primer; and the second primer set 32 ​​includes a splittable first primer and a non-splitable second primer. Figures 2A to 2D depict different configurations of primer sets 30A, 32A, 30B, 32B, 30C, 32C and 30D, 32D attached to the functionalized layers 24, 26 or pads 24', 26'.

[0189] Each of the first primer groups 30A, 30B, 30C and 30D includes a non-splitable first primer 34 or 34' and a splitable second primer 36 or 36'; and each of the second primer groups 32A, 32B, 32C and 32D includes a splitable first primer 38 or 38' and a non-splitable second primer 40 or 40'.

[0190] The non-cleavable first primer 34 or 34' and the cleavable second primer 36 or 36' are oligonucleotide pairs, for example, where the non-cleavable first primer 34 or 34' is a forward amplification primer and the cleavable second primer 36 or 36' is a reverse amplification primer, or where the cleavable second primer 36 or 36' is a forward amplification primer and the non-cleavable first primer 34 or 34' is a reverse amplification primer. In each example of first primer set 30A, 30B, 30C, and 30D, the cleavable second primer 36 or 36' includes cleavage site 42, while the non-cleavable first primer 34 or 34' does not include cleavage site 42.

[0191] The cleavable first primer 38 or 38' and the non-cleavable second primer 40 or 40' are also oligonucleotide pairs, for example, where the cleavable first primer 38 or 38' is a forward amplification primer and the non-cleavable second primer 40 or 40' is a reverse amplification primer, or where the non-cleavable second primer 40 or 40' is a forward amplification primer and the cleavable first primer 38 or 38' is a reverse amplification primer. In each example of second primer set 32A, 32B, 32C, and 32D, the cleavable first primer 38 or 38' includes a cleavage site 42' or 44, while the non-cleavable second primer 40 or 40' does not include a cleavage site 42' or 44.

[0192] It should be understood that the non-cleavable first primers 34 or 34' in the first primer sets 30A, 30B, 30C, and 30D, and the cleavable first primers 38 or 38' in the second primer sets 32A, 32B, 32C, and 32D, have the same nucleotide sequence (e.g., both are forward amplification primers), but the cleavable first primers 38 or 38' include cleavage sites 42' or 44 integrated into the nucleotide sequence or integrated into the linker 46' attached to the nucleotide sequence. Similarly, the cleavable second primers 36 or 36' in the first primer sets 30A, 30B, 30C, and 30D, and the non-cleavable second primers 40 or 40' in the second primer sets 32A, 32B, 32C, and 32D, have the same nucleotide sequence (e.g., both are reverse amplification primers), but the cleavable second primers 36 or 36' include cleavage sites 42 integrated into the nucleotide sequence or integrated into the linker 46 attached to the nucleotide sequence.

[0193] It should be understood that when the first primers 34 and 38 or 34' and 38' are positive amplification primers, the second primers 36 and 40 or 36' and 40' are negative primers, and vice versa.

[0194] The non-cleavable primers 34, 40, or 34', 40' can be any primer having a universal sequence for capture and / or amplification purposes, such as P5 and P7 primers. Examples of P5 and P7 primers are used on the surface of commercial flow cells sold by Illumina for sequencing, for example, on HISEQ™, HISEQX™, MISEQ™, MISEQDX™, MINISEQ™, NEXTSEQ™, NEXTSEQDX™, NOVASEQ™, ISEQ™, GENOME ANALYZER™, and other instrument platforms. In one example, P5 and P7 primers include the following: P5: 5' → 3' AATGATACGGCGACCACCGA(SEQ. ID. NO. 1) P7: 5' → 3' CAAGCAGAAGACGGCATACGA(SEQ. ID. NO. 2) In some instances, the P5 and P7 primers are non-cleavable primers 34, 40, or 34', 40', because they do not include cleavage sites 42, 42', 44. It should be understood that any suitable universal sequence can be used as a non-cleavable primer 34, 40, or 34', 40'.

[0195] Examples of cleavable primers 36, 38, or 36', 38' include P5 and P7 (or other universal sequences) primers having cleavage sites 42, 42', 44 incorporated into individual nucleic acid sequences (e.g., Figures 2A and 2C) or into linkers 46', 46 (Figures 2B and 2D), which attach cleavable primers 36, 38, or 36', 38' to individual functionalized layers 24, 26 or mats 24', 26'. Examples suitable for cleavage sites 42, 42', 44 include enzymatically cleavable or chemically cleavable nucleosides, modified nucleosides, or linkers (e.g., between nucleosides), as described herein.

[0196] Each initiator set 30A and 32A, or 30B and 32B, or 30C and 32C, or 30D and 32D is attached to a respective functionalized layer 24, 26, or pad 24', 26'. In some instances, functionalized layers 24, 26, or pads 24', 26' have the same surface chemistry, and any of the techniques described herein can be used to graft one initiator set 30 onto functionalized layer 24 or pad 24', and another initiator set 32 ​​onto functionalized layer 26 or pad 26'. In other instances, functionalized layers 24, 26 include different surface chemicals (e.g., functional groups) that can selectively react with each initiator 34, 36, or 34', 36', or 38, 40, or 38', 40'. In other examples, the functionalized layer 24 or the pad 24' has a first functional group, and the functionalized layer 26 or the pad 26' has a second functional group different from the first functional group.

[0197] As mentioned, Figures 2A to 2D depict different configurations of initiator groups 30A, 32A, 30B, 32B, 30C, 32C and 30D, 32D attached to functionalized layers 24, 26 or pads 24', 26'. More specifically, Figures 2A to 2D depict different configurations of usable initiators 34, 36 or 34', 36' and 38, 40 or 38', 40'.

[0198] In the example shown in Figure 2A, for example without connectors 46, 46', the leads 34, 36 and 38, 40 in lead groups 30A and 32A are directly attached to functionalized layers 24 and 26 or functionalized pads 24, 26'. Functionalized layer 24 or pad 24' may have surface functional groups that can anchor end groups at the 5' ends of leads 34, 36. Similarly, functionalized layer 26 or pad 26' may have surface functional groups that can anchor end groups at the 5' ends of leads 38, 40. In one example, the fixation chemicals between functionalized layer 24 or pad 24' and leads 34, 36 and between functionalized layer 26 or pad 26' and leads 38, 40 may be different, such that leads 34, 36 or 38, 40 are selectively attached to the desired layer 24 or 26 or pad 24' or 26'. For example, functionalized layer 24 or pad 24' may be an azide-based silane capable of grafting alkyne-terminated initiators, and functionalized layer 26 or pad 26' may be an alkyne-functionalized silane capable of grafting azide-terminated initiators. In another example, functionalized layer 24 or pad 24' may be an amine-functionalized silane capable of grafting NHS ester-terminated initiators, and functionalized layer 26 or pad 26' may be a male-butenediamine silane capable of grafting thiol-terminated initiators. In yet another example, the fixative chemicals for layer 24 or pad 24' or layer 26 or pad 26' and individual initiators 34, 36 or 38, 40 may be identical, and patterning techniques may be used to graft one initiator group 30A, 32A at a time. In another example, the material applied to form functionalized layers 24, 26 or pads 24', 26' may have individual initiators 34, 36 or 38, 40 pre-grafted thereon, and thus the immobilized chemical substances may be the same or different.

[0199] In this example, fixation can be achieved by single-point covalent bonding or by stronger non-covalent attachment at the 5' end of each of the individual initiators 34 and 36 or 38 and 40 to the individual functionalized layers 24, 26 or pads 24', 26'.

[0200] Examples of usable end-capping primers include alkyne-terminated primers, tetrahydric primers, etc. Introductions for end-capping, including azido-terminated, amino-terminated, epoxy or glycidyl-terminated, thiophosphate-terminated, thiol-terminated, aldehyde-terminated, hydrazine-terminated, aminophosphite-terminated, triazolinone-terminated, and biotin-terminated. In certain specific instances, an initiator capped with succinimino (NHS) ester can react with an amine on the surface of functionalized layers 24, 26 or pads 24', 26'; an initiator capped with aldehyde can react with hydrazine on the surface of functionalized layers 24, 26 or pads 24', 26'; an initiator capped with alkyne can react with azide on the surface of functionalized layers 24, 26 or pads 24', 26'; an initiator capped with azide can react with alkyne or dibenzocyclooctyne (DBCO) on the surface of functionalized layers 24, 26 or pads 24', 26'; or an initiator capped with amino group can react with amine on the surface of functionalized layers 24, 26 or pads 24', 26'. The initiator at the end can react with the activated carboxylic acid ester group or NHS ester on the surface of the functionalized layers 24, 26 or the pads 24', 26', or the thiol-terminated initiator can react with the alkylating reactant (e.g., iodoacetamide or maleic anhydride) on the surface of the functionalized layers 24, 26 or the pads 24', 26', or the aminophosphite-terminated initiator can react with the thioether on the surface of the functionalized layers 24, 26 or the pads 24', 26', or the biotin-modified initiator can react with the antibiotic streptomycin on the surface of the functionalized layers 24, 26 or the pads 24', 26'.

[0201] Furthermore, in the example shown in Figure 2A, the cleavage sites 42 and 42' of each of the cleavable primers 36 and 38 are incorporated into the primer sequence. In this example, the same type of cleavage sites 42 and 42' are used in the cleavable primers 36 and 38 of each primer set 30A and 32A. As an example, cleavage sites 42 and 42' are uracil bases, and the cleavable primers 36 and 38 are P5U and P7U, respectively. In this example, the non-cleavable primer 34 of oligonucleotide pairs 34 and 36 can be P7, and the non-cleavable primer 40 of oligonucleotide pairs 38 and 40 can be P5. Therefore, in this example, the first primer set 30A includes P7 and P5U, and the second primer set 32A includes P5 and P7U. Introducer sets 30A and 32A have opposite linear chemistry, which allows the positive template strand to form on a functionalized layer 24 or 26 or a pad 24' or 26' after amplification, clustering and linearization, and the reverse strand to form on another functionalized layer 26 or 24 or a pad 26' or 24'.

[0202] In the example shown in Figure 2B, the leads 34', 36' and 38', 40' in lead groups 30B and 32B are attached to functionalized layers 24, 26 or pads 24', 26', for example, via connectors 46, 46'. The functionalized layer 24 or pad 24' may have surface functional groups that can secure the connector 46 to the 5' end of the leads 34', 36'. Similarly, the functionalized layer 26 or pad 26' may have surface functional groups that can secure the connector 46' to the 5' end of the leads 38', 40'. In one example, the fixation chemicals used for functionalized layer 24 or pad 24' and connector 46 may differ from those used for functionalized layer 26 or pad 26' and connector 46', such that initiators 34', 36' or 38', 40' are selectively grafted onto the desired functionalized layer 24 or 26 or pad 24' or 26'. In another example, the fixation chemicals may be the same for functionalized layers 24 and 26 or pads 24' and 26' and connectors 46, 46', and any suitable technique disclosed herein may be used to graft one initiator set 30B, 32B at a time. In yet another example, the material applied to form functionalized layers 24 and 26 or pads 24' and 26' may have individual initiators 34', 36' and 38', 40' pre-grafted thereon, and therefore the fixation chemicals may be the same or different. Suitable examples of linkers 46 and 46' may include nucleic acid linkers (e.g., 10 nucleotides or less) or non-nucleic acid linkers, such as polyethylene glycol chains, alkyl or carbon chains, aliphatic linkers with vicinal diols, peptide linkers, etc. Examples of nucleic acid linkers are polyT spacers, but other nucleotides may also be used. In one example, the spacer is a 6T to 10T spacer. The following are some examples of nucleotides including non-nucleic acid linkers (where B is a nucleobase and "oligo" is the introductory term):

[0203] In the example shown in Figure 2B, primers 34' and 38' have the same sequence (e.g., P5) and the same or different linkers 46 and 46'. Primer 34' is non-cleavable, while primer 38' includes a cleavage site 42' incorporated into linker 46'. Also in this example, primers 36' and 40' have the same sequence (e.g., P7) and the same or different linkers 46 and 46'. Primer 40' is non-cleavable, and primer 36' includes a cleavage site 42 incorporated into linker 46. Cleavage sites 42 and 42' of the same type are used in the linkers 46 and 46' of each of the cleavable primers 36 and 38'. As an example, cleavage sites 42 and 42' may be uracil bases incorporated into nucleic acid linkers 46 and 46'. The primer groups 30B and 32B have opposite linear chemistry, which allows the positive template strand to form on a functionalized layer 24 or 26 or a pad 24' or 26' after amplification, clustering and linearization, and the reverse strand to form on another functionalized layer 26 or 24 or a pad 26' or 24'.

[0204] The example shown in Figure 2C is similar to the example shown in Figure 2A, but different types of cleavage sites 42 and 44 are used in the cleavable primers 36 and 38 of individual primer groups 30C and 32C. For example, two different enzymatic cleavage sites can be used, two different chemical cleavage sites can be used, or one enzymatic cleavage site and one chemical cleavage site can be used. Examples of different cleavage sites 42 and 44 that can be used in individual cleavable primers 36 and 38 include any combination of the following: vicinal diol, uracil, allyl ether, disulfide, restriction enzyme site, and 8-oxoguanine.

[0205] The example shown in Figure 2D is similar to the example shown in Figure 2B, but different types of cleavage sites 42 and 44 are used to attach to the linkers 46 and 46' of the cleavable primers 36' and 38' of the respective primer sets 30D and 32D. Examples of different cleavage sites 42 and 44 that can be used to attach to the respective linkers 46 and 46' of the cleavable primers 36' and 38' include any combination of the following: vicinal diol, uracil, allyl ether, disulfide, restriction enzyme site, and 8-oxoguanine.

[0206] In any of the examples shown in Figures 2A to 2D, the attachment of initiators 34, 36 and 38, 40 or 34', 36' and 38', 40' to functionalized layers 24, 26 or pads 24', 26' allows the template-specific portions of initiators 34, 36 and 38, 40 or 34', 36' and 38', 50' to remain freely adhered to their homologous templates, and the 3' hydroxyl group is freely used for initiator extension.

[0207] Different methods can be used to generate the flow pool architecture revealed in this paper. These methods will now be described.

[0208] [, Manufacturing drawings , ] [, 1B , ] [, Methods of Flow Pool Architecture , ]

[0209] The structure shown in Figure 1B can be produced by various methods of back-side exposure of photoresist. Several methods are illustrated with reference to the series of Figures 3, 4, 6, 8, and 24.

[0210] The examples shown in Figures 3A to 3R, 4A to 4I and 24A to 24J use one layer as a photomask, while the examples shown in Figures 6A to 6L and 8A to 8G use two layers as photomasks.

[0211] The examples shown in Figures 3A to 3R and Figures 4A to 4I typically involve selectively etching a multilayer stack including a patterned resin layer, an underlying sacrificial layer, and an underlying transparent substrate support, thereby exposing a portion of the transparent substrate support and a portion of the sacrificial layer; developing a negative photoresist through the portion of the transparent substrate support using the multilayer stack to define an insoluble negative photoresist at a predetermined area of ​​the multilayer stack; and applying first and second functionalized layers on the transparent substrate support, wherein the insoluble negative photoresist i) is present during the application of the first functionalized layer and removed before the application of the second functionalized layer, or ii) is present during the application of the second functionalized layer and developed after the application of the first functionalized layer. The various aspects and steps of the method will now be described in more detail with reference to the respective figures.

[0212] Figures 3A to 3R illustrate three different examples of methods for manufacturing the flow cell architecture of Figure 1B, which includes functionalized pads 24' and 26'. One example is shown in Figures 3A to 3B. Another example is shown in Figures 3A to 3E and Figures 3J to 3M. Yet another example is shown in Figures 3A to 3C and Figures 3N to 3R. Figure 3I shows the functionalized pads 24' and 26' produced by each of these methods.

[0213] Each of these methods begins with a multilayer material stack, including a resin layer 50, an underlying sacrificial layer 48, and an underlying substrate support 14. In these examples, the substrate support 14 is a transparent material, such as glass or tantalum pentoxide, and is referred to as a transparent substrate support 14'. In these examples, the transparent substrate support 14' is transparent to the ultraviolet wavelength used for back-side exposure.

[0214] To create a multilayer stack, a sacrificial layer 48 is deposited on a transparent substrate support 14'. Examples of suitable materials for the sacrificial layer 48 include half-metals, such as silicon, or metals, such as aluminum, copper, titanium, gold, silver, etc. In some instances, the half-metal or metal may be at least substantially pure (<99% pure). In other instances, molecules or compounds of the listed elements may be used, provided that the sacrificial layer 48 is opaque to light energy used for photoresist development (non-transparent or having a transmittance of less than 0.25). For example, oxides of any of the listed half-metals (e.g., silicon dioxide) or metals (e.g., aluminum oxide) may be used alone or in combination with the listed half-metals or metals. These materials may be deposited using any suitable technique disclosed herein. The sacrificial layer 48 disposed on the transparent substrate support 14' is shown in Figure 3A.

[0215] Next, resin layer 50 is deposited on sacrificial layer 48, as shown in Figure 3B. Resin layer 50 can be any of the example resins described herein and can be deposited using any suitable technique disclosed herein. For some deposition techniques, the resin can be mixed with a liquid carrier, such as propylene glycol monomethyl ether acetate (PGMEA), toluene, dimethyl sulfoxide (DMSO), tetrahydrofuran (THF), etc. In one example, resin layer 50 is a release inhibitor. Examples of suitable release inhibitors include those based on a polymethylpentadiamine platform, available from Kayaku Advanced Materials (formerly MicroChem). The release inhibitor can be deposited, cured, and subsequently removed at a desired time in the process by spin coating or other methods.

[0216] As shown in Figure 3B, the embossed resin layer 50 forms a recessed area 56 comprising a deeper portion 58 and a shallower portion 60 defined by a stepped portion 62. Any suitable embossing technique can be used. In one example, a working impression is pressed into the resin layer 50 while it is still soft, which creates an impression of the working impression characteristics within the resin layer 50. The resin layer 50 with the working impression can then be cured in place.

[0217] Curing can be achieved by exposure to photochemical radiation, such as visible light or ultraviolet (UV) radiation, when using radiation-curing resin materials; or by exposure to heat when using thermosetting resin materials. Curing can promote polymerization and / or crosslinking. As an example, curing may include multiple stages, including soft baking (e.g., to remove any liquid carriers that can be used to deposit the resin) and hard baking. Soft baking can be performed at low temperatures ranging from about 50°C to about 150°C. Hard baking can last from about 5 seconds to about 10 minutes at temperatures ranging from about 100°C to about 300°C. Examples of apparatus that can be used for soft baking and / or hard baking include heating plates, ovens, etc.

[0218] After curing, the working impression is released. This creates surface morphology features in the resin layer 50. In this example method, the working impression does not extend through the entire depth of the resin layer 50, and therefore the underlying sacrificial layer 48 is not exposed after imprinting (as shown in Figure 3B).

[0219] Next, the multilayer stack is selectively etched to expose portion 64 of the transparent substrate support 14' at the deeper portion 58 and portion 66 of the sacrificial layer 48 at the shallower portion 60. Any exposed areas of the resin layer 50 can be etched during this process, as indicated by the downward arrow in Figure 3C. Since the portion of the resin layer 50 at the deeper portion 58 is thinner, the sacrificial layer 48 at the deeper portion 58 will also be etched away. Etching can continue until portion 64 of the transparent substrate support 14' is exposed. The etching of the resin layer 50 can involve dry etching processes, such as anisotropic oxygen plasma or a mixture of 90% CF4 and 10% O2 plasma.

[0220] Two examples of this method are continued according to Figures 3D and 3E, wherein a negative photoresist may then be applied to a multilayer stack. Examples of suitable negative photoresists include the NR® series (available from Futurrex). Other suitable negative photoresists include the SU-8 and KMPR® series (both available from Kayaku Advanced Materials) or the UVN™ series (available from DuPont). When a negative photoresist is used, it is selectively exposed to certain wavelengths of light to form an insoluble negative photoresist 52, and exposed to a developer to remove soluble portions (e.g., those not exposed to certain wavelengths of light). In this example, it is desirable that the insoluble negative photoresist 52 remain on the portion 64 of the transparent substrate support 14' at the deeper portion 58, and be removed from the resin layer 50 and the portion 66 of the sacrificial layer 48. Thus, in the example shown in Figure 3D, light can be directed through the transparent substrate support 14'. The negative photoresist on portion 64 will be exposed to light and become insoluble. The sacrificial layer 48 blocks at least 75% of the light transmitted through the transparent substrate support 14', thus substantially preventing light from reaching the negative photoresist disposed on the resin layer 50 and the sacrificial layer 48. Therefore, these portions remain soluble and are removed with a developer. In this example, the negative photoresist is developed via the transparent substrate support 14' to define the insoluble negative photoresist 52 in the deeper portion 58 and remove the soluble negative photoresist.

[0221] Examples of suitable developers for negative photoresists include alkaline aqueous solutions, such as diluted sodium hydroxide, diluted potassium hydroxide, or aqueous solutions of metal ion-free organic tetramethylammonium hydroxide (TMAH).

[0222] At least 95% of the soluble portion of the negative photoresist is soluble in the developer. After the negative photoresist is exposed to the developer, the multilayer stack can be exposed to O2 plasma for cleaning, for example, the exposed portion 66.

[0223] At the exposed portion 66, the sacrificial layer 48 is etched, as indicated by the downward arrow in Figure 3E. As examples, the aluminum sacrificial layer can be removed under acidic or alkaline conditions, the copper sacrificial layer can be removed using FeCl3, the copper, gold, or silver sacrificial layers can be removed in iodine and iodide solutions, the titanium sacrificial layer can be removed using H2O2, and the silicon sacrificial layer can be removed under alkaline (pH) conditions. In these examples, the transparent substrate support 14' acts as an etch stop layer for the sacrificial layer etching process. In other examples, dry etching (e.g., reactive ion etching with BCl3 + Cl2) can be used and can be stopped when the second portion 64' of the transparent substrate support 14' is exposed. Thus, the portion 66 of the etched sacrificial layer 48 exposes the second portion 64' of the transparent substrate support 14'.

[0224] Next, an example of the method is performed from Figures 3E to 3F. In Figure 3F, the first functionalized layer 24 is then applied to the second portion 64' of the transparent substrate support 14' using any suitable deposition technique. In this example, the first functionalized layer 24 is also deposited on the remaining resin layer 50 and the insoluble negative photoresist 52.

[0225] When beginning the methods shown in Figures 3A to 3I, silanization or plasma ashing can be used to activate the transparent substrate support 14' to generate surface groups that can react with the functionalized layer 24. Thus, the functionalized layer 24 is covalently attached to the second portion 64' of the transparent substrate support 14'.

[0226] The insoluble negative photoresist 52 can then be removed to re-expose portion 64 of the transparent substrate support 14' at the deeper portion 58. Although the insoluble negative photoresist 52 is insoluble in the developer, it is soluble (at least 99% soluble) in the remover. Suitable removers include dimethyl sulfoxide (DMSO) or acetone treated with acoustic waves, or N-methyl-2-pyrrolidone (NMP)-based strippers. As shown in Figure 3G, this process removes the insoluble negative photoresist 52 and the functionalized layer 24 overlying it.

[0227] As shown in Figure 3H, a second functionalized layer 26 can then be applied to the portion 64 of the transparent substrate support 14' at the deeper portion 58. The second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) can be applied using any suitable deposition technique. In this example, when the gel material is deposited under high ionic strength (e.g., in the presence of 10× PBS, NaCl, KCl, etc.), the second functionalized layer 26 does not deposit on or adhere to the first functionalized layer 24. Therefore, the second functionalized layer 26 does not contaminate the first functionalized layer 24.

[0228] Next, the remaining resin layer 50 can be peeled off. As shown in Figure 3I, the peeling process removes i) at least 99% of the resin layer 50 and ii) the functionalized layers 24, 26 covering or attached to the resin layer 50. This peeling process can be performed using sonic treatment in dimethyl methacrylate (DMSO), or in acetone, or with a peeling agent based on N-methyl-2-pyrrolidone (NMP). This keeps the functionalized pads 24', 26' abutting each other on the surface of the transparent substrate support 14'. The functionalized pads 24', 26' remain intact on the transparent substrate support 14', partly because the functionalized pads 24', 26' are covalently attached to the transparent substrate support 14'.

[0229] The removal of the remaining resin layer 50 also leaves the sacrificial layer 48 at least substantially intact on the transparent substrate support 14'. The sacrificial layer 48 is then removed to expose the gap region 22 surrounding the functionalized pads 24', 26'. This is depicted in Figure 3I. Any suitable etching technique can be used for the sacrificial layer 48. It should be understood that the functionalized pads 24', 26' are covalently attached to the transparent substrate support 14' and are therefore not removed during the sacrificial layer etching.

[0230] Although a single set of functionalized pads 24', 26' is shown in FIG3I, it should be understood that the method described with reference to FIG3A to FIG3I can be performed to produce an array of functionalized pads 24', 26' separated by gap regions 22 spanning the surface of the transparent substrate support 14'.

[0231] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26, and thus to pads 24', 26'. In some instances, primers 34, 36 or 34', 36' (not shown in Figures 3A to 3I) may be pre-grafted to functionalized layer 24, and thus pre-grafted to pad 24'. Similarly, primers 38, 40 or 38', 40' (not shown in Figures 3A to 3I) may be pre-grafted to functionalized layer 26, and thus pre-grafted to pad 26'. In these instances, no additional primer grafting is performed.

[0232] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in FIG. 3F). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to second functionalized layer 26. Conversely, after applying the second functionalized layer 26 (e.g., in Figure 3H), initiators 38, 40, or 38', 40' can be grafted, provided that i) the second functionalized layer 26 has different functional groups for attaching initiators 38, 40, or 38', 40' (compared to the first functionalized layer 24), or ii) the unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0233] When grafting is performed during this method, any suitable grafting technique can be used to achieve grafting. As examples, grafting can be achieved by flow deposition (e.g., using a temporary binding cap), dip coating, spraying, liquid dispensing, or another suitable method. Each of these example techniques may utilize an initiator solution or mixture, which may include initiators 34, 36 or 34', 36' or 38, 40 or 38', 40', water, a buffer, and a catalyst. With any of the grafting methods, initiators 34, 36 or 34', 36' or 38, 40 or 38', 40' are attached to the reactive base of functionalized layer 24 or 26 or pad 24' or 26', and have no affinity for other layers.

[0234] Referring back to Figure 3E, another example of the method is performed after the insoluble negative photoresist 52 has been developed and the exposed portion 66 of the sacrificial layer 48 has been removed, according to Figures 3E to 3J.

[0235] In Figure 3J, a silanized layer 54 is applied over an insoluble negative photoresist 52 and a multilayer stack (e.g., the exposed portion 64' of the transparent substrate support 14' and the resin layer 50). The silanized layer 54 may comprise any silane or silane derivative. The choice of silane or silane derivative may depend in part on the functionalized layers 24, 26 to be applied, as it may be desirable to form covalent bonds between the silane or silane derivative and the functionalized layers 24, 26 (and thus the resulting pads 24', 26'). Some examples of silane derivatives include cycloalkenes with unsaturated moieties, such as norcamphene, norcamphene derivatives (e.g., including (hetero)norcamphene where oxygen or nitrogen replaces one of the carbon atoms), trans-cyclooctene, trans-cyclooctene derivatives, trans-cyclopentene, trans-cycloheptene, trans-cyclononene, bicyclo[3.3.1]non-1-ene, bicyclo[4.3.1]dec-1(9)-ene, bicyclo[4.2.1]non-1(8)-ene, and bicyclo[4.2.1]non-1-ene. Any of these cycloalkenes may be substituted, for example, with an R group, such as hydrogen, alkyl, alkenyl, ynyl, cycloalkyl, cycloalkenyl, cycloynyl, aryl, heteroaryl, heterocyclocycloyl, aralkyl, or (heterocyclocycloyl)alkyl. Examples of norcamphene derivatives include [(5-bicyclo[2.2.1]hept-2-enyl)ethyl]trimethoxysilane. Other examples of silane derivatives include unsaturated cycloalkynes such as cyclooctyne, cyclooctyne derivatives, or bicyclononyne (e.g., bicyclo[6.1.0]non-4-yne or its derivatives, bicyclo[6.1.0]non-2-yne, or bicyclo[6.1.0]non-3-yne). These cycloalkynes may be substituted with any of the R groups described herein.

[0236] The method used to apply the silanized layer 54 may vary depending on the silane or silane derivative being used. Examples of suitable silanization methods include vapor deposition (e.g., the YES method), spin coating, or other deposition methods.

[0237] As shown in Figure 3K, the insoluble negative photoresist 52 can then be removed using a removal agent as described herein. In addition to removing the insoluble negative photoresist 52, the silanized layer 54 covering the insoluble negative photoresist 52 can also be removed. This re-exposes portion 64 of the transparent substrate support 14' at the deeper portion 58.

[0238] Next, using any suitable deposition technique, a first functionalized layer 24 is applied (as shown in Figure 3L). In this example, the first functionalized layer 24 is selectively attached to the silanized layer 54 and not to the exposed portion 64 of the transparent substrate support 14'. At the beginning of this example of the method, using silanization or plasma ashing may not activate the transparent substrate support 14', and therefore the transparent substrate support 14' does not include surface groups that can react with the functionalized layer 24.

[0239] Figure 3L also depicts the application of the second silanized layer 54'. The second silanized layer 54' may be of the same type of silane or silane derivative as the silanized layer 54, or may be of a different type of silane or silane derivative compared to the silanized layer 54. The second silanized layer 54' can be applied using any suitable deposition technique (as shown in Figure 3L). In this example, the second silanized layer 54' is attached to the exposed portion 64 of the transparent substrate support 14' and not to the first functionalized layer 24 (because there are no functional groups in the first functionalized layer 24 that react with the second silanized layer 54').

[0240] Next, using any suitable deposition technique, a second functionalized layer 26 is applied (as shown in Figure 3M). In this example, the second functionalized layer 26 is selectively attached to the second silanized layer 54', and when gel material deposition is performed under high ionic strength (e.g., in the presence of 10× PBS, NaCl, KCl, etc.), the second functionalized layer 26 does not deposit on or adhere to the first functionalized layer 24.

[0241] The remaining resin layer 50 can then be stripped. The stripping process removes i) at least 99% of the resin layer 50, and ii) the silanized layers 54, 54' and functionalized layers 24, 26 covering or attached to the resin layer 50. This stripping process can be performed as described herein. The sacrificial layer 48 is also removed by any suitable etching technique to expose the gap region 22 surrounding the functionalized pads 24', 26'. Although not shown in the stripping and removal process diagrams, it should be understood that the resulting structure is similar to that shown in FIG. 3I, because the functionalized pads 24', 26' remain adjacent to each other on the surface of the transparent substrate support 14' after the stripping and sacrificial layer etching. The functionalized pads 24' and 26' remain intact on the transparent substrate support 14', partly because the functionalized pads 24' and 26' are covalently attached to the transparent substrate support 14' via silanized layers 54 and 54' (not shown in Figure 3I).

[0242] Although a single set of functionalized pads 24', 26' is shown in FIG3I, it should be understood that the methods described with reference to FIG3A to FIG3E and FIG3J to FIG3M can be performed to produce an array of functionalized pads 24', 26' separated by gap regions 22 spanning the surface of the transparent substrate support 14'.

[0243] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26, and thus to pads 24', 26'. In some instances, primers 34, 36 or 34', 36' (not shown in Figures 3J to 3M) may be pre-grafted to functionalized layer 24, and thus pre-grafted to pad 24'. Similarly, primers 38, 40 or 38', 40' (not shown in Figures 3J to 3M) may be pre-grafted to functionalized layer 26, and thus pre-grafted to pad 26'. In these instances, no additional primer grafting is performed.

[0244] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in Figure 3L). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to the second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to the second functionalized layer 26. Conversely, after applying the second functionalized layer 26 (e.g., in Figure 3M), initiators 38, 40, or 38', 40' can be grafted, provided that i) the second functionalized layer 26 has different functional groups for attaching initiators 38, 40, or 38', 40' (compared to the first functionalized layer 24), or ii) the unreacted functional groups of the functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0245] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0246] Referring back to Figure 3C (where parts of 64 and 66 have been exposed by etching), another example of the method is carried out according to Figures 3C to 3N.

[0247] As shown in Figure 3N, a first functionalized layer 24 is applied over the multilayer stack, particularly over the exposed portions 64 of the resin layer 50, the transparent substrate support 14', and the sacrificial layer 48. The first functionalized layer 24 can be any gel material described herein and can be applied using any suitable method. When beginning the methods shown in Figures 3A to 3C and Figures 3N to 3R, silanization or plasma ashing can be used to activate the transparent substrate support 14' to generate surface groups that can react with the functionalized layer 24. Therefore, the first functionalized layer 24 is covalently attached to portions 64' of the transparent substrate support 14'.

[0248] In this example, as shown in FIG3O, a negative photoresist is applied to the first functionalized layer 24, and is developed by exposing a portion of the negative photoresist to light energy passing through the transparent substrate support 14' to form an insoluble negative photoresist 52, and removing the soluble portion using a developer, as described with reference to FIG3D. The insoluble negative photoresist 52 is defined in the deeper portion 58 and the soluble negative photoresist is removed.

[0249] As shown in Figure 3P, the first functionalized layer 24 and the sacrificial layer 48 are etched at the shallower portion 60 to expose the second portion 64' of the transparent substrate support 14'. The downward arrow in Figure 3P indicates where the etching is performed. Dry etching can be used to remove the first functionalized layer 24. Plasma, such as 100% O2 plasma, air plasma, argon plasma, etc., can be used for this etching process. This etching process will remove the first functionalized layer 24 at the shallower portion 60, and will also remove the portion of the first functionalized layer 24 covering the resin layer 50. The sacrificial layer 48 at the shallower portion 60 is also removed by any suitable etching technique.

[0250] Next, using any suitable deposition technique, a second functionalized layer 26 is applied (as shown in Figure 3Q). As depicted, the second functionalized layer 26 is applied onto the second portion 64' of the insoluble negative photoresist 52, the resin layer 50, and the transparent substrate support 14'.

[0251] The insoluble negative photoresist 52 and the second functionalized layer 26 thereon can then be removed using any instance of a removal agent to expose the first functionalized layer 24. This is shown in Figure 3R. This removal process can be performed as described herein.

[0252] The remaining resin layer 50 can then be stripped. The stripping process removes i) at least 99% of the resin layer 50, and ii) the functionalized layers 24, 26 covering or attached to the resin layer 50. This stripping process can be performed as described herein (e.g., using DMSO, acetone, or an N-methyl-2-pyrrolidone (NMP)-based stripper). The sacrificial layer 48 is also removed by any suitable etching technique to expose the gap region 22 surrounding the functionalized pads 24', 26'. Although not shown in the stripping and removal process diagrams, it should be understood that the resulting structure is similar to that shown in FIG. 3I, because the functionalized pads 24', 26' remain adjacent to each other on the surface of the transparent substrate support 14' after the removal of the insoluble negative photoresist, stripping, and etching of the sacrificial layer. The functionalized pads 24' and 26' remain intact on the transparent substrate support 14', partly because the functionalized pads 24' and 26' are covalently attached to the transparent substrate support 14'.

[0253] Although a single set of functionalized pads 24', 26' is shown in FIG3I, it should be understood that the methods described with reference to FIG3A to FIG3C and FIG3N to FIG3R can be performed to produce an array of functionalized pads 24', 26' separated by gap regions 22 spanning the surface of the transparent substrate support 14'.

[0254] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26, and thus to pads 24', 26'. In some instances, primers 34, 36 or 34', 36' (not shown in Figures 3N to 3R) may be pre-grafted to functionalized layer 24, and thus pre-grafted to pad 24'. Similarly, primers 38, 40 or 38', 40' (not shown in Figures 3N to 3R) may be pre-grafted to functionalized layer 26, and thus pre-grafted to pad 26'. In these instances, no additional primer grafting is performed.

[0255] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in FIG. 3N). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to second functionalized layer 26. Instead, leads 38, 40, or 38', 40' may be grafted after second functionalized layer 26 is applied (e.g., in FIG. 3Q).

[0256] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0257] Figures 4A to 4I illustrate another example of a method for manufacturing the flow cell architecture of Figure 1B, which includes functionalized pads 24' and 26'.

[0258] This method also features a multilayer material stack, which includes a resin layer 50, a release layer 68 disposed thereunder, a sacrificial layer 48 disposed thereunder, and a transparent substrate support 14' disposed thereunder.

[0259] To create a multilayer stack, a sacrificial layer 48 is deposited on the transparent substrate support 14'. Any instance of the sacrificial layer 48 can be used, and any suitable technique disclosed herein can be used to deposit it. A release layer 68 is then deposited on the sacrificial layer 48. The release layer 68 may contain a release inhibitor or poly(methyl methacrylate) or titanium (Ti). The release layer 68 can be deposited using any suitable technique and cured using heat. Figure 4A shows the transparent substrate support 14' positioned below the sacrificial layer 48.

[0260] Resin layer 50 is then deposited onto release layer 68, as shown in FIG. 4B. Resin layer 50 may be any of the example resins described herein and may be deposited using any suitable technique disclosed herein. In one example, resin layer 50 is a release inhibitor. As shown in FIG. 4B, resin layer 50 is imprinted to form a recessed area 56 comprising a deeper portion 58 and a shallower portion 60 defined by stepped portions 62. Any suitable imprinting technique may be used. In one example, a working impression and curing may be used as described with reference to FIG. 3B. In this example method, the working impression does not extend through the entire depth of resin layer 50, and therefore the underlying release layer 68 is not exposed after imprinting (as shown in FIG. 4B).

[0261] Next, the multilayer stack is selectively etched to expose portion 64 of the transparent substrate support 14' at the deeper portion 58 and portion 66 of the sacrificial layer 48 at the shallower portion 60. The downward arrows in Figure 4C indicate where the etching occurs. During this etching process, the resin layer 50 is removed, but guidelines or patterns are provided for etching the underlying layers 68, 48. For example, because the portion of resin layer 50 at the deeper portion 58 is thinner than at the shallower portion 60 and elsewhere, the release layer 68 and sacrificial layer 48 at the deeper portion 58 are also etched away. This exposes portion 64 of the transparent substrate support 14'. Because the portion of resin layer 50 at the shallower portion 60 is thicker than at the deeper portion 58, the release layer 68 at the shallower portion 60 is etched away, but the sacrificial layer 48 at the shallower portion 60 is not etched away. This exposes portion 66 of the sacrificial layer 48. Other portions of the release layer 68 are not etched because they are located beneath the thickest portion of the resin layer 50. In some instances, etching portions of resin layer 50, release layer 68, and sacrificial layer 48 may involve dry etching processes, such as anisotropic oxygen plasma or a mixture of 90% CF4 and 10% O2 plasma.

[0262] In this example, as shown in Figure 4D, a negative photoresist is applied to a multilayer stack, and is developed by exposing portions of the negative photoresist to light energy passing through the transparent substrate support 14' and removing soluble portions using a developer, as described with reference to Figure 3D. Insoluble negative photoresist 52 is defined in the deeper portions 58, and soluble negative photoresist is removed using a developer.

[0263] At the exposed portion 66, the sacrificial layer 48 is etched, as indicated by the downward arrow in Figure 4E. As examples, the aluminum sacrificial layer can be removed under acidic or alkaline conditions, the copper sacrificial layer can be removed using FeCl3, the copper, gold, or silver sacrificial layers can be removed in iodine and iodide solutions, and the silicon sacrificial layer can be removed under alkaline (pH) conditions. In these examples, the transparent substrate support 14' acts as an etch stop layer for the sacrificial layer etching process. In other examples, dry etching (e.g., reactive ion etching with BCl3 + Cl2) can be used and can be stopped when the second portion 64' of the transparent substrate support 14' is exposed. Thus, the portion 66 of the etched sacrificial layer 48 exposes the second portion 64' of the transparent substrate support 14'.

[0264] In Figure 4F, the first functionalized layer 24 is then applied to the second portion 64' of the transparent substrate support 14' using any suitable deposition technique. In this example, the first functionalized layer 24 is also deposited on the remaining release layer 68 and the insoluble negative photoresist 52.

[0265] When beginning the methods shown in Figures 4A to 4I, silanization or plasma ashing can be used to activate the transparent substrate support 14' to generate surface groups that can react with the functionalized layer 24. Thus, the functionalized layer 24 is covalently attached to the second portion 64' of the transparent substrate support 14'.

[0266] Removal of the insoluble negative photoresist 52 can then be performed using any instance of a removal agent to re-expose portion 64 of the transparent substrate support 14' at the deeper portion 58. As shown in FIG4G, this process removes the insoluble negative photoresist 52 and the functionalized layer 24 overlying the insoluble negative photoresist 52. This removal process can be performed as described herein.

[0267] As shown in Figure 4H, a second functionalized layer 26 can then be applied to the portion 64 of the transparent substrate support 14' at the deeper portion 58. The second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) can be applied using any suitable deposition technique. In this example, when the gel material is deposited under high ionic strength (e.g., in the presence of 10× PBS, NaCl, KCl, etc.), the second functionalized layer 26 does not deposit on or adhere to the first functionalized layer 24. Therefore, the second functionalized layer 26 does not contaminate the first functionalized layer 24.

[0268] The remaining release layer 68 can then be removed. As shown in Figure 4I, the stripping process removes i) at least 99% of the release layer 68 and ii) the functionalized layer 24 covering or attached to the release layer 68. This stripping process can be performed using sonic treatment in dimethyl sulfoxide (DMSO), or in acetone, or with a stripping agent based on N-methyl-2-pyrrolidone (NMP). When titanium is used as the release layer 68, it can be stripped using wet etching in H₂O₂.

[0269] This ensures that the functionalized pads 24' and 26' remain adjacent to each other on the surface of the transparent substrate support 14'. The functionalized pads 24' and 26' remain intact on the transparent substrate support 14', partly because the functionalized pads 24' and 26' are covalently attached to the transparent substrate support 14'.

[0270] The removal of the remaining release layer 68 also leaves the sacrificial layer 48 at least substantially intact on the transparent substrate support 14'. The sacrificial layer 48 is then removed to expose the gap region 22 surrounding the functionalized pads 24', 26'. This is depicted in Figure 4I. Any suitable etching technique can be used for the sacrificial layer 48. It should be understood that the functionalized pads 24', 26' are covalently attached to the transparent substrate support 14' and are therefore not removed during the sacrificial layer etching.

[0271] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26, and thus to pads 24', 26'. In some instances, primers 34, 36 or 34', 36' (not shown in Figures 4A to 4I) may be pre-grafted to functionalized layer 24, and thus pre-grafted to pad 24'. Similarly, primers 38, 40 or 38', 40' (not shown in Figures 4A to 4I) may be pre-grafted to functionalized layer 26, and thus pre-grafted to pad 26'. In these instances, no additional primer grafting is performed.

[0272] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in FIG. 4F). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to the second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to the second functionalized layer 26. Conversely, after applying the second functionalized layer 26 (e.g., in FIG. 4H), initiators 38, 40, or 38', 40' can be grafted, provided that i) the second functionalized layer 26 has different functional groups for attaching initiators 38, 40, or 38', 40' (compared to the first functionalized layer 24), or ii) the unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0273] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0274] Figures 24A to 24J illustrate two additional examples of a method for fabricating the flow cell architecture of Figure 1B, which includes functionalized pads 24' and 26'.

[0275] Similar to some of the other methods disclosed herein, these methods also have a multilayer material stack including a resin layer 50, an underlying sacrificial layer 48, and an underlying transparent substrate support 14'.

[0276] The transparent substrate support 14' can be any of the examples disclosed herein, as long as it is transparent to the ultraviolet wavelength used for back-side exposure. In the example shown in FIG24A, the transparent substrate support 14' comprises two layers, such as tantalum pentoxide or another transparent layer supported by glass.

[0277] To create an example of a multilayer stack, a sacrificial layer 48 is deposited on a transparent substrate support 14'. Any example of the sacrificial layer 48 disclosed herein blocks ultraviolet wavelengths used for back-side exposure, and it can be deposited using any suitable technique disclosed herein. A resin layer 50 is then deposited on the sacrificial layer 48. The resin layer 50 can be any of the example resins described herein, and can be deposited using any suitable technique disclosed herein.

[0278] As shown in Figure 24B, the resin layer 50 is imprinted to form a multi-height raised area 88, which includes a first area having a first height H1 and a second area having a second height H2 less than the first height. Any suitable imprinting technique can be used. In one example, a working mold and curing can be used as described with reference to Figure 3B. In this example method, the working mold does not extend through the entire depth of the resin layer 50, and therefore the underlying sacrificial layer 48 is not exposed after imprinting (as shown in Figure 24B).

[0279] The method is continued according to Figure 24C. In this example, the multilayer stack is then selectively etched around the multi-height protrusion region 88 to expose a portion 64 of the transparent substrate support 14'. In this example, the portion 64 of the transparent substrate support 14' is etched to expose the multilayer stack, while the portion of the multilayer stack below the multi-height protrusion region 88 remains unetched. This effectively extends the multi-height protrusion region 88 downwards to the transparent substrate support 14'.

[0280] In this example, the resin layer 50 may be etched, followed by the etching of a portion of the sacrificial layer 48. Any exposed areas of these layers surrounding the multi-height protrusion region 88 may be etched during this process, as indicated by the downward arrow in Figure 24C. It should be understood that the entire resin layer 50 may be exposed to etching, and thus the first height H1 and the second height H2 are reduced. However, because the portion 90 of the resin layer 50 surrounding the multi-height protrusion region 88 is thinner than each of the first height H1 and the second height H2, the sacrificial layer 48 beneath this portion 90 will be exposed before the multi-height protrusion region 88 is etched away.

[0281] Different etching techniques can be used for the resin layer portion 90 and the underlying sacrificial layer 48. In one example, dry etching is used for the resin layer portion 90, such as with CF4 plasma or a mixture of 90% CF4 and 10% O2 plasma, and for the sacrificial layer 48, a chlorine-based plasma (e.g., BCl3+Cl2) is used. For the sacrificial layer etching, the transparent substrate support 14' (in this example, the outermost transparent layer) effectively acts as an etching stop layer.

[0282] The multilayer stack is then used to develop the negative photoresist 52' via the transparent substrate support 14' to define an insoluble negative photoresist 52 at a portion 64 of the transparent substrate support 14'. The negative photoresist deposition and development are shown in Figures 24D and 24E and can be performed as described herein with reference to Figure 3D. Any example of negative photoresist 52' can be used, and any deposition technique can be used to deposit the negative photoresist 52' on the multilayer stack, as shown in Figure 24D. In this example, it is desirable that the insoluble negative photoresist 52 remain on the portion 64 of the transparent substrate support 14' and be removed from the resin layer 50. Thus, in the example shown in Figure 24D, light can be directed through the transparent substrate support 14'. The negative photoresist 52' on portion 64 will be exposed to light and will become insoluble. The sacrificial layer 48 blocks at least 75% of the light transmitted through the transparent substrate support 14', thus at least substantially preventing light from reaching the negative photoresist 52' disposed on the resin layer 50 and the sacrificial layer 48. The portions not exposed to light energy remain soluble and are removed with a developer. Figure 24E shows the multilayer stack after development of the negative photoresist 52'.

[0283] Next, the multi-height bump 88 is selectively etched to remove a portion of the resin layer 50 and sacrificial layer 48 below the second region H2 of the multi-height bump 88, thereby exposing the second portion 64' of the transparent substrate support 14' (which effectively acts as an etch stop layer). Different etching techniques can be used for the portion of the resin layer 50 and sacrificial layer 48 below the second height H2. In one example, dry etching (e.g., CF4 plasma or a mixture of 90% CF4 and 10% O2 plasma) is used for the resin layer 50, and a chlorine-based plasma (e.g., BCl3+Cl2) is used for the sacrificial layer 48. Due to the height difference of the resin layer 50, the third portion 64'' of the sacrificial layer 48 below the first height H1 remains at least substantially intact after etching is complete. The multilayer stack after etching is shown in Figure 24F.

[0284] As shown at Figure 24G, the first functionalized layer 24 is then applied to the multilayer stack. More specifically, the first functionalized layer 24 is applied to the exposed portion 64' of the transparent substrate support 14', the remaining sacrificial layer 48, and the insoluble negative photoresist 52. The first functionalized layer 24 can be applied using any suitable deposition technique.

[0285] Next, an example of the method is performed according to Figure 24H. In this example, the remaining portion of the sacrificial layer 48 is removed to expose a third portion 64'' of the transparent substrate support 14'. For removal, the sacrificial layer 48 may be exposed to a suitable wet stripping process. As shown in Figure 24H, this wet stripping process removes i) at least 99% of the sacrificial layer 48 and ii) the first functionalized layer 24 thereon. This process exposes portion 64'' of the transparent substrate support 14'. During the formation of the multilayer stack (e.g., in Figure 24A), the transparent substrate support 14' (e.g., the outermost transparent layer) may be activated using silanization or plasma ashing to generate surface groups that can react with functionalized layers 24 and 26. Thus, the first functionalized layer 24 is covalently attached to portion 64' and is therefore unaffected by the removal of the sacrificial layer 48.

[0286] Next, a second functionalized layer 26 is applied to another (third) portion 64'' of the transparent substrate support 14'', as shown in FIG24I. The second functionalized layer 26 can be applied using any suitable deposition technique, and when deposition is performed under high ionic strength (e.g., in the presence of 10× PBS, NaCl, KCl, etc.), the second functionalized layer 26 does not deposit on or adhere to the first functionalized layer 24. Therefore, portion 64'' receives the second functionalized layer 26.

[0287] Next, the insoluble negative photoresist 52 can be removed. Although the insoluble negative photoresist 52 is insoluble in the developer, it is soluble (at least 99% soluble) in the remover. Suitable removers include dimethyl sulfoxide (DMSO) or acetone treated with acoustic waves, or N-methyl-2-pyrrolidone (NMP)-based strippers. As shown in Figure 24J, this process removes the insoluble negative photoresist 52 and the functionalized layer 24 coated on the insoluble negative photoresist 52.

[0288] After the insoluble negative photoresist 52 is removed, the functionalized pads 24' and 26' remain intact and are surrounded by the gap region 22 of the transparent substrate support 14'.

[0289] Referring back to Figure 24G, another example of the method is then presented according to Figure 24K. This example method involves developing a second negative photoresist using a multilayer stack via a second portion 64' of a transparent substrate support 14' to define a second insoluble negative photoresist 52B at the second portion 64' of the transparent substrate support 14'. It may be desirable that the second negative photoresist is the same as the negative photoresist 52', thereby allowing the insoluble negative photoresist 52 and 52B to be removed simultaneously.

[0290] In this example, it is desirable that the second insoluble negative photoresist 52B remain on portion 64' of the transparent substrate support 14' and be removed from the remainder of the multilayer stack. Thus, in the example shown in FIG24K, the second negative photoresist can be applied to the entire multilayer stack, and light can then be guided through the transparent substrate support 14'. The second negative photoresist on portion 64' will be exposed to light and will become insoluble. The sacrificial layer 48 and the insoluble photoresist 52 block at least 75% of the light transmitted through the transparent substrate support 14', thus at least substantially preventing light from reaching the second negative photoresist thereon. The portion of the second negative photoresist not exposed to light energy remains soluble and is removed with a developer. FIG24K shows the multilayer stack after the second negative photoresist has been developed.

[0291] In this example, the remaining portion of the sacrificial layer 48 is removed to expose the third portion 64'' of the transparent substrate support 14', and then the second functionalized layer 26 is applied to the third portion 64'' of the transparent substrate support 14''. Both of these processes are shown in Figure 24L.

[0292] For removal, the sacrificial layer 48 can be exposed to a suitable wet stripping process. As shown in Figure 24L, this wet stripping process removes at least 99% of the sacrificial layer 48. The functionalized layer 24 disposed on the sacrificial layer 48 can also be removed during this process. This process exposes a portion 64'' of the transparent substrate support 14'. The second insoluble negative photoresist 52B and the underlying first functionalized layer 24 are unaffected by the removal of the sacrificial layer 48.

[0293] Next, a second functionalized layer 26 is applied to the third portion 64'' of the transparent substrate support 14''. The second functionalized layer 26 can be applied using any suitable deposition technique, and when deposition is performed at high ionic strengths (e.g., in the presence of 10× PBS, NaCl, KCl, etc.), the second functionalized layer 26 does not deposit on or adhere to the first functionalized layer 24. Therefore, portion 64'' receives the second functionalized layer 26.

[0294] Next, the insoluble negative photoresist 52 and the second insoluble negative photoresist 52B can be removed. Any suitable removal agent for the insoluble negative photoresist 52 and the second insoluble negative photoresist 52B can be used, such as dimethyl sulfoxide (DMSO) or acetone treated with sonication, or an N-methyl-2-pyrrolidone (NMP)-based stripper. As shown in Figure 24J, this process removes the insoluble negative photoresist 52, the second insoluble negative photoresist 52B, and the first and / or second functionalized layers 24 and 26 coated on the insoluble negative photoresists 52 and 52B.

[0295] It should be understood that the functionalized pads 24' and 26' are covalently attached to the transparent substrate support 14' and are therefore not removed during the removal of photoresist 52 and 52B. The functionalized pads 24' and 26' remain intact and are surrounded by the gap region 22 of the transparent substrate support 14'.

[0296] Although not shown in the figures, the methods described in Figures 24A to 24J also include attaching individual primer groups 30, 32 to functionalized layers 24, 26, and thus to pads 24', 26'. In some instances, primers 34, 36 or 34', 36' (not shown in Figures 24A to 24J) may be pre-grafted to functionalized layer 24, and thus pre-grafted to pad 24'. Similarly, primers 38, 40 or 38', 40' (not shown in Figures 24A to 24J) may be pre-grafted to functionalized layer 26, and thus pre-grafted to pad 26'. In these instances, no additional primer grafting is performed.

[0297] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in FIG. 24G). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to second functionalized layer 26. Conversely, after applying the second functionalized layer 26 (e.g., in Figure 24I or Figure 24L), initiators 38, 40, or 38', 40' may be grafted, provided that i) the functionalized layer 26 has different functional groups for attaching initiators 38, 40, or 38', 40' (compared to the first functionalized layer 24), or ii) the unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0298] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0299] Other examples of the method for fabricating the flow cell architecture of Figure 1B utilize a self-aligned mask. The self-aligned mask includes two sacrificial layers configured to define a functionalized region pattern. These layers and patterns are used throughout the method to define functionalized pads 24' and 26'.

[0300] Figures 5A to 5C collectively illustrate the formation of a multilayer stack including a self-aligned photomask. The multilayer stack includes a transparent substrate support 14'; a sacrificial layer 48 on the transparent substrate support 14', the sacrificial layer 48 defining a second functionalized region pattern 70 exposing the transparent substrate support (e.g., portion 64); a transparent layer 72 on the sacrificial layer 48 and on the second functionalized region pattern 70 on the transparent substrate support 14'; and a second sacrificial layer 48' on the transparent layer 72, the second sacrificial layer 48' defining a first functionalized region pattern 74 exposing the transparent layer 72 (e.g., at portion 76), wherein the first functionalized region pattern 74 overlaps with a portion 78 of the second functionalized region pattern 70 (see Figure 5D).

[0301] The top view of the second sacrificial layer 48' in Figure 5E illustrates that the shape of the first functionalized region pattern 74 is consistent with the desired shape of the first functionalized pad 24' to be formed. Therefore, when the first functionalized layer 24 is deposited at the first functionalized region pattern 74, the pad 24' is formed.

[0302] The top view of the second sacrificial layer 48 in Figure 5D illustrates that the shape of the second functionalized region pattern 74 has a portion 78 that overlaps with the shape of the functionalized region pattern 74, and another portion 80 that conforms to the desired shape of the second functionalized layer pad 26' to be formed. Therefore, when the second functionalized layer 26 is deposited at the portion 80 of the second functionalized region pattern 70, the pad 26' is formed.

[0303] In one example, to create this multilayer stack, a sacrificial layer 48 is deposited on a transparent substrate support 14', as shown in FIG5A. Any example of the sacrificial layer 48 described herein can be used in this example method, provided that it is opaque or non-opaque to the light energy being used for back-side exposure. In one example, the sacrificial layer 48 may comprise any UV-opaque or non-opaque metal or UV-opaque half-metal, such as titanium, chromium, platinum, aluminum, copper, silicon, etc. In one example, the sacrificial layer 48 comprises chromium. Using selective deposition techniques (e.g., masking and coating), the sacrificial layer 48 is deposited, thereby defining the second functionalized region pattern 70.

[0304] As shown in Figure 5B, the transparent layer 72 is then applied to the sacrificial layer 48 and the transparent substrate support 14' at the second functionalized region pattern 70 using any suitable deposition technique.

[0305] A second sacrificial layer 48' is deposited on the transparent layer 72, as shown in FIG5C. While it is desirable that the second sacrificial layer 48' be opaque or non-transparent to light used for back-side exposure, it is also desirable that the second sacrificial layer 48' be easily removable. Examples of suitable materials for the second sacrificial layer 48' include silicon (removable under alkaline (pH) conditions), aluminum (removable under acidic or alkaline conditions), gold (removable in a mixture of iodine and iodides), silver (removable in a mixture of iodine and iodides), titanium (removable in H₂O₂), or copper (removable in a mixture of iodine and iodides). The second sacrificial layer 48' is deposited using selective deposition techniques (e.g., masking and coating) to define the first functionalized region pattern 74.

[0306] Two different example methods using this multilayer stack are illustrated in Figures 6A through 6L. One example is shown in Figures 6A through 6G. Another example is shown in Figures 6A, 6H through 6L, and 6D through 6G. Figure 6G shows the functionalized pads 24' and 26 produced by each of these methods. These methods generally include providing a multilayer stack (shown in Figure 5C), developing a positive photoresist 82 using the multilayer stack via a transparent substrate support 14' (Figures 6D and 6H) to define an insoluble positive photoresist 82' at a predetermined area of ​​the multilayer stack (Figure 6E); defining a first functionalized region (e.g., pad 24') corresponding to a first functionalized region pattern 74 using a second sacrificial layer 48'; and defining a second functionalized region (e.g., pad 26') at least partially corresponding to a second functionalized region pattern 70 using an insoluble positive photoresist 82'.

[0307] Figure 6A depicts the multilayer stack of Figure 5C. In one example method, as shown in Figure 6B, a first functionalized layer 24 is then applied onto the second sacrificial layer 48' and the transparent layer 72 at the first functionalized region pattern 74 using any suitable deposition technique. In one example, the first functionalized layer 24 is applied using dip coating.

[0308] The second sacrificial layer 48' may be exposed to the stripping process. Any suitable wet stripping process can be used, such as soaking, sonication, or rotation and dispensing of stripping liquid. The stripping process removes the second sacrificial layer 48' and the first functionalized layer 24 thereon. This process exposes the remaining portion 76' of the transparent layer 72. This process also forms the first functionalized layer pad 24' (whose shape corresponds to the first functionalized region pattern 74). During the formation of the multilayer stack (e.g., in FIG. 5B), the transparent layer 72 can be activated by silanization to generate surface groups that can react with the functionalized layer 24. Thus, the functionalized layer 24 is covalently attached to portion 76 of the transparent layer 72.

[0309] In this example of the method, a multilayer stack is used to develop the positive photoresist 82 after the second sacrificial layer 48' is peeled off and the first functionalized pad 24' is defined. In this example, developing the positive photoresist 82 using a multilayer stack first involves applying the positive photoresist 82 onto the transparent layer 72 and the first functionalized region 24' (as shown in FIG6D).

[0310] Examples of suitable positive photoresists 82 include the MICROPOSIT® S1800 series or the AZ® 1500 series, both available from Kayaku Advanced Materials. Another example of a suitable positive photoresist is SPR™-220 (from DuPont). Positive photoresist 82 can be applied using any suitable deposition technique disclosed herein. When using positive photoresist 82, selective exposure to certain wavelengths of light forms soluble regions (e.g., at least 95% soluble in the developer), and the developer is used to remove these soluble regions. The portions of positive photoresist 82 not exposed to light will become insoluble in the developer. Examples of suitable developers for positive photoresists include alkaline aqueous solutions, such as diluted sodium hydroxide, diluted potassium hydroxide, or aqueous solutions of metal-ion-free organic tetramethylammonium hydroxide (TMAH).

[0311] In this example, developing the positive photoresist 82 using multilayer stacking involves exposing the positive photoresist 82 to light (e.g., ultraviolet light) passing through the transparent substrate support 14', wherein the portion of the positive photoresist 82 coated on the second functionalized region pattern 70 becomes soluble, and the portion of the positive photoresist 82 coated on the sacrificial layer 48 defines the insoluble positive photoresist 82'. The sacrificial layer 48 blocks at least 75% of the light transmitted through the transparent substrate support 14' and the transparent layer 72 from reaching the positive photoresist 82 directly disposed co-located with the sacrificial layer 48. Therefore, these portions become insoluble portions 82'. In contrast, the transparent layer 72 transmits light through the second functionalized region pattern 70, and the functionalized layer pad 24' transmits light through a portion 78 of the second functionalized region pattern 70. Therefore, the portion of the positive photoresist coated on the entire second functionalized region pattern 70 remains soluble in the developer. For example, a developer is used to remove the soluble portion to reveal the first functionalized region (e.g., pad 24') and another portion 76' of the transparent layer 72, which covers the second portion 80 of the second functionalized region pattern 70. The second portion 80 has the desired shape of the functionalized pad 26', and therefore the other portion 76' directly covers the second portion 80 as well. The resulting structure is shown in Figure 6E.

[0312] At least 95% of the soluble portion of the positive photoresist is soluble in the developer. After the positive photoresist is exposed to the developer, the multilayer stack can be exposed to O2 plasma to clean, for example, the exposed portion 76'.

[0313] The second functionalized region (e.g., pad 26') is then defined using an insoluble positive photoresist 82', which involves applying the second functionalized layer 26 onto the insoluble positive photoresist 82' and onto the exposed portion 76' of the transparent layer 72 (as shown in FIG. 6F); and stripping the insoluble positive photoresist 82' and any second functionalized layer 26 thereon (as shown in FIG. 6G).

[0314] The second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) can be applied using any suitable deposition technique. In this example, when the deposition of the gel material is performed under high ionic strength (e.g., in the presence of 10× PBS, NaCl, KCl, etc.), the second functionalized layer 26 does not deposit on or adhere to the first functionalized pad 24'. The portion 76' has the desired shape of the functionalized pad 26', and therefore the portion in which the second functionalized layer 26 is deposited is also such a portion.

[0315] The insoluble positive photoresist 82' can be stripped using a stripping agent, such as dimethyl sulfoxide (DMSO) treated with sonication, acetone, propylene glycol monomethyl ether acetate, or an N-methyl-2-pyrrolidone (NMP)-based stripping agent. As shown in Figure 6G, the stripping process removes i) at least 99% of the insoluble positive photoresist 82' and ii) the functionalized layer 26 thereon. This stripping process leaves the functionalized pads 24' and 26' abutting each other on the surface of the transparent layer 72. The functionalized pads 24' and 26' remain intact on the transparent layer 72, partly because the functionalized pads 24' and 26' are covalently attached to the transparent layer 72.

[0316] Although a single set of functionalized pads 24', 26' is shown in FIG. 6G, it should be understood that the methods described with reference to FIG. 6A to FIG. 6G can be performed to produce an array of functionalized pads 24', 26' separated by gap regions 22 spanning the surface of the transparent layer 72.

[0317] Referring back to Figure 6A, another method example is then described with reference to Figure 6H. In this example of the method, a second sacrificial layer 48' is used to define the first functionalized region (e.g., pad 24' shown in Figure 6K). As shown in Figure 6H, this method involves applying a first positive photoresist 82'' onto the second sacrificial layer 48' and applying a transparent layer 72 at the pattern 74 of the first functionalized region. The first positive photoresist 82'' can be applied using any suitable deposition technique disclosed herein.

[0318] The first positive photoresist 82'' is exposed to light via the transparent substrate support 14', wherein the portion of the first positive photoresist 82'' covering the first functionalized region pattern 74 becomes soluble in the developer, and the portion of the positive photoresist 82'' covering the second sacrificial layer 48' defines a first insoluble positive photoresist 82''' (which is insoluble in the developer). The second sacrificial layer 48' blocks at least 75% of the light transmitted through the transparent substrate support 14' and the transparent layer 72 from reaching the positive photoresist 82'' directly disposed with the second sacrificial layer 48'. Thus, these portions become insoluble positive photoresist portions 82'''. In contrast, the transparent layer 72 transmits light from the second functionalized region pattern 70 and subsequently allows light to pass through the first functionalized region pattern 74 to reach the positive photoresist 82''. Therefore, the portion of the positive photoresist 82'' covering the first functionalized region pattern 74 remains soluble in the developer. For example, the soluble portion is removed using a developer to expose portion 76 of the transparent layer 72 at the first functionalized region pattern 74. The resulting structure is shown in Figure 6I.

[0319] After the positive photoresist is exposed to the developer, the multilayer stack can be exposed to O2 plasma to clean, for example, the exposed portion 76.

[0320] As shown at Figure 6J, a first functionalized layer 24 is then applied onto the insoluble positive photoresist 82''' and the transparent layer 72 at the first functionalized region pattern 74 using any suitable deposition technique. In one example, spin coating is used to apply the first functionalized layer 24. During multilayer stacking (e.g., in Figure 5B), silanization can be used to activate the transparent layer 72 to generate surface groups that can react with the functionalized layer 24. Thus, the functionalized layer 24 is covalently attached to a portion 76 of the transparent layer 72.

[0321] The insoluble positive photoresist 82''' can be stripped using a positive photoresist remover, such as a sonicated dimethyl sulfoxide (DMSO), acetone, propylene glycol monomethyl ether acetate, or an N-methyl-2-pyrrolidone (NMP)-based stripper. As shown in Figure 6K, the stripping process removes i) at least 99% of the insoluble positive photoresist 82''' and ii) the functionalized layer 24 thereon. This stripping process leaves the functionalized layer pad 24' at the first functionalized region pattern 74.

[0322] As shown in Figure 6L, the method then includes wet etching of the second sacrificial layer 48'. As an example, the aluminum sacrificial layer can be removed under acidic or alkaline conditions, the copper sacrificial layer can be removed using FeCl3, and the silicon sacrificial layer can be removed under alkaline (pH) conditions. In these examples, the transparent layer 72 acts as an etch stop layer for the second sacrificial layer etching process.

[0323] Continuing with this example of the method in Figure 6D, a multilayer stack is used to develop the positive photoresist 82 (Figure 6K) and define the first functionalized pad 24' (Figure 6L) after the second sacrificial layer 48' is peeled off. The development of the positive photoresist 82 using a multilayer stack can be performed as described with reference to Figures 6D and 6E, and the definition of the second functionalized region (e.g., pad 26') using the insoluble positive photoresist 82' can be performed as described with reference to Figures 6F and 6G.

[0324] Figures 7A through 7C collectively illustrate the formation of another example of a multilayer stack including another example of a self-aligned photomask. This multilayer stack includes a transparent substrate support 14'; a sacrificial layer 48 on the transparent substrate support 14', the sacrificial layer 48 defining a second functionalized region pattern 70' exposing the transparent substrate support (e.g., portion 64); a transparent layer 72 on the sacrificial layer 48 and at the second functionalized region pattern 70' on the transparent substrate support 14'; and a second sacrificial layer 48' on the transparent layer 72, the second sacrificial layer 48' defining a first functionalized region pattern 74' exposing the transparent layer 72 (e.g., at portion 76), wherein the first functionalized region pattern 74' is adjacent to the second functionalized region pattern 70'.

[0325] The top views of the sacrificial layer 48 in Figure 7D and the second sacrificial layer 48' in Figure 7E respectively illustrate that the shape of the first functionalized region pattern 70' is consistent with the required shape of the first functionalized layer pad 24' to be formed, and the shape of the second functionalized region pattern 70' is consistent with the required shape of the second functionalized layer pad 26' to be formed.

[0326] To create this multilayer stack, a sacrificial layer 48 is deposited on a transparent substrate support 14', as shown in FIG7A. Examples of suitable materials for the sacrificial layer 48 include those described herein, such as titanium, chromium, platinum, silicon, aluminum, copper, and their oxides. The sacrificial layer 48 is deposited using selective deposition techniques (e.g., masking and coating) to define the second functionalized region pattern 70'.

[0327] As shown in Figure 7B, the transparent layer 72 is then applied to the sacrificial layer 48 and the transparent substrate support 14' at the second functionalized region pattern 70' using any suitable deposition technique.

[0328] A second sacrificial layer 48' is deposited on the transparent layer 72, as shown in FIG7C. Examples of suitable materials for the second sacrificial layer 48' include silicon, aluminum, or copper. The second sacrificial layer 48' is deposited using selective deposition techniques (e.g., masking and coating) to define the first functionalized region pattern 74'.

[0329] Figure 8A depicts the multilayer stack of Figure 7C. As shown in Figure 8B, the first functionalized layer 24 is then applied onto the second sacrificial layer 48' and the transparent layer 72 at the first functionalized region pattern 74 using any suitable deposition technique. In one example, spin coating is used to apply the first functionalized layer 24.

[0330] The second sacrificial layer 48' may be exposed to the stripping process. Any suitable wet stripping process can be used, such as soaking, sonication, or rotation and dispensing of stripping liquid. As shown in FIG8C, this stripping process removes the second sacrificial layer 48' and the first functionalized layer 24 thereon. This process exposes the remaining portion 76' of the transparent layer 72. This process also forms the first functionalized layer pad 24' (whose shape corresponds to the first functionalized region pattern 74'). During the formation of the multilayer stack (e.g., in FIG7B), the transparent layer 72 can be activated by silanization to generate surface groups that can react with the functionalized layer 24. Thus, the functionalized layer 24 is covalently attached to portion 76 of the transparent layer 72.

[0331] In this example of the method, a multilayer stack is used to develop the positive photoresist 82 after the second sacrificial layer 48' is stripped and the first functionalized pad 24' is defined. In this example, developing the positive photoresist 82 using a multilayer stack first involves applying the positive photoresist 82 onto the transparent layer 72 and the first functionalized region 24' (as shown in FIG8D). Any suitable positive photoresist 82 can be used, and it can be applied using any suitable deposition technique disclosed herein.

[0332] In this example, developing the positive photoresist 82 using multilayer stacking involves exposing the positive photoresist 82 to light passing through the transparent substrate support 14', wherein the portion of the positive photoresist 82 coated on the second functionalized region pattern 70' becomes soluble in the developer, and the portion of the positive photoresist 82 coated on the sacrificial layer 48 defines an insoluble positive photoresist 82' (which is insoluble in the developer). The sacrificial layer 48 blocks at least 75% of the light transmitted through the transparent substrate support 14' and the transparent layer 72 from reaching the positive photoresist 82 directly disposed co-located with the sacrificial layer 48. Therefore, these portions become insoluble portions 82'. In contrast, the transparent layer 72 transmits light through the second functionalized region pattern 70'. Therefore, the portion of the positive photoresist coated on the second functionalized region pattern 70' remains soluble in the developer. For example, the soluble portion is removed with a developer to reveal the portion 76' of the transparent layer 72 covering the second functionalized region pattern 70'. The second functionalized region pattern 70' has the desired shape of the functionalized layer pad 26', and so does the other portion 76' directly covering the second functionalized region pattern 70'. The resulting structure is shown in Figure 8E.

[0333] At least 95% of the soluble portion of the positive photoresist is soluble in the developer. After the positive photoresist is exposed to the developer, the multilayer stack can be exposed to O2 plasma to clean, for example, the exposed portion 76'.

[0334] The second functionalized region (e.g., pad 26') is then defined using an insoluble positive photoresist 82', which involves applying the second functionalized layer 26 onto the insoluble positive photoresist 82' and onto the exposed portion 76' of the transparent layer 72 (as shown in FIG8F); and peeling off the insoluble positive photoresist 82' and the second functionalized layer 26 thereon (as shown in FIG8G).

[0335] The second functionalized layer 26 (e.g., the gel material forming the second functionalized layer 26) can be applied using any suitable deposition technique. The second functionalized layer 26 is not deposited on or adhered to the first functionalized pad 24' because the first functionalized pad 24' is covered by a positive photoresist 82'. The portion 76' has the desired shape of the functionalized pad 26', and therefore the portion in which the second functionalized layer 26 is deposited is also such a portion.

[0336] The insoluble positive photoresist 82' can be stripped using any positive photoresist remover, such as ultrasonically treated dimethyl sulfoxide (DMSO), acetone, propylene glycol monomethyl ether acetate, or an N-methyl-2-pyrrolidone (NMP)-based stripper. As shown in Figure 8G, the stripping process removes i) at least 99% of the insoluble positive photoresist 82' and ii) the functionalized layer 26 thereon. This stripping process leaves the functionalized pads 24' and 26' abutting each other on the surface of the transparent layer 72. The functionalized pads 24' and 26' remain intact on the transparent layer 72, partly because the functionalized pads 24' and 26' are covalently attached to the transparent layer 72.

[0337] Although a single set of functionalized pads 24', 26' is shown in FIG8G, it should be understood that the methods described with reference to FIG8A to FIG8G can be performed to produce an array of functionalized pads 24', 26' separated by gap regions 22 spanning the surface of the transparent layer 72.

[0338] Although not shown in the figures, each of the methods described with reference to Figures 6A to 6L and Figures 8A to 8G also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26, and thus to pads 24', 26'. In some instances, primers 34, 36 or 34', 36' (not shown in Figures 6A to 6L or Figures 8A to 8G) may be pre-grafted to functionalized layer 24, and thus pre-grafted to pad 24'. Similarly, primers 38, 40 or 38', 40' (not shown in Figures 6A to 6L or Figures 8A to 8G) may be pre-grafted to functionalized layer 26, and thus pre-grafted to pad 26'. In these instances, no additional primer grafting is performed.

[0339] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in Figures 6B to 6J or Figure 8B). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to the second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to the second functionalized layer 26. Instead, leads 38, 40, or 38', 40' may be grafted after the second functionalized layer 26 is applied (e.g., in Figure 6F or Figure 8F). In Figure 6F, initiators 38, 40 or 38', 40' can be grafted after the application of the second functionalized layer 26, provided that i) the second functionalized layer 26 has different functional groups (compared to the first functionalized layer 24) to which initiators 38, 40 or 38', 40' are attached, or ii) any unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0340] When grafting is performed during this method, any suitable grafting technique can be used to achieve the grafting.

[0341] [, Manufacturing drawings , ] [, 1C , ] [, Methods of Flow Pool Architecture , ]

[0342] Figures 9A to 9M illustrate two different examples of a method for fabricating the flow cell architecture of Figure 1C, including protrusions 28 supporting the first and second functionalized layers 24, 26. One example is shown in Figures 9A to 9H. Another example is shown in Figures 9A, 9B, and 9I to 9M.

[0343] Similar to some other methods disclosed herein, this method also features a multilayer material stack, including a resin layer 50, an underlying sacrificial layer 48, an underlying transparent layer 72, and at least one additional layer. The additional layer may include a masking layer 84, a hydrophobic layer 86, and / or a substrate support 14. Any substrate support 14 may be used in the methods shown in Figures 9A to 9H, and a transparent substrate support 14' may be used in the methods shown in Figures 9A, 9B, and 9I to 9M.

[0344] To create an example of a multilayer stack, a masking layer 84 or a hydrophobic layer 86 is deposited on a substrate support 14 or 14'. The masking layer 84 may be chromium or another material that can act as a photomask (e.g., titanium, aluminum, copper, silicon, etc.). Examples of the hydrophobic layer 86 may be selected from the group consisting of fluorinated polymers, perfluorinated polymers, silicone polymers, and mixtures thereof. As a specific example, the hydrophobic layer 86 may include amorphous fluoropolymers (commercially available examples include amorphous fluoropolymers of AGC Chemicals’ CYTOP® series, having one of the following terminal functional groups: A-type: -COOH, M-type: -CONH-Si(OR)n or S-type: -CF3); polytetrafluoroethylene (commercially available examples include Chemours’ TEFLON®); parylene; fluorinated hydrocarbons; fluoroacrylic acid copolymers (commercially available examples include Cytonix’s FLUOROPEL®). Any suitable deposition technique, including any of the examples disclosed herein, can be used to deposit the masking layer 84 or the hydrophobic layer 86 onto the substrate support 14 or 14'. Then, any suitable deposition technique, including any of the examples disclosed herein, can be used to deposit the transparent layer 72 onto the masking layer 84 or the hydrophobic layer 86. Any example of the transparent layer 72 can be used, and any suitable technique disclosed herein can be used to deposit it. A sacrificial layer 48 can then be deposited onto the transparent layer 72. Any example of the sacrificial layer 48 can be used, and any suitable technique disclosed herein can be used to deposit it. Figure 9A shows the substrate support 14, 14' positioned below the sacrificial layer 48, with the transparent layer 72 positioned below, the masking layer 84 or the hydrophobic layer 86 positioned below, and the substrate support 14, 14' positioned below.

[0345] Next, resin layer 50 is deposited on sacrificial layer 48, as shown in FIG9B. Resin layer 50 can be any of the example resins described herein and can be deposited using any suitable technique disclosed herein. In one example, resin layer 50 is a release inhibitor. As shown in FIG9B, resin layer 50 is imprinted to form a multi-height raised region 88, which includes a first region having a first height H1 and a second region having a second height H2 less than the first height. Any suitable imprinting technique can be used. In one example, a working impression and curing can be used as described with reference to FIG3B. In this example method, the working impression does not extend through the entire depth of resin layer 50, and therefore the underlying sacrificial layer 48 is not exposed after imprinting (as shown in FIG9B).

[0346] One example of the method continues according to FIG. 9C. In this example, a multilayer stack (including a mask layer 84) is then selectively etched around the multi-height bump region 88 to expose at least one of the additional layers, which is the transparent substrate support 14' in FIG. 9C. In this example, a portion 64 of the transparent substrate support 14' is etched to expose the multilayer stack, while the portion of the multilayer stack below the multi-height bump region 88 remains unetched. This effectively extends the multi-height bump region 88 downwards to the transparent substrate support 14'.

[0347] In this example, the resin layer 50 may be etched, followed by the etching of a portion of the sacrificial layer 48, a portion of the transparent layer 72, and a portion of the mask layer 84. Any exposed areas of these layers surrounding the multi-height protrusion region 88 may be etched during this process, as indicated by the downward arrow in Figure 9C. It should be understood that the entire resin layer 50 may be exposed to etching, and thus the first height H1 and the second height H2 are reduced. However, because the portion 90 of the resin layer 50 surrounding the multi-height protrusion region 88 is thinner than each of the first height H1 and the second height H2, the sacrificial layer 48 beneath this portion 90 will be exposed before the multi-height protrusion region 88 is etched away.

[0348] Different etching techniques can be used for the resin layer portion 90 and the underlying sacrificial layer 48. In one example, dry etching, such as with CF4 plasma or a mixture of 90% CF4 and 10% O2 plasma, is used for the resin layer portion 90, and a chlorine-based plasma (e.g., BCl3+Cl2) is used for the sacrificial layer 48. The transparent layer 72 effectively acts as an etch stop layer for the etching of the sacrificial layer. The transparent layer 72 can be etched using inductively coupled plasma (ICP) or reactive ion etching (REI). The mask layer 84 can be etched using BCl3+Cl2.

[0349] Next, the multi-height raised region 88 is selectively etched to remove a portion of the resin layer 50 and the sacrificial layer 48 below the second region H2 of the multi-height raised region 88, thereby exposing a portion 76 of the transparent layer 72 (which effectively acts as an etch stop layer). Different etching techniques can be used for the portion of the resin layer 50 and the sacrificial layer 48 below the second height H2. In one example, dry etching (e.g., CF4 plasma or a mixture of 90% CF4 and 10% O2 plasma) is used for the resin layer 50, and a chlorine-based plasma (e.g., BCl3+Cl2) is used for the sacrificial layer 48. Due to the height difference of the resin layer 50, the portion of the sacrificial layer 48 below the first height H1 remains at least substantially intact after etching is complete.

[0350] As shown in Figure 9E, the first functionalized layer 24 is then applied to the multilayer stack. More specifically, the first functionalized layer 24 is applied to the exposed portion 64 of the transparent substrate support 14', the remaining sacrificial layer 48, and the exposed portion 76 of the transparent layer 72. The first functionalized layer 24 can be applied using any suitable deposition technique.

[0351] The sacrificial layer 48 may then be exposed to a wet stripping process, such as any of the examples described herein for different sacrificial layer 48 materials. As shown in FIG9F, this wet stripping process removes i) at least 99% of the sacrificial layer 48 and ii) the first functionalized layer 24 thereon. This process exposes one or more other portions 76' of the transparent layer 72. During the formation of the multilayer stack (e.g., in FIG9A), the transparent layer 72 may be activated using silanization or plasma ashing to generate surface groups that can react with the functionalized layers 24 and 26. Thus, the first functionalized layer 24 is covalently attached to portion 76 of the transparent layer 72 and is therefore unaffected by the removal of the sacrificial layer 48.

[0352] Next, a second functionalized layer 26 is applied to another (second) portion 76' of the transparent layer 72, as shown in FIG9G. The second functionalized layer 26 can be applied using any suitable deposition technique, and when deposition is performed under high ionic strength (e.g., in the presence of 10× PBS, NaCl, KCl, etc.), the second functionalized layer 26 does not deposit on or adhere to the first functionalized layer 24. Therefore, portion 76' receives the second functionalized layer 26.

[0353] This example of the method further includes guiding UV light through a transparent substrate support 14', wherein a shielding layer 84 blocks at least 75% of the UV light transmitted through the transparent layer 72, and the transparent substrate support 14' transmits at least 25% of the UV light to a portion 92 of the first functionalized layer 24 located on the exposed portion 64 of the transparent substrate support 14', wherein the UV light deactivates the portion 92 of the first functionalized layer 24. Deactivation may involve photodamaging the grafted functional groups of the primers or photodamaging the attached primers 34, 36, or 34', 36'. In one example, the azide groups of the first functionalized layer 24 have a high absorption rate of UV wavelengths in the range of about 200 nm to about 300 nm, and therefore UV light can be used to photodamage the azide groups. Such functional groups in the deactivated portion 92 cannot participate in subsequent primer grafting. In another example, the initiators 34, 36, or 34', 36' pre-grafted onto the first functionalized layer 24 have high absorption rates in the UV wavelength range of about 280 nm to about 315 nm, and therefore UV light can be used to photodamage the initiators 34, 36, or 34', 36'. The initiators 34, 36, or 34', 36' in the deactivated portion 92 cannot participate in subsequent template strand capture and amplification. Because the masking layer 84 blocks at least 75% of the UV light from the remaining portions of the first functionalized layer 24 and the second functionalized layer 26, these layers 24, 26 remain intact. The deactivated portion 92 is schematically shown in Figure 9H.

[0354] The resulting structure includes a protrusion 28, which in this example includes a masking layer 84 and a transparent layer 72. This protrusion 28 supports the functionalized layers 24 and 26.

[0355] Although not shown in the figures, the methods described with reference to Figures 9A to 9H also include attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 9A to 9H) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 9A to 9H) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed. In these instances, the deactivation process causes photodamage to some of the pre-grafted primers 34, 36, or 34', 36' at location 92.

[0356] In other examples, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these examples, leads 34, 36, or 34', 36' may be grafted after the functionalized layer 24 is applied (e.g., in FIG. 9E). In these examples, the deactivation process causes photodamage to the functional groups of functionalized layer 24 at portion 92, and therefore leads 34, 36, or 34', 36' will not be grafted to these portions 92. In these examples, leads 38, 40, or 38', 40' may be pre-grafted to the second functionalized layer 26. Alternatively, in these examples, leads 38, 40, or 38', 40' may not be pre-grafted to the second functionalized layer 26. Conversely, after applying the second functionalized layer 26 (e.g., in FIG9G), initiators 38, 40 or 38', 40' may be grafted, provided that i) the second functionalized layer 26 has different functional groups (compared to the first functionalized layer 24) to which initiators 38, 40 or 38', 40' are attached, or ii) the unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0357] When grafting is performed during this method, any suitable grafting technique can be used to achieve the grafting.

[0358] Referring back to Figure 9B, we proceed to another example of the method based on Figure 9I. In this example, the multilayer stack includes a hydrophobic layer 86 and a substrate support 14 (which may be opaque).

[0359] At Figure 9I, a multilayer stack is selectively etched around the multi-height bump region 88 to expose at least one of the additional layers, which is the hydrophobic layer 86 in Figure 9I. In this example, the portion 94 of the etched layer exposing the hydrophobic layer 86 and the portion of the multilayer stack below the multi-height bump region 88 remain unetched. This effectively extends the multi-height bump region 88 down to the hydrophobic layer 86.

[0360] In this example, the resin layer 50 may be etched, followed by the etching of a portion of the sacrificial layer 48 and a portion of the transparent layer 72. Any exposed areas of these layers surrounding the multi-height protrusion region 88 may be etched during this process, as indicated by the downward arrows in Figure 9I. It should be understood that the entire resin layer 50 may be exposed to etching, and thus the first height H1 and the second height H2 are reduced. However, because the portion 90 of the resin layer 50 surrounding the multi-height protrusion region 88 is thinner than each of the first height H1 and the second height H2, the sacrificial layer 48 beneath this portion 90 will be exposed before the multi-height protrusion region 88 is etched away.

[0361] Different etching techniques can be used for the resin layer portion 90 and the underlying sacrificial layer 48. In one example, dry etching (e.g., a mixture of 90% CF4 and 10% O2 plasma) is used for the resin layer portion 90, and a chlorine-based plasma (e.g., BCl3 + Cl2) is used for the sacrificial layer 48. The transparent layer 72 effectively acts as an etch stop layer for etching the sacrificial layer. The transparent layer 72 can be etched using inductively coupled plasma (ICP) or reactive ion etching (REI). Due to the different etch rates, the hydrophobic layer 86 acts as an etch stop layer for etching the transparent layer 72.

[0362] Next, the multi-height raised region 88 is selectively etched to remove a portion of the resin layer 50 and sacrificial layer 48 below the second region H2 of the multi-height raised region 88, thereby exposing a portion 76 of the transparent layer 72 (which effectively acts as an etch stop layer). The multilayer stack resulting from this etching process is shown in Figure 9J. Different etching techniques can be used for the portion of the resin layer 50 and sacrificial layer 48 below the second height H2. In one example, dry etching (e.g., with a mixture of 90% CF4 and 10% O2 plasma) is used for the resin layer 50, and a chlorine-based plasma (e.g., BCl3 + Cl2) is used for the sacrificial layer 48. Due to the height difference of the resin layer 50, the portion of the sacrificial layer 48 below the first height H1 remains at least substantially intact after etching is complete.

[0363] As shown at Figure 9K, a first functionalized layer 24 is then applied to the multilayer stack. More specifically, the first functionalized layer 24 is applied to the exposed portion 76 of the remaining sacrificial layer 48 and the transparent layer 72. In contrast, the first functionalized layer 24 is not attached (e.g., covalently bonded) to the exposed portion 94 of the hydrophobic layer 86. Instead, the hydrophobicity of the hydrophobic layer 86 repels the gel material of the first functionalized layer 24, and therefore it does not deposit on portion 94 or is loosely applied to portion 94. During the formation of the multilayer stack (e.g., in Figure 9A), the transparent layer 72 can be activated by silanization to generate surface groups that can react with functionalized layers 24 and 26. Thus, the functionalized layer 24 is covalently attached to portion 76 of the transparent layer 72. Due to the different interactions at portion 76 and portion 94, the functionalized layer 24 remains on portion 76 and can be easily removed from portion 94 (e.g., via sonication, washing, wiping, etc.).

[0364] The first functionalized layer 24 can be applied using any suitable deposition technique.

[0365] The sacrificial layer 48 can then be exposed to a wet stripping process. As shown in Figure 9L, this stripping process removes i) at least 99% of the sacrificial layer 48 and ii) the first functionalized layer 24 thereon. This process exposes one or more other portions 76' of the transparent layer 72. The first functionalized layer 24 is covalently attached to portions 76 of the transparent layer 72 and is therefore not adversely affected during the removal of the sacrificial layer 48.

[0366] Next, a second functionalized layer 26 is applied to another (second) portion 76' of the transparent layer 72, as shown in FIG9M. The second functionalized layer 26 can be applied using any suitable deposition technique, and when deposition is performed under high ionic strength (e.g., in the presence of 10× PBS, NaCl, KCl, etc.), the second functionalized layer 26 does not deposit on or adhere to the first functionalized layer 24. Therefore, portion 76' receives the second functionalized layer 26.

[0367] The resulting structure includes a protrusion 28, which in this example includes a transparent layer 72. This protrusion 28 supports the functionalized layers 24 and 26.

[0368] Although not shown in the figures, the methods described with reference to Figures 9A, 9B, and 9I through 9M also include attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 9A, 9B, or 9I through 9M) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 9A, 9B, or 9I through 9M) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed.

[0369] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in Figure 9K). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to the second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to the second functionalized layer 26. Conversely, after applying the second functionalized layer 26 (e.g., in FIG9M), initiators 38, 40, or 38', 40' may be grafted, provided that i) the second functionalized layer 26 has different functional groups (compared to the first functionalized layer 24) to which initiators 38, 40, or 38', 40' are attached, or ii) any unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0370] When grafting is performed during this method, any suitable grafting technique can be used to achieve the grafting.

[0371] [, Manufacturing drawings , ] [, 1D , ] [, Methods of Flow Pool Architecture , ]

[0372] Several different methods can be used to produce the architecture shown in FIG1D, which includes recesses 20 supporting the first and second functionalized layers 24, 26.

[0373] Figures 10A to 10J together illustrate two examples of a method for manufacturing the flow cell structure of Figure 1D. One example method is shown in Figures 10A to 10G, and another example method is shown in Figures 10A, 10B, and 10H to 10J. These methods do not involve polishing the gap region 22 from which unwanted material is removed. The non-polishing method is simpler than the method that includes polishing.

[0374] As shown in Figure 10A, the substrate in this example is a multilayer structure 16 including a substrate support 14 and a layer 18 thereon. In this example, the substrate support 14 may be fused silica, and the layer 18 may be tantalum pentoxide or another transparent layer. In the example shown in Figure 10A, a recess 20 is defined in the substrate support 14 (e.g., via etching, imprinting, photolithography, etc.) and the layer 18 is coated thereon.

[0375] Although not shown in the figures, it may be desirable to remove tantalum pentoxide or another transparent layer from the gap region 22. In such cases, the method shown in Figures 10A to 10J may begin by removing the portion of layer 18 located at the gap region 22. For example, before applying the release material 96 and the blocking material 100, the method may include generating an insoluble photoresist in the recess 20; removing the tantalum pentoxide layer (e.g., layer 18) from the gap region 22 adjacent to the recess 20 while the insoluble photoresist is present in the recess 20; and removing the insoluble photoresist from the recess 20.

[0376] Negative or positive photoresist can be deposited and developed, such that insoluble portions (which are insoluble in the developer) remain in the recess 20, and soluble portions can be removed from the gap region 22 using the developer. Alternatively, negative or positive photoresist can be deposited and developed to coat the entire multilayer structure 16, and insoluble photoresist (e.g., insoluble negative photoresist 52 or insoluble positive photoresist 82') can be removed from the gap region 22 using timed dry etching.

[0377] Then, tantalum pentoxide or other transparent layers (e.g., layer 18) can be removed from the interstitial region 22 via an etching process, such as inductively coupled plasma (ICP) or reactive ion etching (REI).

[0378] The insoluble photoresist can then be removed from the recess 20, and the method can continue according to the example shown in FIG10A. A suitable removal agent for the specific material can be used to strip the insoluble photoresist (which is insoluble in the developer solution). Unlike the multilayer stack shown in FIG10A, if this process is performed, layer 18 will be present in the recess 20 but not on the gap region 22. Therefore, the substrate support 14 will be exposed at the gap region 22.

[0379] Examples of the methods shown in Figures 10A to 10J involve applying a release material 96 to a first portion 98 of a recess 20, wherein a second portion 98' of the recess 20 remains exposed; and applying a blocking material 100, which is different from the release material 96, to a gap region 22 adjacent to the recess 20. The release material 96 may fill the first portion 98 of the recess 20 or may be applied as a thinner layer coating the first portion 98 of the recess 20. As shown in Figure 10A, the release material 96 may not extend over the blocking layer 100. In other embodiments, the release material 96 may extend over the blocking layer 100 directly adjacent to the gap region 22 of the first portion 98 of the recess 20.

[0380] Examples of release material 96 include aluminum, copper, titanium, positive photoresist, or negative photoresist. Examples of blocking material 100 include any release material disclosed herein or any hydrophobic material described herein. Materials 96 and 100 should be different such that when material 96 is released, material 100 is not also removed. In some instances, when both materials 96 and 100 are release materials, i) release material 96 comprises a metal sacrificial layer, and the second release material (i.e., blocking layer 100) comprises a photoresist; or ii) release material 96 comprises a photoresist, and the second release material (i.e., blocking layer 100) comprises a metal sacrificial layer. In other instances, when aluminum is selected for release material 96, copper, a hydrophobic material, or a photoresist may be selected for blocking material 100; or when copper or a photoresist is selected for release material 96, aluminum or a hydrophobic material may be selected for blocking material 100.

[0381] These materials 96 and 100 can be applied in any order and using any technique suitable for the particular material. As an example, masking techniques can be used to selectively deposit aluminum, copper, or hydrophobic materials into desired locations. When a negative or positive photoresist is selectively used to remove material 96, the photoresist can be applied and developed to form an insoluble portion on portion 98 of the recess 20.

[0382] The method shown in Figures 10A to 10J generally includes applying a first functionalized layer 24 to a second portion 98' of the recess 20 (Figures 10B and 10C or Figures 10B and 10H); peeling off the release material 96 (Figure 10D or Figure 10I), thereby exposing a first portion 98 of the recess 20; and applying a second functionalized layer 26 to the first portion 98 of the recess 20 (Figures 10E and 10F or Figure 10J).

[0383] In these examples, applying the first functionalized layer 24 involves activating the second portion 98' of the recess 20 to generate surface groups that react with the first functionalized layer 24, and depositing the first functionalized layer 24. Figure 10B illustrates the activation of the second portion 98', which occurs when the release material 96 is positioned appropriately within the recess 20. This allows the exposed second portion 98' of the recess 20 to be activated while the covered first portion 98 remains inactive. In this example, surface activation can be achieved using silanization as described herein. This forms a silanized layer 54 on the second portion 98', which includes any portion of the recess 20 not covered by the release material 96 (e.g., sidewalls, bottom surface).

[0384] Next, following Figure 10C, one example of the method is performed, wherein a functionalized layer 24 is applied. In this example, the blocking layer 100 comprises a metal sacrificial material or a photoresist. As shown at Figure 10C, the functionalized layer 24 is deposited on the blocking layer 100, the silanized layer 54, and the release material 96. Any suitable deposition technique can be used.

[0385] The stripping material 96 can then be stripped. The stripping technique used will depend on the material used. For example, photoresist can be removed with a suitable stripping agent, such as dimethyl sulfoxide (DMSO) or acetone treated with ultrasound, or an N-methyl-2-pyrrolidone (NMP)-based stripping agent. In another example, a suitable alkali, such as potassium hydroxide (KOH) or sodium hydroxide (NaOH), can be used to strip aluminum stripping material 96. In yet another example, FeCl3 or a mixture of iodine and iodides can be used to remove copper stripping material 96, while a mixture of iodine and iodides can be used to remove gold stripping material 96.

[0386] As shown in Figure 10D, the peeling process removes i) at least 99% of the peeling material 96 (thus exposing the first portion 98 of the recess 20) and ii) the functionalized layer 24 covering or attached to the peeling material 96. Because the peeling material 96 and the blocking material 100 are different, the blocking material 100 and the functionalized layer 24 covering or attached to the blocking material 100 remain intact during the peeling of the peeling material 96. Furthermore, the functionalized layer 24 in the recess 20 remains intact because it is covalently attached to the silanized layer 54.

[0387] In this example method, a second functionalized layer 26 is then applied. In these examples, applying the second functionalized layer 26 involves activating the first portion 98 of the recess 20 to generate surface groups that react with the second functionalized layer 26, and depositing the second functionalized layer 26.

[0388] Figure 10E illustrates the activation of the first portion 98, which involves applying a second silanized layer 54' to the first portion 98. The second silanized layer 54' may be of the same type of silane or silane derivative as the silanized layer 54, or may be of a different type of silane or silane derivative compared to the silanized layer 54. Any suitable deposition technique can be used to apply the second silanized layer 54' (as shown in Figure 3L). In this example, the second silanized layer 54' is attached to the exposed portion 98 of the recess 20 and not to the first functionalized layer 24.

[0389] Next, using any suitable deposition technique, a second functionalized layer 26 is applied (as shown in Figure 10F). In this example, the second functionalized layer 26 is selectively attached to the second silanized layer 54', and when gel material deposition is performed under high ionic strength (e.g., in the presence of 10× PBS, NaCl, KCl, etc.), the second functionalized layer 26 does not deposit on or adhere to the first functionalized layer 24.

[0390] In this example method, the blocking material 100 can then be removed. Because the blocking material 100 contains a metal sacrificial material or a photoresist, removal may involve a suitable stripping process. As an example, the photoresist blocking material 100 can be removed in a suitable stripping agent, such as dimethyl sulfoxide (DMSO) or acetone treated with sonication, or an N-methyl-2-pyrrolidone (NMP)-based stripping agent. For another example, a suitable alkali, such as potassium hydroxide (KOH) or sodium hydroxide (NaOH), can be used to remove the aluminum blocking material 100. For yet another example, FeCl3 or a mixture of iodine and iodides can be used to remove the copper blocking material 100, while a mixture of iodine and iodides can be used to remove the gold blocking material 100.

[0391] As shown in Figure 10G, this stripping process removes i) at least 99% of the blocking material 100 and ii) the functionalized layer 24 covering or attached to the blocking material 100. The functionalized layers 24 and 26 in the recess 20 remain intact because they are respectively and covalently attached to the silanized layers 54 and 54'.

[0392] Referring back to Figure 10B, we proceed to another example of the method according to Figure 10H. In this example, the blocking material 100 is a hydrophobic material and is therefore referred to as blocking material 100, 86.

[0393] When the functionalized layer 24 is applied, as shown in FIG10H, it is deposited on the silanized layer 54 and the release material 96. In contrast, the first functionalized layer 24 does not attach (e.g., covalently bond) to the blocking materials 100, 86. Instead, the hydrophobicity of the blocking materials 100, 86 repels the gel material of the first functionalized layer 24, and therefore it does not deposit on the blocking materials 100, 86. The first functionalized layer 24 can be applied using any suitable deposition technique.

[0394] The stripping of the release material 96 may then be performed as described with reference to FIG10D. As an example, the photoresist release material 96 may be removed in a suitable removal agent, such as dimethyl sulfoxide (DMSO) or acetone treated with sonication, or an N-methyl-2-pyrrolidone (NMP)-based release agent. As another example, a suitable alkali, such as potassium hydroxide (KOH) or sodium hydroxide (NaOH), may be used to remove the aluminum release material 96. As yet another example, FeCl3 or a mixture of iodine and iodides may be used to remove the copper release material 96, while a mixture of iodine and iodides may be used to remove the gold release material 96. As shown in FIG10I, the stripping process removes i) at least 99% of the release material 96 (and thus exposes the first portion 98 of the recess 20) and ii) the functionalized layer 24 covering or attached to the release material 96. Because the release material 96 is different from the blocking material 100, the blocking material 100 remains intact during the removal of the release material 96. Furthermore, the functionalized layer 24 in the depression 20 remains intact because it is covalently attached to the silanized layer 54.

[0395] In this example method, a second functionalized layer 26 is then applied. In these examples, applying the second functionalized layer 26 involves activating the first portion 98 of the recess 20 to generate surface groups that react with the second functionalized layer 26, and depositing the second functionalized layer 26. Figure 10J illustrates the activation of the first portion 98 and the application of the second functionalized layer 26. As described with reference to Figure 10E, activation involves the application of a second silanized layer 54' in the first portion 98. As described with reference to Figure 10F, the second functionalized layer 26 is selectively attached to the second silanized layer 54' and not to the first functionalized layer 24. The structure shown in Figure 10J includes blocking materials 100, 86 on the gap region 22, which may be desirable for guiding fluid to the recess 20 during use of the flow cell 10.

[0396] In another example of the method shown in Figures 10A to 10J, the release material 96 can be removed using any technique suitable for the release material 96 in use. This release process can be performed after activating the second portion 98' of the recess 20 and before depositing the first functionalized layer 24. In this example, the second portion 98' will be activated to covalently attach the first functionalized layer 24, but the first portion 98 will not be activated to covalently attach the first functionalized layer 24. Due to the different interactions at portions 98' and 98, the functionalized layer 24 is attached to portion 98' and can be easily removed from portion 98 (e.g., via sonication, washing, wiping, etc.). Subsequently, portion 98 can be activated and have a second functionalized layer 26 applied thereto as described herein.

[0397] In another example of the method shown in Figures 10A to 10J, a blocking material 100 may be applied to the gap region 22 before the release material 96 is applied. With the blocking material 100 properly positioned on the gap region 22, the entire recess 20 remains exposed. In this example, the entire recess 20 is activated, for example, using plasma ashing or silanization (e.g., to form a silanized layer 54 throughout the recess 20). Subsequently, the release material 96 may be selectively applied to cover a portion 98 of the recess 20. Because the surface of the recess 20 has been activated and the release layer 96 covers the portion 98, the functionalized layer 24 may be applied and become covalently attached to the portion 98' of the recess 20. The release material 96 may then be removed using any technique suitable for the release material 96 in use. This release process exposes another activated portion 98'. The second functionalized layer 26 may then be applied as described herein, thereby covalently attaching it to portion 98 of the recess 20 without contaminating the first functionalized layer 24.

[0398] In any of the examples described with reference to Figures 10A to 10J, the resulting structure includes a recess 20 supporting functionalized layers 24, 26. Although a single recess 20 having functionalized layers 24, 26 is shown in Figures 10G and 10J, it should be understood that the methods described with reference to Figures 10A to 10J can be performed to produce an array of recesses 20 (each having functionalized layers 24, 26) separated from each other by gap regions 22 across the patterned structure.

[0399] Although not shown in the figures, the method described with reference to Figures 10A to 10J also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 10A to 10J) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 10A to 10J) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed.

[0400] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in Figures 10C or 10H). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to the second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to the second functionalized layer 26. Conversely, after applying the second functionalized layer 26 (e.g., in Figure 10F or Figure 10J), initiators 38, 40, or 38', 40' may be grafted, provided that i) the second functionalized layer 26 has different functional groups (compared to the first functionalized layer 24) to which initiators 38, 40, or 38', 40' are attached, or ii) any unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0401] When grafting is performed during this method, any suitable grafting technique can be used to achieve the grafting.

[0402] Another example method is similar to the examples described in Figures 10A to 10G, but a protective substrate 104 can be used instead of the release material 96. Figure 11 shows an example of a multilayer structure 16, which includes a substrate support 14, a layer 18, and a protective substrate 104 on a portion 98 of the layer 18.

[0403] In this example method, a protecting base 104 is applied to a first portion 98 of a recess 20 defined in a multilayer stack, wherein a second portion 98' of the recess 20 remains exposed. Photolithography can be used to selectively apply the protecting base 104. The protecting base 104 may be reversible or switchable from a blocking state (which prevents the attachment of functionalized layers 24, 26) to an attachment state (which allows the functionalized layers 24, 26 to attach). Examples of suitable protecting bases 104 include protecting bases capable of reversible thiol-disulfide exchange, sterically blocking to cleavage bifunctional silanes, acetylamines reversibly hydrolyzed, or mixtures of silanes with switchable hydrophobic and hydrophilic properties.

[0404] As shown in Figure 11, blocking material 100 is applied to gap region 22. In this example, blocking material 100 may comprise a release material, such as a photoresist or a metal sacrificial material.

[0405] Although not shown in the figure, the method includes applying a first functionalized layer 24 to a second portion 98' of the recess 20, wherein a protective base 104 blocks the application of the first functionalized layer 24 to a first portion 98' of the recess 20. This is similar to Figure 10C, but the first functionalized layer 24 will not be attached to the protective base 104. The layer 18 of the multilayer structure 16 may be activated (e.g., silanized or plasma-ashed) before being incorporated into the protective base 104.

[0406] The method then includes one of the following: removing the protecting group 104 (to expose portion 98) or reversing the blocking state of the protecting group 104 (to make it attached). As an example, reversing the blocking state involves initiating a thiol-disulfide exchange or exposing the protecting group to water. In an example where the protecting group 104 is a disulfide, a reducing agent (e.g., dithiothreitol (DTT)) may be introduced to change the blocking state to the attached state.

[0407] The second functionalized layer 26 can then be applied to the first portion 98 of the recess 20. In one example, the second functionalized layer 26 is attached to the activated portion 98 (where the protecting base 104 has been removed), and in another example, the second functionalized layer 26 is adhered to the reversing protecting base 104. The high ionic strength conditions for deposition can be as described herein, such that the second functionalized layer 26 is not applied to the first second functionalized layer 24. This is similar to Figure 10F.

[0408] In this example, the blocking material 100 can be peeled off to expose the gap region 22. Additionally, the first functionalized layer 24 covering the blocking material 100 will also be removed. The peeling technique will depend on the blocking material 100. As an example, the photoresist blocking material 100 can be removed in a suitable removal agent, such as dimethyl sulfoxide (DMSO) or acetone treated with acoustic waves, or an N-methyl-2-pyrrolidone (NMP)-based stripping agent. In another example, a suitable alkali, such as potassium hydroxide (KOH) or sodium hydroxide (NaOH), can be used to remove the aluminum blocking material 100. In yet another example, FeCl3 or a mixture of iodine and iodides can be used to remove the copper blocking material 100, while a mixture of iodine and iodides can be used to remove the gold blocking material 100. This is similar to Figure 10G.

[0409] Although not shown in the figure, the method described with reference to Figure 11 also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26. Primers 34, 36 or 34', 36' and 38, 40 or 38', 40' may be pre-grafted or grafted at appropriate times throughout the method.

[0410] Figures 12A to 12E illustrate another example method of manufacturing the flow cell architecture of Figure 1D. Similar to Figure 10A, the substrate shown in Figure 12A is a multilayer structure 16 including a substrate support 14 and a layer 18 thereon. Recesses 20 are defined in the substrate support 14 (e.g., via etching, imprinting, photolithography, etc.) and layer 18 is coated thereon.

[0411] In this example method, as shown in FIG12A, a silanized layer 54 is applied to the outermost layer of the substrate (in this example, on layer 18). Thus, the recess 20 and the interstitial region 22 are silanized, for example, using silane or silane derivatives as described herein.

[0412] The method then includes filling the depression 20 with a sacrificial layer 48. The sacrificial layer 48 may be any of the examples described herein and may be applied using any suitable selective deposition technique that deposits the sacrificial layer 48 in the depression 20 without depositing it on the gap region 22. For example, a mask may be used to block the gap region 22 during the deposition of the sacrificial layer 48.

[0413] The method then involves plasma etching of the silanized layer 54 from the interstitial region 22. This is shown in Figure 12B, and the downward arrow indicates where the etching is taking place. The sacrificial layer 48 prevents the silanized layer 54 in the recess 20 from being exposed to plasma etching.

[0414] In Figure 12C, a portion 48A of the sacrificial layer 48 is removed from recess 20 to expose the first portion 102 of the silanized layer 54 in recess 20. Although not shown, photoresist can be patterned to form a mask over the exposed gap region 22 and the portion 48B of the sacrificial layer 48, while leaving the portion 48A of the sacrificial layer 48 exposed. The portion 48A of the sacrificial layer 48 can then be removed using a selective etching process, such as O2 plasma. The downward arrows in Figure 12C indicate where etching is performed. The photoresist can then be removed using a suitable stripping technique.

[0415] A first functionalized layer 24 is applied to a first portion 102 of the silanized layer 54 in the recess 20, as shown in FIG12D. The functionalized layer 24 may also be deposited on the interstitial region 22 and the remaining portion 48B of the sacrificial layer 48. Any suitable deposition technique can be used. In this example, portion 102 is activated to covalently attach the first functionalized layer 24, while the interstitial region 22 is not activated and will not covalently attach the first functionalized layer 24. Due to the different interactions at portion 102 and interstitial region 22, the functionalized layer 24 is attached to portion 102 in the recess 20 and can be easily removed from interstitial region 22 (e.g., via acoustic treatment, washing, wiping, etc.).

[0416] Figure 12E illustrates both the removal of the sacrificial layer portion 48B and the application of the second functionalized layer 26 to the exposed portion 102' of the silanized layer 48.

[0417] The remaining portion 48B can then be removed to expose the silanized layer 54 in the second portion 102' of the recess 20. Removal may involve stripping techniques, which will depend on the material of the sacrificial layer 48. For example, a suitable alkali, such as potassium hydroxide (KOH) or sodium hydroxide (NaOH), can be used to remove the aluminum sacrificial layer; FeCl3 or a mixture of iodine and iodides can be used to remove the copper sacrificial layer; or a mixture of iodine and iodides can be used to remove the gold sacrificial layer.

[0418] Next, a second functionalized layer 26 is applied to the exposed portion 102' of the silanized layer 48 in the recess 20. The second functionalized layer 26 is selectively attached to a second portion 102' of the silanized layer 54'. As described herein, a high ion strength condition barrier layer 26 for depositing the second functionalized layer 26 is applied to the first functionalized layer 24.

[0419] In the examples of Figures 12A to 12E, the resulting structure includes a recess 20 supporting functionalized layers 24 and 26. Although a single recess 20 having functionalized layers 24 and 26 is shown in Figure 12E, it should be understood that the method described with reference to Figures 12A to 12E can be performed to produce an array of recesses 20 (each having functionalized layers 24 and 26) separated from each other by gap regions 22 across the patterned structure.

[0420] Although not shown in the figures, the method described with reference to Figures 12A to 12E also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 12A to 12E) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 12A to 12E) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed.

[0421] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in FIG. 12D). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to second functionalized layer 26. Conversely, after applying the second functionalized layer 26 (e.g., in FIG12E), initiators 38, 40, or 38', 40' may be grafted, provided that i) the second functionalized layer 26 has different functional groups (compared to the first functionalized layer 24) to which initiators 38, 40, or 38', 40' are attached, or ii) any unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0422] When grafting is performed during this method, any suitable grafting technique can be used to achieve the grafting.

[0423] So far, the methods for manufacturing the flow cell architecture of FIG1D described herein begin with a single-layer substrate support 14 or a multi-layer structure 16 having recesses 20 defined therein. In contrast, the methods shown in FIG13A to FIG13H and FIG14A to FIG14I begin with a multi-layer stack, which is processed to define recesses 20 and portions 98, 98' in which functionalized layers 24, 26 become attached.

[0424] The method shown in Figures 13A to 13H will now be described. As shown in Figure 13A, the substrate is a multilayer stack, including a substrate support 14 (which may be transparent or opaque) and a resin layer 50 thereon. The resin layer 50 is initially formed by imprinting into recessed areas 56 including a deeper portion 58 and a shallower portion 60 defined by stepped portions 62. In one example, a working mold and curing can be used as described with reference to Figure 3B. In this example, the resin layer 50 is thick enough that the imprinting process or subsequent etching process performed throughout the method will not expose the underlying substrate support 14.

[0425] The deeper portion 58 and the stepped portion 62 of the recessed area 56 provide patterns / guides for a subsequent etching process used to create recesses 20 in the resin layer 50, forming layer 18 (in FIG. 1D).

[0426] As shown in Figure 13B, photoresist is deposited on resin layer 50, including recessed areas 56, and developed to form insoluble photoresist 52 or 82'. In this example, negative or positive photoresist can be applied and developed such that all photoresist on resin layer 50 is insoluble in the developer.

[0427] A timed dry etching process can then be used to remove portions of the insoluble photoresist 52 or 82' from the resin layer 50, including from the surface and shallower portions 60. This process exposes the surface 63 of the stepped portion 62. As shown in FIG13C, the timed dry etching is stopped, such that the insoluble photoresist 52 or 82' remains in the deeper portion 58 adjacent to the stepped portion 62. Thus, the remaining insoluble photoresist 52 or 82' is at least substantially coplanar with the surface 63 of the stepped portion 62. In one example, the timed dry etching may involve reactive ion etching (e.g., with CF4), wherein the insoluble photoresist 52 or 82' is etched at a rate of approximately 17 nm / min. In another example, the timed dry etching may involve 100% O2 plasma etching, wherein the insoluble photoresist 52 or 82' is etched at a rate of approximately 98 nm / min.

[0428] This example of the method then involves etching a stepped portion 62 to define a recessed portion 19 adjacent to the insoluble photoresist 52 or 82' in the deeper portion 58. Any exposed areas of the resin layer 50 may be etched during this process, as indicated by the downward arrow in Figure 13D. Etching may continue until the bottom surface of the formed recessed portion 19 is at least substantially coplanar with the bottom surface of the deeper portion 58. The etching of the resin layer 50 may involve a dry etching process, such as anisotropic oxygen plasma or a mixture of 90% CF4 and 10% O2 plasma.

[0429] As shown in Figure 13D, the recessed area 56 (Figure 13A) has been etched to form the recessed portion 19 and the gap area 22 adjacent to the recessed portion 19 and the remaining insoluble photoresist 52 or 82'.

[0430] As shown in Figure 13E, a first functionalized layer 24 is applied onto the resin layer 50 (including in the recessed portion 19) and the remaining insoluble photoresist 52 or 82'. Any suitable deposition technique can be used. In this example, the resin layer 50 may be activated, for example, by plasma ashing or silanization, before the first functionalized layer 24 is applied.

[0431] The insoluble photoresist 52 or 82' can then be stripped using a stripping agent, such as dimethyl sulfoxide (DMSO), acetone, or an N-methyl-2-pyrrolidone (NMP)-based stripper for the insoluble negative photoresist 52, or dimethyl sulfoxide (DMSO), acetone, propylene glycol monomethyl ether acetate, or an N-methyl-2-pyrrolidone (NMP)-based stripper for the insoluble positive photoresist 82'. As shown in Figure 13F, the stripping process removes i) at least 99% of the insoluble photoresist 52 or 82' and ii) the functionalized layer 24 thereon. The functionalized layer 24 remains intact on the resin layer 50, partly because the functionalized layer 24 is covalently attached to the resin layer 50. This process exposes the bottom surface 59 of the deeper portion 58.

[0432] As depicted in Figure 13F, the recess 20 in the resin layer 50 (similar to layer 18 in Figure 1D) is exposed after the removal of the insoluble photoresist 52 or 82'. The recess 20 includes the bottom surface 59 of the deeper portion 58 and the recessed portion 19.

[0433] In this example method, a second functionalized layer 26 is then applied to the resin layer 50 at the bottom surface 59 of the deeper portion 58. In these examples, applying the second functionalized layer 26 may involve activating the bottom surface 59 to generate surface groups that react with the second functionalized layer 26, and depositing the second functionalized layer 26. Activation may involve plasma ashing or silanization. Under the high ion strength deposition conditions described herein, the second functionalized layer 26 selectively attaches to the bottom surface 59 and not to the first functionalized layer 24.

[0434] In Figure 13H, a polishing process is used, for example, to remove the functionalized layer 24 disposed on the gap region 22. The polishing process can be performed using a chemical slurry (including, for example, abrasives, buffers, chelating agents, surfactants, and / or dispersants) that can remove the functionalized layers 24 and / or 26 from the gap region 22 without harmfully affecting the substrate beneath those regions 22. Alternatively, polishing can be performed using a solution that does not include the abrasive example.

[0435] Chemical slurries can be used in a chemical mechanical polishing system to polish the surface of gap region 22. A polishing head / pad or other polishing tool can polish functionalized layers 24, 26 that may be present on gap region 22, while ensuring that the functionalized layers 24, 26 in recess 20 remain at least substantially intact. As an example, the polishing head may be a Strasbaugh ViPRR II polishing head.

[0436] Cleaning and drying processes can be performed after polishing. The cleaning process can utilize water baths and sonic treatment. The water bath can be maintained at a relatively low temperature ranging from approximately 22°C to approximately 30°C. The drying process can involve rotary drying or drying via another suitable technology.

[0437] Although the single functionalized layers 24, 26 are shown in FIG13H, it should be understood that the method described with reference to FIG13A to FIG13H can be performed to produce an array of recesses 20 (which have functionalized layers 24, 26) separated by gap regions 22 across the surfaces of resin layers 50, 18.

[0438] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 13A to 13H) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 13A to 13H) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed.

[0439] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in FIG. 13E). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to second functionalized layer 26. Conversely, after applying the second functionalized layer 26 (e.g., in FIG. 13G), initiators 38, 40, or 38', 40' may be grafted, provided that i) the second functionalized layer 26 has different functional groups for attaching initiators 38, 40, or 38', 40' (compared to the first functionalized layer 24), or ii) any unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0440] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0441] The method shown in Figures 14A to 14I will now be described. As shown in Figure 14A, the substrate is a multilayer stack including a resin layer 50 and an underlying substrate support 14 (which may be transparent or opaque). In this example, the substrate support 14 may be activated by plasma ashing or silanization before the resin layer 50 is applied thereon. In one example, the substrate support 14 is tantalum pentoxide and the activation process involves silanization.

[0442] The resin layer 50 is initially formed by imprinting into a recessed area 56 comprising a deeper portion 58 and a shallower portion 60 defined by a stepped portion 62. In one example, a working mold and curing may be used as described with reference to FIG. 3B. In this example, the resin layer 50 is thin enough at both the deeper portion 58 and the shallower portion 60 that subsequent etching processes performed throughout the method actually expose the underlying substrate support 14.

[0443] The deeper portion 58 and the stepped portion 62 of the recessed area 56 provide patterns / guides for a subsequent etching process used to create a recess 20 in the resin layer 50, forming another example of layer 18 (in FIG. 1D). In this example, the bottom surface of the recess 20 is the top surface of the substrate support 14, and the sidewalls of the recess are defined by the resin layers 50 and 18.

[0444] As shown in Figure 14B, the resin layer 50 is then selectively etched to remove residual resin at the deeper portion 58, exposing the portion 64 of the substrate support 14 at the deeper portion 58. Any exposed area of ​​the resin layer 50 can be etched during this process, as indicated by the downward arrow in Figure 14B. Etching can continue until the portion 64 of the substrate support 14 is exposed. The etching of the resin layer 50 can involve dry etching processes, such as anisotropic oxygen plasma or a mixture of 90% CF4 and 10% O2 plasma.

[0445] As shown in Figure 14B, photoresist is deposited on resin layer 50, including recessed areas 56, and thus on exposed portions 64 of substrate support 14, and developed to form insoluble negative or positive photoresist 52 or 82'. In this example, negative or positive photoresist can be applied and developed such that all photoresist 52 or 82' is insoluble in the developer.

[0446] A timed dry etching process can then be used to remove portions of the insoluble photoresist 52 or 82', including removal from the surface adjacent to the recessed region 56 and from the shallower portion 60. This process exposes the surface 63 of the stepped portion 62. As shown in FIG14D, the timed dry etching is stopped such that the insoluble photoresist 52 or 82' remains in the portion of the deeper portion 58 immediately adjacent to the stepped portion 62. Thus, the remaining insoluble photoresist 52 or 82' is at least substantially coplanar with the surface 63 of the stepped portion 62. In one example, the timed dry etching may involve reactive ion etching (e.g., using CF4) or 100% O2 plasma etching.

[0447] This example of the method then involves etching the stepped portion 62 to expose the surface 64' of the substrate support 14 and defining the recessed portion 19 adjacent to the insoluble photoresist 52 or 82' in the deeper portion 58. Any exposed area of ​​the resin layer 50 can be etched during this process, as indicated by the downward arrow in Figure 14E. Etching can continue until the portion 64' of the substrate support 14 is exposed. The etching of the resin layer 50 can involve a dry etching process, such as anisotropic oxygen plasma or a mixture of 90% CF4 and 10% O2 plasma. Some of the photoresist 52 or 82' can also be etched away during this process.

[0448] As shown in Figure 14F, after etching, the resin layer 50 includes a gap region 22 adjacent to the remaining photoresist 52 or 82' and adjacent to the recessed portion 19.

[0449] In Figure 14F, a first functionalized layer 24 is applied to the resin layer 50 and the exposed portion 64' (in the recessed portion 19) of the substrate support 14. Any suitable deposition technique can be used.

[0450] The insoluble photoresist 52 or 82' can then be stripped using a stripping agent, such as dimethyl sulfoxide (DMSO), acetone, or an N-methyl-2-pyrrolidone (NMP)-based stripping agent for the insoluble negative photoresist 52, or dimethyl sulfoxide (DMSO), acetone, propylene glycol monomethyl ether acetate, or an N-methyl-2-pyrrolidone (NMP)-based stripping agent for the insoluble positive photoresist 82'. As shown in Figure 14G, the stripping process removes i) at least 99% of the insoluble photoresist 52 or 82' and ii) the functionalized layer 24 thereon. The remaining portion of the functionalized layer 24 remains intact on the resin layer 50. This process re-exposes the portion 64 of the substrate support 14 at the deeper portion 58.

[0451] As depicted in Figure 14G, the recess 20 in the resin layer 50 (similar to layer 18 in Figure 1D) is exposed after the removal of the insoluble photoresist 52 or 82'. The recess 20 includes portions 64, 64' (the latter of which corresponds to recess portion 19).

[0452] In this example method, as shown in FIG14H, a second functionalized layer 26 is then applied to a portion 64 of the substrate support 14. Under the high ion intensity deposition conditions described herein, the second functionalized layer 26 selectively attaches to the portion 64 and not to the first functionalized layer 24.

[0453] In Figure 14I, for example, a polishing process is used to remove the functionalized layer 24 disposed on the gap region 22. The polishing process can be performed using an example of a chemical slurry disclosed herein, which can remove the functionalized layer 24 and / or 26 from the gap region 22 without harmfully affecting the substrate beneath those regions 22 as described herein with reference to Figure 13H. A cleaning and drying process can be performed after polishing.

[0454] Although the single functionalized layers 24, 26 are shown in FIG14I, it should be understood that the methods described with reference to FIG14A to FIG14I can be performed to produce an array of recesses 20 (which have functionalized layers 24, 26) separated by gap regions 22 across the surfaces of resin layers 50, 18.

[0455] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 14A to 14I) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 14A to 14I) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed.

[0456] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in FIG. 14F). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to second functionalized layer 26. Conversely, after applying the second functionalized layer 26 (e.g., in FIG. 14H), initiators 38, 40, or 38', 40' may be grafted, provided that i) the second functionalized layer 26 has different functional groups for attaching initiators 38, 40, or 38', 40' (compared to the first functionalized layer 24), or ii) any unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0457] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0458] Another example of a method for generating the flow pool architecture shown in Figure 1D is depicted in Figures 15A through 15D.

[0459] As shown in Figure 15A, the substrate in this example is a multilayer structure 16 comprising a substrate support 14 and a layer 18 thereon. In this example, the substrate support 14 may be fused silica, and the layer 18 may be tantalum pentoxide or another transparent material (such as those described herein with respect to transparent layer 72). In the example shown in Figure 15A, a recess 20 is defined in the substrate support 14 (e.g., via etching, imprinting, photolithography, etc.) and the layer 18 is coated thereon.

[0460] In some instances, layer 18 may then be activated, for example, by depositing a silanized layer (not shown) thereon. The silanized layer may be any silane or silane derivative described herein. The silanized layer adheres to layer 18 (e.g., Ta₂O₅). The silanized layer significantly improves the adhesion of the first and second functionalized layers 24, 26 to layer 18, which would otherwise not have strong adhesion to the functionalized layers 24, 26. In other instances, the recessed portions 98, 98' may be activated only before the application of the respective functionalized layers 24, 26.

[0461] In the case of a depression 20, this example method continues to apply a sacrificial layer 48 to the first portion 98 of the depression 20 and the gap region 22. This is depicted in Figure 15A. Any example of the sacrificial layer 48 disclosed herein may be used.

[0462] The applied sacrificial layer 48 defines the pattern of one of the functionalized layers 26 that will subsequently be applied to the covered portion of the recess 20. Thus, the sacrificial layer 48 can be applied such that it covers a portion 98 of the recess 20, including some of the sidewalls and some of the bottom, while leaving another portion 98' of the recess 20 exposed. The sacrificial layer 48 is also applied to the gap region 22 adjacent to the recess 20. As shown, the portion of the sacrificial layer 48 in the gap region 22 has a first height H1, and the portion of the sacrificial layer 48 in the first portion 98 has a second height H2 that is less than the first height H1. In one example, the first height H1 may be twice the thickness of the second height H2.

[0463] The sacrificial layer 48 can be constructed using selective deposition techniques, such as chemical vapor deposition (CVD) and its variations (e.g., low-pressure CVD or LPCVD), atomic layer deposition (ALD), and masking techniques. These techniques can be used to deposit the sacrificial layer 48 in the desired region and at the desired thickness / height H1, H2.

[0464] As shown in Figure 15B, a first functionalized layer 24 is then applied to the sacrificial layer 48 and the exposed portion 98' of the recess 20. Any suitable deposition technique can be used to apply the first functionalized layer 24. As mentioned above, the portion 98' is activated to covalently attach the first functionalized layer 24.

[0465] The sacrificial layer 48 can then be exposed to a timed wet etching process. This process also removes the first functionalized layer 24 disposed on the sacrificial layer 48, but not the portion of the first functionalized layer 24 covalently attached at portion 98'. The timed wet etching is depicted by the arrows in FIG15C. It should be understood that this etching process is performed to reduce the thickness of the second height H2 of the sacrificial layer 48, which exposes the first portion 98 of the recess 20 and leaves some of the sacrificial layer 48 on the gap region 22. The entire sacrificial layer 48 can be exposed to etching. However, due to the thickness difference, any portion having the second height H2 will be completely removed, while any portion having the first height H1 reduces the thickness of the second height H2. This process exposes portion 98 of the recess 20.

[0466] In this example method, as shown in Figure 15D, a second functionalized layer 26 is then applied to the recess 20 at portion 98 and to the remaining portion of the sacrificial layer 48 on the interstitial region 22. As mentioned above, portion 98 is activated to covalently attach the second functionalized layer 26. Under the high ion intensity deposition conditions described herein, the second functionalized layer 26 selectively attaches to portion 98 and not to the first functionalized layer 24.

[0467] Although not shown in the figure, it should be understood that another wet etching process can be used to remove the sacrificial layer 48 (and the functionalized layer 26 thereon) from the interstitial region 22. This retains the functionalized layers 24 and 26 in the recess 20. The wet etching process used will depend on the material of the sacrificial layer 48. As an example, aluminum sacrificial layers can be removed under acidic or alkaline conditions, copper sacrificial layers can be removed using FeCl3, copper, gold, or silver sacrificial layers can be removed in iodine and iodide solutions, titanium sacrificial layers can be removed using H2O2, and silicon sacrificial layers can be removed under alkaline (pH) conditions.

[0468] Although the single functionalized layers 24, 26 are shown in FIG15D, it should be understood that the methods described with reference to FIG15A to FIG15D can be performed to produce an array of recesses 20 (which have functionalized layers 24, 26) separated by gap regions 22 across the surface of layer 18.

[0469] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 15A-15D) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 15A-15D) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed.

[0470] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in Figure 15B). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to the second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to the second functionalized layer 26. Conversely, after applying the second functionalized layer 26 (e.g., in FIG. 15D), initiators 38, 40, or 38', 40' may be grafted, provided that i) the second functionalized layer 26 has different functional groups for attaching initiators 38, 40, or 38', 40' (compared to the first functionalized layer 24), or ii) any unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0471] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0472] Another example of a method for generating the flow pool architecture shown in Figure 1D is depicted in Figures 23A through 23G.

[0473] As shown in Figure 23A, the substrate in this example is a single-layer substrate support 14. In this example, the substrate support 14 may be fused silica, tantalum pentoxide, or another transparent layer, silicon, or any of the other examples disclosed herein. In the example shown in Figure 23A, a recess 20 is defined in the substrate support 14 (e.g., via etching, imprinting, photolithography, etc.).

[0474] This method can also be performed using a multilayer structure 16, which includes a substrate support 14 and layers 18 (e.g., SiO2, Ta2O5, silicon, resin layers, etc.). In the case of the multilayer structure 16, the recess 20 will be defined in layer 18.

[0475] After the recess 20 is defined, the substrate support 14 can be activated by silanization or plasma ashing before any further processing.

[0476] As shown in Figure 23A, a sacrificial layer 48'' is applied. The applied sacrificial layer 48'' defines the pattern of one of the functionalized layers 26 that will subsequently be applied to a portion 98 of the recess 20 (see Figure 23E). Thus, the sacrificial layer 48'' can be applied such that it covers a portion 98 of the recess 20, including some of the sidewalls and some of the bottom, while leaving another portion 98' of the recess 20 exposed. As depicted, the sacrificial layer 48'' is not applied to the gap region 22 adjacent to the recess 20.

[0477] Any instance of the sacrificial layer 48'' disclosed herein may be used. In one instance, the sacrificial layer 48'' is aluminum.

[0478] The sacrificial layer 48'' can be constructed using selective deposition techniques, such as chemical vapor deposition (CVD) and its variations (e.g., low-pressure CVD or LPCVD), atomic layer deposition (ALD), and masking techniques. These techniques can be used to deposit the sacrificial layer 48'' in the desired region.

[0479] Figure 23B depicts two processes: the application of the first functionalized layer 24 and the application of photoresist 52 or 82'.

[0480] After selectively applying the sacrificial layer 48'', a first functionalized layer 24 is then applied to the gap region 22 adjacent to the recess 20, the sacrificial layer 48'', and the second portion 98' of the recess 20. The first functionalized layer 24 may be any of the examples disclosed herein and may be applied using any suitable technique. As mentioned above, the portion 98' is activated to covalently attach the first functionalized layer 24.

[0481] After the first functionalized layer 24 is applied, a photoresist is applied to the first functionalized layer 24 and developed to form an insoluble photoresist 52 or 82'. In this example, a negative or positive photoresist can be applied and developed such that all the photoresist on the first functionalized layer 24 is insoluble in the developer.

[0482] As shown in Figure 23C, a portion of the photoresist 52 or 82' and a portion of the first functionalized layer 24 are removed to expose the gap region 22 and the sacrificial layer 48''. This removal may involve a timed dry etching process or polishing. In one example, timed dry etching may involve reactive ion etching (e.g., using CF4) or 100% O2 plasma etching. Polishing may be performed as described herein with reference to Figure 13H. Timed dry etching or polishing may be stopped such that a portion of the insoluble photoresist 52 or 82 and a portion of the first functionalized layer 24 remain on the portion 98' of the recess 20 immediately adjacent to the sacrificial layer 48''. The remaining insoluble photoresist 52 or 82' and the first functionalized layer 24 may be at least substantially coplanar with the gap region 22.

[0483] In Figure 23D, the sacrificial layer 48'' can be removed to expose the first portion 98 of the recess 20. The sacrificial layer 48'' can be stripped in a stripping liquid suitable for the sacrificial layer 48''. As an example, the aluminum sacrificial layer can be removed under acidic or alkaline conditions, the copper sacrificial layer can be removed using FeCl3, and the silicon sacrificial layer can be removed under alkaline (pH) conditions. The stripping process removes at least 99% of the sacrificial layer 48'', but leaves the photoresist 52 or 82' at least substantially intact.

[0484] Next, a second functionalized layer 26 can be applied to the first portion 98 of the recess 20, as shown in FIG23E. The second functionalized layer 26 can be any of the examples disclosed herein and can be applied using any suitable technique. The second functionalized layer 26 is also deposited on the interstitial region 22, the photoresist 52 or 82', and the exposed portion of the first functionalized layer 24. The portion 98' is activated to covalently attach the second functionalized layer 26.

[0485] Next, the remaining portion of photoresist 52 or 82' is stripped, as shown in Figure 23F. The insoluble negative photoresist 52 is insoluble in the developer but can be stripped with a suitable stripping agent, including dimethyl sulfoxide (DMSO), acetone, or an N-methyl-2-pyrrolidone (NMP)-based stripping agent. The insoluble positive photoresist 82' is also insoluble in the developer but can be stripped with a suitable stripping agent, including dimethyl sulfoxide (DMSO), acetone, propylene glycol monomethyl ether acetate, or an N-methyl-2-pyrrolidone (NMP)-based stripping agent. The stripping process removes i) at least 99% of the photoresist 52 or 82' and ii) the second functionalized layer 26 thereon. The functionalized layer 24 is then exposed.

[0486] The stripping process may also leave portions of the second functionalized layer 26 on the gap region 22. These portions of the second functionalized layer 26 can be polished away with a chemical slurry as described herein with reference to Figure 13H. Polishing should be terminated before any of the functionalized layers 24 and 26 are removed from the recess 20. Cleaning and drying processes can be performed after polishing.

[0487] Although the single functionalized layers 24, 26 are shown in FIG23G, it should be understood that the methods described with reference to FIG23A to FIG23G can be performed to produce an array of recesses 20 (which have functionalized layers 24, 26) separated by gap regions 22 on the surface of the substrate support 14.

[0488] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 23A to 23G) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 23A to 23G) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed.

[0489] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in FIG. 23B). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to the second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to the second functionalized layer 26. Conversely, after applying the second functionalized layer 26 in Figure 23E, Figure 23F, or Figure 23G, initiators 38, 40, or 38', 40' may be grafted, provided that i) the second functionalized layer 26 has different functional groups for attaching initiators 38, 40, or 38', 40' (compared to the first functionalized layer 24), or ii) the unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0490] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0491] [, Manufacturing drawings , ] [, 1E , ] [, Methods of Flow Pool Architecture, ]

[0492] Several different methods can be used to produce the architecture shown in FIG1E. Each of these methods begins with a multilayer stack that initially includes or is processed to define multilayer recesses 20' (see, for example, FIG16F), in which functionalized layers 24, 26 become attached.

[0493] The method shown in Figures 16A to 16F will now be described. As shown in Figure 16A, the substrate is a multilayer stack including a resin layer 50 and a substrate support 14 below it. The resin layer 50 is another layer 18 of the multilayer structure 16, and therefore may be referred to as resin layer 50, 18 throughout this discussion. The substrate support 14 may or may not be transparent in this example, but is selected such that it does not have a high selective adhesion to the functionalized layers 24, 26 without additional silanization. In one example, the substrate support is tantalum pentoxide and is referred to as Ta₂O₅ substrate support 14'' throughout this example.

[0494] The resin layer 50 is initially formed by imprinting into a recessed area 56 comprising a deeper portion 58 and a shallower portion 60 defined by a stepped portion 62. In one example, a working impression and curing can be used as described with reference to FIG. 3B. In this example, the resin layer 50 is thin enough at the deeper portion 58 to ensure that a subsequent etching process exposes the underlying Ta₂O₅ substrate support 14'', and thick enough at the stepped portion 62 to prevent the subsequent etching process from exposing the underlying Ta₂O₅ substrate support 14''.

[0495] As shown in Figure 16B, the resin layer 50 is then selectively etched to remove residual resin at the deeper portion 58, exposing the portion 64 of the substrate support 14 at the deeper portion 58. Any exposed area of ​​the resin layer 50 can be etched during this process, as indicated by the downward arrow in Figure 16B. Therefore, some areas become shorter or thinner, for example, thinner stepped portions 62'. Etching can continue until the portion 64 of the substrate support 14 (e.g., 14'') is exposed. The etching of the resin layer 50 can involve dry etching processes, such as anisotropic oxygen plasma or a mixture of 90% CF4 and 10% O2 plasma.

[0496] Removing portions of resin layers 50 and 18 forms multi-layered recesses 20' and gap regions 22 surrounding the multi-layered recesses 20'. In this example, the surface 64 of the deeper portion 58 and the surface 63' of the thinner stepped portion 62' define the areas where the functionalized layers 24 and 26 become attached.

[0497] After the multilayer recess 20' is defined, the resin layers 50, 18 can be activated by plasma ashing before the first functionalized layer 24 is applied thereon. This process does not activate the Ta₂O₅ substrate support 14''.

[0498] In Figure 16C, a first functionalized layer 24 is applied to resin layers 50, 18. Any suitable deposition technique can be used. Due to the different interactions at portions 64 and surfaces (e.g., 22, 63') of resin layers 50, 18, the functionalized layer 24 remains on resin layers 50, 18 and does not adhere to portions 64 of the Ta₂O₅ substrate support 14''.

[0499] The portion 64 of the Ta₂O₅ substrate support 14'' can then be activated, for example, by depositing a silanized layer 54 thereon. The silanized layer 54 can be any silane or silane derivative described herein. The silanized layer 54 adheres to the portion 64 of the Ta₂O₅ substrate support 14'', but not to the first functionalized layer 24, as shown in FIG16D. The silanized layer 54 significantly improves the adhesion of the second functionalized layer 26 to the Ta₂O₅ substrate support 14'', which otherwise would not have strong adhesion to the functionalized layers 24, 26.

[0500] In Figure 16E, a second functionalized layer 26 is then applied using any suitable deposition technique. In this example, the second functionalized layer 26 is selectively attached to the silanized layer 54, and when gel material deposition is performed under high ionic strength (e.g., in the presence of 10× PBS, NaCl, KCl, etc.), the second functionalized layer 26 is not deposited on or adheres to the first functionalized layer 24.

[0501] In Figure 16E, a polishing process is used, for example, to remove the functionalized layer 24 disposed on the gap region 22. The polishing process can be performed using a chemical slurry as described herein with reference to Figure 13H. Polishing can be performed to remove some of the functionalized layers 24 from the sidewalls of the multilayer recess 20'. However, since it is desirable to maintain the first functionalized layer 24 on the surface 63' of the thinner stepped portion 62', polishing should be terminated before any removal from the surface 63' of the thinner stepped portion 62'. A cleaning and drying process can be performed after polishing.

[0502] Although the single functionalized layers 24, 26 are shown in FIG16F, it should be understood that the methods described with reference to FIG16A to FIG16F can be performed to produce an array of recesses 20 (which have functionalized layers 24, 26) separated by gap regions 22 across the surfaces of resin layers 50, 18.

[0503] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 16A-16F) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 16A-16F) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed.

[0504] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in FIG. 16C). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to the second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to the second functionalized layer 26. Conversely, after the application of the second functionalized layer 26, initiators 38, 40 or 38', 40' (e.g., in FIG. 16E) may be grafted, provided that i) the second functionalized layer 26 has different functional groups for attaching initiators 38, 40 or 38', 40' (compared to the first functionalized layer 24), or ii) the unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0505] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0506] The method shown in Figures 17A to 17G will now be described. In Figure 17A, the substrate is a multilayer stack including resin layers 50, 18 and a substrate support 14 (which may be transparent or opaque) below them. In this example, the resin layer 50 is imprinted to form a recessed area 56 including a deeper portion 58 and a shallower portion 60 defined by a stepped portion 62. In one example, a working mold and curing can be used as described with reference to Figure 3B. In this example, the recessed area 56 corresponds to a multilayer recess 20', and the bottom surface 59 of the deeper portion 58 and the surface 63 of the stepped portion 62 define the areas where the functionalized layers 24, 26 become attached.

[0507] After defining the recessed area 56 and thus the multilayer recess 20', the resin layers 50, 18 may be activated by plasma ashing or silanization before the first functionalized layer 24 is applied thereon.

[0508] As shown in Figure 17B, photoresist is deposited on resin layers 50, 18, including in recessed areas 56 / multi-layered recesses 20', and developed to form insoluble photoresist 52 or 82'. In this example, negative or positive photoresist can be applied and developed such that all photoresist on resin layers 50, 18 is insoluble in the developer.

[0509] A timed dry etching process can then be used to remove portions of the insoluble photoresist 52 or 82' from resin layers 50, 18, including from the gap region 22 and the shallower portion 60. This process exposes the surface 63 of the stepped portion 62. As shown in FIG17C, the timed dry etching is stopped, leaving the insoluble photoresist 52 or 82' in the deeper portion 58 immediately adjacent to the stepped portion 62. Thus, the remaining insoluble photoresist 52 or 82' is at least substantially coplanar with the surface 63 of the stepped portion 62. In one example, the timed dry etching may involve reactive ion etching (e.g., using CF4) or 100% O2 plasma etching.

[0510] As shown in Figure 17D, a first functionalized layer 24 is applied onto resin layers 50, 18 (including in the recess 20') and the remaining insoluble photoresist 52 or 82'. Any suitable deposition technique can be used.

[0511] The insoluble photoresist 52 or 82' can then be stripped using a suitable removal agent as described herein for the insoluble negative or positive photoresist 52 or 82'. As shown in Figure 17E, the stripping process removes i) at least 99% of the insoluble photoresist 52 or 82' and ii) the functionalized layer 24 thereon. The functionalized layer 24 remains intact on the resin layers 50 and 18, partly because the functionalized layer 24 is covalently attached to the resin layers 50 and 18. This process exposes the bottom surface 59 of the deeper portion 58.

[0512] In this example method, a second functionalized layer 26 is then applied to the resin layers 50, 18 at the bottom surface 59 of the deeper portion 58. Under the high ion intensity deposition conditions described herein, the second functionalized layer 26 selectively attaches to the bottom surface 59 and not to the first functionalized layer 24, as shown in FIG17F.

[0513] In Figure 17G, for example, a polishing process is used to remove the functionalized layer 24 disposed on the gap region 22. The polishing process can be performed using chemical abrasive slurries as described herein. Cleaning and drying processes can be performed after polishing.

[0514] Although the single functionalized layers 24, 26 are shown in FIG17G, it should be understood that the methods described with reference to FIG17A to FIG17G can be performed to produce an array of recesses 20 (which have functionalized layers 24, 26) separated by gap regions 22 across the surfaces of resin layers 50, 18.

[0515] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 17A to 17G) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 17A to 17G) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed.

[0516] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in FIG. 17D). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to the second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to the second functionalized layer 26. Conversely, after applying the second functionalized layer 26, initiators 38, 40, or 38', 40' (e.g., in Figure 17F) may be grafted, provided that i) the second functionalized layer 26 has different functional groups for attaching initiators 38, 40, or 38', 40' (compared to the first functionalized layer 24), or ii) any unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid.

[0517] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0518] The methods shown in Figures 17A to 17G use developer-insoluble negative or positive photoresist 52 or 82' to mask the deeper portion 58 when the first functionalized layer 24 is applied. Alternatively, variable polymer beads can be used instead of photoresist 52 or 82'. Example methods using variable polymer beads are shown in Figures 18A to 18M. One example is shown in Figures 18A to 18G. Another example is shown in Figures 18A and 18H to 18M.

[0519] As shown in Figure 18A, the substrate is a multilayer stack including resin layers 50, 18 and a substrate support 14 (which may be transparent or opaque). In this example, the resin layers 50, 18 are imprinted to form a recessed area 56 including a deeper portion 58 and a shallower portion 60 defined by a stepped portion 62. In one example, a working mold and curing can be used as described with reference to Figure 3B. In this example, the recessed area 56 corresponds to a multilayer recess 20', and the bottom surface 59 of the deeper portion 58 and the surface 63 of the stepped portion 62 define the areas where the functionalized layers 24, 26 become attached.

[0520] After defining the recessed region 56 and thus the multilayer recess 20', the resin layers 50, 18 can be activated by plasma ashing or silanization before the first functionalized layer 24 is applied thereon. Surface activation facilitates the subsequent covalent bonding of the functionalized layers 24, 26 to different regions of the resin layers 50, 18.

[0521] The method shown in Figures 18B to 18G will now be described. In Figure 18B, variable polymer beads 106 are introduced into the deeper portion 58 such that they are disposed adjacent to the stepped portion 62. Therefore, the diameter of the variable polymer beads 106 is smaller than the width of the deeper portion 58, so that the variable polymer beads 106 fit into the space between the sidewall 108 of the recess 20' and the sidewall 110 of the stepped portion 62.

[0522] Examples of variable polymer beads 106 include partially cross-linked or uncross-linked expandable latex particles. Some specific examples include polystyrene, poly(methyl methacrylate), and other acrylic polymers and copolymers. Variable polymer beads 106 can be introduced by cultivating a solution of beads 106 on a surface with or without stirring or sonication.

[0523] The variable polymer beads 106 can then be modified to at least partially fill the deeper portion 58 between the sidewalls 108 of the recess 20' and the sidewalls 110 of the stepped portion 62. "At least partially fill" means that the modified polymer beads 106' extend across the bottom surface 59 at the deeper portion 58, thus contacting at least some of the sidewalls 108 of the recess 20' and at least some of the sidewalls 110 of the stepped portion 62, and also having a surface coplanar with or shorter than the stepped portion 63 (and therefore not extending over the stepped portion 63). In one example, the modified polymer beads 106 fill the deeper portion 58 until their height matches that of the stepped portion 62 or is half the height of the stepped portion 62.

[0524] In one example of altering the variable polymer beads 106, annealing can be used. Annealing causes the variable polymer beads 106 to flow and coat the substrate surface 59 at a deeper portion 58, and the flow stops upon contact with the sidewalls 108, 110. Annealing is performed at a temperature higher than the glass transfer temperature of the variable polymer beads 106. For example, for polystyrene variable polymer beads 106, the temperature may be in the range of about 150°C to about 300°C.

[0525] In another example of altering the variable polymer beads 106, expansion can be used. Expansion can be achieved by introducing an expansion solvent absorbed by the beads 106. It should be understood that slightly cross-linked variable polymer beads 106 may expand rather than dissolve in the selected expansion solvent. In one example, the expansion solvent for the polystyrene variable polymer beads 106 may include solvents of low to medium polarity, such as dimethylformamide (DMF), dimethyl carbonate (DMC), or toluene. In another example, the expansion solvent for the poly(methyl methacrylate) variable polymer beads 106 may include a 50:50 mixture of methanol and acetonitrile. Expansion causes the variable polymer beads 106 to bulge and thus increase in size, and this increase stops upon contact with the sidewalls 108, 110. The altered polymer beads 106' are shown in Figure 18C.

[0526] The first functionalized layer 24 is applied to the resin layers 50, 18 (including in the recess 20') and to the modified polymer beads 106', as shown in FIG18D. Any suitable deposition technique can be used.

[0527] The modified polymer beads 106' can then be removed. Removal of the modified polymer beads 106' can be achieved by dissolution, chemical or enzymatic degradation (without harmfully affecting other components), or photolysis. In one example, the polystyrene-modified polymer beads 106' can be removed using solvents such as tetrahydrofuran (THF) or chlorinated solvents. In another example, enzymatic degradation can be used to remove the poly(caprolactone)-modified polymer beads 106'. As shown in Figure 18E, the bead removal process removes i) the modified polymer beads 106' and ii) the functionalized layer 24 thereon. The functionalized layer 24 remains intact on the resin layers 50, 18, partly because the functionalized layer 24 is covalently attached to the resin layers 50, 18. This process exposes the bottom surface 59 of the deeper portion 58.

[0528] In this example method, a second functionalized layer 26 is then applied to the resin layers 50, 18 at the bottom surface 59 of the deeper portion 58. Under the high ion intensity deposition conditions described herein, the second functionalized layer 26 selectively attaches to the bottom surface 59 and not to the first functionalized layer 24, as shown in FIG18F.

[0529] In Figure 18G, for example, a polishing process is used to remove the functionalized layer 24 disposed on the gap region 22. The polishing process can be performed using chemical abrasive slurries as described herein. Cleaning and drying processes can be performed after polishing.

[0530] In an alternative example of this method, as shown in Figure 18E, the functionalized layer 24 of the interstitial region 22 may be polished off before or after the removal of the bulging polymer beads 106'. This polishing is performed before the deposition of the second functionalized layer 26. Then, in this example, the second functionalized layer 26 is deposited on the interstitial region 22. Therefore, a final polishing step can be performed to remove the second functionalized layer 26 from the interstitial region 22.

[0531] Referring back to Figure 18A, another instance of this method is continued in Figures 18H through 18M. This method will now be described.

[0532] The first functionalized layer 24 is applied onto the resin layers 50, 18 (including in the recess 20'), as shown in Figure 18H. Any suitable deposition technique can be used.

[0533] In Figure 18I, inflatable polymer beads 106 are introduced into the deeper portion 58, such that they are placed on the first functionalized layer 24 and between the sidewall 108 of the recess 20' and the sidewall 110 of the stepped portion 62.

[0534] As shown in Figure 18J, the expandable polymer beads 106 can then be inflated to at least partially fill the deeper portion 58 between the sidewall 108 of the recess 20' and the sidewall 110 of the stepped portion 62. Annealing or expansion can be used to convert the expandable polymer beads 106 into inflatable polymer beads 106'.

[0535] As also shown in Figure 18J, the functionalized layer 24 can be removed from the surface 63 of the gap region 22 and the stepped portion 62. Removing the functionalized layer 24 from the surface 63 of the gap region 22 and the stepped portion 62 can involve dry etching or polishing. Dry etching can be performed using reactive ion etching, such as O2 or air plasma. During dry etching, a combustion reaction can occur, in which the functionalized layer 24 is converted into carbon dioxide and water, and vented from the etching chamber. The bulging polymer beads 106' can act as an etching termination layer at the deeper portion 58, as shown in Figure 18J.

[0536] In this example method, as shown in Figure 18K, a second functionalized layer 26 is then applied onto the resin layers 50, 18 and the bulging polymer beads 106'. Any suitable deposition process can be used.

[0537] The bulging polymer beads 106' can then be removed. Removal of the bulging polymer beads can be achieved through dissolution, chemical or enzymatic degradation, or photolysis. As shown in Figure 18L, the bead removal process removes i) the bulging polymer beads 106' and ii) the functionalized layer 26 thereon. The functionalized layers 24 and 26 remain intact on their respective portions of the resin layers 50 and 18, partly because the functionalized layers 24 and 26 are covalently attached to the resin layers 50 and 18.

[0538] In Figure 18M, for example, a polishing process is used to remove the functionalized layer 26 disposed on the gap region 22. The polishing process can be performed using chemical abrasive slurries as described herein. A cleaning and drying process can be performed after polishing.

[0539] Although the single functionalized layers 24, 26 are shown in Figures 18G and 18M, it should be understood that the methods described with reference to Figures 18A to 18M can be performed to produce an array of recesses 20' (which have functionalized layers 24, 26) separated by gap regions 22 spanning the surfaces of resin layers 50, 18.

[0540] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 18A to 18M) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 18A to 18M) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed.

[0541] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in Figures 18D or 18H). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to the second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to the second functionalized layer 26. Conversely, for example in Figure 18F, initiators 38, 40, or 38', 40' can be grafted after the application of the second functionalized layer 26, provided that i) the second functionalized layer 26 has different functional groups for attaching initiators 38, 40, or 38', 40' (compared to the first functionalized layer 24), or ii) any unreacted functional groups of the first functionalized layer 24 have been quenched, for example, by Staudinger reduction to amine or by additional click reaction with passive molecules such as hexynic acid. Because the functionalized layer 24 is covered by the bulging polymer beads 106 in Figure 18K, initiators 38, 40, or 38', 40' can be grafted onto the second functionalized layer 26 without conditions i) or ii).

[0542] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0543] Another method for forming the architecture of Figure 1E is shown in Figures 22A to 22G.

[0544] As shown in Figure 22A, the substrate may be a multilayer stack, including resin layers 50, 18 and an underlying substrate support 14. The substrate support 14 may or may not be transparent in this example. The resin layers 50, 18 are initially imprinted to form recessed areas 56 including a deeper portion 58 and a shallower portion 60 defined by stepped portions 62. In one example, a working mold and curing may be used as described with reference to Figure 3B. In this example, the recessed areas 56 are also multilayered recesses 20'.

[0545] This method can also be performed using a single-layer substrate support 14 (e.g., SiO2, Ta2O5, silicon, etc.), and multi-layer recesses 20' will be formed in the single-layer substrate support 14.

[0546] After defining the multi-layered recesses 20', the resin layers 50, 18 can be activated by plasma ashing before any further processing. When using a single-layer substrate support 14, the activation method may vary depending on the material used.

[0547] As shown in Figure 22A, a sacrificial layer 48'' is applied to resin layers 50 and 18. It is desirable that the sacrificial layer 48'' i) has an etch difference from the photoresist 52 or 82' to be used in this method, and ii) be easily removable. Examples of suitable materials for the sacrificial layer 48'' include silicon (removable under alkaline (pH) conditions), aluminum (removable under acidic or alkaline conditions), gold (removable in a mixture of iodine and iodides), silver (removable in a mixture of iodine and iodides), titanium (removable in H₂O₂), or copper (removable in a mixture of iodine and iodides). In one example, the sacrificial layer 48'' is aluminum. The sacrificial layer 48'' can be deposited using any suitable deposition technique.

[0548] The sacrificial layer 48'' can then be etched, as shown in FIG22B, to expose the resin layers 50 and 18 at the deeper portion 58 and the shallower portion 60. More specifically, this process exposes the surface 59 of the resin layers 50 and 18 at the deeper portion 58 and the surface 63 of the resin layers 50 and 18 at the shallower portion 60. In the example shown in FIG22B, this etching process also exposes the gap region 22 of the resin layers 50 and 18. The portion of the sacrificial layer 48'' aligned with the sidewall of the multilayer recess 20' is not removed due to this etching process. A dry etching process, such as anisotropic oxygen plasma or a mixture of 90% CF4 and 10% O2 plasma, can be used to etch the sacrificial layer 48''.

[0549] Next, the first functionalized layer 24 is applied to the remaining portion of the sacrificial layer 48'' and the exposed portions of the resin layers 50, 18, such as 22, 59, 63, as shown in FIG22C. The first functionalized layer 24 can be deposited using any suitable deposition technique.

[0550] As shown in Figure 22D, a photoresist is applied to the first functionalized layer 24 and the multilayer recesses 20', and then developed to form an insoluble photoresist 52 or 82'. In this example, a negative or positive photoresist can be applied and developed such that all the photoresist on the first functionalized layer 24 is insoluble in the developer.

[0551] A timed dry etching process can then be used to remove portions of the insoluble photoresist 52 or 82' and the first functionalized layer 24. This process is shown in Figure 22E, where arrows indicate the etched portions. Etching is performed to expose the resin layer (substrate) surface 63 at the shallower portion 62 and portions of the sacrificial layer 48''. As shown in Figure 22E, the timed dry etching is stopped such that a portion of the insoluble photoresist 52 or 82' and a portion of the first functionalized layer 24 remain in the deeper portion 58 immediately adjacent to the stepped portion 62. Thus, at the stepped portion 62, the remaining insoluble photoresist 52 or 82' and the first functionalized layer 24 are at least substantially coplanar with the surface 63 of the resin layers 50, 18. In one example, the timed dry etching may involve reactive ion etching (e.g., using CF4) or 100% O2 plasma etching.

[0552] Next, a second functionalized layer 26 is applied to the exposed portions of the substrate (e.g., resin layers 50, 18) and the exposed portions of the sacrificial layer 48''. This is shown in FIG22F.

[0553] The remaining portions of photoresist 52 or 82' and sacrificial layer 48'' can then be stripped. Insoluble negative photoresist 52 can be stripped with suitable removal agents, including dimethyl sulfoxide (DMSO), acetone, or N-methyl-2-pyrrolidone (NMP)-based strippers. Insoluble positive photoresist 82' can be stripped with sonicated dimethyl sulfoxide (DMSO), acetone, propylene glycol monomethyl ether acetate, or N-methyl-2-pyrrolidone (NMP)-based strippers. Sacrificial layer 48'' can be stripped in a suitable stripping liquid. As an example, aluminum sacrificial layers can be removed under acidic or alkaline conditions, copper sacrificial layers can be removed using FeCl3, and silicon sacrificial layers can be removed under alkaline (pH) conditions. The stripping process removes i) at least 99% of the photoresist 52 or 82', ii) at least 99% of the sacrificial layer 48'', and ii) the first and second functionalized layers 24, 26 thereon or in contact with it. For example, this stripping process can remove the first functionalized layer 24 that is in contact with the sacrificial layer 48'' that is not covalently attached to the resin layers 50, 18. In contrast, the portions of the first and second functionalized layers 24, 26 covalently attached to the resin layers 50, 18 remain at least substantially intact. As shown in FIG22G, this process leaves the functionalized layers 24, 26 on the surfaces 59 and 63 of the resin layers 50, 18 in the multilayer recess 20', respectively.

[0554] The stripping process may also leave portions of the second functionalized layer 26 on the gap region 22. These portions of the second functionalized layer 26 can be polished away with a chemical slurry as described herein with reference to Figure 13H. Polishing should be terminated before any of the functionalized layers 24 and 26 are removed from surfaces 59 and 63. Cleaning and drying processes can be performed after polishing.

[0555] Although the single functionalized layers 24, 26 are shown in FIG22G, it should be understood that the methods described with reference to FIG22A to FIG22G can be performed to produce an array of recesses 20' (which have functionalized layers 24, 26) separated by gap regions 22 across the surfaces of resin layers 50, 18.

[0556] Although not shown in the figures, this method also includes attaching individual primer groups 30, 32 to functionalized layers 24, 26. In some instances, primers 34, 36, or 34', 36' (not shown in Figures 22A to 22G) may be pre-grafted to functionalized layer 24. Similarly, primers 38, 40, or 38', 40' (not shown in Figures 22A to 22G) may be pre-grafted to functionalized layer 26. In these instances, no additional primer grafting is performed.

[0557] In other instances, leads 34, 36, or 34', 36' are not pre-grafted to functionalized layer 24. In these instances, leads 34, 36, or 34', 36' may be grafted after functionalized layer 24 is applied (e.g., in FIG. 22C). In these instances, leads 38, 40, or 38', 40' may be pre-grafted to second functionalized layer 26. Alternatively, in these instances, leads 38, 40, or 38', 40' may not be pre-grafted to second functionalized layer 26. Instead, leads 38, 40, or 38', 40' may be grafted after second functionalized layer 26 is applied (e.g., in FIG. 22F).

[0558] When grafting is performed during this method, any grafting technique described herein can be used to perform the grafting.

[0559] [, Manufacturing drawings , ] [, 1B , ] [, and diagram , ] [, 1D , ] [, Additional methods for the flow pool architecture , ]

[0560] Figures 20A through 20M illustrate other example methods including back-side exposure. One example, as shown in Figures 20A through 20G, can be used to form the architecture shown in Figure 1B, and another example, as shown in Figures 20A and 20H through 20M, can be used to form the architecture shown in Figure 1D.

[0561] These examples utilize another example of a self-aligned photomask. Figures 19A to 19C collectively illustrate the formation of another example of a multilayer stack including this other example of a self-aligned photomask. This multilayer stack includes a transparent substrate support 14'; a sacrificial layer 48 located on the transparent substrate support 14', the sacrificial layer 48 defining a first functionalized region pattern 74'' exposing the transparent substrate support (e.g., portion 64); a transparent layer 72 located on the sacrificial layer 48 and at the first functionalized region pattern 74'' on the transparent substrate support 14'; and a second sacrificial layer 48' located on the transparent layer 72, the second sacrificial layer 48' defining a second functionalized region pattern 70'' exposing the transparent layer 72 (e.g., at portion 76), wherein a first portion 112 of the second functionalized region pattern 74'' overlaps with the first functionalized region pattern 74''.

[0562] The top view of the sacrificial layer 48 in Figure 19D illustrates that the shape of the first functionalized region pattern 74'' is consistent with the desired shape of the first functionalized pad 24' (Figure 20G) or layer 24 (Figure 20M) to be formed. Therefore, when the first functionalized layer 24 is deposited at the first functionalized region pattern 74'', pad 24' or layer 24 is formed.

[0563] The top view of the second sacrificial layer 48' in Figure 19E illustrates that the shape of the second functionalized region pattern 70'' has a portion 112 that overlaps with the shape of the first functionalized region pattern 74'', and another portion 114 that is consistent with the shape of the second functionalized layer pad 26' (Figure 20G) or layer 24 (Figure 20M) to be formed.

[0564] To create this multilayer stack, a sacrificial layer 48 is deposited on a transparent substrate support 14', as shown in FIG19A. Any of the transparent substrate supports 14' disclosed herein may be used. Examples of suitable materials for the sacrificial layer 48 include those described herein, such as titanium, chromium, platinum, silicon, aluminum, copper, etc. Selective deposition techniques (e.g., masking and coating) are used to deposit the sacrificial layer 48, thereby defining the first functionalized region pattern 74''.

[0565] As shown in Figure 19B, the transparent layer 72 is then applied to the sacrificial layer 48 at the first functionalized region pattern 74'' and the transparent substrate support 14' using any suitable deposition technique. The transparent layer 72 can be activated by silanization to generate surface groups that can react with the functionalized layers 24 and 26.

[0566] A second sacrificial layer 48' is deposited on the transparent layer 72, as shown in Figure 19C. Examples of suitable materials for the second sacrificial layer 48' include silicon, aluminum, or copper. The second sacrificial layer 48' is deposited using selective deposition techniques (e.g., masking and coating) to define the second functionalized region pattern 70''.

[0567] As mentioned, two different example methods utilize this multilayer stack and are illustrated in Figures 20A through 20M. These methods generally include providing a multilayer stack (illustrated in Figure 19C), developing a positive photoresist 82 using the multilayer stack via a transparent substrate support 14' (Figures 20B and 20I) to define an insoluble positive photoresist 82' at a predetermined area of ​​the multilayer stack (Figures 20C and 20J); defining a first functionalized region (e.g., pad 24' in Figure 20G or layer 24 in Figure 20M) corresponding to a first functionalized region pattern 74'' using the insoluble positive photoresist 82'; and defining a second functionalized region (e.g., pad 26' in Figure 20G or layer 26 in Figure 20M) corresponding to a second portion 114 of a second functionalized region pattern 70'' using a second sacrificial layer 48'.

[0568] Figure 20A depicts the multilayer stack of Figure 19C. In one example method, the multilayer stack is used to develop the positive photoresist 82 before applying any functionalized layers 24, 26. In this example, developing the positive photoresist 82 using the multilayer stack first involves applying the positive photoresist 82 at the second functionalized region pattern 70'' on the transparent layer 72 and on the second sacrificial layer 48' (as shown in Figure 20B); and exposing the positive photoresist to light via the transparent substrate support 14', wherein the portion of the positive photoresist 82 covering the first functionalized region pattern 74'' becomes soluble in the developer, and the portion of the positive photoresist covering the sacrificial layer 48 defines the insoluble positive photoresist 82' (as shown in Figure 20C) (which is insoluble in the developer).

[0569] Positive photoresist 82 can be any of the examples described herein and can be applied using any suitable deposition technique disclosed herein. When positive photoresist 82 is used, selective exposure to certain wavelengths of light forms soluble regions, and a developer is used to remove the soluble regions. In one example, UV light is used. The portions of positive photoresist 82 not exposed to light become insoluble in the developer. In this example, sacrificial layer 48 blocks at least 75% of the light transmitted through transparent substrate support 14' and transparent layer 72 from reaching the positive photoresist 82 directly disposed with respect to sacrificial layer 48. Therefore, these portions become insoluble positive photoresist portions 82'. In contrast, transparent layer 72 transmits light through the first functionalized region pattern 74''. Therefore, the portion of positive photoresist covering the entire first functionalized region pattern 74'' remains soluble in the developer. One or more soluble portions may be removed, for example, with a developer, to reveal the first portion 112 of the second functionalized region pattern 70'' and the portion 76 of the transparent layer 72 overlapping with the first functionalized region pattern 74''. Any example of a developer described herein for positive photoresist 82 may be used.

[0570] At least 95% of the soluble portion of the positive photoresist 82 is soluble in the developer. After the positive photoresist is exposed to the developer, the multilayer stack can be exposed to O2 plasma to clean, for example, the exposed portion 76.

[0571] The first functionalized region (e.g., the pad 24 in FIG. 20G) is then defined using an insoluble positive photoresist 82', which involves applying the first functionalized layer 24 on the insoluble positive photoresist 82' and on the exposed portion 76 of the transparent layer 72 (as shown in FIG. 20D); and peeling off the insoluble positive photoresist 82' and the first functionalized layer 24 thereon (as shown in FIG. 20E).

[0572] The first functionalized layer 24 can be applied using any suitable deposition technique. In one example, the first functionalized layer 24 is applied using dip coating. As shown in FIG20D, the functionalized layer 24 is deposited on the exposed portion 76 of the insoluble positive photoresist 82' and the transparent layer 72. The portion 76 has the desired shape of the functionalized pad 24', and therefore the portion on which the first functionalized layer 24 is deposited is also so.

[0573] The insoluble positive photoresist 82' can be stripped using dimethyl sulfoxide (DMSO), acetone, propylene glycol monomethyl ether acetate, or an N-methyl-2-pyrrolidone (NMP)-based stripper. As shown in Figure 20E, the stripping process removes i) at least 99% of the insoluble positive photoresist 82' and ii) the functionalized layer 24 thereon. This process exposes a second portion 76' of the transparent layer 72. This second portion 76' corresponds to the second portion 114 of the second functionalized region pattern 70''.

[0574] The second sacrificial layer 48' is then used to define the second functionalized region (e.g., pad 26' in FIG. 20G). This involves applying the second functionalized layer 26 to the second sacrificial layer 48' and at the second portion 114 of the second functionalized region pattern 70'' on the transparent layer 72 (e.g., on portion 76', as shown in FIG. 20F); and peeling off the second sacrificial layer 48' and the second functionalized layer 26 thereon (as shown in FIG. 20G).

[0575] The second functionalized layer 26 can be applied using any suitable deposition technique. In this example, when the gel material is deposited under high ionic strength (e.g., in the presence of 10× PBS, NaCl, KCl, etc.), the second functionalized layer 26 does not deposit on or adhere to the first functionalized layer 24. The portion 76' has the desired shape of the functionalized pad 26', and therefore the portion on which the second functionalized layer 26 is deposited is also such a portion. This is illustrated in Figure 20F.

[0576] The second sacrificial layer 48' may be exposed to the stripping process. Any suitable wet stripping process may be used, such as soaking, sonication, stripping flow (e.g., using KOH), or rotation and distribution of the stripping liquid. The wet stripping process used will depend on the material of the sacrificial layer 48'. For example, aluminum sacrificial layers may be removed under acidic or alkaline conditions, copper sacrificial layers may be removed using FeCl3, copper, gold, or silver sacrificial layers may be removed in iodine and iodide solutions, titanium sacrificial layers may be removed using H2O2, and silicon sacrificial layers may be removed under alkaline (pH) conditions. The stripping process removes i) at least 99% of the second sacrificial layer 48' and ii) the second functionalized layer 26 thereon. This process may also remove the first functionalized layer 24 that is in contact with the second sacrificial layer 48' that is not covalently attached to the transparent layer 72. As shown in FIG20G, this process leaves the functionalized layer pads 24', 26' on the transparent layer 72 and exposes the gap region 22.

[0577] During the removal of the second sacrificial layer 48', the functionalized pads 24' and 26' were able to remain intact, partly because the functionalized pads 24' and 26' were covalently attached to the transparent layer 72.

[0578] Although single functionalized pads 24' and 26' are shown in FIG. 20G, it should be understood that the methods described with reference to FIG. 20A to FIG. 20G can be performed to produce functionalized pads 24' and 26' separated by gap regions 22 spanning the surface of the transparent layer 72.

[0579] Referring back to Figure 20A, another method example is then described with reference to Figure 20H. In this example of the method, the recess 20 is first formed in the transparent layer 72. The transparent layer 72 can be etched using a timed dry etching process, stopping the process before reaching the underlying sacrificial layer 48. This etching process essentially extends the second functionalized region pattern 70'' (including portions 112 and 114) further into the transparent layer 72. In this example, the second sacrificial layer 48' acts as a mask during recess formation, preventing the portion of the transparent layer 72 below the second sacrificial layer 48' from being removed. As shown in Figure 20H, this etching process forms the recess 20 in the transparent layer 72.

[0580] As shown in Figure 20I, this method then involves applying a positive photoresist 82 onto the second sacrificial layer 48' and the transparent layer 72 (e.g., in the recess 20). The positive photoresist 82 can be applied using any suitable deposition technique disclosed herein.

[0581] Positive photoresist 82 is exposed to light via a transparent substrate support 14', wherein the portion of the first positive photoresist 82 coated on the first functionalized region pattern 74'' becomes soluble in the developer, and the portion of the positive photoresist 82 coated on the sacrificial layer 48 defines an insoluble positive photoresist 82' (which is insoluble in the developer). The sacrificial layer 48 blocks at least 75% of the light transmitted through the transparent substrate support 14' and the transparent layer 72 from reaching the positive photoresist 82 directly disposed with respect to the sacrificial layer 48. Therefore, these portions become insoluble positive photoresist portions 82', as shown in FIG20J. In contrast, the transparent layer 72 transmits light from the first functionalized region pattern 74''. Therefore, the portion of the positive photoresist 82' coated on the first functionalized region pattern 74'' is soluble in the developer. The soluble portion is removed, for example, with a developer to reveal the first portion 112 of the second functionalized region pattern 70'' and the portion 76 where the transparent layer 72 overlaps with the first functionalized region pattern 74''. The resulting structure is shown in Figure 20J. Any example of a developer described herein for positive photoresist 82 can be used.

[0582] At least 95% of the soluble portion of the positive photoresist 82 is soluble in the developer. After the positive photoresist is exposed to the developer, the multilayer stack can be exposed to O2 plasma to clean, for example, the exposed portion 76.

[0583] As shown in Figure 20K, a first functionalized layer 24 is then applied to the insoluble positive photoresist 82' and a portion 76 of the transparent layer 72 using any suitable deposition technique. In one example, spin coating is used to apply the first functionalized layer 24. During multilayer stacking (e.g., in Figure 19B), the transparent layer 72 can be activated by silanization to generate surface groups that can react with the functionalized layer 24. Thus, the functionalized layer 24 is covalently attached to a portion 76 of the transparent layer 72.

[0584] The insoluble positive photoresist 82' can be stripped using dimethyl sulfoxide (DMSO), acetone, propylene glycol monomethyl ether acetate, or an N-methyl-2-pyrrolidone (NMP)-based stripper. As shown in Figure 20L, the stripping process removes i) the insoluble positive photoresist 82' and ii) the functionalized layer 24 thereon, thus exposing another portion 76' of the transparent layer 72. This second portion 76' corresponds to the second portion 114 of the second functionalized region pattern 70''.

[0585] The second sacrificial layer 48' is then used to define the second functionalized region (e.g., layer 26 in FIG. 20M). This involves applying the second functionalized layer 26 to the second sacrificial layer 48' and at the second portion 114 of the second functionalized region pattern 70' on the transparent layer 72 (e.g., on portion 76', as shown in FIG. 20L); and peeling off the second sacrificial layer 48' and the second functionalized layer 26 thereon (as shown in FIG. 20M).

[0586] The second functionalized layer 26 can be applied using any suitable deposition technique. In this example, when the deposition of the gel material is carried out under high ionic strength (e.g., in the presence of 10× PBS, NaCl, ...

Claims

1. A flow cell comprising: a substrate support; a protrusion located on the substrate support, the protrusion being made of a different material from the substrate support; a first functionalized layer located on a first portion of the protrusion; a second functionalized layer located on a second portion of the protrusion; a first initiator assembly attached to the first functionalized layer, the first initiator assembly having a non-degradable first initiator and a degradable second initiator; and a second initiator assembly attached to the second functionalized layer, the second initiator assembly having a degradable first initiator and a non-degradable second initiator.

2. The flow cell of claim 1, wherein the flow cell further comprises a hydrophobic layer located between the substrate support and the protrusion.

3. As in request item 2, the flow pool, wherein: The flow cell includes a plurality of such protrusions; and each of the plurality of protrusions is spatially separated from the other of the plurality of protrusions by a gap region of the hydrophobic layer.

4. The flow cell of claim 3, wherein the interstitial regions of the hydrophobic layers are at least substantially free of the first and second functionalized layers and the first and second initiator sets.

5. As in request item 1, the flow pool, where: The substrate support includes a substrate that is transparent to ultraviolet light; the protrusion includes tantalum pentoxide; and the flow cell further includes a shielding layer located between the substrate support and the protrusion.

6. As in request item 5, the flow pool, wherein: The flow cell includes a plurality of such protrusions; and each of the plurality of protrusions is spatially separated from another of the plurality of protrusions by a gap area in the base support.

7. The flow cell of claim 6 further includes a deactivated portion covering the gap region of the substrate support, the deactivated portion including a deactivated first functionalized layer or a deactivated first initiator group.

8. A method for patterning a multilayer stack, the method comprising: imprinting a resin layer of the multilayer stack to form a multi-height protrusion region including a first region having a first height and a second region having a second height less than the first height, wherein the multilayer stack includes, from top to bottom, the resin layer, a sacrificial layer, a transparent layer and at least one additional layer, the additional layer being selected from the group consisting of a substrate support and a hydrophobic layer on the substrate support; selectively etching a portion of the multilayer stack surrounding the multi-height protrusion region to expose the at least one additional layer; selectively etching the multi-height protrusion region to remove a portion of the resin layer and the sacrificial layer below the second region of the multi-height protrusion region, thereby forming a protrusion on the substrate support and exposing a first portion of the transparent layer, the protrusion including at least the transparent layer and having a material different from the substrate support; applying a first functionalized layer to the protrusion, including on the first portion of the transparent layer and on the remaining portion of the sacrificial layer; The remaining portion of the sacrificial layer and its first functionalized layer are peeled off, thereby exposing the second portion of the transparent layer, and thereby maintaining the first functionalized layer on the first portion of the protrusion; a second functionalized layer is applied to the second portion of the transparent layer, thereby on the second portion of the protrusion; a first primer set is attached to the first functionalized layer, wherein the first primer set includes a non-degradable first primer and a degradable second primer; and a second primer set is attached to the second functionalized layer, wherein the second primer set includes a degradable first primer and a non-degradable second primer.

9. As in request item 8, wherein: The at least one additional layer is the substrate support, and the substrate support is transparent to ultraviolet light; the multilayer stack further includes a masking layer located between the substrate support and the transparent layer; the application of the first functionalized layer covers the sacrificial layer and a first portion of the transparent layer and the exposed portion of the substrate support; and the method further includes guiding ultraviolet light through the substrate support, wherein the masking layer blocks the ultraviolet light from reaching the transparent layer, and the substrate support transmits the ultraviolet light to a portion of the first functionalized layer on the exposed portion of the substrate support, wherein the ultraviolet light deactivates a portion of the first functionalized layer on the exposed portion of the substrate support or deactivates a first set of initiators at a portion of the first functionalized layer on the exposed portion of the substrate support.

10. The method of claim 9, wherein the ultraviolet light deactivates a portion of the first functionalized layer on the exposed portion of the substrate support, and wherein the method further comprises attaching the first initiator set to the activated portion of the first functionalized layer and attaching the second initiator set to the activated portion of the second functionalized layer.

11. As in request item 8, where: The at least one additional layer includes a hydrophobic layer on the substrate support; and the application of the first functionalized layer covers a first portion of the sacrificial layer and the transparent layer, but does not cover the exposed portion of the hydrophobic layer.

12. A method of patterning a substrate, the method comprising: applying a release material to a first portion of a recess defined in the substrate, wherein a second portion of the recess remains exposed; applying a blocking material to a gap region adjacent to the recess, wherein the blocking material is different from the release material; applying a first functionalized layer to the second portion of the recess; peeling off the release material to expose the first portion of the recess; applying a second functionalized layer to the first portion of the recess; and attaching respective sets of leads to the first and second functionalized layers.

13. The method of claim 12, wherein the application of the first functionalized layer involves: activating a second portion of the depression to generate surface groups that react with the first functionalized layer; and depositing the first functionalized layer.

14. The method of claim 13, wherein the stripping material is stripped after the second portion of the depression is activated and before the first functionalized layer is deposited.

15. The method of claim 13, wherein the release material is peeled off after activating the second portion of the depression and depositing the first functionalized layer.

16. The method of claim 12, wherein the application of the second functionalized layer involves: activating a first portion of the depression to generate surface groups that react with the second functionalized layer; and depositing the second functionalized layer.

17. The method of claim 12, wherein the blocking material comprises a second peeling material, and wherein the method further comprises peeling off the blocking material.

18. As in request item 17, wherein: i) The release material contains a metal sacrificial layer and the second release material contains a photoresist; or ii) The release material contains a photoresist and the second release material contains a metal sacrificial layer.

19. The method of claim 12, wherein the blocking material comprises a hydrophobic material.

20. As in request item 12, wherein: Before applying the release material, the blocking material is selectively applied to the gap regions; and before applying the release material, the method further includes activating the depression to generate surface groups that react with each of the first functionalized layer and the second functionalized layer.

21. As in request item 12, wherein: The substrate includes a transparent layer located on a substrate support; and before applying the release material and the blocking material, the method further includes: generating an insoluble photoresist in the recess; removing the transparent layer from a gap region adjacent to the recess when the insoluble photoresist is present in the recess; and removing the insoluble photoresist from the recess.

22. A method of patterning a substrate, the method comprising: applying a silanized layer on a substrate including recesses separated by gap regions; filling the recesses with a sacrificial material; plasma etching the silanized layer in the gap regions; removing a portion of the sacrificial material from the recesses to expose a first portion of the silanized layer in the recesses; applying a first functionalized layer on the first portion of the silanized layer in the recesses; removing a second portion of the sacrificial material from the recesses to expose a second portion of the silanized layer in the recesses; applying a second functionalized layer on the second portion of the silanized layer in the recesses; and attaching respective sets of initiators to the first and second functionalized layers.

23. A method of patterning a substrate, the method comprising: applying a protective substrate to a first portion of a recess defined in the substrate, wherein a second portion of the recess remains exposed; and applying a release material to a gap region adjacent to the recess. A first functionalized layer is applied to the second portion of the depression, wherein the protective base blocks the application of the first functionalized layer to the first portion of the depression; i) Remove the protective base or ii) reverse the blocking state of the protective base; apply a second functionalized layer to the first portion of the recess; and attach the respective initiator sets to the first and second functionalized layers.

24. The method of claim 23, wherein removing the protecting base involves cleaving the protecting base.

25. The method of claim 23, wherein reversing the blocking state involves an initial thiol-disulfide exchange or exposing the protecting group to water.

26. A method of patterning a substrate, the method comprising: applying a photoresist on a substrate, the substrate including a recessed region having a deeper portion and a shallower portion defined by a stepped portion; dry etching the photoresist to expose the surface of the stepped portion, wherein a portion of the photoresist is retained in the deeper portion; applying a first functionalized layer on the substrate and the portion of the photoresist; removing the photoresist and the first functionalized layer thereon to expose the substrate at the deeper portion; and applying a second functionalized layer on the substrate at the deeper portion; and attaching respective sets of leads to the first and second functionalized layers.

27. As in request item 26, wherein: The substrate further includes a gap region adjacent to the recessed region; the first functionalized layer is applied to the gap region; and the method further includes removing the first functionalized layer from the gap region.

28. The method of claim 26, wherein before applying the first functionalized layer, the method further comprises etching the stepped portion to define a recessed portion of photoresist adjacent to the deeper portion.

29. As in request item 26, wherein: The substrate further includes a gap region adjacent to the recessed region; the first functionalized layer is applied to the gap region; and the method further includes polishing the first functionalized layer of the gap region.

30. As in request item 26, wherein: The substrate comprises a multilayer stack, which includes a resin layer and an underlying transparent substrate. Before applying the first functionalized layer, the method further includes etching the stepped portion to expose the surface of the transparent substrate and define a recessed portion of the photoresist adjacent to the deeper portion.

31. As in request item 30, wherein: After the etching, the resin layer includes gap regions adjacent to the photoresist and the recessed portion; the first functionalized layer is applied to the gap regions; and the method further includes polishing the first functionalized layer of the gap regions.

32. A method for patterning a transparent substrate support, the method comprising: activating the surface of a resin layer including a recessed region having a deeper portion and a shallower portion defined by a stepped portion, wherein the resin layer is disposed on a transparent substrate support, and wherein the transparent substrate support is exposed at the deeper portion; applying a first functionalized layer to the activated resin layer, wherein the transparent substrate support remains exposed at the deeper portion; applying a silanized layer to the transparent substrate support exposed at the deeper portion; applying a second functionalized layer to the silanized layer; and attaching respective sets of initiators to the first and second functionalized layers.

33. As in request item 32, wherein: The resin layer further includes a gap region adjacent to the recessed region; the first functionalized layer is applied to the gap regions; and the method further includes polishing the first functionalized layer of the gap regions.

34. The method of claim 32, wherein prior to activating the resin layer, the method further comprises: imprinting the resin layer to form the recessed area; and dry etching the resin layer to expose the transparent substrate support at the deeper portion.

35. A method of patterning a substrate, the method comprising: introducing variable polymer beads into a deeper portion of a recessed region defined in a substrate, wherein the recessed region also includes a shallower portion defined by a stepped portion, and wherein the substrate includes a gap region adjacent to the recessed region; modifying the variable polymer beads to at least partially fill the deeper portion; applying a first functionalized layer to the substrate and the modified polymer beads; removing the modified polymer beads and the first functionalized layer thereon, thereby exposing the substrate at the deeper portion; applying a second functionalized layer to the substrate at the deeper portion; and attaching respective sets of initiators to the first and second functionalized layers.

36. The method of claim 35, wherein the substrate comprises a resin layer, and the method further comprises imprinting the resin layer to form the recessed area comprising a deeper portion and a shallower portion.

37. The method of claim 35, further comprising polishing the first functionalized layer of the interstitial regions after applying the second functionalized layer to the deeper portion.

38. As in request item 35, wherein: The method further includes polishing the first functionalized layer of the gap regions before applying the second functionalized layer to the deeper portion; applying the second functionalized layer to the gap regions; and the method further includes polishing the second functionalized layer of the gap regions.

39. The method of claim 35, wherein removing the modified polymer beads involves dissolving the modified polymer beads.

40. The method of claim 35, wherein changing the variable polymer beads involves expanding or annealing the variable polymer beads.

41. A method of patterning a substrate, the method comprising: applying a first functionalized layer on a substrate including a recessed region and a gap region adjacent to the recessed region, the recessed region including a deeper portion and a shallower portion defined by a stepped portion; introducing variable polymer beads on the first functionalized layer in the deeper portion; and changing the variable polymer beads to at least partially fill the deeper portion. Remove the exposed portion of the first functionalized layer, thereby exposing a portion of the substrate; A second functionalized layer is applied to the substrate and the variable polymer beads; the variable polymer beads and the second functionalized layer thereon are removed, thereby exposing the first functionalized layer at the deeper portion; and individual initiator sets are attached to the first and second functionalized layers.

42. The method of claim 41, wherein the substrate comprises a resin layer, and the method further comprises imprinting the resin layer to form the recessed area comprising a deeper portion and a shallower portion.

43. The method of claim 41, further comprising polishing the second functionalized layer of the gap regions.

44. The method of claim 41, wherein removing the variable polymer beads involves dissolving the altered polymer beads.

45. The method of claim 41, wherein changing the variable polymer beads involves expanding or annealing the variable polymer beads.

46. ​​A method of patterning a substrate, the method comprising: applying a sacrificial layer on a first portion of a recess defined in the substrate and on gap regions adjacent to the recess, wherein a second portion of the recess remains exposed, wherein the sacrificial layer on the gap regions has a first height, and wherein the sacrificial layer on the first portion of the recess has a second height less than the first height; applying a first functionalized layer on the second portion of the recess; reducing the thickness of the second height of the sacrificial layer, thereby exposing the first portion of the recess and leaving some of the sacrificial layer on the gap regions; applying a second functionalized layer on the second portion of the recess; and removing the sacrificial layer from the gap regions.

47. The method of claim 46, further comprising attaching the respective primer sets to the first and second functionalized layers.

48. The method of claim 46, wherein reducing the thickness of the sacrificial layer involves timed wet etching.

49. A method of patterning a substrate, the method comprising: applying a sacrificial layer on a substrate, the substrate including a recessed region having a deeper portion and a shallower portion defined by a stepped portion; and etching the sacrificial layer to expose the substrate at the deeper portion and the shallower portion. A first functionalized layer is applied to the remaining portion of the sacrificial layer and the exposed portion of the substrate; A photoresist is applied to the first functionalized layer; the photoresist and the first functionalized layer are dry-etched to expose the substrate surface and a portion of the sacrificial layer at the shallower portion, wherein a portion of the photoresist and a portion of the first functionalized layer remain in the deeper portion; a second functionalized layer is applied to the exposed portion of the substrate and the exposed portion of the sacrificial layer; and the remaining portion of the sacrificial layer and a portion of the photoresist are stripped.

50. The method of claim 49, further comprising attaching the respective primer sets to the first and second functionalized layers.

51. The method of claim 49, further comprising polishing a second functionalized layer in the gap region of the substrate.

52. A method of patterning a substrate, the method comprising: applying a sacrificial layer on a first portion of a recess defined in the substrate, wherein a second portion of the recess remains exposed; applying a first functionalized layer on a gap region adjacent to the recess, on the sacrificial layer, and on the second portion of the recess; applying a photoresist on the first functionalized layer; removing a portion of the photoresist and a portion of the first functionalized layer to expose the gap region and the sacrificial layer; removing the sacrificial layer thereby exposing the first portion of the recess; applying a second functionalized layer on the first portion of the recess; and peeling off the remaining portion of the photoresist.

53. The method of claim 52 further includes attaching the respective primer sets to the first and second functionalized layers.

54. The method of claim 52, further comprising polishing a second functionalized layer in the gap region of the substrate.

Images