Compounds and methods for modulating angiotensinogen expression
Patent Information
- Application Number
- TW110142878
- Authority / Receiving Office
- TW · TW
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2021-08-11
- Filing Date
- 2021-11-18
- Publication Date
- 2026-08-11
- Estimated Expiration
- 2041-11-17
AI Technical Summary
Current treatments for hypertension, particularly those targeting the renin-angiotensin system, have limitations in inhibiting the RAAS pathway and are ineffective for a significant proportion of hypertensive patients, and can worsen kidney function in individuals with kidney disease.
Development of compounds and pharmaceutical compositions that reduce proangiotensin RNA and protein expression using modified oligonucleotides, specifically oligomeric compounds with modified sugar moieties and internucleoside linkages, to target and inhibit the RAAS pathway.
These compounds effectively ameliorate symptoms associated with hypertension and related conditions by reducing proangiotensin activity, providing an alternative treatment option that is not contraindicated for kidney disease.
Abstract
Description
Technical Field
[0001] This invention provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of angiotensinogen RNA in cells or individuals and, in some cases, reducing the amount of angiotensinogen (AGT) in cells or individuals. These compounds and pharmaceutical compositions may be used to improve at least one symptom or marker of RAAS-related diseases or conditions. These diseases and conditions include hypertension, hypertensive emergencies (i.e., malignant hypertension), refractory hypertension, kidney disease (e.g., chronic kidney disease, polycystic kidney disease), preeclampsia, Marfan syndrome, stroke, heart disease (e.g., myocardial infarction, heart failure, congestive heart failure, valvular heart disease), vascular aneurysms, abdominal aneurysms, peripheral artery disease, organ injury, pulmonary hypertension, obesity, metabolic syndrome, NASH, NAFLD, and other RAAS-related diseases, conditions, and / or disorders or their symptoms. Prior Technology
[0002] Angiotensinogen (AGT), also known as SERPINA8 or ANHU, is a member of the serine protease inhibitor (serpin) family and a component of the renin-angiotensin-aldosterone system (RAAS). It is primarily produced in the liver and released into circulation, where renin converts it to angiotensin I. Angiotensin I is then converted to angiotensin II by angiotensin-converting enzyme (ACE). Angiotensin II is a peptide hormone that causes vasoconstriction, subsequently leading to increased blood pressure. Angiotensin II also stimulates the adrenal cortex to secrete the hormone aldosterone. Aldosterone increases the reabsorption of sodium and water by the kidneys, resulting in an increase in body fluid volume, which in turn increases blood pressure. Overstimulation or activity of the RAAS pathway can lead to hypertension. Chronic hypertension is called high blood pressure. Hypertension in individuals requires the heart to work harder to circulate blood through the blood vessels.
[0003] Hypertension remains a leading cause of death and disability worldwide from cardiovascular disease and stroke. Despite extensive research and the existence of various effective therapeutic interventions, hypertension remains a significant public health challenge in the United States (Sigmund et al., Hypertension 2020, 75: 902-917). Currently approved therapies for hypertension have limitations because a large proportion of all hypertensive patients do not achieve adequate blood pressure control. For example, drugs that target portions of the renin-angiotensin system (RAS) pathway, such as ACE inhibitors and angiotensin receptor blockers (ARBs), have limited ability to inhibit the RAAS pathway (Nobakht et al., Nat Rev Nephrol, 2011, 7:356-359). Furthermore, some antihypertensive drugs (such as ACE inhibitors) are contraindicated in hypertensive patients with kidney disease because they may impair renal function.
[0004] Therefore, there is a need to find alternative treatments that inhibit the RAAS pathway and treat hypertension. Thus, the objective of this paper is to provide compounds, methods, and pharmaceutical compositions for treating these conditions. Summary of the Invention
[0005] This document provides compounds, methods, and pharmaceutical compositions for reducing the amount or activity of AGT RNA in cells or individuals and, in some embodiments, reducing the expression of AGT protein. In some embodiments, the individual has cardiovascular disease. In some embodiments, the individual has hypertension. In some embodiments, the individual has refractory hypertension. In some embodiments, the individual has Marfan syndrome. In some embodiments, the individual has kidney disease. In some embodiments, the compound used to reduce the amount or activity of AGT RNA is an oligomeric compound. In some embodiments, the compound used to reduce the amount or activity of AGT RNA is a modified oligonucleotide. In some embodiments, the compound used to reduce the expression of AGT protein is an oligomeric compound. In some embodiments, the compound used to reduce the expression of AGT protein is a modified oligonucleotide.
[0006] Methods are also provided for improving at least one symptom or marker of a RAAS pathway-related disease or indication. In some embodiments, the disease is hypertension. In some embodiments, the disease is refractory hypertension. In some embodiments, the disease is Marfan syndrome. In some embodiments, the indication is heart failure. In some embodiments, symptoms or markers include hypertension, hypertensive emergency (i.e., malignant hypertension), preeclampsia, stroke, heart disease (e.g., myocardial infarction, heart failure, congestive heart failure, valvular heart disease), vascular aneurysm, abdominal aneurysm, organ injury, pulmonary hypertension, obesity, and other RAAS pathway-related diseases, conditions, and / or disorders or their symptoms. Implementation
[0007] [] [Sequence List] []
[0008] This application is filed together with an electronic sequence list. The sequence list is provided as a file titled BIOL0393TWSEQ_ST25.txt, created on November 16, 2021, and is 32 KB in size. Information from the electronic version of this sequence list is incorporated herein by reference in its entirety. []
[0009] It should be understood that both the foregoing general description and the following detailed description are illustrative and explanatory only, and are not restrictive. In this document, unless otherwise expressly stated, the use of the singular includes the plural. Unless otherwise stated, as used herein, "or" means "and / or". Furthermore, the use of the term "including" and other forms such as "includes" and "included" is not restrictive. Similarly, unless otherwise expressly stated, terms such as "element" or "component" cover elements and components constituting a unit as well as elements and components constituting more than one subunit.
[0010] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents or portions thereof cited in this application, including (but not limited to) patents, patent applications, articles, books, monographs, and GenBank, ENSEMBL, and NCBI reference sequence records, are expressly incorporated herein by reference in their entirety. definition
[0011] Unless specifically defined, the nomenclature, procedures, and techniques used in conjunction with analytical chemistry, synthetic organic chemistry, and medical and pharmaceutical chemistry as described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, publications, and other materials referenced throughout this disclosure are incorporated herein by reference in their entirety.
[0012] Unless otherwise indicated, the following terms have the following meanings: [definition] []
[0013] As used herein, "2'-deoxynucleoside" means a nucleoside comprising a 2'-H(H)deoxyfuranosyl sugar moiety. In some embodiments, the 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside comprising a 2'-β-D-deoxyribosyl sugar moiety having the β-D configuration found in native deoxyribonucleic acid (DNA). In some embodiments, the 2'-deoxynucleoside may comprise modified nucleotides or may comprise RNA nucleotides (uracil).
[0014] As used herein, "2'-MOE" refers to a sugar moiety in which the 2'-OH group of the furanyl sugar moiety is replaced by the 2'-OCH 2CH 2OCH 3 group. "2'-MOE sugar moiety" refers to a sugar moiety in which the 2'-OH group of the furanyl sugar moiety is replaced by the 2'-OCH 2CH 2OCH 3 group. Unless otherwise indicated, the 2'-MOE sugar moiety is β-D-ribosyl. "MOE" refers to O-methoxyethyl.
[0015] As used in this article, "2'-MOE nucleoside" refers to a nucleoside containing the 2'-MOE sugar moiety.
[0016] As used herein, "2'-OMe" refers to the 2'-OCH 3 group replacing the 2'-OH group of the furanyl sugar moiety. As used herein, "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" refers to the sugar moiety in which the 2'-OCH 3 group replaces the 2'-OH group of the furanyl sugar moiety. Unless otherwise indicated, the 2'-OMe sugar moiety is β-D-ribosyl.
[0017] As used in this article, "2'-OMe nucleoside" refers to a nucleoside containing the 2'-OMe sugar moiety.
[0018] As used herein, "2'-substituted nucleoside" means a nucleoside containing a 2'-substituted sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety contains at least one 2'-substituent that is not H or OH.
[0019] As used herein, "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleobase.
[0020] As used in this article, “about” means within ±10% of the value. For example, if it is stated that “the compound affects approximately 70% of AGT inhibition,” it implies that the AGT level is inhibited by 63% to 77%.
[0021] As used in this article, "to give" means to provide medicine to an individual.
[0022] As used in this article, "angiotensinogen" and "AGT" are used interchangeably. Angiotensinogen is also known as SERPINA8 and ANHU.
[0023] As used herein, "antihypertensive drugs" refers to drugs that can lower blood pressure. Examples of such drugs include (but are not limited to) RAAS inhibitors, diuretics, calcium channel blockers, adrenergic receptor antagonists, adrenergic agonists, and vasodilators. In one example, the antihypertensive drug captopril may be used in combination with the AGT compounds described herein to treat animals with or at risk of developing RAAS pathway-related diseases, conditions, and / or disorders.
[0024] As used herein, "antisense activity" means any detectable and / or measurable change attributable to hybridization of the antisense compound with its target nucleic acid. In some embodiments, antisense activity is a reduction in the amount or performance of the target nucleic acid or the protein encoded by the target nucleic acid compared to the target nucleic acid or target protein levels in the absence of the antisense compound.
[0025] As used herein, "antisense compound" means an oligomeric compound or oligodimer that can achieve at least one antisense activity.
[0026] As used herein, “improvement” in the context of treatment means that at least one symptom is improved relative to the same symptom in the absence of the treatment. In some embodiments, improvement is a reduction in the severity or frequency of the symptom, or a delay in the onset of the symptom or a slowing of its progression in severity or frequency. The progression or severity of the indicator can be determined by subjective or objective measures, as known to those skilled in the art.
[0027] As used in this article, "blood pressure" refers to the pressure of blood against the walls of blood vessels in the circulatory system. In animals, blood pressure is primarily caused by the heartbeat. During each heartbeat, blood pressure varies between maximum (systolic) blood pressure (SBP) and minimum (diastolic) blood pressure (DBP). Mean arterial pressure (MAP) is the average arterial pressure during the heartbeat cycle. Blood pressure can be measured using a blood pressure meter (also known as a sphygmomanometer). Normal resting blood pressure is less than 120 mmHg for systolic and less than 80 mmHg for diastolic, and is usually expressed as systolic (maximum reading) / diastolic (minimum reading) mmHg.
[0028] As used in this article, "bicyclic nucleoside" or "BNA" refers to a nucleoside that contains a bicyclic sugar moiety.
[0029] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety comprising two rings, wherein a second ring is formed via a bridge connecting two atoms in the first ring, thereby forming a bicyclic structure. In some embodiments, the first ring of the bicyclic sugar moiety is a furanyl moiety. In some embodiments, the furanyl sugar moiety is a ribosyl moiety. In some embodiments, the bicyclic sugar moiety does not contain a furanyl moiety.
[0030] As used herein, "cEt" refers to a 4' to 2' bridge replacing the 2'OH- group of the ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH 3)-O-2', and wherein the methyl group of the bridge is in the S configuration. "cEt sugar moiety" is a bicyclic sugar moiety in which a 4' to 2' bridge replaces the 2'OH- group of the ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH 3)-O-2', and wherein the methyl group of the bridge is in the S configuration. "cEt" also refers to a bound ethyl group.
[0031] As used in this article, "cEt nucleoside" refers to a nucleoside that contains the cEt sugar moiety.
[0032] As used herein, "cleavable portion" means a bond or group of atoms that can be broken under physiological conditions, such as within a cell, an individual, an animal, or a human body.
[0033] As used herein, "complementarity" of an oligonucleotide means that, when the oligonucleotide and the nucleotide sequence of another nucleic acid are aligned in a relative direction, at least 70% of the nucleotides of the oligonucleotide or one or more portions thereof are capable of forming hydrogen bonds with the nucleotides of the other nucleic acid or one or more portions thereof. As used herein, "complementary nucleotides" means nucleotides capable of forming hydrogen bonds with each other. Complementary nucleotide pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or target nucleic acids do not need to have nucleotide complementarity at every nucleoside. Conversely, some mismatch systems are tolerable. As used herein, “perfectly complementary” or “100% complementary” in relation to an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary to another oligonucleotide or target nucleic acid at every nucleobase of the shorter of the two oligonucleotides, or, if the oligonucleotides are of the same length, to each nucleoside.
[0034] As used herein, "binding group" refers to a group of atoms directly or indirectly attached to an oligonucleotide. A binding group includes a binding moiety and a linker that attaches the binding moiety to the oligonucleotide.
[0035] As used in this article, "linking linker" means a single bond or a group of atoms containing at least one bond that links the linking portion to the oligonucleotide.
[0036] As used in this article, "binding part" refers to a group of atoms that is linked to an oligonucleotide via a binding linker.
[0037] As used in this article, "neighboring" in the context of oligonucleotides refers to nucleotides, nucleosides, sugar moieties, or nucleotide bonds that are adjacent to each other. For example, "neighboring nucleosides" means nucleosides that are adjacent to each other in the sequence.
[0038] As used herein, a "palm-rich cluster" refers to a plurality of molecules having the same molecular formula, wherein the number or percentage of molecules within the cluster containing a specific stereochemical configuration at a particular palm-shaped center is greater than the expected number or percentage of molecules within the cluster containing the same specific stereochemical configuration at the same particular palm-shaped center if that particular palm-shaped center were stereorandom. A palm-rich cluster of molecules having multiple palm-shaped centers per molecule may contain one or more stereorandom palm-shaped centers. In some embodiments, the molecule is a modified oligonucleotide. In some embodiments, the molecule is a compound comprising a modified oligonucleotide.
[0039] As used in this article, "handicapped control" in relation to nucleoside-nucleotide linkages means that the handicappedness is enriched at the linkage site for a specific stereochemical configuration.
[0040] As used herein, "deoxygenated region" refers to a region of 5-12 adjacent nucleotides, wherein at least 70% of the nucleotides are 2'-β-D-deoxynucleotides. In some embodiments, each nucleotide is selected from 2'-β-D-deoxynucleotides, bicyclic nucleotides, and 2'-substituted nucleotides. In some embodiments, the deoxygenated region supports RNase H activity. In some embodiments, the deoxygenated region is the interstitial or internal region of a spacer polymer.
[0041] As used herein, "interstitial aggregate" refers to a modified oligonucleotide comprising an inner region situated between an outer region having one or more nucleosides, having a plurality of nucleosides supporting RNase H cleavage, wherein the nucleosides constituting the inner region are chemically different from the one or more nucleosides constituting the outer region. The inner region may be referred to as the "interstitial space," and the outer region may be referred to as the "wing." The inner region is a deoxygenated region. The position of the inner region or interstitial space refers to the sequence of the nucleosides in the inner region and is counted starting from the 5' end of the inner region. Unless otherwise indicated, "interstitial aggregate" refers to a glycomolecular structure. In some embodiments, each nucleoside of the interstitial space is a 2'-β-D-deoxynucleoside. In some embodiments, the interstitial space contains a 2'-substituted nucleoside at positions 1, 2, 3, 4, or 5 of the interstitial space, and the remaining nucleosides of the interstitial space are 2'-β-D-deoxynucleosides. As used herein, the term "MOE interstitial polymer" refers to an interstitial polymer having an interstitial space containing a 2'-β-D-deoxynucleoside and a wing containing a 2'-MOE nucleoside. As used herein, the term "mixed-wing interstitial polymer" refers to an interstitial polymer having wings containing modified nucleosides containing at least two different sugar modifications. Unless otherwise indicated, interstitial polymers may contain one or more modified nucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the sugar-modified interstitial polymer pattern.
[0042] As used in this article, a "hotspot" is a series of nucleobases on the target nucleic acid that is susceptible to the reduction in the amount or activity of the target nucleic acid mediated by oligomers.
[0043] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. While not limited to a specific mechanism, the most common hybridization mechanisms involve hydrogen bonding between complementary nucleobases, which can be Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds.
[0044] As used in this article, "hypertension" or "HTN" refers to a chronic medical condition characterized by elevated blood pressure in animals. Elevated blood pressure requires the heart to work harder to circulate blood through the blood vessels. Hypertension is defined as blood pressure consistently at or above 130 / 80 mmHg (Stage 1) or 140 / 90 mmHg (Stage 2). Hypertension is classified as primary or secondary. Primary hypertension has no clear cause and is believed to be related to genetics, diet, lack of exercise, and obesity. Secondary hypertension is caused by another medical condition. Hypertension is a major risk factor for shortened life expectancy, chronic kidney disease, stroke, myocardial infarction, heart failure, aneurysms (e.g., aortic aneurysm), peripheral artery disease, organ damage (e.g., cardiac enlargement or hypertrophy), and other cardiovascular diseases, conditions, and / or disorders, or their symptoms. Antihypertensive medications, dietary changes, and lifestyle modifications can lower blood pressure and reduce hypertension-related diseases, conditions, and / or disorders. Hypertension may be resistant to drug intervention (i.e., it can be controlled by commercially available drugs) or it may be resistant to drug intervention.
[0045] As used herein, "nucleoside linkage" refers to a covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein, "modified nucleoside linkage" refers to any nucleoside linkage other than a phosphodiester nucleoside linkage. "Thiophosphate nucleoside linkage" is a modified nucleoside linkage in which one of the non-bridging oxygen atoms in the phosphodiester nucleoside linkage is replaced by a sulfur atom.
[0046] As used herein, "linkomeric nucleoside" refers to a nucleoside that directly or indirectly links an oligonucleotide to a binding site. Linkomeric nucleosides reside within the linker of an oligomer. Linkomeric nucleosides are not considered part of the oligonucleotide moiety of the oligomer, even if they are adjacent to the oligonucleotide.
[0047] As used in this article, "non-bicyclic modified sugar moiety" means a modified sugar moiety containing modifications (such as substituents) that do not form bridges between the two atoms of the sugar to form a second ring.
[0048] As used in this article, "mismatch" or "non-complementarity" means that when the first oligonucleotide is aligned with the second oligonucleotide, the nucleobases of the first oligonucleotide are not complementary to the corresponding nucleobases of the second oligonucleotide or the target nucleic acid.
[0049] As used in this article, "motif" refers to the pattern of unmodified and / or modified sugar moieties, nucleobases and / or nucleosides in an oligonucleotide.
[0050] As used herein, "nucleobase" refers to an unmodified or modified nucleobase. As used herein, "unmodified nucleobase" refers to adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" refers to a group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-Methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases. As used herein, "nucleobase sequence" refers to the sequence of adjacent nucleobases in a target nucleic acid or oligonucleotide, regardless of any sugar or nucleoside linkage modifications.
[0051] As used herein, "nucleoside" refers to a compound or compound fragment comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are either independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abase-free nucleosides lacking a nucleobase. "Linked nucleosides" are nucleosides linked by adjacent sequences (i.e., no other nucleosides exist between the linked nucleosides).
[0052] As used herein, "oligomeric compound" means oligonucleotide and, where applicable, one or more additional features, such as binding groups or terminal groups. An oligomeric compound may be paired with a second oligomeric compound complementary to the first oligomeric compound, or may not be paired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligoduplex" refers to a duplex formed from two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligoduplex may be referred to as a "duplexed oligomeric compound."
[0053] As used herein, "oligonucleotide" means a chain of linked nucleosides connected by internucleotide bonds, wherein each nucleoside and the internucleotide bonds may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" means an oligonucleotide in which at least one nucleoside or internucleotide bond is modified. As used herein, "unmodified oligonucleotide" means an oligonucleotide that does not contain any nucleoside or internucleotide modifications.
[0054] As used herein, "organ damage" or "end-organ damage" refers to damage occurring in a major organ supplied by the circulatory system, such as the heart (e.g., myocardial hypertrophy, decreased cardiac function, and / or heart failure), the kidneys (e.g., albuminuria, proteinuria, decreased renal function, and / or renal failure), the eyes (e.g., hypertensive retinopathy), the brain (e.g., stroke), and the like. Hypertension can damage organs in animals. In some embodiments, cardiac damage is fibrosis, hypertrophy of cardiac cells and / or muscles, resulting in cardiac enlargement.
[0055] As used herein, "medically acceptable carrier or diluent" means any substance suitable for administration to an individual. Certain such carriers enable the formulation of pharmaceutical compositions into, for example, tablets, pills, sugar-coated tablets, capsules, liquids, gels, syrups, liquids, suspensions, and rhomboid tablets for oral ingestion by an individual. In some embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
[0056] As used in this article, "medically acceptable salt" means a compound that is physiologically and pharmaceutically acceptable. A pharmaceutically acceptable salt retains the desired biological activity of the parent compound without conferring undesirable toxicological effects.
[0057] As used herein, "pharmaceutical composition" means a mixture of substances suitable for administration to an individual. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In some embodiments, the pharmaceutical composition exhibits activity in free-take analysis in certain cell lines.
[0058] As used herein, "prodrug" refers to a therapeutic agent that is converted within an individual or its cells into a form different from its in vitro form. Typically, the conversion of prodrugs within an individual is facilitated by enzymes (e.g., endogenous or viral enzymes) or chemicals present in cells or tissues and / or by physiological conditions.
[0059] As used herein, “reduction or activity” refers to a reduction or blockage of transcriptional expression or activity relative to untreated or control samples, and does not necessarily indicate complete elimination of transcriptional expression or activity.
[0060] As used herein, the "renin-angiotensin-aldosterone system," "renin-angiotensin-aldosterone system pathway," "RAAS pathway," or "RAAS" refers to a multi-component enzymatic pathway in which the precursor component (angiotensinogen) is converted into downstream components, such as angiotensin I and angiotensin II, by various enzymes (such as renin and angiotensin-converting enzyme (ACE)). Angiotensin I stimulates the secretion of the steroidal aldosterone in the pathway. The RAAS pathway regulates blood pressure and fluid homeostasis.
[0061] As used herein, the "renin-angiotensin system," "RAS," or "RAS pathway" refers to a portion of the RAAS pathway. Agonists and antagonists have targeted various components of this pathway to block their production. For example, renin inhibitors, ACE inhibitors, angiotensin receptor blockers (ARBs), and similar agents have been developed to inhibit or block the RAS pathway. However, due to various mechanisms or adverse effects, commercially available therapies targeting various RAS pathway components are ineffective in completely inhibiting or blocking the RAS pathway (Nobakht et al., Nat Rev Nephrol, 2011, 7:356-359).
[0062] As used herein, "RAAS-related diseases, conditions and / or disorders" or "RAAS pathway-related diseases, conditions and / or disorders" refers to any disease, condition or disorder in animals that is associated with the RAAS. Examples of RAAS-related diseases, conditions and / or disorders include shortened life expectancy, hypertension (e.g., non-refractory hypertension, refractory hypertension), kidney disease (e.g., chronic kidney disease, polycystic kidney disease), stroke, heart disease (e.g., myocardial infarction, heart failure, valvular heart disease), vascular aneurysms (e.g., aortic aneurysm), peripheral artery disease, organ damage (e.g., cardiac injury or hypertrophy), tissue fibrosis, and other cardiovascular diseases, conditions and / or disorders or their symptoms. In some embodiments, RAAS-related diseases, conditions and / or disorders do not include hypertension.
[0063] As used in this article, "refractory hypertension" or "RHTN" is defined as a) blood pressure that remains above the treatment target (usually ≥130 / 80 mmHg) despite the use of three or more antihypertensive agents from different classes of drugs at the maximum tolerated dose; or b) blood pressure that is controlled at or below the treatment target only after control has been achieved with at least four different classes of antihypertensive agents.
[0064] Unless otherwise specified, as used herein, "RNA" means RNA transcript and includes both pre-mRNA and mature mRNA.
[0065] As used herein, "RNAi compound" means an antisense compound that functions at least partially via RISC or Ago2 to regulate target nucleic acids and / or proteins encoded by the target nucleic acids. RNAi compounds include (but are not limited to) double-stranded siRNA, single-stranded RNA (ssRNA), and microRNAs, including microRNA mimics. In some embodiments, RNAi compounds regulate the amount, activity, and / or splicing of target nucleic acids. The term RNAi compound does not include antisense compounds that function via RNase H.
[0066] As used in this article, “self-complementarity” in oligonucleotides means that the oligonucleotide at least partially hybridizes with itself.
[0067] As used in this article, "standard in vitro analysis" refers to the analysis and its reasonable variations as illustrated in the examples.
[0068] As used in this article, "standard in vivo analysis" refers to the analysis and its reasonable variations as illustrated in the examples.
[0069] As used herein, "stereorandom palmar center" in the context of a molecular population with the same molecular formula refers to a palmar center with a random stereochemical configuration. For example, in a molecular population containing stereorandom palmar centers, the number of molecules with a stereorandom palmar center (S) configuration may be the same as, but not necessarily the same as, the number of molecules with a stereorandom palmar center (R) configuration. When the stereochemical configuration of the palmar center is not the result of a synthetic method designed to control the stereochemical configuration, it can be considered random. In some embodiments, the stereorandom palmar center is a stereorandom phosphate thioester nucleoside linkage.
[0070] As used in this article, "individual" refers to a human or a non-human animal.
[0071] As used herein, "glycomolecular moiety" refers to an unmodified or modified glycomolecular moiety. As used herein, "unmodified glycomolecular moiety" refers to the 2'-OH(H)β-D-ribosyl moiety found in RNA ("unmodified RNA glycomolecular moiety"), or the 2'-H(H)β-D-deoxyribosyl glycomole found in DNA ("unmodified DNA glycomolecular moiety"). An unmodified glycomolecular moiety has one hydrogen atom at each of the 1', 3', and 4' positions, an oxygen atom at the 3' position, and two hydrogen atoms at the 5' position. As used herein, "modified glycomolecular moiety" or "modified sugar" refers to a modified furanyl glycomolecular moiety or a sugar substitute.
[0072] As used herein, "sugar substitute" refers to a modified sugar moiety having a portion other than the furanyl moiety that allows a nucleobase to be linked to another group, such as an internucleotide linker, binding group, or terminal group in an oligonucleotide. Modified nucleosides containing sugar substitutes can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides can hybridize with complementary oligomers or target nucleic acids.
[0073] As used herein, "symptom" or "marker" means any physical feature or test result that indicates the presence or extent of a disease or condition. In some embodiments, symptoms are obvious to the individual or to a medical professional examining or testing that individual. In some embodiments, marks are obvious when performing invasive diagnostic tests, including (but not limited to) post-mortem tests.
[0074] As used in this article, "target nucleic acid" and "target RNA" refer to nucleic acids that are designed to be affected by antisense compounds.
[0075] As used in this article, "target region" refers to a portion of the target nucleic acid with which the oligomeric compound is designed to hybridize.
[0076] As used in this article, "terminal group" refers to a chemical group or atomic group covalently attached to the end of an oligonucleotide.
[0077] As used in this article, "therapeutic effective dose" refers to the amount of a medicine that provides therapeutic benefit to an individual. For example, a therapeutic effective dose improves the symptoms of a disease. [Some embodiments] []
[0078] This disclosure provides the following non-limiting numbered embodiments:
[0079] Example 1: An oligomeric compound comprising a modified oligonucleotide consisting of 14 to 30 linked nucleosides and having a nucleobase sequence comprising at least 14, at least 15, or 16 adjacent nucleosides of any of the nucleobase sequences of SEQ ID NO: 12-15, wherein the modified oligonucleotide comprises at least one modification selected from modified sugar moieties and modified nucleoside linkages.
[0080] Example 2: An oligomeric compound comprising a modified oligonucleotide consisting of 14 to 30 linked nucleosides and having a nucleobase sequence comprising at least 14, at least 15, or at least 16 adjacent nucleosides complementary to the following: The equal-length portion of nucleobases 2046-2061 of SEQ ID NO: 1; The equal-length portion of nucleobases 2271-2286 of SEQ ID NO: 1; The equal-length portion of nucleobases 2272-2287 of SEQ ID NO: 1; The modified oligonucleotide contains at least one modification selected from the modified sugar moiety and the modified nucleoside linkage.
[0081] Example 3: An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence including the nucleobase sequence of SEQ ID NO: 12, wherein the modified oligonucleotide comprises at least one modification selected from the modified sugar moiety and the modified nucleoside linkage.
[0082] Example 4: An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence including the nucleobase sequence of SEQ ID NO: 13, wherein the modified oligonucleotide comprises at least one modification selected from the modified sugar moiety and the modified nucleoside linkage.
[0083] Example 5: An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence including the nucleobase sequence of SEQ ID NO: 14, wherein the modified oligonucleotide comprises at least one modification selected from the modified sugar moiety and the modified nucleoside linkage.
[0084] Example 6: An oligomeric compound comprising a modified oligonucleotide consisting of 16 linked nucleosides and having a nucleobase sequence including the nucleobase sequence of SEQ ID NO: 15, wherein the modified oligonucleotide comprises at least one modification selected from the modified sugar moiety and the modified nucleoside linkage.
[0085] Example 7: An oligomeric compound as described in any of Examples 1 to 6, wherein, when measured over the entire nucleobase sequence of the modified oligonucleotide, the modified oligonucleotide has a nucleobase sequence that is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of either SEQ ID NO: 1 or SEQ ID NO: 2.
[0086] Example 8: An oligomeric compound as described in any of Examples 1 to 7, wherein the modified oligonucleotide comprises at least one bicyclic sugar moiety.
[0087] Example 9: An oligomeric compound as in Example 8, wherein the bicyclic sugar moiety has a 4'-2' bridge, wherein the 4'-2' bridge is selected from -CH 2-O- and -CH(CH 3)-O-.
[0088] Example 10: An oligomeric compound as described in any of Examples 1 to 9, wherein the modified oligonucleotide comprises at least one non-bicyclic modified sugar moiety.
[0089] Example 11: The oligomeric compound as in Example 10, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.
[0090] Example 12: An oligomeric compound as in any of Examples 1 to 11, wherein the modified oligonucleotide contains at least one sugar substitute.
[0091] Example 13: The oligomeric compound as in Example 12, wherein the sugar substitute is any one of morpholino, modified morpholino, PNA, THP and F-HNA.
[0092] Example 14: An oligomeric compound as in any of Examples 1 to 13, wherein the modified oligonucleotide is an interstitial polymer.
[0093] Example 15: An oligomeric compound as in Example 14, wherein the modified oligonucleotide has a glycomigrum comprising the following: The 5' region is composed of 1-6 linked 5' region nucleotides; The central region, which consists of 6-10 linked central region nucleosides; and The 3' region is composed of 1-6 linked 3' region nucleotides; among which Each of the 5' region nucleosides and each of the 3' region nucleosides contains a modified sugar moiety, and at least 6 of the central region nucleosides contain a 2'-β-D-deoxyribosyl sugar moiety.
[0094] Example 16: An oligomeric compound as in Example 14, wherein the modified oligonucleotide has a glycomotome comprising the following: The 5' region is composed of 1-6 linked 5' region nucleotides; The central region, which consists of 6-10 linked central region nucleosides; and The 3' region is composed of 1-6 linked 3' region nucleotides; among which Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-deoxyribosyl sugar moiety.
[0095] Example 17: An oligomeric compound as in Example 14, wherein the modified oligonucleotide has a glycomigrum comprising the following: The 5' region is composed of three linked 5' region nucleotides; The central region, which consists of 10 linked central region nucleosides; and The 3' region is composed of three linked 3' region nucleotides; among which Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE-modified sugar moiety or a cEt-modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.
[0096] Example 18: An oligomeric compound as in Example 14, wherein the modified oligonucleotide has a glycomigrum comprising the following: The 5' region is composed of three linked 5' region nucleotides; The central region, which consists of 10 linked central region nucleosides; and The 3' region is composed of 43 linked 3' region nucleotides; among which Each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE-modified sugar moiety or a cEt-modified sugar moiety, and at least 6 of the central region nucleosides comprise a 2'-β-D-deoxyribosyl sugar moiety.
[0097] Example 19: An oligomeric compound as described in any of Examples 1 to 18, wherein the modified oligonucleotide has a sugar motif (5' to 3') selected from the following: eekddddddddddkke, ekkddddddddddkke, kkkdyddddddddkkk, kkkddydddddddkkk, kkkdddyddddddddkkk, kkkddddddddddddkkk or eeeeeddddddddddeeeee; wherein 'e' represents the 2'-MOE sugar moiety, 'k' represents the cEt sugar moiety, 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, and 'y' represents the 2'-OMe sugar moiety.
[0098] Example 20: An oligomeric compound as in any of Examples 1 to 19, wherein the modified oligonucleotide comprises at least one modified nucleoside linker.
[0099] Example 21: The oligomeric compound as in Example 20, wherein the nucleoside-to-nucleotide linkage of the modified oligonucleotide is a modified nucleoside-to-nucleotide linkage.
[0100] Example 22: An oligomeric compound as in Example 20 or Example 21, wherein at least one nucleoside link is a thiophosphate nucleoside link.
[0101] Example 23: An oligomeric compound as in any of Examples 20 and 22, wherein the modified oligonucleotide comprises at least one phosphodiester nucleoside linker.
[0102] Example 24: An oligomeric compound as in any of Examples 20, 22 and 23, wherein the internucleotide linkage is a phosphate diester nucleoside linkage or a thiophosphate nucleoside linkage.
[0103] Example 25: An oligomeric compound as in Example 21, wherein the internucleotide linkage is a thiophosphate nucleotide linkage.
[0104] Example 26: An oligomeric compound as described in any of Examples 1 to 20 or 22 to 24, wherein the modified oligonucleotide has a soosssssssssssos nucleoside internucleotide motif; wherein, s = thiophosphate nucleoside linkage and o = phosphate diester nucleoside linkage.
[0105] Example 27: An oligomeric compound as in any of Examples 1 to 26, wherein the modified oligonucleotide contains at least one modified nucleobase.
[0106] Example 28: An oligomeric compound as in Example 27, wherein the modified nucleobase is 5-methylcytosine.
[0107] Example 29: An oligomeric compound as in any of Examples 1 to 28, wherein the modified oligonucleotide is composed of 12-30, 12-22, 12-20, 14-18, 14-20, 15-17, 15-25 or 16-20 linked nucleosides.
[0108] Example 30: An oligomeric compound as in any of Examples 1 to 28, wherein the modified oligonucleotide consists of 16 linked nucleosides.
[0109] Example 31: An oligomeric compound as described in any of Examples 1 to 30, comprising a binding group.
[0110] Example 32: An oligomeric compound as in Example 31, wherein the binding group comprises a GalNAc cluster containing 1-3 GalNAc ligands.
[0111] Example 33: An oligomeric compound as in any of Examples 31 and 32, wherein the binding group comprises a binding linker consisting of single bonds.
[0112] Example 34: An oligomeric compound as in any of Examples 31 to 33, wherein the binding group comprises a cleavable linker.
[0113] Example 35: An oligomeric compound as in any of Examples 31 to 34, wherein the binding group comprises a binding linker containing 1 to 3 linker nucleosides.
[0114] Example 36: An oligomeric compound as in any of Examples 31 to 35, wherein the binding group is attached to the 5' end of the modified oligonucleotide.
[0115] Example 37: An oligomeric compound as in any of Examples 31 to 35, wherein the binding group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.
[0116] Example 38: An oligomeric compound as described in any of Examples 1 to 37, wherein the oligomeric compound is a monostranded oligomeric compound.
[0117] Example 39: An oligomeric compound as in any of Examples 1 to 37, which is composed of the modified oligonucleotide.
[0118] Example 40: An oligomeric double chain comprising the oligomeric compound of any of Examples 1 to 37.
[0119] Example 41: An antisense compound comprising, or consisting of, any of the oligomeric compounds of Examples 1 to 39 or the oligomeric duplex of Example 40.
[0120] Example 42: A pharmaceutical composition comprising an oligomeric compound as in any of Examples 1 to 39 or an oligomeric duplex as in Example 40, and a pharmaceutically acceptable carrier or diluent.
[0121] Example 43: A compound or a salt thereof with the following chemical structure, (SEQ ID NO: 12).
[0122] Example 44: A compound with the following chemical structure, (SEQ ID NO: 12).
[0123] Example 45: A compound or a salt thereof with the following chemical structure, (SEQ ID NO: 13).
[0124] Example 46: A compound based on the following chemical structure, (SEQ ID NO: 13).
[0125] Example 47: A compound or a salt thereof with the following chemical structure, (SEQ ID NO: 14).
[0126] Example 48: A compound based on the following chemical structure, (SEQ ID NO: 14).
[0127] Example 49: A compound or a salt thereof with the following chemical structure, (SEQ ID NO: 15).
[0128] Example 50: A compound based on the following chemical structure, (SEQ ID NO: 15).
[0129] Example 51: The modified oligonucleotide of any of Examples 43, 45, 47 and 49 is a sodium or potassium salt of the chemical structure.
[0130] Example 52: A pharmaceutical composition comprising a modified oligonucleotide as described in any of Examples 43 to 51 and a pharmaceutically acceptable carrier or diluent.
[0131] Example 53: A compound comprising a modified oligonucleotide according to the following chemiluminescence: mC esG eo mC koT dsG dsA dsT dsT dsT dsG dsT ds mC ds mC dsG koG ksG e (SEQ ID NO: 12), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-β-D-MOE sugar moiety, k = cEt sugar portion, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside linkage, and o = Phosphodiester nucleoside linkage.
[0132] Example 54: A compound comprising a modified oligonucleotide according to the following chemiluminescence: Te es mC koG koG dsT dsT dsG dsG dsA dsA dsT dsT ds mC dsT koT ksT e (SEQ ID NO: 13), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-β-D-MOE sugar moiety, k = cEt sugar portion, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside linkage, and o = Phosphodiester nucleoside linkage.
[0133] Example 55: A compound comprising a modified oligonucleotide according to the following chemiluminescence: G ksT ks mC ksG dsG ysT dsT dsG dsG dsA dsA dsT dsT ds mC ksT ksT k (SEQ ID NO: 15), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, k = cEt sugar portion, d = 2'-β-D-deoxyribosyl sugar moiety, y = 2'-OMe ribose portion, and s = thiophosphate nucleoside linkage.
[0134] Example 56: A compound comprising a modified oligonucleotide according to the following chemiluminescence: T ks mC koG koG dsU ysT dsG dsG dsA dsA dsT dsT ds mC dsT koT ksT k (SEQ ID NO: 14), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, U = uracil nucleobase, k = cEt sugar portion, d = 2'-β-D-deoxyribosyl sugar moiety, y = 2'-OMe ribose portion, s = thiophosphate nucleoside linkage, and o = Phosphodiester nucleoside linkage.
[0135] Example 57: A compound as in any of Examples 53 to 56, comprising the modified oligonucleotide covalently linked to a binding group.
[0136] Example 58: A pharmaceutical composition as described in any of Examples 53 to 56, and a pharmaceutically acceptable diluent or carrier.
[0137] Example 59: A palmar enrichment cluster of modified oligonucleotides as in any of Examples 53 to 56, wherein the enrichment cluster comprises at least one modified oligonucleotide with a specific phosphate ester nucleoside bond having a specific stereochemical configuration.
[0138] Example 60: A palm-shaped enriched cluster as in Example 59, wherein the enrichment comprises at least one modified oligonucleotide with a specific phosphate thioester nucleoside linkage having a (Sp) configuration.
[0139] Example 61: A palm-like enriched cluster as in Example 59, wherein the enrichment comprises at least one modified oligonucleotide with a specific phosphate thioester nucleoside linkage having an (Rp) configuration.
[0140] Example 62: A palmar enrichment cluster as in Example 59, wherein the cluster is enriched in modified oligonucleotides having a specific, independently selected stereochemical configuration at each thiophosphate nucleoside linker.
[0141] Example 63: A palmar enrichment cluster as in Example 59, wherein the cluster is enriched in modified oligonucleotides having a (Sp) configuration at each thiophosphate nucleoside linker or in modified oligonucleotides having a (Rp) configuration at each thiophosphate nucleoside linker.
[0142] Example 64: A palmar enrichment cluster as in Example 59, wherein the cluster is enriched in modified oligonucleotides having an (Rp) configuration at a specific thiophosphate nucleoside linker and an (Sp) configuration at each of the remaining thiophosphate nucleoside links.
[0143] Example 65: The palmar enrichment cluster of Example 59, wherein the cluster is enriched with modified oligonucleotides having at least three adjacent phosphate thioester nucleosides linked in a Sp, Sp, and Rp configuration along the 5' to 3' direction.
[0144] Example 66: A population of modified oligonucleotides as in any of Examples 59 to 65, wherein all phosphate thioester nucleoside linkages of the modified oligonucleotides are stereo-random.
[0145] Example 67: A method comprising administering to an individual a pharmaceutical composition as described in any of the foregoing examples.
[0146] Example 68: A method of treating a disease associated with the RAAS pathway, comprising administering a therapeutically effective amount of a pharmaceutical composition as described in any of the foregoing examples to an individual suffering from or at risk of suffering from a disease associated with the RAAS pathway, thereby treating the disease associated with the RAAS pathway.
[0147] Example 69: The method of Example 68, wherein the disease is a cardiovascular disease.
[0148] Example 70: The method of any of Examples 68 and 69, wherein the disease is selected from hypertension, refractory hypertension, Marfan syndrome, heart failure, kidney disease, obesity, metabolic syndrome, NASH, and NAFLD.
[0149] Example 71: The method of any of Examples 68 to 70, wherein at least one symptom or sign of the disease is improved.
[0150] Example 72: The method of Example 71, wherein the symptom or sign is any of the following: hypertension, hypertensive emergency (i.e., malignant hypertension), stroke, preeclampsia, vascular aneurysm, abdominal aneurysm, peripheral artery disease, organ injury, or pulmonary hypertension.
[0151] Example 73: The method of any of Examples 67 to 72, wherein the pharmaceutical composition is administered systemically.
[0152] Example 74: The method of any of the examples in Example 73, wherein the pharmaceutical composition is administered subcutaneously or intramuscularly.
[0153] Example 75: Use of an oligomeric compound as in any of Examples 1 to 37 or an oligomeric duplex as in Example 40 for reducing AGT expression in cells.
[0154] Example 76: As used in Example 75, wherein the level of AGT RNA is reduced.
[0155] Example 77: As used in Example 75, wherein the level of AGT protein is reduced. [I.] [certain oligonucleotides] []
[0156] In some embodiments, this document provides oligomeric compounds comprising oligonucleotides composed of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides, relative to unmodified RNA or DNA, comprise at least one modification. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified inter-nucleoside bond. [A.] [Some modified nucleosides] []
[0157] Modified nucleosides may contain a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. [1.] [Some sugar components] []
[0158] In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In some embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In some embodiments, the modified sugar moiety is a sugar substitute. Such sugar substitutes may contain one or more substitutions, which correspond to other substitutions of other types of modified sugar moiety.
[0159] In some embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanyl ring having one or more substituents, none of which bridge the two atoms of the furanyl ring to form a bicyclic structure. These unbridging substituents can be located at any position on the furanyl ring, including (but not limited to) substituents located at the 2', 4', and / or 5' positions. In some embodiments, one or more of the unbridging substituents in the non-bicyclic modified sugar moiety are branched. Examples of suitable 2'-substituents for non-bicyclic modified sugar moiety include (but are not limited to): 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"). In some embodiments, the 2'-substituent is selected from: halogen, allyl, amino, azide, SH, CN, OCN, CF3, OCF3, OC1-C10 alkoxy, substituted OC1-C10 alkoxy, OC1-C10 alkyl, substituted OC1-C10 alkyl, S-alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-ynyl, S-ynyl, N(Rm)-ynyl, O-alkyl-O-alkyl, ynyl, alkylaryl, aralkyl, O-alkylaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn), wherein each Rm and Rn is independently H, an amino protecting group, or a substituted or unsubstituted C1-C group. 10-alkyl, and the 2'-substituents described in Cook et al., US 6,531,584; Cook et al., US 5,859,221; and Cook et al., US 6,005,087. Some embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from: hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro (NO₂), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include (but are not limited to) alkoxy (e.g., methoxy), alkyl, and those groups described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include (but are not limited to): 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In some embodiments, the non-bicyclic modified sugar moiety comprises one or more non-bridging sugar substituents, such as the 2'-F-5'-methyl sugar moiety and the modified sugar moiety and modified nucleoside described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.
[0160] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-bridging 2'-substituent selected from: F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and an N-substituted acetylamine (OCH2C(=O)-N(Rm)(Rn)), wherein each Rm and Rn is independently H, an amino protecting group, or a substituted or unsubstituted C1-C10 alkyl group.
[0161] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-bridging 2'-substituent selected from the following: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").
[0162] In some embodiments, the 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety containing a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.
[0163] In some embodiments, the modified furanyl sugar moiety and the nucleotide having such modified furanyl sugar moiety are further defined by isomer configuration. For example, the 2'-deoxyfuranyl sugar moiety can exhibit seven isomer configurations other than the native β-D-deoxyribosyl configuration. These modified sugar moieties are described in, for example, WO 2019 / 157531, which is incorporated herein by reference. The 2'-modified sugar moiety has another stereocenter at the 2' position relative to the 2'-deoxyfuranyl sugar moiety; therefore, these sugar moieties have a total of sixteen possible isomer configurations. Unless otherwise specified, the 2'-modified sugar moiety described herein is in a β-D-ribosyl isomer configuration.
[0164] Some modified sugar moieties contain substituents that bridge two atoms of the furanyl ring to form a second ring, thereby producing a bicyclic sugar moieties. In some of these embodiments, the bicyclic sugar moieties contain bridges between the 4' and 2' furanyl ring atoms. Examples of such 4' to 2' bridging sugar substituents include (but are not limited to): 4'-CH 2-2', 4'-(CH 2) 2-2', 4'-(CH 2) 3-2', 4'-CH 2-O-2' (“LNA”), 4'-CH 2-S-2', 4'-(CH 2) 2-O-2' (“ENA”), 4'-CH(CH 3)-O-2' (referred to as “restricted ethyl” or “cEt”), 4'-CH 2-O-CH 2-2', 4'-CH 2-N(R)-2', 4'-CH(CH 2OCH 3)-O-2' (“restricted MOE” or “cMOE”) and their analogues (e.g., see Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,569,686). 7,741,457; and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and its analogues (e.g., see Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and its analogues (e.g., see Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (e.g., see Allenson et al., US 7,696,345 and Allenson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (e.g., see Zhou et al., J. Org. Chem., 2009, 74,118-134), 4'-CH2-C(=CH2)-2' and its analogues (e.g., see Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and its analogues (e.g., see Seth et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (e.g., see Allenson et al., US 7,696,345 and Allenson et al., US 8,124,745), 4'-CH2-C(=CH2)-2' and its analogues (e.g., see Seth et al., US 8,741,457; and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and its analogues (e.g., see Seth et al., US 8,278,283), 4'-CH2-N( 8,278,426), 4'-C(RaRb)-N(R)-O-2', 4'-C(RaRb)-ON(R)-2', 4'-CH2-ON(R)-2' and 4'-CH2-N(R)-O-2', wherein each R, Ra and Rb is independently H, a protecting group or a C1-C12 alkyl group (e.g., see Imanishi et al., US 7,427,672).
[0165] In some embodiments, these 4' to 2' bridges independently comprise 1 to 4 linking groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NR a)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and -N(Ra)-; in: x is 0, 1, or 2; n is 1, 2, 3, or 4; Each Ra and Rb is independently H, a protecting group, a hydroxyl group, a C1-C12 alkyl group, a substituted C1-C12 alkyl group, a C2-C12 alkenyl group, a substituted C2-C12 alkenyl group, a C2-C12 ynyl group, a substituted C2-C12 ynyl group, a C5-C20 aryl group, a substituted C5-C20 aryl group, a heterocyclic group, a substituted heterocyclic group, a heteroaryl group, a substituted heteroaryl group, a C5-C7 alicyclic group, a substituted C5-C7 alicyclic group, a halogen, OJ 1, NJ 1J 2, SJ 1, N 3, COOJ 1, acetyl (C(=O)-H), a substituted acetyl, CN, sulfonylurea (S(=O) 2-J) 1) or sulfoxide group (S(=O)-J 1); and Each J1 and J2 is independently H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 ynyl, substituted C2-C12 ynyl, C5-C20 aryl, substituted C5-C20 aryl, acetyl (C(=O)-H), substituted acetyl, heterocyclic group, substituted heterocyclic group, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or protecting group.
[0166] Other bicyclic sugar moieties are known in this technique, for example, see: Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129 ,8362-8379; Wengel et al., US 7,053,207; Imanishi et al., US 6,268,490; Imanishi et al., US 6,770,748; Imanishi et al., US RE44,779; Wengel et al., US 6,794,499; Wengel et al., US 6,670,461; Wengel et al., US 7,034,133; Wengel et al., US 8,080,644; Wengel et al., US 8,034,909; Wengel et al., US 8,153,365; Wengel et al., US 7,572,582; Ramasamy et al., US 6,525,191; Torsten et al., WO 2004 / 106356; Wengel et al., WO 1999 / 014226; Seth et al., WO 2007 / 134181; Seth et al., US 7,547,684; Seth et al., US 7,666,854; Seth et al., US 8,088,746; Seth et al., US 7,750,131; Seth et al., US 8,030,467; Seth et al., US 8,268,980; Seth et al., US 8,546,556; Seth et al., US 8,530,640; Migawa et al., US 9,012,421; Seth et al., US8,501,805; and Allenson et al., U.S. Patent Publication No. US2008 / 0039618 and Migawa et al., U.S. Patent Publication No. US2015 / 0191727.
[0167] In some embodiments, the bicyclic sugar moiety and the nucleotides containing such bicyclic sugar moiety are further defined by isomeric configuration. For example, LNA nucleotides (described herein) may be in an α-L configuration or in a β-D configuration.
[0168] α-L-methyleneoxy (4'-CH₂-O₂') or α-L-LNA bicyclic nucleotides have been incorporated into oligonucleotides exhibiting antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this document, the general description of bicyclic nucleotides includes two isomeric configurations. Unless otherwise specified, when a specific bicyclic nucleotide (e.g., LNA or cEt) position is identified in the examples illustrated herein, it is in the β-D configuration.
[0169] In some embodiments, the modified sugar portion comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (e.g., 5'-substituted sugars and 4'-2' bridging sugars).
[0170] In some embodiments, the modified sugar moiety is a sugar substitute. In some of these embodiments, the oxygen atom of the sugar moiety is replaced by, for example, a sulfur, carbon, or nitrogen atom. In some of these embodiments, the modified sugar moiety also contains bridging and / or non-bridging substituents as described herein. For example, some sugar substitutes contain a 4'-sulfur atom and substitutions at the 2' position (e.g., see Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or the 5' position.
[0171] In some embodiments, the sugar substitute comprises a ring having no more than five atoms. For example, in some embodiments, the sugar substitute comprises a six-membered tetrahydropyran (“THP”). These tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include (but are not limited to) hexotol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), mannitol nucleic acid (“MNA”) (e.g., see Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA: ("F-HNA", for example, see Swayze et al., US 8,088,904; Swayze et al., US 8,440,803; Swayze et al., US 8,796,437; and Swayze et al., US 9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran) and nucleosides containing other modified THP compounds having the following formula: Specifically, for each modified THP nucleotide: Bx represents the nucleobase portion; T3 and T4 are each independently an internucleotide linking group that links the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleotide linking group that links the modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is an H, a hydroxyl protecting group, a linking group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 ynyl, or substituted C2-C6 ynyl; and R1 and R2 are each independently selected from: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, wherein X is O, S or NJ1, and each J1, J2 and J3 is independently H or C1-C6 alkyl.
[0172] In some embodiments, a modified THP nucleoside is provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In some embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In some embodiments, a modified THP nucleoside is provided, wherein one of R1 and R2 is F. In some embodiments, R1 is F and R2 is H; in some embodiments, R1 is methoxy and R2 is H; and in some embodiments, R1 is methoxyethoxy and R2 is H.
[0173] In some embodiments, the sugar substitute comprises a ring having five or more atoms and one or more heteroatoms. For example, nucleosides comprising a morpholinyl sugar moiety and their use in oligonucleotides have been reported (e.g., see Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholinyl" means a sugar substitute having the following structure: .
[0174] In some embodiments, the morpholino group can be modified, for example, by adding or changing various substituents compared to the morpholino group structure described above. These sugar substitutes are referred to herein as "modified morpholino groups".
[0175] In some embodiments, the sugar substitute comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar substitutes include (but are not limited to): peptide nucleic acids (“PNA”), acyclic butyl nucleic acids (e.g., see Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.
[0176] Many other bicyclic and tricyclic sugars and sugar substitute ring systems are known to be applicable to modified nucleosides in this technology. [2.] [Some modified nucleobases] [, , ]
[0177] In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing unmodified nucleobases. In some embodiments, the modified oligonucleotide comprises one or more nucleosides containing modified nucleobases. In some embodiments, the modified oligonucleotide comprises one or more nucleosides that do not contain nucleobases, referred to as abase-free nucleosides.
[0178] In some embodiments, the modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6-substituted purines. In some embodiments, the modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymidine, and 2-thiocytosine, 5-propynyl (-C≡C-CH 3) Uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymidine, 5-ribosyluracil (pseudouracil), 4-thiouracil; 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, 8-aza and other 8-substituted purines; 5-halogen, specifically 5-bromo, 5-trifluoromethyl, 5-halogenuridine and 5-halogencytosine; 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazoguanine, 7-deazoguanine, 3-deazoguanine, 3-deazoguanine, 6-N-benzoyladenine, 2-N-isobutylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl-4-N-benzoylcytosine, 5-methyl-4-N-benzoyluracil, universal bases, hydrophobic bases, mixed bases, enlarged bases, and fluorinated bases. Other modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenthiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). The modified nucleobases may also include purine or pyrimidine bases replaced by other heterocycles, such as 7-deadenine, 7-deadenine, 2-aminopyridine, and 2-pyridone.Other nucleobases include those revealed in Merigan et al., US 3,687,808; The Concise Encyclopedia Of Polymer Science and Engineering, Kroschwitz, JI (ed.), John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Antisense Research and Applications, Crooke, ST and Lebleu, B. (eds.), CRC Press, Chapter 15, 1993, 273-288; and Antisense Drug Technology, Crooke ST (ed.), CRC Press, Chapters 6 and 15, 2008, 163-166 and 442-443.
[0179] Publications teaching the preparation of certain of the aforementioned modified nucleosides and other modified nucleosides include (but are not limited to) Manoharan et al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., US 4,845,205; Spielvogel et al., US 5,130,302; Rogers et al., US 5,134,066; Bischofberger et al., US 5,175,273; Urdea et al., US 5,367,066; Benner et al., US 5,432,272; Matteucci et al., US 5,434,257; Gmeiner et al., US 5,457,187; Cook et al., US 5,459,255; Froehler et al., US 5,484,908; Matteucci et al., US 5,502,177; Hawkins et al., US 5,525,711; Haralambidis et al., US 5,552,540; Cook et al., US 5,587,469; Froehler et al., US 5,594,121; Switcher et al., US 5,596,091; Cook et al., US 5,614,617; Froehler et al., US 5,645,985; Cook et al., US 5,681,941; Cook et al., US 5,811,534; Cook et al., US 5,750,692; Cook et al., US 5,948,903; Cook et al., US 5,587,470; Cook et al., US 5,457,191; Matteucci et al., US 5,763,588; Froehler et al., US 5,830,653; Cook et al., US 5,808,027; Cook et al., 6,166,199; and Matteucci et al., US 6,005,096. [3.] [Some modified nucleoside bonds] []
[0180] In some embodiments, any nucleoside linker can be used to link the nucleosides of modified oligonucleotides together. Two main categories of nucleoside linker groups are defined based on the presence or absence of a phosphorus atom. Representative phosphorus-containing nucleoside linkers include (but are not limited to) phosphodiesters containing a phosphodiester bond ("P(O₂)=O") (also known as unmodified linkers or natural linkers); phosphotriesters; methylphosphonates; aminophosphates; thiophosphates ("P(O₂)=S") and dithiophosphates ("HS-P=S"). Representative phosphorus-free nucleoside linker groups include (but are not limited to) methylenemethylimino (-CH₂-N(CH₃)-O-CH₂-), thiodiesters, thiocarbonylcarbamates (-OC(=O)(NH)-S-); siloxanes (-O-SiH₂-O-); and N,N'-dimethylhydrazine (-CH₂-N(CH₃)-N(CH₃)-). Modified nucleoside linkages, compared to natural phosphodiester nucleoside linkages, can be used to alter, and generally increase, the nuclease resistance of oligonucleotides. In some embodiments, nucleoside linkages with phosphodiester atoms can be prepared as racemic mixtures or separate mirror-image isomers. Methods for preparing phosphorus-containing and phosphorus-free nucleoside linkages are well known to those skilled in the art.
[0181] Representative internucleotide links with palmate centers include (but are not limited to) alkylphosphonates and thiophosphates. Modified oligonucleotides containing internucleotide links with palmate centers can be prepared into populations of modified oligonucleotides containing stereorandom internucleotide links, or into populations of modified oligonucleotides containing thiophosphate internucleotide links exhibiting a specific stereochemical configuration. In some embodiments, the population of modified oligonucleotides contains thiophosphate internucleotide links, wherein all such thiophosphate internucleotide links are stereorandom. These modified oligonucleotides can be generated using synthetic methods that randomly select the stereochemical configuration of each thiophosphate internucleotide link. Nevertheless, as will be fully understood by those skilled in the art, each thiophosphate of each individual oligonucleotide molecule has a defined stereochemical configuration. In some embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides containing one or more modified oligonucleotides with specific, independently selected stereochemical configurations of thiophosphate internucleotide links. In some embodiments, at least 65% of the molecules in the population contain specific thiophosphate nucleoside linkages with a specific configuration. In some embodiments, at least 70% of the molecules in the population contain specific thiophosphate nucleoside linkages with a specific configuration. In some embodiments, at least 80% of the molecules in the population contain specific thiophosphate nucleoside linkages with a specific configuration. In some embodiments, at least 90% of the molecules in the population contain specific thiophosphate nucleoside linkages with a specific configuration. In some embodiments, at least 99% of the molecules in the population contain specific thiophosphate nucleoside linkages with a specific configuration. Such kinetic enrichment clusters of modified oligonucleotides can be generated using synthetic methods known in this art, such as those described in the following literature: Oka et al., JACS125,8307 (2003); Wan et al., Nuc. Acid. Res. 42,13456 (2014); and WO 2017 / 015555. In some embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one indicated phosphate thioester in a (Sp) configuration. In some embodiments, the population of modified oligonucleotides is enriched with modified oligonucleotides having at least one indicated phosphate thioester in a (Rp) configuration. In some embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphate thioesters each comprise one or more of the following formulas, wherein "B" indicates a nucleobase: Unless otherwise indicated, the palmar nucleoside linkages of the modified oligonucleotides described herein may be stereorandom or exhibit a specific stereochemical configuration.
[0182] Neutral nucleoside linkages include (but are not limited to) phosphate triesters, methylphosphonates, MMI (3'-CH 2-N(CH 3)-O-5'), acetal-3 (3'-CH 2-C(=O)-N(H)-5'), acetal-4 (3'-CH 2-N(H)-C(=O)-5'), methyl acetal (3'-O-CH 2-O-5'), methoxypropyl (MOP), and thiomethyl acetal (3'-S-CH 2-O-5'). Other neutral nucleoside linkages include nonionic linkages, which include siloxanes (dialkylsiloxanes), carboxylic esters, carboxylamines, sulfides, sulfonates, and acetals (e.g., see Carbohydrate Modifications in Antisense Research; edited by YS Sanghvi and PD Cook, ACS Symposium Series 580; Chapters 3 and 4, 40–65). Other neutral nucleoside bonds include nonionic bonds that incorporate a mixture of N, O, S, and CH2 components. [B.] [Some modifiers] [, , ]
[0183] In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides containing modified sugar moieties. In some embodiments, the modified oligonucleotide comprises one or more modified nucleosides containing modified nucleotides. In some embodiments, the modified oligonucleotide comprises one or more modified inter-nucleoside bonds. In these embodiments, the modified, unmodified, and differently modified sugar moieties, nucleotides, and / or inter-nucleoside bonds of the modified oligonucleotide define patterns or motifs. In some embodiments, the patterns of sugar moieties, nucleotides, and inter-nucleoside bonds are each independent of each other. Therefore, the modified oligonucleotide can be described by its sugar motif, nucleotide motif, and / or inter-nucleoside bond motif (as used herein, a nucleotide motif describes the modification of the nucleotides, regardless of the nucleotide sequence). [1.] [Some sugar molds]
[0184] In some embodiments, the oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar motifs arranged in a defined pattern or sugar motif along the oligonucleotide or a portion thereof. In some cases, such sugar motifs include (but are not limited to) any of the sugar modifications discussed herein.
[0185] In some embodiments, the modified oligonucleotide has a gap motif defined by two outer regions or "wings" and a central or inner region or "gap". The three regions (5' wing, gap, and 3' wing) of the gap motif form adjacent sequences of nucleotides, wherein at least some sugar moieties of the nucleotide in each wing differ from at least some sugar moieties of the nucleotide in the gap. Specifically, at least some sugar moieties of the nucleotide closest to the gap in each wing (the 3' end nucleotide of the 5' wing and the 5' end nucleotide of the 3' wing) differ from the sugar moieties of the adjacent gap nucleotide, thereby defining the boundary between the wing and the gap (i.e., the wing / gap junction). In some embodiments, the sugar moieties within the gap are identical to each other. In some embodiments, the gap includes one or more nucleotides whose sugar moieties differ from the sugar moieties of one or more other nucleotides in the gap. In some embodiments, the sugar motifs of the two wings are identical to each other (symmetric gap moieties). In some embodiments, the 5' winged sugar motif is different from the 3' winged sugar motif (asymmetric interstitial polymer).
[0186] In some embodiments, the wings of the interstitial polymer contain 1-6 nucleotides. In some embodiments, each nucleotide of each wing of the interstitial polymer contains a modified sugar moiety. In some embodiments, at least one nucleotide of each wing of the interstitial polymer contains a modified sugar moiety. In some embodiments, at least two nucleotides of each wing of the interstitial polymer contain a modified sugar moiety. In some embodiments, at least three nucleotides of each wing of the interstitial polymer contain a modified sugar moiety. In some embodiments, at least four nucleotides of each wing of the interstitial polymer contain a modified sugar moiety. In some embodiments, at least five nucleotides of each wing of the interstitial polymer contain a modified sugar moiety.
[0187] In some embodiments, the gaps between interstitial polymers contain 7-12 nucleotides. In some embodiments, at least six nucleotides between the interstitial polymers contain a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, each nucleotide between the interstitial polymers contains a 2'-deoxyribosyl sugar moiety. In some embodiments, each nucleotide between the interstitial polymers contains a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, at least one nucleotide between the interstitial polymers contains a modified sugar moiety. In some embodiments, at least one nucleotide between the interstitial polymers contains a 2'-OMe sugar moiety.
[0188] In some embodiments, the interstitial polymer is a deoxyinterstitial polymer. In some embodiments, the nucleoside on the interstitial side of each wing / interstitial junction comprises a 2'-deoxyribosyl sugar moiety, and the nucleoside on the wing side of each wing / interstitial junction comprises a modified sugar moiety. In some embodiments, at least six nucleosides in the interstitial polymer's interstitial space comprise a 2'-β-D-deoxyribosyl sugar moiety. In some embodiments, each nucleoside in the interstitial space comprises a 2'-deoxyribosyl sugar moiety. In some embodiments, each nucleoside in each wing of the interstitial polymer comprises a modified sugar moiety. In some embodiments, one nucleoside in the interstitial space comprises a modified sugar moiety, and each remaining nucleoside in the interstitial space comprises a 2'-deoxyribosyl sugar moiety.
[0189] In some embodiments, the modified oligonucleotide comprises or is composed of a portion having a fully modified sugar motif. In these embodiments, each nucleotide of the fully modified portion of the modified oligonucleotide comprises a modified sugar motif. In some embodiments, each nucleotide of the entire modified oligonucleotide comprises a modified sugar motif. In some embodiments, the modified oligonucleotide comprises or is composed of a portion having a fully modified sugar motif, wherein each nucleotide within the fully modified portion comprises the same modified sugar motif, referred herein to as a homogeneous modified sugar motif. In some embodiments, the fully modified oligonucleotide is a homogeneous modified oligonucleotide. In some embodiments, each nucleotide of a homogeneous modified oligonucleotide comprises the same 2'-modification.
[0190] In this paper, the lengths (number of nucleotides) of the three regions of the interstitial polymer can be provided using the notation [number of nucleotides in the 5' wing] - [number of nucleotides in the interstitial region] - [number of nucleotides in the 3' wing]. Therefore, the 5-10-5 interstitial polymer consists of 5 linked nucleotides in each wing and 10 linked nucleotides in the interstitial region. If this nomenclature is subsequently modified, the modification is in each sugar moiety of each wing and the interstitial nucleotides contain a 2'-β-D-deoxyribosyl sugar moiety. Therefore, the 5-10-5 MOE interstitial polymer consists of 5 linked 2'-MOE nucleotides in the 5' wing, 10 linked 2'-β-D-deoxyribosyl nucleotides in the interstitial region, and 5 linked 2'-MOE nucleotides in the 3' wing. The 3-10-3 cEt interstitial polymer consists of three linked cEt nucleotides in the 5' wing, ten linked 2'-β-D-deoxy nucleotides in the interstitial space, and three linked cEt nucleotides in the 3' wing. The 5-8-5 interstitial polymer consists of five linked nucleotides containing a modified sugar moiety in the 5' wing, eight linked 2'-deoxy nucleotides in the interstitial space, and five linked nucleotides containing a modified sugar moiety in the 3' wing. Mixed-wing interstitial polymers have at least two different modified sugars in the 5' wing and / or the 3' wing. The 5-8-5 or 5-8-4 mixed-wing interstitial polymers have at least two different modified sugar moieties in the 5' wing and / or the 3' wing.
[0191] In some embodiments, the modified oligonucleotide is a 5-10-5 MOE interstitial polymer. In some embodiments, the modified oligonucleotide is a 4-10-6 MOE interstitial polymer. In some embodiments, the modified oligonucleotide is a 6-10-4 MOE interstitial polymer. In some embodiments, the modified oligonucleotide is a 5-8-5 MOE interstitial polymer. In some embodiments, the modified oligonucleotide is an XYZ MOE interstitial polymer, wherein X and Z are independently selected from 1, 2, 3, 4, 5, or 6 linked 2'-MOE nucleosides, and Y is 7, 8, 9, 10, or 11 linked deoxynucleosides.
[0192] In some embodiments, the modified oligonucleotide has a sugar motif (5' to 3') selected from the following: meeemddddddddddmmmmmm, where 'd' represents the 2'-deoxyribosyl sugar moiety, 'e' represents the 2'-MOE sugar moiety, and 'm' represents the 2'-OMe sugar moiety. [2.] [Some nucleobase motifs] [, , ]
[0193] In some embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or a portion thereof. In some embodiments, each nucleobase is modified. In some embodiments, none of the nucleobases are modified. In some embodiments, each purine or each pyrimidine is modified. In some embodiments, each adenine is modified. In some embodiments, each guanine is modified. In some embodiments, each thymine is modified. In some embodiments, each uracil is modified. In some embodiments, each cytosine is modified. In some embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In some embodiments, all the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine and all other nucleobases are unmodified.
[0194] In some embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In some of these embodiments, the block is located at the 3' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 3' end of the oligonucleotide. In some embodiments, the block is located at the 5' end of the oligonucleotide. In some embodiments, the block is located within three nucleosides at the 5' end of the oligonucleotide.
[0195] In some embodiments, the oligonucleotide having a spacer motif comprises a nucleoside containing a modified nucleotide. In some of these embodiments, a nucleoside containing a modified nucleotide is located in the central space of the oligonucleotide having the spacer motif. In some of these embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In some embodiments, the modified nucleotide is selected from 2-thiopyrimidine and 5-propynylpyrimidine. [, , ] [3.] [Some nucleoside interlinking motifs] []
[0196] In some embodiments, the oligonucleotide comprises modified and / or unmodified internucleotide links arranged in a defined pattern or motif along the oligonucleotide or a portion thereof. In some embodiments, each internucleotide linking group is a phosphodiester internucleotide link (P(O 2)=O). In some embodiments, each internucleotide linking group of the modified oligonucleotide is a thiophosphate internucleotide link (P(O 2)=S). In some embodiments, each internucleotide link of the modified oligonucleotide is independently selected from thiophosphate internucleotide links and phosphodiester internucleotide links. In some embodiments, each thiophosphate internucleotide link is independently selected from stereorandom thiophosphate, (Sp) thiophosphate, and (Rp) thiophosphate. In some embodiments, the sugar motif of the modified oligonucleotide is an interstitial polymer and all internucleotide links within the interstitial space are modified. In some of these embodiments, some or all of the internucleotide links are unmodified phosphodiester internucleotide links. In some embodiments, the terminal nucleoside interlinkings are modified. In some embodiments, the modified oligonucleotide's glycomotif is an interstitial polymer, and the nucleoside interlinking motif contains at least one phosphodiester nucleoside interlinking in at least one wing, wherein the at least one phosphodiester nucleoside interlinking is not a terminal nucleoside interlinking, and the remaining nucleoside interlinkings are thiophosphate nucleoside interlinkings. In some of these embodiments, all thiophosphate nucleoside interlinkings are stereo-random. In some embodiments, all thiophosphate nucleoside interlinkings in the wing are (Sp) thiophosphates, and the interstitial space contains at least one Sp, Sp, Rp motif. In some embodiments, the modified oligonucleotide population is enriched with modified oligonucleotides containing these nucleoside interlinking motifs.
[0197] In some embodiments, all internucleotide linkages are phosphodiester-based or thiophosphate-based linkages, and the palmar motifs are (5' to 3'): Sp-ooo- Sp- Sp- Sp- Rp- Sp- Sp- Rp- Sp- Sp- Sp- Sp- Sp- Sp- Sp- Sp- Sp or Sp-ooo- Sp- Sp- Sp- Rp- Sp- Sp- Sp- Sp- Sp- Sp- Sp- Sp- Sp- Sp- Sp- Sp- Sp- Sp- Sp, where each 'Sp' represents a (Sp) thiophosphate linkage, each 'Rp' represents an Rp linkage, and each 'o' represents a phosphodiester-based linkage. In some embodiments, the population enrichment of modified oligonucleotides includes modified oligonucleotides containing these internucleotide linkage motifs.
[0198] In some embodiments, the modified oligonucleotide has a nucleoside linkage motif of soooossssssssssssooss, where each "s" represents a thiophosphate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. In some embodiments, the modified oligonucleotide has a nucleoside linkage motif (5' to 3') of soooooossssssssssoss, where each "s" represents a thiophosphate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. In some embodiments, the modified oligonucleotide has a nucleoside linkage motif (5' to 3') of sooooosssssssssssooss, where each "s" represents a thiophosphate nucleoside linkage and each "o" represents a phosphodiester nucleoside linkage. In some embodiments, the modified oligonucleotide has the following internucleotide linking motif (5' to 3'): soooossssssssssooss, where each "s" represents an internucleotide link of thiophosphate and each "o" represents an internucleotide link of phosphodiester. In some embodiments, the modified oligonucleotide has the following internucleotide linking motif (5' to 3'): soooosssssssssssoooss, where each "s" represents an internucleotide link of thiophosphate and each "o" represents an internucleotide link of phosphodiester. In some embodiments, the modified oligonucleotide has the following internucleotide linking motif (5' to 3'): soooosssssssssssssss, where each "s" represents an internucleotide link of thiophosphate and each "o" represents an internucleotide link of phosphodiester. [C.] [Some length] []
[0199] The length of oligonucleotides can be increased or decreased without eliminating activity. For example, in Woolf et al., Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992, the ability of a series of oligonucleotides with lengths of 13-25 nucleotides to induce target nucleic acid cleavage in an oocyte injection model was tested. Oligonucleotides with a length of 25 nucleotides and 8 or 11 mismatched bases near the end of the oligonucleotide could guide specific cleavage of the target nucleic acid, but to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleotide oligonucleotides (including those with 1 or 3 mismatches).
[0200] In some embodiments, the oligonucleotide (including modified oligonucleotides) may have any of a variety of length ranges. In some embodiments, the oligonucleotide consists of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In some of these embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50; the condition is X ≤ Y. For example, in some embodiments, the oligonucleotides are 12 to 13, 12 to 14, 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30, 13 to 14, 13 to 15, 13 to 16, 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 1 3 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19, 14 to 20, 14 to 21, 14 to 22, 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18, 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 2 8, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 29, 19 to 28, 19 to 29, 19 to 30, 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26,20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 2 Composed of 3 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides. [D.] [Some modified oligonucleotides] []
[0201] In some embodiments, the above modifications (sugars, nucleotides, and internucleotide linkages) are incorporated into the modified oligonucleotide. In some embodiments, the modified oligonucleotide is characterized by its modification motif and total length. In some embodiments, these parameters are independent of each other. Therefore, unless otherwise indicated, each internucleotide linkage of an oligonucleotide having a spacer-glycan motif may be modified or unmodified, and may or may not follow a sugar-modified spacer modification pattern. For example, internucleotide linkages within the wings of a sugar spacer may be the same or different from each other, and may be the same or different from the internucleotide linkages in the spacer regions of the sugar motif. Similarly, such sugar spacer oligonucleotides may contain one or more modified nucleotides, regardless of the sugar-modified spacer pattern. Unless otherwise indicated, all modifications are independent of the nucleotide sequence. [E.] [Specific groups of modified oligonucleotides] []
[0202] A population of modified oligonucleotides, in which all modified oligonucleotides have the same molecular formula, can be a stereorandom population or a palmately rich population. In a stereorandom population, all palmate centers of all modified oligonucleotides are stereorandom. In a palmately rich population, at least one specific palmate center is not stereorandom in the modified oligonucleotides of the population. In some embodiments, the modified oligonucleotides of the palmately rich population are enriched in the β-D-ribosyl sugar moiety, and all thiophosphate nucleoside linkages are stereorandom. In some embodiments, the modified oligonucleotides of the palmately rich population are enriched in the β-D-ribosyl sugar moiety and linked to at least one specific thiophosphate nucleoside exhibiting a specific stereochemical configuration. [F.] [Nucleobase sequence] []
[0203] In some embodiments, the oligonucleotide (unmodified or modified) is further described by its nucleotide sequence. In some embodiments, the oligonucleotide has a nucleotide sequence complementary to a second oligonucleotide or an identified reference nucleic acid (such as a target nucleic acid). In some of these embodiments, a portion of the oligonucleotide has a nucleotide sequence complementary to a second oligonucleotide or an identified reference nucleic acid (such as a target nucleic acid). In some embodiments, a portion or the entire length of the nucleotide sequence is complementary to the second oligonucleotide or nucleic acid (such as a target nucleic acid) by at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%. [II.] [Some oligomeric compounds] []
[0204] In some embodiments, this document provides oligomeric compounds comprising an oligonucleotide (modified or unmodified) and, where appropriate, one or more binding groups and / or terminal groups. The binding group comprises one or more binding moieties and a binding linker connecting the binding moieties to the oligonucleotide. The binding group may be attached to one or both ends of the oligonucleotide and / or attached to any internal position. In some embodiments, the binding group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In some embodiments, the binding group attached to one or both ends of the oligonucleotide is a terminal group. In some of these embodiments, the binding group or terminal group is attached to the 3' end and / or 5' end of the oligonucleotide. In some of these embodiments, the binding group (or terminal group) is attached to the 3' end of the oligonucleotide. In some embodiments, the binding group is attached near the 3' end of the oligonucleotide. In some embodiments, the binding group (or terminal group) is attached to the 5' end of the oligonucleotide. In some embodiments, the binding group is attached near the 5' end of the oligonucleotide.
[0205] Examples of terminal groups include (but are not limited to) binding groups, capping groups, phosphate moieties, protecting groups, baseless nucleosides, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides. [A.] [certain binding groups] []
[0206] In some embodiments, the oligonucleotide is covalently linked to one or more binding groups. In some embodiments, the binding group modifies one or more properties of the linked oligonucleotide, including (but not limited to) pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In some embodiments, the binding group imparts new properties to the linked oligonucleotide, such as enabling the detection of the oligonucleotide's fluorophore or reporter group.Some binding groups and binding moieties have been previously described, such as: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556); bile acids (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060); thioethers, such as hexyl-S-triphenylmethylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770); sulfur cholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538); aliphatic chains, such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54); phospholipids, such as di-hexadecyl-racemic-glycerol or 1,2-di-O-hexadecyl-racemic-glycerol-3-H-phosphonate triethylammonium (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783); polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,969-973); or adamantaneacetic acid, palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237); octadecylamine or hexano-carbonyl-hydroxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937); tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740); or GalNAc cluster (e.g., WO2014 / 179620). 1. [Combined Part] []
[0207] The binding portion includes (but is not limited to) intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin portions, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, bile acid portions, folates, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinones, adamantane, acridine, fluorescent yellow, rose red, coumarin, fluorescein, and dyes.
[0208] In some embodiments, the binding portion comprises an active pharmaceutical ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprafen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, aldehyde folic acid, benzothiazide, chlorothiazide, diazoxide, indomethacin, barbiturate, cephalosporin, sulfonamides, antidiabetic drugs, antibacterial agents, or antibiotics. 2. [Connector] []
[0209] The binding moiety is linked to the oligonucleotide via a binding linker. In some oligomers, the binding linker is a single chemical bond (i.e., the binding moiety is directly linked to the oligonucleotide via a single bond). In some oligomers, the binding moiety is linked to the oligonucleotide via a more complex binding linker comprising one or more binding linker moieties, which(e) are subunits constituting the binding linker. In some embodiments, the binding linker comprises an oligomer of a chain structure such as a hydrocarbon chain or a repeating unit such as an ethylene glycol, nucleoside, or amino acid unit.
[0210] In some embodiments, the linker comprises one or more groups selected from the following: alkyl, amino, oxy, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In some of these embodiments, the linker comprises groups selected from the following: alkyl, amino, oxy, amide, and ether. In some embodiments, the linker comprises groups selected from alkyl and amide. In some embodiments, the linker comprises groups selected from alkyl and ether. In some embodiments, the linker comprises at least one phosphorus moiety. In some embodiments, the linker comprises at least one phosphate group. In some embodiments, the linker includes at least one neutral linker group.
[0211] In some embodiments, the linker, including the linkers described above, is a bifunctional linker, such as those known in the art for linking a binding group to a parent compound, such as the oligonucleotides provided herein. Generally, a bifunctional linker comprises at least two functional groups. One functional group is bound to a specific site on the parent compound, and another functional group is bound to the binding group. Examples of functional groups used in a bifunctional linker include (but are not limited to) electrophiles for reacting with nucleophiles and nucleophiles for reacting with electrophiles. In some embodiments, the bifunctional linker comprises one or more groups selected from: amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0212] Examples of linkers include (but are not limited to) pyrrolidine, 8-amino-3,6-dioxanoic acid (ADO), 4-(N-maleiminomethyl)cyclohexane-1-carboxylic acid succinimino ester (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other linkers include (but are not limited to) substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, or substituted or unsubstituted C2-C10 alkynyl groups, wherein a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0213] In some embodiments, the linker comprises 1-10 linker nucleosides. In some embodiments, the linker comprises 2-5 linker nucleosides. In some embodiments, the linker comprises exactly 3 linker nucleosides. In some embodiments, the linker comprises a TCA motif. In some embodiments, these linker nucleosides are modified nucleosides. In some embodiments, these linker nucleosides comprise a modified sugar moiety. In some embodiments, the linker nucleosides are unmodified. In some embodiments, the linker nucleosides comprise a heterocyclic base selected from, where applicable, protected: purine, substituted purine, pyrimidine, or substituted pyrimidine. In some embodiments, the cleavable portion is a nucleoside selected from: uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutylguanine. It is generally desirable for the linker nucleosides to cleave from the oligomer after it reaches the target tissue. Therefore, the linker nucleosides are typically linked to each other and to the remainder of the oligomer via cleavable bonds. In some embodiments, these cleavable bonds are phosphodiester bonds.
[0214] In this document, linker nucleosides are not considered part of an oligonucleotide. Therefore, in embodiments where the oligomer compound comprises an oligonucleotide consisting of a specified number or range of linker nucleosides and / or having a specified percentage of complementarity with a reference nucleic acid, and the oligomer compound also comprises a binding group containing a linker (containing a linker nucleoside), such linker nucleosides are not included in the length of the oligonucleotide and are not used to determine the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, the oligomer compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a binding group comprising 1-10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. In this oligomer compound, the total number of adjacent linked nucleosides is greater than 30. Alternatively, the oligomer compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides without a binding group. In this oligomer compound, the total number of adjacent linked nucleosides does not exceed 30. Unless otherwise indicated, the linker contains no more than 10 linker nucleosides. In some embodiments, the linker comprises no more than five linker nucleosides. In some embodiments, the linker comprises no more than three linker nucleosides. In some embodiments, the linker comprises no more than two linker nucleosides. In some embodiments, the linker comprises no more than one linker nucleoside.
[0215] In some embodiments, it is desirable for the binding group to cleave from the oligonucleotide. For example, in some cases, an oligomeric compound containing a specific binding moiety is preferably taken up by a specific cell type, but once the oligomeric compound has been taken up, it is desirable to cleave the binding group to release unbound oligonucleotides or parent oligonucleotides. Therefore, some binding linkers may contain one or more cleavable moieties. In some embodiments, the cleavable moiety is a cleavable bond. In some embodiments, the cleavable moiety is a group of atoms containing at least one cleavable bond. In some embodiments, the cleavable moiety contains a group of atoms having one, two, three, four, or more cleavable bonds. In some embodiments, the cleavable moiety is selectively cleaved within a cell or subcellular compartment (such as a lysosome). In some embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme (such as a nuclease).
[0216] In some embodiments, the cleavable bond is selected from one or two esters of amide, ester, ether, phosphate diester, phosphate ester, carbamate, or disulfide. In some embodiments, the cleavable bond is one or two phosphate diesters. In some embodiments, the cleavable portion comprises a phosphate ester or phosphate diester. In some embodiments, the cleavable portion is an oligonucleotide linked to a phosphate ester or phosphate diester bond between the binding portion or binding group.
[0217] In some embodiments, the cleavable portion comprises or is composed of one or more linker nucleosides. In some of these embodiments, the one or more linker nucleosides are linked to each other via cleavable bonds and / or to the remainder of the oligomeric compound. In some embodiments, these cleavable bonds are unmodified phosphodiester bonds. In some embodiments, the cleavable portion is a 2'-deoxynucleoside linked to the 3' or 5' terminal nucleoside of the oligonucleotide via phosphodiester nucleoside linkages and covalently linked to the linker or the remainder of the binding portion via phosphate or thiophosphate nucleoside linkages. In some of these embodiments, the cleavable portion is 2'-deoxyadenosine. 3. [] [Cell-Targeted Section] []
[0218] In some embodiments, the binding group comprises a cell-targeting portion. In some embodiments, the binding group has the following general formula: Where n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater than 2, j is 1 or 0, and k is 1 or 0.
[0219] In some embodiments, n is 1, j is 1, and k is 0. In some embodiments, n is 1, j is 0, and k is 1. In some embodiments, n is 1, j is 1, and k is 1. In some embodiments, n is 2, j is 1, and k is 0. In some embodiments, n is 2, j is 0, and k is 1. In some embodiments, n is 2, j is 1, and k is 1. In some embodiments, n is 3, j is 1, and k is 0. In some embodiments, n is 3, j is 0, and k is 1. In some embodiments, n is 3, j is 1, and k is 1.
[0220] In some embodiments, the binding group comprises a cell-targeting portion having at least one tethered ligand. In some embodiments, the cell-targeting portion comprises two tethered ligands covalently linked to the branching group. In some embodiments, the cell-targeting portion comprises three tethered ligands covalently linked to the branching group. [B.] [certain terminal groups] []
[0221] In some embodiments, the oligomeric compound comprises one or more terminal groups. In some of these embodiments, the oligomeric compound comprises a stabilized 5'-phosphate ester. The stabilized 5'-phosphate ester includes (but is not limited to) 5'-phosphonates, including (but not limited to) 5'-vinylphosphonates. In some embodiments, the terminal group comprises one or more abasic nucleosides and / or inverse nucleosides. In some embodiments, the terminal group comprises one or more 2'-linked nucleosides. In some of these embodiments, the 2'-linked nucleosides are abasic nucleosides. [III.] [Oligomerized Distreptone] []
[0222] In some embodiments, the oligomers described herein comprise oligonucleotides having a nucleotide sequence complementary to the nucleotide sequence of a target nucleic acid. In some embodiments, the oligomers pair with a second oligomer to form an oligoduplex. Such oligoduplexes comprise a first oligomer having a portion complementary to the target nucleic acid and a second oligomer having a portion complementary to the first oligomer. In some embodiments, the first oligomer of the oligoduplex comprises or consists of: (1) a modified or unmodified oligonucleotide and, if applicable, a binding group, and (2) a second modified or unmodified oligonucleotide and, if applicable, a binding group. One or both oligomers of the oligoduplex may comprise a binding group. The oligonucleotide of each oligomer of the oligoduplex may comprise a non-complementary pendant nucleoside. [IV.] [Antisense Activity] []
[0223] In some embodiments, the oligomeric compound and oligoduplex are capable of hybridizing with the target nucleic acid to produce at least one antisense activity; such oligomeric compounds and oligoduplexes are antisense compounds. In some embodiments, an antisense compound is considered to have antisense activity when it reduces the amount or activity of the target nucleic acid by 25% or more in standard cell analysis. In some embodiments, the antisense compound selectively affects one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes with one or more target nucleic acids to produce one or more desired antisense activities, and does not hybridize with one or more non-target nucleic acids or hybridizes with one or more non-target nucleic acids in a manner that results in significantly undesirable antisense activity.
[0224] In some antisense activities, hybridization of the antisense compound with the target nucleic acid leads to the recruitment of proteins that cleave the target nucleic acid. For example, some antisense compounds cause RNase H-mediated cleavage of the target nucleic acid. RNase H is an intracellular nuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in this RNA:DNA duplex does not need to be unmodified DNA. In some embodiments, antisense compounds that are sufficiently "DNA-like" to induce RNase H activity are described herein. In some embodiments, the presence of one or more non-DNA-like nucleotides in the gaps of the interstitial polymer is permitted.
[0225] In some antisense activities, an antisense compound, or part of an antisense compound, is loaded into the RNA-induced silencing complex (RISC), ultimately leading to the cleavage of the target nucleic acid. For example, some antisense compounds cause the target nucleic acid to be cleaved by Argonaute proteins. The antisense compound loaded into the RISC is an RNAi compound. RNAi compounds can be double-stranded (siRNA) or single-stranded (ssRNA).
[0226] In some embodiments, hybridization of the antisense compound with the target nucleic acid does not recruit proteins that cleave the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid results in altered splicing of the target nucleic acid. In some embodiments, hybridization of the antisense compound with the target nucleic acid results in inhibition of binding interactions between the target nucleic acid and proteins or other nucleic acids. In some embodiments, hybridization of the antisense compound with the target nucleic acid results in altered translation of the target nucleic acid.
[0227] Antisense activity can be observed directly or indirectly. In some embodiments, observing or detecting antisense activity involves observing or detecting changes in the amount of a target nucleic acid or the protein encoded by that target nucleic acid, changes in the ratio of splice variants of nucleic acids or proteins, and / or phenotypic changes in cells or individuals. [V.] [certain target nucleic acids] []
[0228] In some embodiments, the oligomeric compound comprises or is composed of an oligonucleotide containing a portion complementary to the target nucleic acid. In some embodiments, the target nucleic acid is an endogenous RNA molecule. In some embodiments, the target nucleic acid encodes a protein. In some of these embodiments, the target nucleic acid is selected from mature mRNA and premRNA, including introns, exons, and nontranslated regions. In some embodiments, the target nucleic acid is mature mRNA. In some embodiments, the target nucleic acid is premRNA. In some embodiments, the target region is entirely located within an intron. In some embodiments, the target region spans an intron / exon junction. In some embodiments, at least 50% of the target region is located within an intron. [A.] [Complementarity with target nucleic acids] [ / ] [Mismatch]
[0229] Mismatched bases can be introduced without eliminating activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that oligonucleotides with 100% complementarity to bcl-2 mRNA and three mismatches with bcl-xL mRNA could reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, these oligonucleotides exhibited potent in vivo antitumor activity. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested the ability of a series of tandem 14-nucleotide oligonucleotides and 28- and 42-nucleotide oligonucleotide sequences containing two or three tandem oligonucleotides to inhibit the translation of human DHFR in rabbit reticulocyte analysis. Each of the three 14-nucleotide oligonucleotides can individually inhibit translation, but at a more moderate level than the 28- or 42-nucleotide oligonucleotides.
[0230] In some embodiments, the oligonucleotide is complementary to the target nucleic acid along its entire length. In some embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In some embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid along its entire length and includes a portion that is 100% or completely complementary to the target nucleic acid. In some embodiments, the length of the completely complementary portion is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.
[0231] In some embodiments, the oligonucleotide contains one or more mismatched nucleobases relative to the target nucleic acid. In some embodiments, antisense activity against the target is reduced due to the mismatch, but the reduction in activity against non-targets is greater. Therefore, in some embodiments, the selectivity of the oligonucleotide is improved. In some embodiments, the mismatch is specifically located within the oligonucleotide having a spacer motif. In some embodiments, the mismatch is located at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 from the 5' end of the spacer region. In some embodiments, the mismatch is located at positions 1, 2, 3, 4, 5, or 6 from the 5' end of the 5' wing region or 3' wing region. [B. AGT]
[0232] In some embodiments, the oligomeric compound comprises or is composed of an oligonucleotide complementary to or consisting of a target nucleic acid, wherein the target nucleic acid is an AGT nucleic acid. In some embodiments, the AGT nucleic acid has the sequence shown in SEQ ID NO: 1 (GENBANK accession number NM_000029.3) or SEQ ID NO: 2 (complementary sequence to GENBANK accession number NC_000001.11 truncated from nucleotides 230700001 to 230718000).
[0233] In some embodiments, contacting cells with an oligomeric compound complementary to any of SEQ ID NO: 1 and 2 reduces the amount of AGT RNA, and in some embodiments reduces the amount of AGT protein. In some embodiments, the oligomeric compound consists of modified oligonucleotides. In some embodiments, contacting cells with an oligomeric compound complementary to any of SEQ ID NO: 1 and 2 reduces the amount of AGT RNA in the cells, and in some embodiments reduces the amount of AGT protein in the cells. In some embodiments, the cells are in vitro. In some embodiments, the cells are in vivo. In some embodiments, the oligomeric compound consists of modified oligonucleotides. In some embodiments, contacting cells in an individual with an oligomeric compound complementary to any of SEQ ID NO: 1 and 2 improves one or more symptoms or markers of cardiovascular disease. In some embodiments, the disease is hypertension. In some embodiments, the disease is refractory hypertension. In some embodiments, the disease is Marfan syndrome. In some embodiments, the disease is heart failure. In some embodiments, symptoms or signs are selected from hypertension, chronic kidney disease, stroke, myocardial infarction, heart failure, valvular heart disease, vascular aneurysm, peripheral artery disease, and organ damage.
[0234] In some embodiments, when administered according to standard in vitro analysis, the oligomeric compound complementary to either SEQ ID NO: 1 or 2 is capable of reducing the detectability of in vitro AGT RNA by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, when administered according to standard in vitro analysis, the oligomeric compound complementary to SEQ ID NO: 1 or 2 is capable of reducing the amount of in vitro AGT by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In some embodiments, the oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 is capable of reducing the detectability of AGT RNA in an individual by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. [, WE. , ] [Some binding compounds] [, , ]
[0235] In some embodiments, the oligomeric compounds described herein comprise, or consist of, an oligonucleotide (modified or unmodified) and, where appropriate, one or more binding groups and / or terminal groups. The binding group consists of one or more binding portions and a binding linker connecting the binding portions to the oligonucleotide. The binding group may be attached to one or both ends of the oligonucleotide and / or attached to any internal position. In some embodiments, the binding group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In some embodiments, the binding group attached to one or both ends of the oligonucleotide is a terminal group. In some of these embodiments, the binding group or terminal group is attached to the 3' end and / or 5' end of the oligonucleotide. In some of these embodiments, the binding group (or terminal group) is attached to the 3' end of the oligonucleotide. In some embodiments, the binding group is attached near the 3' end of the oligonucleotide. In some embodiments, the binding group (or terminal group) is attached to the 5' end of the oligonucleotide. In some embodiments, the binding group is attached near the 5' end of the oligonucleotide.
[0236] In some embodiments, the oligonucleotide is modified. In some embodiments, the oligonucleotide of the compound has a nucleobase sequence complementary to the target nucleic acid. In some embodiments, the oligonucleotide is complementary to messenger RNA (mRNA). In some embodiments, the oligonucleotide is complementary to pre-mRNA. In some embodiments, the oligonucleotide is complementary to sense transcripts.
[0237] Examples of terminal groups include (but are not limited to) binding groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more independently modified or unmodified nucleosides.
[0238] In some embodiments, the oligonucleotide is covalently linked to one or more binding groups. In some embodiments, the binding group modifies one or more properties of the linked oligonucleotide, including (but not limited to) pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In some embodiments, the binding group imparts new properties to the linked oligonucleotide, such as enabling the detection of the oligonucleotide's fluorophore or reporter group.Some binding groups and binding moieties have been previously described, such as: cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556); bile acids (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060); thioethers, such as hexyl-S-triphenylmethylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770); sulfur cholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538); aliphatic chains, such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54); phospholipids, such as di-hexadecyl-racemic-glycerol or 1,2-di-O-hexadecyl-racemic-glycerol-3-H-phosphonate triethylammonium (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783); polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14,969-973); or adamantaneacetic acid, palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237); octadecylamine or hexano-carbonyl-hydroxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937); tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740); or GalNAc cluster (e.g., WO2014 / 179620). 1. Combination part
[0239] The binding portion includes (but is not limited to) intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin portions, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, bile acid portions, folates, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinones, adamantane, acridine, fluorescent yellow, rose red, coumarin, fluorescein, and dyes.
[0240] In some embodiments, the binding portion comprises an active pharmaceutical ingredient, such as aspirin, warfarin, phenbuprofen, ibuprofen, sulprofen, fenbuprofen, ketoprofen, (S)-(+)-pranoprofen, carboprofen, dansyl sarcosinate, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folate, benzothiazide, chlorothiazide, diazoxide, indomethacin, barbiturates, cephalosporins, sulfonamides, antidiabetic drugs, antibacterial agents, or antibiotics. 2. Connecting the connector
[0241] The binding moiety is linked to the oligonucleotide via a binding linker. In some compounds, the binding linker is a single chemical bond (i.e., the binding moiety is directly linked to the oligonucleotide via a single bond). In some compounds, the binding moiety is linked to the oligonucleotide via a more complex binding linker comprising one or more binding linker moieties, which(e) are subunits constituting the binding linker. In some embodiments, the binding linker comprises an oligomer of a chain structure such as a hydrocarbon chain or a repeating unit such as an ethylene glycol, nucleoside, or amino acid unit.
[0242] In some embodiments, the linker comprises one or more groups selected from the following: alkyl, amino, oxy, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In some of these embodiments, the linker comprises groups selected from the following: alkyl, amino, oxy, amide, and ether. In some embodiments, the linker comprises groups selected from alkyl and amide. In some embodiments, the linker comprises groups selected from alkyl and ether. In some embodiments, the linker comprises at least one phosphorus moiety. In some embodiments, the linker comprises at least one phosphate group. In some embodiments, the linker includes at least one neutral linker group.
[0243] In some embodiments, the linker, including the linkers described above, is a bifunctional linker, such as those known in the art for linking a binding group to a parent compound, such as the oligonucleotides provided herein. Generally, a bifunctional linker comprises at least two functional groups. One functional group is bound to a specific site on the parent compound, and another functional group is bound to the binding group. Examples of functional groups used in a bifunctional linker include (but are not limited to) electrophiles for reacting with nucleophiles and nucleophiles for reacting with electrophiles. In some embodiments, the bifunctional linker comprises one or more groups selected from: amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0244] Examples of linkers include (but are not limited to) pyrrolidine, 8-amino-3,6-dioxanoic acid (ADO), 4-(N-maleiminomethyl)cyclohexane-1-carboxylic acid succinimino ester (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other linkers include (but are not limited to) substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, or substituted or unsubstituted C2-C10 alkynyl groups, wherein a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxyl, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0245] In some embodiments, the linker comprises 1-10 linker nucleosides. In some embodiments, these linker nucleosides are modified nucleosides. In some embodiments, these linker nucleosides comprise a modified sugar moiety. In some embodiments, the linker nucleosides are unmodified. In some embodiments, the linker nucleosides comprise a heterocyclic base selected from, where applicable, protected: purine, substituted purine, pyrimidine, or substituted pyrimidine. In some embodiments, the cleavable portion is a nucleoside selected from: uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutylguanine. It is generally desirable for the linker nucleosides to cleave from the compound upon arrival at the target tissue. Therefore, the linker nucleosides are typically linked to each other and to the remainder of the compound via cleavable bonds. In some embodiments, these cleavable bonds are phosphate diester bonds.
[0246] In this document, linker nucleosides are not considered part of an oligonucleotide. Therefore, in embodiments where the compound comprises an oligonucleotide consisting of a specified number or range of linker nucleosides and / or having a specified percentage of complementarity with a reference nucleic acid, and the compound also comprises a binding group containing a linker (containing a linker nucleoside), such linker nucleosides are not included in the length of the oligonucleotide and are not used to determine the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, the compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a binding group comprising 1-10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. In this compound, the total number of adjacent linked nucleosides is greater than 30. Alternatively, the compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides without a binding group. In this compound, the total number of adjacent linked nucleosides does not exceed 30. Unless otherwise indicated, the linker contains no more than 10 linker nucleosides. In some embodiments, the linker contains no more than 5 linker nucleosides. In some embodiments, the linker comprises no more than three linker nucleosides. In some embodiments, the linker comprises no more than two linker nucleosides. In some embodiments, the linker comprises no more than one linker nucleoside.
[0247] In some embodiments, it is desirable for the binding group to cleave from the oligonucleotide. For example, in some cases, a compound containing a specific binding moiety is preferably taken up by a specific cell type, but once the compound has been taken up, it is desirable to cleave the binding group to release unbound oligonucleotides or parent oligonucleotides. Therefore, some binding linkers may contain one or more cleavable moieties. In some embodiments, the cleavable moiety is a cleavable bond. In some embodiments, the cleavable moiety is a group of atoms containing at least one cleavable bond. In some embodiments, the cleavable moiety contains a group of atoms having one, two, three, four, or more cleavable bonds. In some embodiments, the cleavable moiety is selectively cleaved within a cell or subcellular compartment (such as a lysosome). In some embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme (such as a nuclease).
[0248] In some embodiments, the cleavable bond is selected from one or two esters of amide, ester, ether, phosphate diester, phosphate ester, carbamate, or disulfide. In some embodiments, the cleavable bond is one or two phosphate diesters. In some embodiments, the cleavable portion comprises a phosphate ester or phosphate diester. In some embodiments, the cleavable portion is a phosphate ester bond between an oligonucleotide and a binding portion or binding group.
[0249] In some embodiments, the cleavable portion comprises or is composed of one or more linker nucleosides. In some of these embodiments, the one or more linker nucleosides are linked to each other and / or to the remainder of the compound via cleavable bonds. In some embodiments, these cleavable bonds are unmodified phosphodiester bonds. In some embodiments, the cleavable portion is a 2'-deoxynucleoside linked to the 3' or 5' terminal nucleoside of an oligonucleotide via phosphate ester nucleoside linkage and covalently linked to the linker or the remainder of the binding portion via phosphate ester or thiophosphate ester linkage. In some of these embodiments, the cleavable portion is 2'-deoxyadenosine. [3.] [Specific cell-targeting binding sites] []
[0250] In some embodiments, the binding group comprises a cell-targeting binding moiety. In some embodiments, the binding group has the following general formula: Where n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater than 2, j is 1 or 0, and k is 1 or 0.
[0251] In some embodiments, n is 1, j is 1, and k is 0. In some embodiments, n is 1, j is 0, and k is 1. In some embodiments, n is 1, j is 1, and k is 1. In some embodiments, n is 2, j is 1, and k is 0. In some embodiments, n is 2, j is 0, and k is 1. In some embodiments, n is 2, j is 1, and k is 1. In some embodiments, n is 3, j is 1, and k is 0. In some embodiments, n is 3, j is 0, and k is 1. In some embodiments, n is 3, j is 1, and k is 1.
[0252] In some embodiments, the binding group comprises a cell-targeting portion having at least one tethered ligand. In some embodiments, the cell-targeting portion comprises two tethered ligands covalently linked to the branching group. In some embodiments, the cell-targeting portion comprises three tethered ligands covalently linked to the branching group.
[0253] In some embodiments, the cell-targeting portion includes a branched group comprising one or more groups selected from: alkyl, amino, oxy, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In some embodiments, the branched group includes a branched aliphatic group comprising groups selected from: alkyl, amino, oxy, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino. In some of these embodiments, the branched aliphatic group includes groups selected from: alkyl, amino, oxy, amide, and ether. In some of these embodiments, the branched aliphatic group includes groups selected from alkyl, amino, and ether. In some of these embodiments, the branched aliphatic group includes groups selected from alkyl and ether. In some embodiments, the branched group comprises a monocyclic or polycyclic system.
[0254] In some embodiments, each chain of the cell-targeting portion comprises one or more groups selected from any combination of the following: alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxy group, amide, phosphate diester, and polyethylene glycol. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from any combination of the following: alkyl, ether, thioether, disulfide, amino, oxy group, amide, and polyethylene glycol. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from any combination of the following: alkyl, phosphate diester, ether, amino, oxy group, and amide. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from any combination of the following: alkyl, ether, amino, oxy group, and amide. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from any combination of the following: alkyl, amino, and oxy group. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from alkyl and oxy groups in any combination. In some embodiments, each chain is a straight-chain aliphatic group comprising one or more groups selected from alkyl and phosphate diester groups in any combination. In some embodiments, each chain comprises at least one phosphorus-linking group or a neutral linking group. In some embodiments, each chain comprises a chain of about 6 to about 20 atoms in length. In some embodiments, each chain comprises a chain of about 10 to about 18 atoms in length. In some embodiments, each chain comprises a chain of about 10 atoms in length.
[0255] In some embodiments, each ligand of the cell-targeting portion has an affinity for at least one type of receptor on target cells. In some embodiments, each ligand has an affinity for at least one type of receptor on the surface of mammalian liver cells. In some embodiments, each ligand has an affinity for the hepatic desialylate glycoprotein receptor (ASGP-R). In some embodiments, each ligand is a carbohydrate. In some embodiments, each ligand is independently selected from galactose, N-acetylglucosamine (GalNAc), mannose, glucose, glucosamine, and fucose. In some embodiments, each ligand is N-acetylglucosamine (GalNAc). In some embodiments, the cell-targeting portion contains three GalNAc ligands. In some embodiments, the cell-targeting portion contains two GalNAc ligands. In some embodiments, the cell-targeting portion contains one GalNAc ligand.
[0256] In some embodiments, each ligand of the cell-targeting moiety is a carbohydrate, a carbohydrate derivative, a modified carbohydrate, a polysaccharide, a modified polysaccharide, or a polysaccharide derivative. In some of these embodiments, the binding group comprises a carbohydrate cluster (e.g., see Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting", Bioconjugate Chemistry, 2003, 14, 18-29 or Rensen et al., "Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor", J. Med. Chem. 2004, 47, 5798-5808). In some of these embodiments, each ligand is an amino sugar or a sulfose. For example, the amino sugars can be selected from a number of compounds known in this technology, such as sialic acid, α-D-galactosamine, β-muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-methamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfano-D-glucopyranose, N-sulfo-D-glucosamine, and N-ethanolacyl-α-neuraminic acid. For example, the sucrase may be selected from 5-thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetylglucopyranoside, 4-thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetylglucopyranoside 2-deoxy-1,5-dithio-α-D-glucopyranoside α-hepta-glucopyranoside.
[0257] In some embodiments, the binding group comprises a cell-targeting portion having the following formula: .
[0258] In some embodiments, the binding group comprises a cell-targeting portion having the following formula: .
[0259] In some embodiments, the binding group comprises a cell-targeting portion having the following formula: .
[0260] In some embodiments, the binding group comprises a cell-targeting portion having the following formula: .
[0261] In some embodiments, the binding group comprises a cell-targeting portion having the following formula: .
[0262] In some embodiments, the compound contains a binding group described herein as "LICA-1". LICA-1 has the following formula:
[0263] In some embodiments, the compounds described herein comprising LICA-1 and a cleavable portion located within the binding linker have the following formula: . [] Oligo is an oligonucleotide.
[0264] Representative U.S. patents, U.S. patent applications, international patent applications, and other publications teaching the preparation of certain of the aforementioned binding groups, compounds containing binding groups, chains, linkers, branched groups, ligands, cleavable portions, and other modifications include (but are not limited to) US 5,994,517, US 6,300,319, US 6,660,720, US 6,906,182, US 7,262,177, US 7,491,805, US 8,106,022, US 7,723,509, US 2006 / 0148740, US 2011 / 0123520, WO 2013 / 033230, and WO 2012 / 037254; Biessen et al., J. Med. Chem. 1995, 38, 1846-1852; Lee et al., Bioorganic & Medicinal Chemistry 2011, 19, 2494-2500; Rensen et al., J. Biol. Chem. 2001, 276, 37577-37584; Rensen et al., J. Med. Chem. 2004, 47, 5798-5808; Sliedregt et al., J. Med. Chem. 1999, 42, 609-618; and Valentijn et al., Tetrahedron, 1997, 53, 759-770.
[0265] In some embodiments, the modified oligonucleotide comprises an interstitial polymer or a fully modified glycomolecular body and a binding group comprising at least one, two, or three GalNAc ligands. In some embodiments, the compound includes a binding group found in any of the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al. Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycobiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852;Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798-5808; Rensen et al., Arterioscler Thromb Vasc Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato et al., J Am Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29; Jayaprakash et al., Org Lett, 2010, 12, 5410-5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International Applications: WO1998 / 013381; WO2011 / 038356; WO1997 / 046098; WO2008 / 098788; WO2004 / 101619; WO2012 / 037254; WO2011 / 120053; WO2011 / 100131; WO2011 / 163121; WO2012 / 177947; WO2013 / 033230; WO2013 / 075035; WO2012 / 083185; WO2012 / 083046;WO2009 / 082607;WO2009 / 134487;WO2010 / 144740;WO2010 / 148013;WO1997 / 020563;WO2010 / 088537;WO2002 / 043771;WO2010 / 129709;WO2012 / 068187;WO2009 / 126933;WO2004 / 024757;WO2010 / 054406;WO2012 / 089352;WO2012 / 089602;WO2013 / 166121;WO2013 / 165816; US Patents 4,751,219; 8,552,163; 6,908,903; 7,262,177; 5,994,517; 6,300,319; 8,106,022; 7,491,805; 7,491,805; 7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,720; 7,723,509; 8,541,548; 8,344 ,125;8,313,772;8,349,308;8,450,467;8,501,930;8,158,601;7,262,177;6,906,182;6,620,916;8,435,491;8,404,862;7,851,615;Published U.S. Patent Application Publications US2011 / 0097264;US2011 / 0097265;US2013 / 0004427;US2005 / 0164235;US2006 / 014 8740;US2008 / 0281044;US2010 / 0240730;US2003 / 0119724;US2006 / 0183886;US2008 / 0206869;US2011 / 0269814;US20 09 / 0286973;US2011 / 0207799;US2012 / 0136042;US2012 / 0165393;US2008 / 0281041;US2009 / 0203135;US2012 / 003511 5; US2012 / 0095075; US2012 / 0101148; US2012 / 0128760; US2012 / 0157509; US2012 / 0230938; US2013 / 0109817; US2013 / 0121954; US2013 / 0178512; US2013 / 0236968; US2011 / 0123520; US2003 / 0077829; US2008 / 0108801; and US2009 / 0203132. [VII.] [certain pharmaceutical compositions] []
[0266] In some embodiments, this document describes pharmaceutical compositions comprising one or more oligomeric compounds. In some embodiments, the one or more oligomeric compounds are each composed of modified oligonucleotides. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In some embodiments, the pharmaceutical composition comprises an aqueous saline solution and one or more oligomeric compounds, or consists thereof. In some embodiments, the pharmaceutical composition comprises a sterile aqueous saline solution and one or more oligomeric compounds, or consists thereof. In some embodiments, the sterile saline solution is pharmaceutical grade saline. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and water, or consists thereof. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and sterile water, or consists thereof. In some embodiments, the sterile water is pharmaceutical grade water. In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and phosphate-buffered saline (PBS), or consists thereof. In some embodiments, the sterile PBS is pharmaceutical grade PBS.
[0267] In some embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients. In some embodiments, the excipients are selected from water, salt solution, ethanol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silica, viscous paraffin, hydroxymethyl cellulose, and polyvinylpyrrolidone.
[0268] In some embodiments, the oligomeric compound may be mixed with pharmaceutically acceptable active and / or inert substances to prepare a pharmaceutical composition or formulation. The composition and method used to formulate the pharmaceutical composition depend on a variety of criteria, including (but not limited to) the route of administration, the severity of the disease, or the desired dosage.
[0269] In some embodiments, pharmaceutical compositions comprising oligomeric compounds encompass any pharmaceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such esters. In some embodiments, pharmaceutical compositions comprising oligomeric compounds containing one or more oligonucleotides are capable of providing (directly or indirectly) a bioactive metabolite or its residues when administered to an individual (including humans). Therefore, by way of example, this disclosure also relates to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalent forms. Suitable pharmaceutically acceptable salts include (but are not limited to) sodium and potassium salts. In some embodiments, a prodrug comprises one or more binding groups linked to an oligonucleotide, wherein the binding group is cleaved by an endogenous nuclease in vivo.
[0270] Lipid moieties have been used in nucleic acid therapy in various methods. In some of these methods, nucleic acids (such as oligomeric compounds) are introduced into pre-formed liposomes or lipid complexes prepared from a mixture of cationic and neutral lipids. In some methods, DNA complexes comprising monocationic or polycationic lipids are formed in the absence of neutral lipids. In some embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to specific cells or tissues. In some embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to adipose tissue. In some embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to muscle tissue.
[0271] In some embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include (but are not limited to) liposomes and emulsions. Certain delivery systems can be used to prepare certain pharmaceutical compositions, including those comprising hydrophobic compounds. In some embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.
[0272] In some embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules, which are designed to deliver one or more pharmaceutical agents comprising the oligomeric compounds provided herein to a specific tissue or cell type. For example, in some embodiments, the pharmaceutical composition comprises liposomes coated with tissue-specific antibodies.
[0273] In some embodiments, the pharmaceutical composition comprises a cosolvent system. Some of these cosolvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In some embodiments, these cosolvent systems are used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which comprises an anhydrous ethanol solution containing 3% w / v benzyl alcohol, 8% w / v nonpolar surfactant polysorbate 80™, and 65% w / v polyethylene glycol 300. The proportions of these cosolvent systems can be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of the cosolvent components can be modified: for example, other surfactants can be used instead of polysorbate 80™; the fraction of polyethylene glycol can be varied; other biocompatible polymers can replace polyethylene glycol, such as polyvinylpyrrolidone; and other sugars or polysaccharides can replace dextrose.
[0274] In some embodiments, the pharmaceutical composition is prepared for oral administration. In some embodiments, the pharmaceutical composition is prepared for buccal administration. In some embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), intraneural, perineurial, etc.). In some of these embodiments, the pharmaceutical composition comprises a carrier and is formulated in an aqueous solution such as water or a physiologically compatible buffer such as Hanks' solution, Ringer's solution, or saline buffer. In some embodiments, other components are included (e.g., components that aid dissolution or act as preservatives). In some embodiments, an injectable suspension is prepared using a suitable liquid carrier, suspending agent, and the like. Some injectable pharmaceutical compositions are presented in unit dosage forms (e.g., in ampoules or in multi-dose containers). Some injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous media and may contain formulation agents such as suspending agents, stabilizers, and / or dispersants. Suitable solvents for use in injectable pharmaceutical compositions include (but are not limited to) lipophilic solvents and fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides), and liposomes.
[0275] Under certain conditions, some of the compounds disclosed herein act as acids. Although these compounds can be drawn or described in protonated (free acid) form, or in ionized and cation-associated (salt) form, aqueous solutions of these compounds exist in equilibrium in these forms. For example, the phosphate ester bonds of oligonucleotides in aqueous solutions exist in equilibrium in free acid, anionic, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Furthermore, some oligonucleotides have several such bonds, each in equilibrium. Thus, oligonucleotides in solution exist in a series of forms at multiple sites, all in equilibrium. The term "oligonucleotide" is intended to include all such forms. The drawn structures necessarily represent a single form. However, unless otherwise indicated, these diagrams are also intended to include corresponding forms. In this document, the drawing of the structure of a compound as a free acid followed by the term "or its salt" explicitly includes all such forms, which may be fully or partially protonated / deprotonated / cation-associated. In some cases, one or more specific cations are identified.
[0276] In some embodiments, the modified oligonucleotides or oligomers are in an aqueous sodium-containing solution. In some embodiments, the modified oligonucleotides or oligomers are in an aqueous potassium-containing solution. In some embodiments, the modified oligonucleotides or oligomers are in PBS. In some embodiments, the modified oligonucleotides or oligomers are in water. In some of these embodiments, the pH of the solution is adjusted using NaOH and / or HCl to achieve the desired pH.
[0277] In this document, specific dosages are described. Dosages may be expressed in units of dosage. For clarity, the dosage (or unit of dosage) (in milligrams) of a modified oligonucleotide or oligomer indicates the mass of the free acid form of the modified oligonucleotide or oligomer. As explained above, in aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purposes of dosage calculation, it is assumed that the modified oligonucleotide or oligomer exists in a solvent-free, sodium acetate-free, and anhydrous free acid form. For example, if the modified oligonucleotide or oligomer is in a solution containing sodium (e.g., saline), it may be partially or completely deprotonated and associated with Na+ ions. However, the mass of the protons is still included in the weight of the dosage, while the mass of the Na+ ions is not. When the oligomer contains a binding group, the mass of the binding group is included when calculating the dosage of the oligomer. If the binding group also has an acid, then for the purpose of calculating the dosage, it is also assumed that the binding group is fully protonated. [VIII.] [certain compositions] [] 1. Compound No. 1205407
[0278] In some embodiments, compound 1205407 is characterized as a 3-10-3 MOE / cEt mixed interwing interferometer polymer with a binding group at its 5' end. Compound 1205407 has the sequence CGCTGATTTGTCCGGG (SEQ ID NO: 12) (from 5' to 3'), wherein nucleosides 1 to 3 are sugar-modified with eek (from 5' to 3'), and wherein nucleosides 14 to 16 are sugar-modified with kke, wherein each 'e' represents a 2'- The MOE sugar moiety, and each 'k' refers to the cEt sugar moiety; and each of nucleosides 4 to 13 is a 2'-β-D-deoxynucleoside; wherein the inter-nucleoside bonds between nucleosides 2 to 3, 3 to 4, and 14 to 15 are phosphodiester inter-nucleoside bonds and the inter-nucleoside bonds between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, and 15 to 16 are thiophosphate inter-nucleoside bonds, and wherein each cytosine is 5-methylcytosine. Compound 1205407 has a 5'-hexylamino-(THA)-C 6GalNAc 3-capped structure, which is represented by the following structure, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside: .
[0279] In some embodiments, compound 1205407 is represented by the following chemical notation: THA-C6-GalNAc 3- mC esG eo mC koT dsG dsA dsT dsT dsT dsG dsT ds mC ds mC dsG koG ksG e (SEQ ID NO: 12), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-β-D-MOE sugar moiety, k = cEt sugar portion, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside linkage, and o = Phosphodiester nucleoside linkage.
[0280] In some embodiments, compound 1205407 is represented by the following chemical structure: (SEQ ID NO: 12), or its salt.
[0281] In some embodiments, the sodium salt of compound 1205407 is represented by the following chemical structure: (SEQ ID NO: 12).
[0282] In some embodiments, compound 1205407 is in anionic form. 2. Compound No. 1205408
[0283] In some embodiments, compound 1205408 is characterized as a 3-10-3 MOE / cEt mixed interwing interferometer polymer with a binding group at its 5' end. Compound 1205408 has the sequence TCGGTTGGAATTCTTT (SEQ ID NO: 13) (from 5' to 3'), wherein nucleosides 1 to 3 are sugar-modified with ekk (from 5' to 3') and wherein nucleosides 14 to 16 are sugar-modified with kke; wherein each 'e' represents a 2'- The MOE sugar moiety, and each 'k' refers to the cEt sugar moiety; and each of nucleosides 4 to 13 is a 2'-β-D-deoxynucleoside; wherein the inter-nucleoside bonds between nucleosides 2 to 3, 3 to 4, and 14 to 15 are phosphodiester inter-nucleoside bonds and the inter-nucleoside bonds between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, and 15 to 16 are thiophosphate inter-nucleoside bonds, and wherein each cytosine is 5-methylcytosine. Compound 1205408 has a 5'-hexylamino-(THA)-C 6GalNAc 3-capped structure, which is represented by the following structure, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside: .
[0284] In some embodiments, compound 1205408 is represented by the following chemical notation: THA-C6-GalNAc 3-T es mC koG koG dsT dsT dsG dsG dsA dsA dsT dsT ds mC dsT koT ksT e (SEQ ID NO: 13), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-β-D-MOE glycoside, k = cEt sugar portion, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside linkage, and o = Phosphodiester nucleoside linkage.
[0285] In some embodiments, compound 1205408 is represented by the following chemical structure: [, , ] (SEQ ID NO: 13), or its salt.
[0286] In some embodiments, the sodium salt of compound 1205408 is represented by the following chemical structure: [] (SEQ ID NO: 13).
[0287] In some embodiments, compound 1205408 is in anionic form. 3. Compound No. 1250837
[0288] In some embodiments, compound 1250837 is characterized as a 3-10-3 interstitial polymer with a binding group at its 5' end. Compound 1250837 has the sequence GTCGGTTGGAATTCTT (SEQ ID NO: 15) (from 5' to 3'), wherein nucleosides 1 to 3 and 14 to 16 are modified with cEt sugars, wherein nucleoside 5 has a 2'-OMe ribose, and wherein each of nucleosides 4 and 6 to 13 is a 2'-β-D-deoxynucleoside; wherein each nucleoside inter-linking is a thiophosphate nucleoside inter-linking, and wherein each cytosine is 5-methylcytosine. Compound 1250837 has a 5'-hexylamino-(THA)-C 6GalNAc 3-terminus, which is represented by the following structure, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside: .
[0289] In some embodiments, compound 1250837 is represented by the following chemical notation: THA-C6-GalNAc 3- G ksT ks mC ksG dsG ysT dsT dsG dsG dsA dsA dsT dsT ds mC ksT ksT k (SEQ ID NO: 15), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, k = cEt sugar portion, d = 2'-β-D-deoxyribosyl sugar moiety, y = 2'-OMe ribose portion, and s = thiophosphate nucleoside linkage.
[0290] In some embodiments, compound 1250837 is represented by the following chemical structure: (SEQ ID NO: 15), or its salt.
[0291] In some embodiments, the sodium salt of compound 1250837 is represented by the following chemical structure: (SEQ ID NO: 15).
[0292] In some embodiments, compound 1250837 is in anionic form. 4. Compound No. 1250851
[0293] In some embodiments, compound 1250851 is characterized as a 3-10-3 interstitial polymer with a binding group at its 5' end. Compound 1250851 has the sequence TCGGUTGGAATTCTTT (SEQ ID NO: 14) (from 5' to 3'), wherein nucleosides 1 to 3 and 14 to 16 are modified with cEt sugar, wherein nucleoside 5 has 2'-OMe ribose, and wherein each of nucleosides 4 and 6 to 13 is a 2'-β-D-deoxy nucleoside; wherein the inter-nucleoside linkages between nucleosides 2 to 3, 3 to 4 and 14 to 15 are phosphodiester inter-nucleoside linkages and the inter-nucleoside linkages between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14 and 15 to 16 are thiophosphate inter-nucleoside linkages, and wherein each cytosine is 5-methylcytosine. Compound 1250851 has a 5'-hexylamino-(THA)-C 6GalNAc 3-terminus, represented by the following structure, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside: .
[0294] In some embodiments, compound 1250851 is represented by the following chemical notation: THA-C6-GalNAc 3- T ks mC koG koG dsU ysT dsG dsG dsA dsA dsT dsT ds mC dsT koT ksT k (SEQ ID NO: 14), wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, U = uracil nucleobase, k = cEt sugar portion, d = 2'-β-D-deoxyribosyl sugar moiety, y = 2'-OMe ribose portion, s = thiophosphate nucleoside linkage, and o = Phosphodiester nucleoside linkage.
[0295] In some embodiments, compound 1250851 is represented by the following chemical structure: (SEQ ID NO: 14), or its salt.
[0296] In some embodiments, the sodium salt of compound 1250851 is represented by the following chemical structure: (SEQ ID NO: 14).
[0297] In some embodiments, compound 1250851 is in anionic form. [VI.] [Some comparative compositions] []
[0298] In some embodiments, compound 757456 is a comparative compound. Compound 757456 was previously described in WO2017062816, which is incorporated herein by reference, and has the sequence CACAAACAAGCTGGTCGGTT (SEQ ID NO: 28) (from 5' to 3'), wherein the compound comprises a binding group and a modified oligonucleotide; wherein the modified oligonucleotide is a 5-10-5 MOE interstitial polymer, wherein the central interstitial segment is composed of ten 2'-β-D-deoxynucleosides and the 5' and 3' wing segments are each composed of five 2'-MOE modified nucleosides. The inter-nucleoside linkage is a phosphate thioester nucleoside linkage. All cytosine residues are 5-methylcytosine. Compound 757456 has a 5'-hexylamino-(THA)-C 6GalNAc 3-terminus, represented by the following structure, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside:
[0299] In some embodiments, compound 568637 is a comparative compound. Compound 568637 was previously described in WO2017062816, which is incorporated herein by reference, and has the sequence CGCTGATTTGTCCGGG (SEQ ID NO: 12) (from 5' to 3'), wherein the compound consists of a modified oligonucleotide; wherein the modified oligonucleotide is 16 nucleotides in length and has a mixed sugar moiety as described by the sugar motif eekddddddddddkke; wherein each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, each 'e' represents a 2'-MOE sugar moiety, and each 'k' represents a cEt sugar moiety. The internucleotide linkages are phosphate thioester internucleotide linkages. All cytosine residues are 5-methylcytosine.
[0300] In some embodiments, compound 1176644 is a comparative compound. Compound 1176644 is compound 568637, which has a 5'-tris(hexylamino-(THA)-C6GalNAc 3-terminus. Similar to compound 568637, compound 1176644 has the sequence CGCTGATTTGTCCGGG (SEQ ID NO: 12) (from 5' to 3'), wherein the compound comprises a modified oligonucleotide; wherein the modified oligonucleotide is 16 nucleotides in length and has a mixed sugar moiety as described by the sugar motif eekddddddddddkke; wherein each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, each 'e' represents a 2'-MOE sugar moiety, and each 'k' represents a cEt sugar moiety. The internucleotide linkages are phosphate thioester internucleotide linkages. All cytosine residues are 5-methylcytosine.
[0301] In some embodiments, the compounds described herein are superior to those described in WO2017062816 because they exhibit one or more improved properties, such as performance.
[0302] For example, compound 1205407 exhibits improved in vivo efficacy compared to compound 757456. As shown in Example 5, at a dose of 2.7 mg / kg, compound 1205407 achieved 93% and 90% inhibition of AGT RNA and protein, respectively. In contrast, at a dose of 3.3 mg / kg, compound 757456 achieved 65% and 60% inhibition of AGT RNA and protein, respectively. Therefore, in this analysis, compound 1205407 is more potent than compound 757456. For example, as shown in Study 1 of Example 6, the ED50 of compound 1205407 in liver and plasma was 0.1. In contrast, the ED50 of compound 757456 in liver and plasma was 1.3. Therefore, in this analysis, compound 1205407 is more potent than compound 757456.
[0303] For example, compound 1205407 exhibits improved in vitro efficacy compared to compound 757456. As shown in Example 8, using the Hepatopac system, the in vitro IC50 of compound 1205407 is 0.04 nM. In contrast, the in vitro IC50 of compound 757456 is >20 µM. Therefore, in this analysis, compound 1205407 is more potent than compound 757456.
[0304] For example, compound 1205407 exhibits improved in vitro efficacy compared to compounds 757456 or 1176644. As shown in Example 7, when tested in vitro using two different primer probe sets, compound 1205407 showed IC50 values of 8 nM and 12 nM. In contrast, under the same in vitro culture conditions, compound 757456 showed IC50 values of 868 nM and 709 nM. And under the same in vitro culture conditions, compound 1176644 showed IC50 values of 35 nM and 43 nM. Therefore, in this analysis, compound 1205407 is more potent than either compound 757456 or 1176644.
[0305] For example, compound 1205407 exhibits improved in vivo potency compared to compounds 757456 or 1176644. As shown in Study 2 of Example 6, compound 1205407 had an ED50 of 0.11 and an ED75 of 0.38 in transgenic mouse studies. In contrast, compound 757456 had an ED50 of 2.1 and an ED75 of 2.68. Compound 1176644 had an ED50 of 0.38 and an ED75 of 0.61. Therefore, in this analysis, compound 1205407 is more potent than compounds 757456 or 1176644. [] Non-restrictive disclosures and inclusion by reference
[0306] Every document and patent publication listed in this article is incorporated in full by way of quotation.
[0307] While certain compounds, compositions, and methods described herein have been specifically illustrated with reference to certain embodiments, the following examples are for illustrative purposes only and are not intended to limit the compounds described herein. Every reference, GenBank accession number, and such listed in this application is incorporated herein by reference in its entirety.
[0308] Although the sequence listing accompanying this application may identify each sequence as "RNA" or "DNA" as needed, in practice, these sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily understand that, in some cases, names such as "RNA" or "DNA" describing modified oligonucleotides are arbitrary. For example, an oligonucleotide containing a nucleotide with a 2'-OH sugar moiety and a thymine base may be described as DNA with a modified sugar moiety (2'-OH replacing one of the 2'-Hs in DNA) or as RNA with a modified base (thymine (methylated uracil) replacing uracil in RNA). Therefore, the nucleic acid sequences provided herein (including, but not limited to, those in the sequence listing) are intended to cover nucleic acids containing any combination of native or modified RNA and / or DNA, including, but not limited to, nucleic acids with modified nucleobases. As another example, but without limitation, the term "ATCGATCG" encompasses any oligomer having this nucleobase sequence, whether modified or unmodified, including (but not limited to) compounds containing RNA bases, such as those having the sequence "AUCGAUCG"; and those containing some DNA bases and some RNA bases, such as "AUCGATCG"; and oligomers having other modified nucleobases, such as "AT mCGAUCG", where mC indicates a cytosine base containing a methyl group at position 5.
[0309] Some of the compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers, resulting in mirror-image isomers, non-mirror-image isomers, and other stereoisomer configurations that can be defined, in absolute stereochemistry, as (R) or (S), α or β (e.g., for sugar mutarotation isomers), or (D) or (L) (e.g., for amino acids). The compounds depicted or described herein as having certain stereoisomer configurations include only those indicated. Unless otherwise specified, compounds depicted or described herein with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. Similarly, unless otherwise indicated, all cis and trans isomers and tautomers of the compounds described herein are also included. The oligomeric compounds described herein include palmar pure or enriched mixtures and racemic mixtures. For example, oligomeric compounds having multiple inter-nucleoside bonds of thiophosphates include such compounds with palmar controlled or random inter-nucleoside bonds of thiophosphates. Unless otherwise indicated, the compounds described herein are intended to include their corresponding salt forms.
[0310] The compounds described herein include variations of one or more atoms substituted with non-radioactive or radioactive isotopes of the indicator element. For example, the compounds contained herein encompass all possible deuterium substitutions for each 1H hydrogen atom. Isotopic substitutions covered in the compounds herein include (but are not limited to): 2H or 3H replacing 1H, 13C or 14C replacing 12C, 15N replacing 14N, 17O or 18O replacing 16O, and 33S, 34S, 35S, or 36S replacing 32S. In some embodiments, non-radioactive isotopic substitution can impart new properties to the oligomeric compounds, which may be beneficial for use as therapeutic or research tools. In some embodiments, radioactive isotopic substitution can make the compounds suitable for research or diagnostic purposes, such as imaging. [Example]
[0311] The following examples illustrate certain embodiments of this disclosure and are not intended to be limiting. Furthermore, in providing specific embodiments, the inventors have considered their general applicability. [] [Example] [1] [With Humanity] [AGT] [Design of modified oligonucleotides for nucleic acid complementarity] []
[0312] As illustrated in the tables below, modified oligonucleotides complementary to human AGT nucleic acids were designed. In all the tables below, the “start site” indicates the 5' end nucleotide of the target nucleic acid sequence complementary to the modified oligonucleotide. The “stop site” indicates the 3' end nucleotide of the target nucleic acid sequence complementary to the modified oligonucleotide. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (GENBANK accession number NM_000029.3) or SEQ ID NO: 2 (the complementary sequence of GENBANK accession number NC_000001.11 truncated from nucleotides 230700001 to 230718000).
[0313] The modified oligonucleotides in Table 1 are 16 nucleotides in length and have mixed sugar moieties as indicated in the table below, where each 'd' represents a 2'-β-D-deoxyribosyl sugar moiety, each 'e' represents a 2'-MOE sugar moiety, and each 'k' represents a cEt sugar moiety. The internucleotide linkages are phosphate thioester internucleotide linkages. All cytosine residues are 5-methylcytosine. 568637 is a comparative compound previously described in WO 2017 / 062816. [surface] [1] 3-10-3 MOE / cEt hybrid interwing intermerates complementary to human AGT RNA and with uniform PS nucleotide interlinking [] [Compound ID] [SEQ ID NO: 1] [Start site] [SEQ ID NO: 1] [Termination Site] [SEQ ID NO: 2] [Start site] [SEQ ID NO: 2] [Termination Site] [Sequence(5')] [to 3')] [Sugar motif] [(5')] [to 3')] [SEQ ID NO] 568637 2046 2061 14940 14955 CGCTGATTTGTCCGGG eekddddddddddkke 12
[0314] The modified oligonucleotides in Tables 2 to 6 all have a 5'-hexylamino-(THA)-C 6GalNAc 3-capped structure, represented by the following structure, wherein the phosphate group is attached to the 5'-oxygen atom of the 5'-nucleoside: .
[0315] The modified oligonucleotides in Table 2 are 16 nucleotides in length and have mixed sugar moieties as indicated, where each 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, each 'e' represents the 2'-MOE sugar moiety, and each 'k' refers to the cEt sugar moiety. The internucleotide motif of the interstitial polymer is (from 5' to 3'): soossssssssssos; where each 'o' represents a phosphodiester nucleotide link and each 's' represents a thiophosphate nucleotide link. All cytosine residues are 5-methylcytosine. [surface] [2] A 3-10-3 MOE / cEt hybrid interwing intergranular polymer complementary to human AGT RNA and containing mixed PO / PS nucleotide interlinking. [Compound ID] [SEQ ID NO: 1] [Start site] [SEQ ID NO: 1] [Termination Site] [SEQ ID NO: 2] [Start site] [SEQ ID NO: 2] [Termination Site] [Sequence(5')] [to 3')] [Sugar motif] [(5')] [to 3')] [SEQ ID NO] 1205407 2046 2061 14940 14955 THA-GalNAc-CGCTGATTTGTCCGGG eekddddddddddkke 12 1205408 2271 2286 15165 15180 THA-GalNAc-TCGGTTGGAATTCTTT ekkddddddddddkke 13 1205410 2046 2061 14940 14955 THA-GalNAc-CGCTGATTTGTCCGGG ekkddddddddddkke 12
[0316] The modified oligonucleotides in Table 3 are 16 nucleotides in length and have mixed sugar moieties as indicated, where each 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, each 'e' represents the 2'-MOE sugar moiety, each 'k' refers to the cEt sugar moiety, and each 'y' refers to the 2'-OMe ribose. The internucleotide motif of the interstitial polymer is (from 5' to 3'): soossssssssssos; where each 'o' represents the phosphodiester nucleotide link and each 's' represents the thiophosphate nucleotide link. All cytosine residues are 5-methylcytosine, unless indicated by bold and underlined '...'. [, C The , ]』 indicates that in this case, cytosine is unmethylated. [surface] [3] A 3-10-3 cEt interstitial polymer that is complementary to human AGT RNA and has mixed PO / PS nucleotide interlinking, with 2'-OMe GalNAc binding in the interstitial space. [Compound ID] [SEQ ID NO: 1] [Start site] [SEQ ID NO: 1] [Termination Site] [SEQ ID NO: 2] [Start site] [SEQ ID NO: 2] [Termination Site] [Sequence(5')] [to 3')] [Sugar motif] [(5')] [to 3')] [SEQ ID NO] 1299239 637 652 7279 7294 THA-GalNAc-CTCATUGTGGATGACG kkkddydddddddkkk 16 1299240 637 652 7279 7294 THA-GalNAc-CTCATTGTGGATGACG kkkdddyddddddkkk 17 1299247 711 726 7353 7368 THA-GalNAc-TGAATUGGAGCAGGTA kkkddydddddddkkk 18 1299248 711 726 7353 7368 THA-GalNAc-TGAATTGGAGCAGGTA kkkdddyddddddkkk 19 1251199 785 800 7427 7442 THA-GalNAc-CGGTGTCAAGTTTTGC kkkdyddddddddkkk 20 1251204 1826 1841 14720 14735 THA-GalNAc-GTTGGGTAGACTCTGT kkkdyddddddddkkk 21 1250850 2046 2061 14940 14955 THA-GalNAc-CGCTGATTTGTCCGGG kkkdyddddddddkkk 12 1251213 2268 2283 15162 15177 THA-GalNAc-GTTGGAATTCTTTTTG kkkdyddddddddkkk 22 1250851 2271 2286 15165 15180 THA-GalNAc-TCGGUTGGAATTCTTT kkkdyddddddddkkk 14
[0317] The modified oligonucleotides in Table 4 are 16 nucleotides in length and have mixed sugar motifs as indicated, where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, 'e' represents the 2'-MOE sugar moiety, and 'k' refers to the cEt sugar moiety. Each nucleotide is linked by a phosphate thioester nucleotide link. All cytosine residues are 5-methylcytosine. [surface] [4] A 3-10-3 MOE / cEt hybrid interwing intergranular polymer complementary to human AGT RNA and possessing unified PS nucleotide interlinking with GalNAc binding. [Compound ID] [SEQ ID NO: 1] [Start site] [SEQ ID NO: 1] [Termination Site] [SEQ ID NO: 2] [Start site] [SEQ ID NO: 2] [Termination Site] [Sequence(5')] [to 3')] [Sugar motif] [(5')] [to 3')] [SEQ ID NO] 1176644 2046 2061 14940 14955 THA-GalNAc-CGCTGATTTGTCCGGG eekddddddddddkke 12 1176648 2271 2286 15165 15180 THA-GalNAc-TCGGTTGGAATTCTTT ekkddddddddddkke 13 1176649 2272 2287 15166 15181 THA-GalNAc-GTCGGTTGGAATTCTT ekkddddddddddkke 15 1176653 2046 2061 14940 14955 THA-GalNAc-CGCTGATTTGTCCGGG ekkddddddddddkke 12 1231463 1834 1849 14728 14743 THA-GalNAc-GTTAAGCTGTTGGGTA kkkddddddddddkkk twenty three
[0318] The modified oligonucleotides in Table 5 are 16 nucleotides in length and have the mixed sugar motifs indicated, where 'd' represents the 2'-β-D-deoxyribosyl sugar moiety, 'e' represents the 2'-MOE sugar moiety, 'k' refers to the cEt sugar moiety, and 'y' refers to the 2'-OMe ribose. Each nucleotide is linked by a phosphate thioester nucleotide linker. All cytosine residues are 5-methylcytosine, unless otherwise indicated by a bolded and underlined ''. [, C The , ]』 indicates that in this case, cytosine is unmethylated. [surface] [5] A 3-10-3 cEt interstitial polymer that is complementary to human AGT RNA and has a unified PS nucleotide interlinking with GalNAc binding in the interstitial space, and has 2'-OMe binding. [Compound ID] [SEQ ID NO: 1] [Start site] [SEQ ID NO: 1] [Termination Site] [SEQ ID NO: 2] [Start site] [SEQ ID NO: 2] [Termination Site] [Sequence(5')] [to 3')] [Sugar motif] [(5')] [to 3')] [SEQ ID NO] 1250835 2046 2061 14940 14955 THA-GalNAc-CGCTGATTTGTCCGGG kkkdyddddddddkkk 12 1250836 2271 2286 15165 15180 THA-GalNAc-TCGGUTGGAATTCTTT kkkdyddddddddkkk 14 1250837 2272 2287 15166 15181 THA-GalNAc-GTCGGTTGGAATTCTT kkkdyddddddddkkk 15 1250840 711 726 7353 7368 THA-GalNAc-TGAAUTGGAGCAGGTA kkkdyddddddddkkk 24 1250842 1729 1744 13760 13775 THA-GalNAc-TTGCAGGTTCAGCTCG kkkdyddddddddkkk 25 1251216 1822 1837 14716 14731 THA-GalNAc-GGTAGACTCTGTGGGC kkkdyddddddddkkk 26 1251228 2268 2283 15162 15177 THA-GalNAc-GTTGGAATTCTTTTTG kkkdyddddddddkkk 27
[0319] The modified oligonucleotides in Table 6 are 5-10-5 MOE interstitial polymers with uniform phosphate thioester nucleoside linkages. The compound is 20 nucleosides in length, with the central interstitial region consisting of ten 2'-β-D-deoxy nucleosides and the 5' and 3' wing regions each consisting of five 2'-MOE-modified nucleosides. Each nucleoside linkage is a phosphate thioester nucleoside linkage. All cytosine residues are 5-methylcytosine. 757456 is a comparative compound previously described in WO 2017 / 062816. [] [surface] [6] A 5-10-5 MOE interstitial polymer complementary to human AGT RNA and possessing unified PS nucleotide interlinking. [Compound] [ID] [SEQ ID NO: 1] [Start site] [SEQ ID NO: 1] [Termination Site] [SEQ ID NO: 2] [Start site] [SEQ ID NO: 2] [Termination Site] [sequence] [(5')] [to] [3')] [Sugar motif] [(5')] [to] [3')] [SEQ ID NO] 757456 2281 2300 15175 15194 THA-GalNAc-CACAAACAAGCTGGTCGGTT eeeeeddddddddddeeeee 28 [Example] [2] [:] [HepG2] Humans in Cells [AGT] [Dose-dependent in vitro inhibition] []
[0320] Cultured HepG2 cells at a density of 10,000 cells per well were treated by electroporation with modified oligonucleotides diluted to different concentrations as specified in the tables below. After a treatment period of approximately 24 hours, AGT RNA levels were measured using the human AGT primer-probe set RTS3721 (described above) as previously described. AGT RNA levels were normalized to human GAPDH expression levels using the primer-probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC, designated SEQ ID NO: 9 herein; reverse sequence GAAGATGGTGATGGGATTTC, designated SEQ ID NO: 10 herein; probe sequence CAAGCTTCCCGTTCTCAGCC, designated SEQ ID NO: 11 herein). The results are presented in the tables below as the percentage of AGT inhibition relative to untreated control cells. As used herein, a value of '0' indicates that treatment with modified oligonucleotides did not inhibit AGT mRNA levels. [surface] [7] Multiple-dose analysis of modified oligonucleotides in HepG2 cells [Compound Number] [inhibition] [%] [IC, 50 , (µM) ] [23 nM] [94 nM] [375 nM] [1500 nM] [6000 nM] 1250840 0 0 5 25 51 5.3 1231463 0 8 14 47 77 1.8 1205407 0 19 52 81 91 0.4 1250850 12 25 49 74 93 0.4 1251213 0 6 3 33 71 2.8 1251228 0 0 4 34 58 3.9 1205408 3 5 15 47 77 1.8 1250836 0 9 22 48 75 1.7 1250851 11 7 twenty four 61 80 1.1 1250837 11 4 29 61 83 1.0 1299239 13 37 65 92 97 0.8 1299240 twenty three 56 85 97 96 1.9 1205410 6 16 31 68 98 0.2 1250835 10 20 50 87 86 0.4 [Example] [3] [Targeting Humans] [AGT] [The modified oligonucleotides in] [CD-1] [Tolerance in mice] []
[0321] CD1 mice are a versatile mouse model commonly used for safety and efficacy testing. Mice were treated with modified oligonucleotides selected from the aforementioned studies, and changes in the levels of various plasma chemical markers were evaluated. treat
[0322] Six- to eight-week-old male CD-1 mice were administered 15 mg / kg of modified oligonucleotides subcutaneously once a week for six weeks (a total of seven treatments). One group of male CD-1 mice was injected with saline. The mice were euthanized 72 hours after the last administration. plasma chemical markers
[0323] To assess the effects of modified oligonucleotides on liver function, plasma levels of blood urea nitrogen (BUN), albumin, alanine transaminase (ALT), aspartate transaminase (AST), creatinine (CREA), and total bilirubin (TBIL) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results are presented in the table below. [surface] [8] Plasma chemical markers in male CD-1 mice [Compound Number] [BUN (mg / dL)] [albumin] [(g / dL)] [ALT (IU / L)] [AST (IU / L)] [TBIL (mg / dL)] [CREA (mg / dL)] brine twenty three 3 31 49 0.14 0.08 1176644 twenty four 3 52 56 0.13 0.11 1176648 25 3 70 51 0.12 0.11 1176653 22 3 309 330 0.12 0.09 1205407 21 3 123 83 0.12 0.09 1205408 24 3 64 78 0.12 0.13 1205410 26 3 161 121 0.13 0.11 1231463 27 3 132 188 0.19 0.13
[0324] Blood samples obtained from the mouse group at week 6 were sent to IDEXX BioResearch for blood cell count measurement. Counts included red blood cell (RBC) count, white blood cell (WBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), and individual white blood cell counts such as monocytes (MON), neutrophils (NEU), lymphocytes (LYM), and platelets (PLT). Results are presented in the tables below. [surface] [9] Blood cell count in male CD-1 mice [Compound Number] [WBC (K / uL)] [RBC (M / uL)] [HGB (g / dL)] [HCT (%)] [MCV (fL)] [MCH (pg)] [MCHC (g / dL)] [NEU ( / uL)] [LYM ( / uL)] [MON ( / uL)] [PLT (K / uL)] brine 8 9 14 47 52 16 31 1133 6142 390 1290 1176644 6 9 14 46 50 16 31 919 4533 231 1182 1176648 4 9 14 44 50 16 31 703 3370 227 1186 1176653 8 10 15 48 48 15 32 989 6505 361 829 1205407 9 10 15 47 47 15 33 901 7171 355 1228 1205408 9 9 15 46 48 15 32 1633 6745 501 1446 1205410 6 9 14 45 50 16 32 714 5112 227 994 1231463 8 10 15 46 48 16 32 872 6365 481 1260
[0325] Mice body weight was measured on day 1 and day 35, and the mean body weight for each group is shown in the table below. Liver, spleen, and kidney weights were measured at the end of the study and are shown in the table below. Modified oligonucleotides that caused any changes in organ weight beyond the expected range were excluded from further studies. [surface]
[10] [Body weight and organ weight] [(g)] [Compound Number] [weight] [(g)] [Liver weight] [(g)] [Kidney weight] [(g)] [Spleen weight] [(g)] [No.] [1] [sky] [No.]
[35] [sky] PBS 31.7 37.7 2.1 0.7 0.2 1176644 31.0 37.7 2.5 0.5 0.1 1176648 32.4 40.0 2.5 0.6 0.1 1176653 32.0 40.7 2.8 0.7 0.1 1205407 31.7 39.2 2.7 0.6 0.1 1205408 30.5 38.3 2.2 0.5 0.1 1205410 29.8 35.2 2.4 0.5 0.1 1231463 32.5 39.6 2.5 0.5 0.1 [Example] [4] [Targeting Humans] [AGT] [The modified oligonucleotides in] [Sprague-Dawley] [Tolerance in rats] []
[0326] The Sprague-Dawley rat is a versatile model used for safety and efficacy assessment. Rats were treated with a modified Ionis oligonucleotide derived from the study described in the examples above, and changes in the levels of various plasma chemical markers were evaluated. Study 1 treat
[0327] Male Sprague-Dawley rats were kept under a 12-hour light / dark cycle and fed a Purina normal rat diet. Four Sprague-Dawley rats in each group were subcutaneously injected weekly with 15 mg / kg Ionis oligonucleotides for 6 weeks (a total of 6 doses). The rats were euthanized 72 hours after the last dose; organs, urine, and plasma were harvested for further analysis. plasma chemical markers
[0328] To assess the effects of Ionis oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). ALT (alanine transaminase) and AST were also measured. The plasma levels of aspartate transaminase (IU / L) were measured and are presented in the table below. The plasma levels of total bilirubin (TBIL), creatinine, albumin, and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer, and the results are also presented in the table below. [surface]
[11] Plasma chemical markers in Sprague-Dawley rats [Compound Number] [BUN (mg / dL)] [albumin] [(g / dL)] [ALT (IU / L)] [AST (IU / L)] [TBIL (mg / dL)] [CREA (mg / dL)] brine 17 3 27 78 0.13 0.23 1205407 15 3 69 182 0.15 0.25 1205408 20 3 34 151 0.36 0.25 organ weight
[0329] At the end of the study, the weights of the liver, heart, spleen, and kidneys were measured and are presented in the table below. [surface]
[12] Organ weight (g) [Compound Number] [liver] [(g)] [kidney] [(g)] [spleen] [(g)] brine 13.7 3.4 0.8 1205407 15.2 3.6 1.2 1205408 18.3 4.0 1.2 Kidney function
[0330] To assess the effects of Ionis-modified oligonucleotides on renal function, urinary total protein and creatinine levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The total protein to creatinine ratio (P / C ratio) is presented in the table below. [] [surface]
[13] Total protein to creatinine ratio in Sprague-Dawley rats [Compound Number] [P / C] [Compare] brine 1.1 1205407 2.1 1205408 0.7 Study 2 treat
[0331] Male Sprague-Dawley rats were kept under a 12-hour light / dark cycle and fed a Purina normal rat diet. Four Sprague-Dawley rats in each group were subcutaneously injected weekly with 15 mg / kg Ionis oligonucleotides for 6 weeks (a total of 6 doses). The rats were euthanized 72 hours after the last dose; organs, urine, and plasma were harvested for further analysis. plasma chemical markers
[0332] To assess the effects of Ionis oligonucleotides on liver function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). ALT (alanine transaminase) and AST were also measured. The plasma levels of aspartate transaminase (IU / L) were measured and are presented in the table below. The plasma levels of total bilirubin (TBIL), creatinine, albumin, and blood urea nitrogen (BUN) were also measured using the same clinical chemistry analyzer, and the results are also presented in the table below. [surface]
[14] Plasma chemical markers in Sprague-Dawley rats [Compound Number] [BUN (mg / dL)] [albumin] [(g / dL)] [ALT (IU / L)] [AST (IU / L)] [TBIL (mg / dL)] [CREA (mg / dL)] brine 16 3 28 112 0.11 0.27 1250837 18 4 32 129 0.14 0.23 1250851 18 3 119 641 0.41 0.25 organ weight
[0333] At the end of the study, the weights of the liver, heart, spleen, and kidneys were measured and are presented in the table below. [surface]
[15] Organ weight (g) [Compound Number] [liver] [(g)] [kidney] [(g)] [spleen] [(g)] brine 12.242 3.388 1.051 1250837 13.771 3.580 1.184 1250851 14.850 3.756 1.166 Kidney function
[0334] To assess the effects of Ionis-modified oligonucleotides on renal function, urinary total protein and creatinine levels were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The total protein to creatinine ratio (P / C ratio) is presented in the table below. [] [surface]
[16] Total protein to creatinine ratio in Sprague-Dawley rats [Compound Number] [P / C] [Compare] brine 0.9 1250837 1.1 1250851 0.8 [Example] [5] [With Humanity] [AGT] [Activity of complementary modified oligonucleotides in gene-transfected mice] []
[0335] Dr. Curt Sigmund's laboratory developed a transgenic AGT mouse model by inserting a 14 kb gene transgenic construct containing the entire human angiotensinogen gene (approximately 11.5 kb) and 5' (1.2 kb) and 3' (1.4 kb) side sequences (Yang G et al., 1994. J Biol Chem 269(51):32497-502), and used this model to further test the modified oligonucleotides described above. treat []
[0336] AGT gene-transfected mice were divided into two groups of two. Each mouse was subcutaneously injected weekly with 2.7 mg / kg of the modified oligonucleotide (days 0 and 7, for a total of two doses). Two mice in one group received saline as a negative control. Another group of two mice received 3.3 mg / kg of the comparative modified oligonucleotide 757456 (days 0 and 7, for a total of two doses). Three days after the last dose (day 10), the mice were sacrificed. Liver and plasma were collected for analysis. RNA and protein analysis
[0337] RNA was extracted from liver tissue for real-time PCR analysis, and the amount of AGT RNA was measured using the human primer probe set RTS3721 (described above). Results are presented as the percentage inhibition of AGT RNA relative to the saline control, normalized to the total RNA content as measured by RIBOGREEN®. Additionally, plasma was extracted, and the level of human AGT protein in the plasma was measured using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, catalog number 27412). Results are presented as the percentage inhibition of AGT protein relative to the saline control. [] [surface]
[17] Reduction of human AGT RNA and protein in genetically modified mice [Compound Number] [dose] [(mg / kg)] [Inhibition in the liver] [% (AGT RNA)] [Inhibition in plasma] [% (AGT)] [protein] [)] 757456 3.3 65 60 1231463 2.7 93 87 1176644 2.7 90 91 1176648 2.7 93 90 1176653 2.7 96 93 1205407 2.7 93 90 1205408 2.7 94 91 1205410 2.7 96 92 1250842 2.7 88 65 1251204 2.7 44 47 [Example] [6] [With Humanity] [AGT RNA] [Efficacy of complementary modified oligonucleotides in gene-transfected mice, multiple doses] []
[0338] In the gene-transgenic mouse model described above, the modified oligonucleotides were further tested in a dose-dependent manner. [] treat
[0339] AGT gene-transfected mice were divided into groups of two. Each mouse was subcutaneously injected with two doses (on day 0 and day 7) of the modified oligonucleotide at the concentrations indicated in the table below. Four mice in one group received PBS as a negative control. Mice were euthanized 72 hours after the last dose (day 10). Liver and plasma were collected for analysis. Compound 757456 was added as a comparative compound in some studies. Study 1 RNA and protein analysis
[0340] RNA was extracted from liver tissue for real-time PCR analysis, and the amount of AGT RNA was measured using the human primer probe set RTS3721 (described above). Results are presented as the percentage inhibition of AGT RNA relative to the saline control, normalized to the total RNA content as measured by RIBOGREEN®. Additionally, plasma was extracted, and the level of human AGT protein in the plasma was measured using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, catalog number 27412). Results are presented as the percentage inhibition of AGT protein relative to the saline control. [] [surface]
[18] Reduction of human AGT RNA and protein in genetically modified mice (%) [Compound Number] [dose] [(mg / kg)] [Inhibition in the liver] [% (AGT RNA)] [ED, 50 , (mg / kg) [Inhibition in plasma] [% (AGT)] [protein] [)] 757456 4.5 81 1.3 81 1.5 41 49 0.5 39 31 1205407 4.5 97 0.1 97 1.5 95 94 0.5 75 79 1205408 4.5 97 0.2 95 1.5 91 90 0.5 75 74 1205410 4.5 98 0.1 98 1.5 97 96 0.5 83 85 1231463 4.5 97 0.3 94 1.5 90 87 0.5 70 65 1250835 4.5 88 0.2 91 1.5 86 84 0.5 72 73 1250836 4.5 95 0.1 96 1.5 93 93 0.5 82 77 1250837 4.5 96 0.2 94 1.5 89 88 0.5 62 69 1250840 4.5 96 0.3 95 1.5 81 85 0.5 47 64 1250850 4.5 91 0.2 93 1.5 78 84 0.5 74 78 1250851 4.5 96 0.1 96 1.5 94 95 0.5 77 81 1251199 4.5 92 0.2 91 1.5 84 83 0.5 69 69 1251213 4.5 91 0.2 93 1.5 84 86 0.5 74 75 1251216 4.5 90 0.3 91 1.5 79 80 0.5 46 68 1251228 4.5 94 0.2 95 1.5 83 88 0.5 58 67 1299247 4.5 99 0.1 98 1.5 98 97 0.5 83 84 1299248 4.5 89 0.3 91 1.5 74 84 0.5 49 61 Study 2 RNA and protein analysis
[0341] RNA was extracted from liver tissue for real-time PCR analysis, and the amount of AGT RNA was measured using the human primer probe set RTS3721 (described above). Results are presented as the percentage inhibition of AGT RNA relative to the saline control, normalized to the total RNA content as measured by RIBOGREEN®. Additionally, plasma was extracted, and the level of human AGT protein in the plasma was measured using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, catalog number 27412). Results are presented as the percentage inhibition of AGT protein relative to the saline control. [surface]
[19] Reduction of human AGT RNA and protein in genetically modified mice [Compound Number] [dose] [(mg / kg)] [Inhibition in the liver] [% (AGT RNA)] [ED50 (mg / kg)] [Inhibition in plasma] [% (AGT)] [protein] [)] 1205407 5.0 98 0.14 96 1.7 93 90 0.6 85 80 0.2 56 37 0.1 30 29 1205408 5.0 98 0.27 95 1.7 93 88 0.6 73 76 0.2 37 twenty three 0.1 9 0 1250837 5.0 85 0.53 83 1.7 84 84 0.6 57 64 0.2 26 40 0.1 0 46 1250851 5.0 94 0.23 95 1.7 89 91 0.6 76 76 0.2 32 49 0.1 32 37 Study 3 RNA and protein analysis
[0342] RNA was extracted from liver tissue for point-of-care PCR analysis, and the amount of AGT RNA was measured using the human primer probe set RTS3721 (described above). Results are presented as the percentage of AGT RNA inhibition relative to the saline control, normalized to the total RNA content as measured by RIBOGREEN®. Additionally, plasma was extracted, and the level of human AGT protein in the plasma was measured using an ELISA kit (Human Total Angiotensinogen Assay Kit, IBL, catalog number 27412). Results are presented as the percentage of AGT protein inhibition relative to the saline control. As used herein, a value of '0' indicates that treatment with modified oligonucleotides did not inhibit AGT levels. [surface]
[20] Reduction of human AGT RNA and protein in genetically modified mice [Compound Number] [dose] [(mg / kg)] [Inhibition in the liver] [% (AGT RNA)] [ED50 (mg / kg)] [ED75 (mg / kg)] [Inhibition in plasma] [% (AGT)] [protein] [)] 757456 10 88 2.1 2.68 88 3.3 74 72 0.1 0 0 0.04 0 0 1205407 1.5 86 0.11 0.38 87 0.5 68 62 0.17 38 29 0.06 35 11 1176644 1.5 76 0.38 0.61 71 0.5 62 51 0.17 0 5 0.06 0 0 1250837 1.5 74 0.22 0.67 67 0.5 60 52 0.17 38 28 0.06 0 0 1176649 1.5 83 0.20 0.59 82 0.5 50 56 0.17 17 17 0.06 0 0 [Example] [7] [Gene-transplanted human liver cells from mice] [AGT] [Dose-dependent in vitro inhibition] []
[0343] This study used the gene-transfected AGT mouse model described above. In primary mouse hepatocytes extracted from these gene-transfected mice, the inhibitory effect of the modified oligonucleotides described in the above study on AGT RNA at various doses was tested.
[0344] Primary mouse gene-transfected hepatocytes were seeded at a density of 20,000 cells / well and treated with modified oligonucleotides diluted to different concentrations as specified in the tables below via free uptake. After overnight culture, AGT RNA levels were measured using the human AGT primer-probe set RTS3721 (forward sequence CCCTGATGGGAGCCAGTGT, designated as SEQ ID NO: 3; reverse sequence AGCAGGGAGAAGCCCTTCA, designated as SEQ ID NO: 4; probe sequence CCCTGGCTTTCAACACCTACGTCCACT, designated as SEQ ID NO: 5). In addition, human AGT RNA levels were measured using the second human AGT primer probe set RTS4039 (forward sequence GGACAAGGTGGAGGGTCTCA, designated as SEQ ID NO: 6 in this document; reverse sequence AGATCCTTGCAGCACCAGTTG, designated as SEQ ID NO: 7 in this document; probe sequence ATGAAGAAACTATCTCCCCGGACCATCCA, designated as SEQ ID NO: 8 in this document) to confirm the data. AGT RNA levels were normalized to the total RNA content measured by RIBOGREEN®. The results are presented in the following tables as the percentage of AGT inhibition relative to untreated control cells. As used herein, a value of '0' indicates that treatment with the modified oligonucleotide did not inhibit AGT mRNA levels. The half-maximum inhibitory concentration (IC50) for each modified oligonucleotide is also presented. IC50 (Prism) was calculated using nonlinear regression with a 4-parameter variable slope method of log(inhibitor) versus response, with the base and top values fixed at 0 and 100, respectively. [surface] [twenty one] Multiple-dose analysis of modified oligonucleotides in primary mouse hepatocytes [Compound Number] [Inhibition % (RTS3721)] [IC, 50 , (µM) ] [0.61 nM] [2.44 nM] [9.77 nM] [39.06 nM] [156.25 nM] [625 nM] [2500 nM] [10000 nM] 757456 0 0 0 0 39 52 32 20 868 1205407 36 19 51 74 86 94 88 77 8 1176644 0 8 25 51 79 88 86 88 35 1176649 0 0 25 33 60 74 72 53 95 1250837 0 0 12 27 61 67 72 73 145 [surface] [twenty two] Multiple-dose analysis of modified oligonucleotides in primary mouse hepatocytes [Compound Number] [Inhibition % (RTS4039)] [IC, 50 , (µM) ] [0.61 nM] [2.44 nM] [9.77 nM] [39.06 nM] [156.25 nM] [625 nM] [2500 nM] [10000 nM] 757456 0 0 0 3 43 50 37 7 709 1205407 27 twenty one 44 69 84 89 87 83 12 1176644 0 16 16 48 74 85 82 82 43 1176649 0 0 13 35 55 74 73 65 116 1250837 2 0 14 28 57 66 70 67 169 [Example] [8] [:] [HepatoPac]® [Middle Humans] [AGT] [Dose-dependent in vitro inhibition] []
[0345] The HepatoPac® kit is a commercially available liver model system from BIOIVT, consisting of micropatterned hepatocyte "islands" co-cultured with supporting stromal cells. Prior to treatment, 96-well HepatoPac plates were equilibrated in fresh maintenance medium at 37°C and 10% CO2 for 48 hours. Modified oligonucleotides were diluted to the maintenance medium at the concentrations described in the table below and kept for 48 hours. After 48 hours, the medium was replaced with fresh maintenance medium without the additional oligonucleotides. Cell lysates were collected 96 hours after oligonucleotide addition and analyzed by RT-PCR using the primer probe set RTS3721 (described above). Results are presented in the tables below as the percentage of AGT inhibition relative to untreated control cells. As used herein, a value of '0' indicates that treatment with the modified oligonucleotides did not inhibit AGT mRNA levels. The IC50 was calculated using a variable-slope 4-parameter logistic regression in Prism, with the base and peak values set to 5 and 100, respectively. [surface] [twenty three] Multiple-dose analysis of modified oligonucleotides in Hepatopac® cells [Compound Number] [inhibition] [%] [IC, 50 , (µM) ] [6.4 nM] [32 nM] [160 nM] [800 nM] [4000 nM] [20000 nM] 757456 31 31 twenty one 16 29 16 >20 1250850 0 3 18 61 78 86 0.85 1205407 27 52 70 84 93 92 0.04 1205410 9 46 63 89 95 99 0.06 [Example] [9] [Targeting Humans] [AGT] [Effects of modified oligonucleotides in cynomolgus monkeys] []
[0346] The modified oligonucleotides selected from the study illustrated in the examples above were used to treat cynomolgus monkeys. treat
[0347] Prior to the study, the monkeys were isolated and then placed under acclimatization, during which their general health was observed daily. The monkeys were 2–4 years old and weighed 2–4 kg. Nine groups of four randomly assigned male cynomolgus monkeys each received subcutaneous injections of Ionis oligonucleotides or saline solution at four different sites on their backs in a clockwise rotation. Following loading doses on days 1, 4, and 8, the monkeys were administered 20 mg / kg of Ionis oligonucleotides weekly (on days 15, 22, 29, 36, 43, 50, 57, 64, 71, 78, and 85). Four cynomolgus monkeys served as a control group, receiving 0.9% saline solution in a similar manner.
[0348] During the study, monkeys were observed at least daily for signs of illness or distress. Any animal showing severe weakness or signs of toxicity, especially if it appeared to be near death, was euthanized as soon as possible for humanitarian reasons, after consultation with the attending veterinarian. Euthanasia was performed on day 87, approximately 48 hours after the last dose, by bloodletting under deep anesthesia. The protocol described in this example has been approved by the Institutional Animal Care and Use Committee (IACUC). Body weight and organ weight measurement
[0349] To assess the effects of Ionis oligonucleotides on the overall health of animals, body weight and organ weight were measured. Final body weight was measured before necropsy. Organ weight was also measured, and all weight measurements are presented in the table below. [surface] [twenty four] Body weight and organ weight (g) [Compound Number] [Final weight] [Liver and Gallbladder] [kidney] [spleen] brine 2967 60 13 3 1205407 2956 96 15 5 1205408 2971 72 13 3 1205410 2868 101 14 4 1231463 2923 69 13 5 1250835 2949 93 16 6 1250836 2973 71 14 6 1250837 2712 63 15 3 1250850 3044 97 17 5 1250851 2806 63 15 3 Kidney and liver function
[0350] To assess the effects of Ionis oligonucleotides on liver and kidney function, blood samples were collected from all study groups on day 87. Monkeys were fasted overnight before blood collection. Blood was collected in tubes without anticoagulants for serum separation. The tubes were kept at room temperature for at least 90 minutes and then centrifuged at 3000 rpm for 10 minutes to obtain serum. The levels of various liver function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Plasma levels of blood urea nitrogen (BUN), creatinine (CREA), total protein (TP), albumin (ALB), globulin (GLO), albumin / globulin (A / G) ratio, alanine transaminase (ALT), aspartate transaminase (AST), and total bilirubin (TBIL) were measured, and the results are presented in the table below. [surface]
[25] liver function markers in cynomolgus monkey plasma [Compound Number] [BUN (mg / dL)] [CREA (mg / dL)] [TP (g / dL)] [ALB (g / dL)] [GLO (g / dL)] [A / G] [Compare] [ALT (IU / L)] [AST (IU / L)] [TBIL (mg / dL)] brine 28 0.8 6.9 4.1 2.8 1.5 50 57 0.25 1205407 23 0.8 6.9 4.0 2.9 1.4 67 55 0.20 1205408 26 0.8 6.7 4.0 2.7 1.5 53 50 0.27 1205410 21 0.9 6.9 3.9 3.0 1.3 145 72 0.26 1231463 22 0.8 7.3 4.0 3.4 1.2 112 75 0.26 1250835 19 0.9 7.4 3.8 3.6 1.1 129 82 0.25 1250836 23 1.1 7.7 3.9 3.8 1.1 150 95 0.34 1250837 twenty one 0.8 6.9 4.2 2.7 1.6 91 68 0.28 1250850 twenty one 0.8 7.4 4.0 3.4 1.2 85 86 0.25 1250851 20 0.8 6.8 4.1 2.7 1.6 63 64 0.27 Analysis of pro-inflammatory proteins
[0351] To evaluate any inflammatory effects of the modified Ionis oligonucleotide in cynomolgus monkeys, blood samples were collected for analysis. Monkeys were fasted overnight before blood collection. On day 85 (before administration and 24 hours after administration), approximately 0.8 mL of blood was collected from each animal and placed in anticoagulant-free tubes for serum separation. The tubes were kept at room temperature for at least 90 min, followed by centrifugation at 3,000 rpm for 10 min at room temperature to obtain serum. Complement C3 was measured using a Toshiba 120 FR NEO chemimeter (Toshiba Co., Japan). Another inflammatory marker, C-reactive protein (CRP), was measured along with the clinical chemical parameters for liver function described above. [surface]
[26] Analysis of inflammatory proteins in cynomolgus monkeys [Compound Number] [Complement] [C3 (mg / dL)] [CRP (mg / L)] [No.]
[85] [sky] [(] [Before medication administration] [)] [No.]
[86] [sky] [(] [After medication] [twenty four] [Hour] [)] [No.]
[87] [sky] brine 110 110 2 1205407 94 91 10 1205408 93 93 4 1205410 117 111 14 1231463 92 102 6 1250835 84 75 15 1250836 78 82 9 1250837 82 87 1 1250850 86 83 12 1250851 86 92 3 hematology
[0352] To assess any effects of the modified Ionis oligonucleotide on hematological parameters in cynomolgus monkeys, blood samples of approximately 0.5 mL were collected from each available study animal on day 87. Samples were collected in tubes containing K2-EDTA. Red blood cell (RBC) count, hemoglobin (HGB), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), platelet count (PLT), white blood cell (WBC) count, and individual white blood cell counts (such as monocytes (MON), neutrophils (NEU), and lymphocytes (LYM)) were analyzed using an ADVIA 2120i hematology analyzer (Siemens, USA). [surface]
[27] Blood cell count of cynomolgus monkeys [Compound Number] [WBC (^3 / µL)] [RBC (^6 / µL)] [HGB (g / dL)] [HCT (%)] [MCV (fL)] [MCH (pg)] [MCHC (g / dL)] [NEU (%)] [LYM (%)] [MON (%)] [PLT (^3 / µL)] brine 13 6 14 45 78 twenty four 30 39 55 4 403 1205407 11 6 13 43 77 twenty three 30 40 56 3 377 1205408 12 6 13 44 78 twenty three 30 43 51 3 375 1205410 8 6 13 45 81 twenty four 30 32 63 2 312 1231463 10 6 13 45 78 24 30 28 66 3 338 1250835 10 6 14 47 79 24 30 28 65 4 370 1250836 12 6 14 45 75 23 31 29 66 3 354 1250837 7 6 13 43 77 24 31 37 59 3 288 1250850 8 5 13 42 78 23 30 29 66 3 376 1250851 9 6 14 45 77 twenty four 31 45 51 2 356 Urine analysis
[0353] The day before fresh urine collection, food was removed and left overnight, but water was provided. On day 87, fresh urine samples (first morning urine) were collected from all animals using clean cage trays on wet ice for urinalysis and urinalysis chemistry. Urinalysis / urinalysis chemistry parameters included creatinine (UCRE), protein / creatinine (P / C) ratio, urinary microalbumin (UTP), and urinary microalbumin (UALB), which were measured using a Toshiba 120FR automated chemical analyzer (Toshiba Co., Japan). [surface]
[28] Urine analysis and urinary chemical markers of cynomolgus monkeys [Compound Number] [UTP (mg / dL)] [UALB (mg / dL)] [P / C] [Compare] [UCRE (mg / dL)] brine 7 0.57 0.15 55 1205407 7 0.29 0.19 37 1205408 7 0.47 0.14 52 1205410 7 0.34 0.19 52 1231463 7 0.37 0.13 63 1250835 12 0.58 0.14 95 1250836 10 0.54 0.11 114 1250837 7 0.41 0.16 49 1250850 7 0.55 0.08 105 1250851 9 0.74 0.07 140
[0354] <![CDATA[ <110> Ionis Pharmaceuticals, Inc. (USA) <![CDATA[ <120> Compounds and methods for regulating angiotensinogen expression]]> <![CDATA[ <130> BIOL0393TW]]> <![CDATA[<150> 63 / 232,109]]> <![CDATA[<151> 2021-08-11]]> <![CDATA[<150> 63 / 115,499]]> <![CDATA[<151> 2020-11-18]]> <![CDATA[<160> 28 ]]> <![CDATA[<170> PatentIn version 3.5]]> <![CDATA[<210> 1]]> <![CDATA[<211> 2587]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Homo sapiens]]> <![CDATA[<400> 1]]> atcccatgag cgggcagcag ggtcagaagt ggcccccgtg ttgcctaagc aagactctcc 60 cctgccctct gccctctgca cctccggcct gcatgtccct gtggcctctt gggggtacat 120 ctcccggggc tgggtcagaa ggcctgggtg gttggcctca ggctgtcaca cacctaggga 180 gatgctcccg tttctgggaa ccttggcccc gactcctgca aacttcggta aatgtgtaac 240 tcgaccctgc accggctcac tctgttcagc agtgaaactc tgcatcgatc actaagactt 300 cctggaagag gtcccagcgt gagtgtcgct tctggcatct gtccttctgg ccagcctgtg 360 gtctggccaa gtgatgtaac cctcctctcc agcctgtgca caggcagcct gggaacagct 420 ccatccccac ccctcagcta taaatagggc atcgtgaccc ggccggggga agaagctgcc 480 gttgttctgg gtactacagc agaagggtat gcggaagcga gcaccccagt ctgagatggc 540 tcctgccggt gtgagcctga gggccaccat cctctgcctc ctggcctggg ctggcctggc 600 tgcaggtgac cgggtgtaca tacacccctt ccacctcgtc atccacaatg agagtacctg 660 tgagcagctg gcaaaggcca atgccgggaa gcccaaagac cccaccttca tacctgctcc 720 aattcaggcc aagacatccc ctgtggatga aaaggcccta caggaccagc tggtgctagt 780 cgctgcaaaa cttgacaccg aagacaagtt gagggccgca atggtcggga tgctggccaa 840 cttcttgggc ttccgtatat atggcatgca cagtgagcta tggggcgtgg tccatggggc 900 caccgtcctc tccccaacgg ctgtctttgg caccctggcc tctctctatc tgggagcctt 960 ggaccacaca gctgacaggc tacaggcaat cctgggtgtt ccttggaagg acaagaactg 1020 cacctcccgg ctggatgcgc acaaggtcct gtctgccctg caggctgtac agggcctgct 1080 agtggcccag ggcagggctg atagccaggc ccagctgctg ctgtccacgg tggtgggcgt 1140 gttcacagcc ccaggcctgc acctgaagca gccgtttgtg cagggcctgg ctctctatac 1200 ccctgtggtc ctcccacgct ctctggactt cacagaactg gatgttgctg ctgagaagat 1260 tgacaggttc atgcaggctg tgacaggatg gaagactggc tgctccctga tgggagccag 1320 tgtggacagc accctggctt tcaacaccta cgtccacttc caagggaaga tgaagggctt 1380 ctccctgctg gccgagcccc aggagttctg ggtggacaac agcacctcag tgtctgttcc 1440 catgctctct ggcatgggca ccttccagca ctggagtgac atccaggaca acttctcggt 1500 gactcaagtg cccttcactg agagcgcctg cctgctgctg atccagcctc actatgcctc 1560 tgacctggac aaggtggagg gtctcacttt ccagcaaaac tccctcaact ggatgaagaa 1620 actatctccc cggaccatcc acctgaccat gccccaactg gtgctgcaag gatcttatga 1680 cctgcaggac ctgctcgccc aggctgagct gcccgccatt ctgcacaccg agctgaacct 1740 gcaaaaattg agcaatgacc gcatcagggt gggggaggtg ctgaacagca ttttttttga 1800 gcttgaagcg gatgagagag agcccacaga gtctacccaa cagcttaaca agcctgaggt 1860 cttggaggtg accctgaacc gcccattcct gtttgctgtg tatgatcaaa gcgccactgc 1920 cctgcacttc ctgggccgcg tggccaaccc gctgagcaca gcatgaggcc agggccccag 1980 aacacagtgc ctggcaaggc ctctgcccct ggcctttgag gcaaaggcca gcagcagata 2040 acaaccccgg acaaatcagc gatgtgtcac ccccagtctc ccaccttttc ttctaatgag 2100 tcgactttga gctggaaagc agccgtttct cttggtcta agtgtgctgc atggagtgag 2160 cagtagaagc ctgcagcggc acaaatgcac ctcccagttt gctgggttta ttttagagaa 2220 tgggggtggg gaggcaagaa ccagtgttta gcgcgggact actgttccaa aaagaattcc 2280 aaccgaccag cttgtttgtg aaaaaaaaa gtgttccctt ttcaagttga gaaaaaaat 2340 tgggttttaa attaaagta tacatttttg cattgccttc ggtttgtatt tagtgtcttg 2400 aatgtaagaa catgacctcc gtgtagtgtc tgtaatacct tagttttttc cacagatgct 2460 tgtgattttt gaacaatacg tgaaagatgc aagcacctga atttctgttt gaatgcggaa 2520 ccatagctgg ttatttctcc cttgtgttag taataaacgt cttgccacaa taagcctcca 2580 aaaaaaa 2587 <![CDATA[<210> 2]]> <![CDATA[<211> 18000]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Homo sapiens]]> <![CDATA[<400> 2]]> cagagcaaga ccccaactct aaaacaacac acaaaaatac agccatttct cctgggtgaa 60 atgggggagc tcagactatt ttgttttatt tgtcaggagt ctaaagccca tgtgagccaa 120 cttaagaaaa ttctgtttgt atttgagtgt tctttattgg aaagaaatgg acttttccct 180 aatgagccca ttttacaaat cgagagctcc aaatgcccgg ttccagcccc catgatatag 240 atgggcagca atgaggacca gaatgctgg gaagtgtcct tgtcatgcaa ggaaacttg 300 gaacttcaag gatccatcat gggatgcagg acagtaggct ccacccctct tcctgctttc 360 foot tgttcagggc tcacatgcct cttccaaggc atgatgtggg gttgcagttc 420 tgatcccagc agacaaag gctcctgtga aacaattagt tttggctcag aggcaaaaaa 480 tggaaacccc attcctgtat ttacccttca ttctttcctt acctcataca gctggttcca 540 ggtttgattg catcatatac ataaataat aatctgcttt cctggtttgg tttagttttg 600 ctggagagag gagtttatgt gttcatccca tgactagctg ggtggtcaag agattggaaa 660 gtaggagttc tagtttagac caagtctcat ctcagaaacc agagagtaga actgatccca 720 aacgtcatca tccctgtagg gaaaagaaag agagatcaga ctgttactgt gtctatatag 780 aaagggaaga cataagagac tccattttga aaaagagcta tactttaaac aattgctttg 840 ctgagatgtt gttaatttgt agctttgccc cagccacttt gacccaacct ggagctcaca 900 aaaacatgtg ttgtataaaa tcaaggttta agggatctag ggctgtgtca aagtggctgg 960 ggcaaagcta caaattaaca acatctcagc aaagcaattg tttaaagtac agctcttttt 1020 caaaatggag tctcttatgt cttccctttc tatatagaca cagtaacagt ctgatctctc 1080 ttttttttcc ctacatatcc caatagcacc tgcctgacta atacatcatg ctctgctgac 1140 tccatatgtg gctggtttcc tggatccgat tctgactgat ggtatctgtt ctcacgctgc 1200 taataagac ataccagaga ctgggtaatt tataaagaaa aagaggttta atggacttat 1260 gtgttccacg tggctggggga ggcctcacaa tcatggtgga aggtgaagga ggagcaaaag 1320 cacatctttac atggtggctg gcaaaagaga gaagcatgt tcagggggaac tcccctttat 1380 1440 ccctcatgat tcaattacct cccactgggt ccctcccatg acacatggga attatgggag 1500 ctacaattgg agatttgggt ggggacacag ccaaaccata tcagatggct tatttggttt 1560 ctatgtagaa cctctgcttt tcattcaaca gtcttcattt agccacagat aagctctgtc 1620 cctaacttcc actgatggaa tgtacacata agaaacttcc actgatggaa tgaacacaga 1680 aggtgcctac tgggaagaaa actggcctga atctgagctg ggtcaaatgt ctgcagtcag 1740 tttgaatggc tgctccttat gggaataatt tacattctca ataaaattct ctagcaattt 1800 tctgattgat tttaatgagc tttaaagcct tacgtagaag atcccccagc tgatagtcag 1860 ccttgggcat ggattaaggg cttttaacca atcttgcaac aagtttaagc agatattctt 1920 tattgggtcc aatctaacca aaattatttt cttatgttct ccccagtaac gtgtcattat 1980 taagagaagt ttggcttgct tagaggccaa atttagaggg tcctgaaatt ttattttctt 2040 ttacaccact ttccagcatg ttacctgatc agttgtttat tatctttgct gttgaatgga 2100 gtgatcattc caagggcccg aggcaggagg cccaggcaca gtggaaactc tcccaaagac 2160 caggatcttt gttttgttcc ctgacatatg ctgagcacca ggaatagtga gtgaatgaaa 2220 caaattgtga ggctttaaag agccgaaata tttaaacact gggcacaagg ttgttgctta 2280 atcagtgcta gatccttacc tcccccttgt gtccaggtgg acttgttact gcagttaaac 2340 cacttgctga tcctcaaaca actagttagt ggcacagcca ggcctaggac cccagtctct 2400 actgttccaa ctaacccatt cgcaggcagg agcactttga atggtctctt atttaaaaa 2460 attaaatta aaattgtcta tttatttaga gacagagtct tactctgtag cccaggctcg 2520 agtgcagtgg tgcaatcata gctcactgta acctccatct cctggcctca aaaagtgttt 2580 gaattacaga tgcgaggcac tgtacctggc ccgaatgttc tgttcagaca aagccacctc 2640 taagtcgctg tggggcccca gandaagtgat ttttgaggag tcccttacta taggaacaa 2700 gtaattaaaaaatgtattt cagaatttac aggcccatgt gagatatgat ttttttaat 2760 gagatttag agtaatgggt aaaaagagg tattgtgtg ttgttgatt gttcagtcag 2820 tgaatgtaca gcttctgcct catatccagg caccatctct tcctgctt tgttgttaaa 2880 tgttccattc ctgggtaatt tcatgtctgc catcgtggat atgccgtgc tccttgacc 2940 tgcttgtgtt gaagcaggat ctccttcct gtccttcag tgcctaata ccatgtattt 3000 aaggctggac acatcaccac 3060 gcttctggcg actctcacca aggtctctgt catgccctgt tataatgact aaaagcaa 3120 gtcttaccta taggaaaaata agaattataa cccttttact ggtcatgtga aacttaccat 3180 ttgcaatttg tacagcataa acacagaaca gcacatcttt caatgcctgc atcctgaagg 3240 cattttgttt gtgtctttca atctggctgt gctattgttg gtgtttaaca gtctccccag 3300 ctacactgga aacttccaga aggcactttt cacttgcttg tgtgttttcc ccagtgtcta 3360 ttagaggcct ttgcacaggg taggctcttt ggagcagctg aaggtcacac atcccatgag 3420 cgggcagcag ggtcagaagt ggccccccgtg ttgcctaagc aagactctcc cctgccctct 3480 gccctctgca cctccggcct gcatgtccct gtggcctctt gggggtacat ctcccggggc 3540 tgggtcagaa ggcctgggtg gttggcctca ggctgtcaca cacctaggga gatgctccccg 3600 tttctgggaa ccttggcccc gactcctgca aacttcggta aatgtgtaac tcgaccctgc 3660 accggctcac tctgttcagc agtgaaactc tgcatcgatc actaagactt cctggaagag 3720 gtcccagcgt gagtgtcgct tctggcatct gtccttctgg ccagcctgtg gtctggccaa 3780 gtgatgtaac cctcctctcc agcctgtgca caggcagcct gggaacagct ccatccccac 3840 ccctcagcta taaatagggc atcgtgaccc ggccggggga agaagctgcc gttgttctgg 3900 gtactacagc agaaggtaag ccgggggccc cctcagctcc ttctcggtct tgtctctctc 3960 agatgtaact gagctgtggg ctaggaggaa aaggccggga ggaggcacgg tgatgactga 4020 aaaacctctc ccctctcata agaccagtca tccggacgcg ggctttcccc cactcggtgc 4080 ccacctgggg tcttacagga ggagctgctc ctcctcagca ataggacaag atggtcaggt 4140 cttcctgctt ccgctgagaa aagttagggt cctcaggaac ggagcagact ggtacaggaa 4200 cagagtcatc atggccaaga gtccaccggg tcctcttgcc atcaggagga atagcagggc 4260 ttgtgcagga attggggctg gagggaaggg ccgggctcgg tcagtctcca gctgggatcc 4320 ccagagtggt caccctaccc ctccctcgag acagactgcc tgactgtgtg tcatcaggct 4380 ggtcaccatc tccctgaacc tcgatttgct cacctataaa atggaactaa taacgatgcc 4440 tgggctccct gtctcagggg ctctggtata gctgaagaga actaatataa catgaaagtg 4500 ctttctaagc tttgggataa gctaaaaggc agattccaat tttattcgag ggcagcgtag 4560 attggtgctt cagctcgtgg atgacagagt cagggggcct ggttctgagt cctagttctg 4620 tctcttccca gctgtgtgac gttgaacaag tcactggacc tctctgttcc tctgcaaaac agcatgaacc aattcattaa ctacttctcc agcatgcagt aggtcccagg gactatccta ggaatgtggg ctgtattagt aaacacaaca gcgggaaccc tgttccgggg ctcacattca catcagagca aacagacaaa gacgctggac aagaatagtg cataactaca tggtacagag ggttataagg agggaaaagg ggagctggat gagagagttg agagtgcccg gtgtggtggg 4920. gaaagctgca gggtgaaata ctgcatcagg gaaacctcag ggaaggtgag gactatggtg aggtcagagg ggttgatatg agaacagtgc cctgcaaatg gcaggcacca caggagcatg agccgtcatc ttcaccttta gcattcagcc cgggagaagt agggagacat agaaggggca 5100 ggtgctggcc aagaggcagg ggcaggagag gagaaggcgg aggggcactc agggcgaggg 5160 tgtcaggccc gccaccccag agcaccatta ctcccaggac gcggctgcgt gcagacctgg 5220 aaccagccta gggagcagcc gcagatcaca actgagaaca aacgacagtc tctgcctcaa 5280 5340 gggctgcatc gaccagcgcc atccaaaccc cgaacagttg gcgcttgtca ggcaggactt 5400 cccagcagtc ggttcccaca ggtttcccct gttgacctga tttgatgtga ctgtctagat 5460 taggtgtgaa ctggtggctt aggcttctct gcacagaaag gcctgcaagc agcagagaga 5520 gttttctgtt ccatttttcc atgtcatgtg gctcttcctg agaacagcgg atggagtcaa 5580 atgcatgggg agtggggtga gatggtagct gaggtcagaa tttggcattt gaatgactga 5640 agcagaacaa aacacaccag gtacttcagc agctgcaccg tgttgagggc aggtgctggt 5700 tacgggtctg ggtgagggaa gccagctgcc aatgtaagaa gaatgactgg gtatgcttag 5760 atgaagcaga aaaatctagg catcaaggtg gccttgagtc agtgatgaca cgctacagct 5820 ccaaggaagc ctggcctagc cctgggggga cagaaaaggc caagaagtga cgatattgca 5880 gtacaccccc ctccacaaga aatgagtgag atgtggtaca aaatgttaga attgaatgaa 5940 tcaatagaat aaacgttcat cccttcaatc aagaagagtc agatgaaatg aattagcagg 6000 gccagcccaa gaacctcttc tgggggtctc agggtagctt tcatttgtag cagctgaggc 6060 tgaagcccag ctgcaaggcc tttgagagaa cgtggtgctg gacccgtgtc tagggcaggg 6120 gttctaaacc ctgcttacat atcagagtca cctgagaatt ttctattttt tttttttttt 6180 ttttatacgt ggtcccagca cagactaagg aatccaacta tcattgggca agccatgcta 6240 ggtatgcatg cctttggggc tctgcagggg atagcgctat gcagggatgg ttgagagctg 6300 gttttggggt tgagacacgt gggaaatact tggactttgg gctgagcctg tggtgctcaa 6360 tcccggctgc atgttgggac cacagggaga tgacaaaacc atccccagcc ctcaccctag 6420 ggccctcgaa tgagcatctc aggggtctag gaggcctcca caaagaccta ctgattggca 6480 cacacttgtt tctctaggaa gagaacttac agctgcaggc aggagcatgt cttaatctgc 6540 ttgggctgcc ataagtacca cagactggga gggtttaaca acagaaatgt gttatctcac 6600 agttctggaa gctagaagcc tgggagccag ccatcagcag agttggtttc ctctgggtcc 6660 tctatccttg gcttgtagat ggccgtcttc tctctgtgtc cccacatggt cttccctctg 6720 tgtccccaca tggtcttccc tctgtgtgtg tccatgtcct catctcctct tctcataagg 6780 acacaggtca tattagatca gggctcaccc tcatggcctc attttaactt aatcatctct 6840 ttaaagatcc tgtctccaaa taatggtcac attctgaggt cctggggttg aggacttcaa 6900 cacgggcatt atggccgttg ggggaggtag gacataattc agctgatatt ggtgcatttt 6960 gcacttggat catgtagata ttttccatgg agctttgaat ccatttcttc ttttttttgt 7020 agacatgaat ggatttattc tgggctaaat ggtgacaggg aatattgaga caatgaaaga 7080 tctggttaga tggcacttaa aggtcagtta ataaccacct ttcacccttt gcaaaatgat 7140 atttcagggt atgcggaagc gagcacccca gtctgagatg gctcctgccg gtgtgagcct 7200 gagggccacc atcctctgcc tcctggcctg ggctggcctg gctgcaggtg accgggtgta 7260 catacacccc ttccacctcg tcatccacaa tgagagtacc tgtgagcagc tggcaaaggc 7320 caatgccggg aagcccaaag accccacctt catacctgct ccaattcagg ccaagacatc 7380 ccctgtggat gaaaaggccc tacaggacca gctggtgcta gtcgctgcaa aacttgacac 7440 cgaagacaag ttgagggccg caatggtcgg gatgctggcc aacttcttgg gcttccgtat 7500 atatggcatg cacagtgagc tatggggcgt ggtccatggg gccaccgtcc tctccccaac 7560 ggctgtcttt ggcaccctgg cctctctcta tctgggagcc ttggaccaca cagctgacag 7620 gctacaggca atcctgggtg ttccttggaa ggacaagaac tgcacctccc ggctggatgc 7680 gcacaaggtc ctgtctgccc tgcaggctgt acagggcctg ctagtggccc agggcagggc 7740 tgatagccag gcccagctgc tgctgtccac ggtggtgggc gtgttcacag ccccaggcct 7800 gcacctgaag cagccgtttg tgcagggcct ggctctctat acccctgtgg tcctcccacg 7860 ctctctggac ttcacagaac tggatgttgc tgctgagaag attgacaggt tcatgcaggc 7920 tgtgacagga tggaagactg gctgctccct gatgggagcc agtgtggaca gcaccctggc 7980 tttcaacacc tacgtccact tccaaggtaa ggcaaacctc tctgctggct ctggccctag 8040 gacttagtat ccaatgtgta gctgagatca gccagtcagg ccttggagat gggcaggggg 8100 cagccctgcg gacatacctg gtgaccaccc ttgagaagtg gggaagtggc tgctccgctg 8160 ggtccctgga tgggccgtcc acctcctgga cctgctgccc tactatgtgc acgactatac 8220 aacatcctt ttcttacatc atttaatccc cttatgatgt ggtgaagagg tatttgtgcc 8280 tttgtttacc agtgaagaaa tagagactcg gagaaacaaa gtgccttgct caagatggca 8340 cagccaccag tgggggtcct gggattgaaa cccacatctc ctggccccac agcccagttc 8400 tacactcaga agggtcaggt tcatatctct tgagaaggtc aggaactggg gtccctggcc 8460 catgcagaaa taagcaattg gcttgcttaa atccctttca tgttaggagg ggcattactg 8520 aaaaccctct actacaaaga ttgttgattt tttttttttt ttttattgag acagggtctt 8580 gttctgtcac ccaggctgca gtgtagtggt gccatcattg ctcactgtag ccttgaactc 8640 ctggcctcaa gcgatcctcc cacctctgcc ttccaaagtg ttgggattaa aggtgtgagc 8700 cactgcaccc agccacagat tgcttaaagc attcatttaa caaatacttg ttgaggattt 8760 gctacttgta agactttaag cctggcatct cagaggaggc cagaggaggg ctgtataggc 8820 cctgcctcca ggcttttaaa ggtcaatggg caaatgccta ggatttggag ctgcagggaa 8880 acgtgctcca caaggtaact cagggaagcc tcggggctct cagaggacag aggtcactgg 8940 ggagcggaga gcaggccttg cctggcagtg agggcaacag ggctggtgaa gctaggagca 9000 agcatgatga gcccagcctg cagagtttgg ggcaaggaac gaggatgggg cggttggctt 9060 ggcatgagtg ttgaaccaga aaatgggcct ggggagggca gagctggaga cactttgaac 9120 gccatgcttg gtaggtgtgg gaatggggac gcgttctgtt cagaggtcat cccggaagcc 9180 tgccgtgtgc agactggagg cagggaggat tgtttgaagg ttacgcaaga gtccaggcac 9240 acagtcacgg gaacacgtgc tcagggagca gctcggcaaa tccatgggtg gggtggggct 9300 gaggggtgtg tctaagagac actgaggagg ctctgtcaag atgttaacct cgtgagggac 9360 agagagccag gcgggaggtg aaagacaaga ctgtggagaa agaggttcag tggcgcatag 9420 tgatttttct taccacaaca acctccttga ggtctttccc ttcgggttca gggagaggtg 9480 atagatgggg ggattgctca gccctggcac tgactggtca caggggcaga ggccagcccg 9540 agggttgccc ggttgagggt ggcagcacac tgtgcagggc agagcaggga cacatggact 9600 tagcctgctg tccctaggag aagtgctggg aggagcgctc actgagaagg agggtcctgc 9660 agaaggcaaa ggcaagaaag ccagtggcat ctgaaatggg tctcccttcg aaagagagca 9720 catccacctg acccagaccg cagagccagg ccaggaggaa gaggaggaag aataaaaaag 9780 ccaaccacat cgggactcaa aggaagccca ggatcctcgc cggcctccac cgcatgctgc 9840 cctgaccctg ccccacttcc taactttgct ggcctcagtt tccgtcaaag gaggcagcca 9900 cttcctgcc acatggtctg tccagtgagg agatcgggg ctgtctcggg acccttaggt 9960 ttccctttag caatgatgtt ctatttacat gacctcagca ggcagctaga tgtgtcccac 10020 tagagaggac ctgaggatct ggggcctgat gggctccagg gtaccgtctg cccagtgctt 10080 gctgtgctcc tgagcatggg gcgctggccc tggtggtttc catgacacca ggtcctgact 10140 tgacctcgac agatttacct agcctccgga tgagaatggt gagctgtgca tgtcagacga 10200 gcagagggaa gacggcagcc actctcatgt caaatcccag cgtcttttgg gaggcagctt 10260 ccctttttta gtttaagtttg ttggaagaaa agaattgtcc ctttcccccc tctaaactaa 10320 aagccttgcc agcccaggtg ggcagcaccg aggtccctgc agggaacgtg cagggggaac 10380 cctgcagttt cccgctcaca tgcccttccg agactgagtg ctccgaggac tgaggacgag 10440 aaatatgcca ggtctgccac tgccttctta cgagacccgg acccaggga ggcacagcca 10500 tgcccagctc ctgcctgcca gttctgtcct cccagctgcc ctactttcat gctgggacct 10560 ccaattcagt acaaagggag acctcactgt ttctgaacca tctctactca gactcccaag 10620 tgccacgtgc ccaggggact gttctgtgac aaacttatac aaacttcac cctattctcc 10680 tagaacaac cgcagaatag gcctttcagg atgagtggga ggacagccga gggcagggat 10740 gtgctagtgt aaggtcgagg cagagggtgg gctgctgtca tggaaagacc ccaggtaact 10800 gcgtcacaca caaatttgtg tccttctccc acaacgggct ctcccgagtt ctctgtcatc 10860 tgcacggccc tgtgagcagg aggggaaaca gagggctcac ccctgccccc aaggcccagt 10920 gtgcaaatcc attcatcaca acgaggttgt gtgagtctcc ccagtagcaa gggctgctga 10980 ggaatggagc cctcgtttcc ggggcctgcg tggcccactc tgtattctat gactgtgatg 11040 ggggagggtg ggggccacag gacagctggt gggctctgcc atggctgggg ctagacatgg 11100 attaaaaagt gagtatgagc aggggcctct aggagtggtg ggatagtgcg gtggtggcca 11160 catgtcattc tacgtgcgtc caaacctaca gaatgtaaaa caccaggagg gagactcaaa 11220 gaaaactatc aactttgagt gctgaggacg tgtcagtgta ggttcgtcag ttgcaacaaa 11280 tgggccacgc tggtgtgaga tgttgatcac gggggaggct gtgtagtggg ggacaagagt 11340 tatatgggaa ctttctgtac tttctgctcg attttgctgt gaacctaaag tcactctaaa 11400 aaataacatc tcttaaattt tttaaaaagt gagtgtgtca aaccacagcc tttgggtcag 11460 gacagttcta ggtttgagtt gacctggcag gtaccagtgg cttatgtccc ttaaggtgac 11520 agatgcaaaa cccccggttt ggtgcctggc atgttgtgtg tcttgcaggt ggcggttagg 11580 gctgcctcag tgaactcaaa tggctgcatt ttacaggaga aatatttgag ccacacttgc 11640 ggtcctgtgg ccaggagaat gcagagtggc ctgggggggg ccaaggaagg aggctgaggc 11700 agggcgaggg gcaggatctg ggcctttggt gtctgccagc cctcattcct gcccctgtct 11760 tgggtgactc ttccctccct gtctcctgtc tggatttcag ggaagatgaa gggcttctcc 11820 ctgctggccg agccccagga gttctgggtg gaacagca cctcagtgtc tgttcccatg 11880 ctctctggca tgggcacctt ccagcactgg agtgacatcc aggacaactt ctcggtgact 11940 caagtgccct tcactgagag cgcctgcctg ctgctgatcc agcctcacta tgcctctgac 12000 ctggacaagg tggagggtct cactttccag caaaactccc tcaactggat gaaaacta 12060 tctccccggt aggagcctcc cggtctcccc tggaatgtgg gagccacact gtcctgccca 12120 ggctggggc ggggtggga gtagacacac ctgagctgag ccttgggtgc agagcagggc 12180 agggccgcgg tggcacgggg ctgggcaggc ggcctgtgtg tctgtctacc agtcctctat 12240 ccagccagca cccagctctc cagttagtgt ctgtctttca agtgcaggca aggtaaagga 12300 ggagaggaag aatgcttttt ctacacttac acttgcctgg tagttttgga gggggagaaa 12360 acattgcaat ccgccctctg agagaggacc attttggtcc cacacctgac acacagcaca 12420 cctgtgacat ccaagagctt cttggaactg acttgccagg agggttcgga cttcgcgtga 12480 gcgggggtgg ggccttctca gggagcgtcc cttgactcca gaacgccctt gctggcggct 12540 ggcggctggg tggggatagg tgttgttagc tcctctttcc tgctgcaatt cctttccaca 12600 gagccctgga ctcaaactac acatcacccc agatcatcga ggcctggaaa tctgctccca 12660 gaggcaggca ttgagtgaca cgatggcttg acatcaactc tgggtgtttt ttatgtttta 12720 aaaattgtga tggtaaaata tacgtaacaa aatttgccat cgtaaccatt ttcgagtgca 12780 cagttcagtg gtactaggcc cattcacact gttgtgcagc catcaccccc gtccatctcc 12840 atttatcttc tcaacttccc aaactgaagc tctgtcctgc tgaaacacta actctccatt 12900 tccccttccc cttggccccg gcaaccacca cgatgtcctc gaggttcacc catgttgtag 12960 cacatgtcag aatgtccttc cttttgaagg ctgaataata ttccattgca tgtggttacc 13020 accttttgtg tatccactca tccatcgatg gacacgtggg ttgcttccac ctttgagctg 13080 ctgtgaatag tgcagtgtac cctgtaaaca tgggtgtact gtcagctctt ataagtgctt 13140 gatacatcac tggaaatgtc catgggctct gaaggatgcc aaaagatgga agaggctcta 13200 tacgaagatc aatcgagttg acatagcaac gtgtccagca cgaggttgac actgtaccct 13260 cctgcctctc tccttttcat gggtgtcatg tcatcaagaa cactgctgtg gcagtagtaa 13320 gacacagtgc attatttcag agaatagcat ttaaaatta cccaagtaac acaccttcaa 13380 tgcagccaac ctaaaaacag aatgcaccaa aggacaacca ttcctaggtc ctcatcggta 13440 aatcttctat gtccctcaca tagtattgca aatgacatga aggattttta ttgtaggttt 13500 tgctgaaatt ttccccaagg gggaggatga cttagttggg tgatgggggg agcaaacatc 13560 cctgtcgtca gggttgggtg caaggagcat aagcctgcct ggcctctggg agagccctca 13620 ctgtgtggcc tggagccttc ctaactgtgc atcatctccc caggaccatc cacctgacca 13680 tgccccaact ggtgctgcaa ggatcttatg acctgcagga cctgctcgcc caggctgagc 13740 tgcccgccat tctgcacacc gagctgaacc tgcaaaaatt gagcaatgac cgcatcaggg 13800 tgggggaggt atgtgtgagc ctgtgtctgt gcctgacctg ggttccaagt gtgcacaggg 13860 tgggaggcat ggatgtaagg gacacagagg aggctatggg tggggccagc agggcaagag 13920 ggagcggaga gtagggccaa aggtgggaga gaagtagcca gagcattctg gggccttcca 13980 ggtgcagagc agcaaatccc tccccatccc tgctgtgcct cctcctgcta ggtgtgtgtt 14040 ccatggtcct gcttggcctt gccttgcctc agggtcctcc agggttccta tagtggagtt 14100 gaaaccggga tgaagacagc aagcacccct ggacctggtg ccctgggccc agccccttct 14160 tcaggaat gctgagcagc agacagaatg tccccctgcc atgtggcacc atgcacatct gcagctacca aggatgtgcc ttgatgttct gggccctgtg ctcagtgctg gggagaaagt gggagttctt acgggggcca gcggggagag ccctctgtgc tagttagct aagccctggc 14340 actggtgggc catggccaag ggagccagg attctgcctg ggacatcagg gcagaatgtg aagatgggag gatgtaaggg gtgtgttagg gaggagccgg catgtgagtt tggccattgt ggccatta cggtcatcta cacacagaca cacccttgcc tacactgagg ggcaggcata cactgtgcat cctcctggca ggctggaaa tgtccccctc caggacagtg cacagcacag aggtcctgag cccaccccgg ccctctagcc ctcagcaccc tgggtcaccc agtgcgccct 14640 cagaatgatc ctgatgtctg ctgctttgca ggtgctgaac agcatttttt ttgagcttga 14700 agcggatgag agagagccca cagagtctac ccaacagctt aacaagcctg aggtcttgga 14760 ggtgaccctg aaccgcccat tcctgtttgc tgtgtatgat caaagcgcca ctgccctgca 14820 cttcctgggc cgcgtggcca acccgctgag cacagcatga ggccagggcc ccagaacaca 14880 gtgcctggca aggcctctgc ccctggcctt tgaggcaaag gccagcagca gataacaacc 14940 ccggacaaat cagcgatgtg tcacccccag tctcccacct tttcttctaa tgagtcgact 15000 ttgagctgga aagcagccgt ttctccttgg tctaagtgtg ctgcatggag tgagcagtag 15060 aagcctgcag cggcacaaat gcacctccca gtttgctggg tttattttag agaatggggg 15120 tggggaggca agaaccagtg tttagcgcgg gactactgtt ccaaaaaga ttccaaccga ccgcttgtt tgtgaaacaa aaaagtgttc ccttttcaag ttgagaacaa aaattgggtt ttaaataa agtatacatt tttgcattgc cttcggtttg tatttagtgt cttgaatgta agaacatgac ctccgtgtag tgtctgtaat accttagttt tttccacaga tgcttgtgat ttttgaacaa tacgtgaaag atgcaagcac ctgaatttct gtttgaatgc ggaaccatag ctggttattt ctcccttgtg ttagtaataa acgtcttgcc acaataagcc tccaaaaatt ttatctttca tttagcagcc aaacagatgt atacaattca gcagatagac tgtgcaaacg aaagtgcttt cctggacttt ggatggaatt tccatggggag gtctgagcca gtacttagca gtcctttgaa gttttaggtg atgctttct ctggacactt ccattggtaa gcagtggtgg 15660 ccatctgtgt gatggacagg gggcgggaag agggtgacag ggaaggcccc ataccccatg 15720 tggcacctgg gaaaggaacc aggcagatgg gacttcttcc gtcctggtga cacagggcca 15780 gactgctgct ggtattgtgc cccgggagtg gaaggtagag aaataaatct tcacaaataa 15840 atatttgcaa ttttccccca tctgttgagt gcctctgcct gctcctcctc gatgggatta 15900 ggcccacagt tcggaatctt ggggagagcc aaggaagcgg taggcaccca gtaggcccac 15960 ggccgtcggc tgatagcaat ggtgatgctg tcctacctac ttgtgtaagg cattcgatct 16020 tcctcccttc catacatatt gaaataaata agccgcgcaa tgtgttagct attgatcaga 16080 actaaagtga agtcagccac ggggattaca aatctcggct tctcccctca tgttcctgag 16140 agtcttcccc tggttttgaa cacatctccc tagctcgatg tcaaggtgag ggattctgtc 16200 ggcaacagca gtgcccttag ttgcttcgtc gtaactcccc gtcaccggtt ttattcagtt 16260 accttccagt cccactctca gagcttcctg gcttgttctg ctctcaaagc gggtagagct 16320 ggcacacatg gactctccga aacggctgca agatgccaag tttctcggaa gaactggaag 16380 cacagagacc agaagtgcct taaggtctcg ctattcagtg tggcgcttag accggcagtg 16440 gcggcagctg ccctgggagc ttgttagaat gtggcttctc acgcccctcc tggacctaca 16500 gagtcagaat ctgcagtttt acaggaggtc caggcttgga agttgctcgt agagacctga 16560 gacagcgcag ccacgtgctg gaaacaaagc atttaagttt gtgactttat tttaaaaggc 16620 agcaggcagt cgacaaacca atttcttcta cttagaggcg gcttcggctt ctggaagtcg 16680 ctaggagtat aaagttgcca accagcgctg ttctcccgct gttttctgtg cacttataaa 16740 tgggaagtta ggtcaggata gatctctcag ctattacaag gatacaaaat acgaacattc 16800 tacaagttac ttaacacaca cacacacaca cacacacaca cacacacaca caaaattaat 16860 tccacaggtc agtttctctg aaacattttt tcactaaatt ctaagtcttc ctggagttgc 16920 aagtgcctat ctcctagaca aggcaattac tcaccaacta aaatcactgt caatctgaga 16980 tttcggctgg gcatgagacc atggtcaggg gatgctttga acagcctctg aggaaattag 17040 tgagtttgaa aaatggaaag atttttatta ctcacttggc agtaaaacct gatggggaca gacgtcaggc tgtttaagat cctcagaaga aaaagttgat agtgtgaata ttcctaaatt tgccacacga agatgtacat gtgattataa ggtgctgttg cagaagcccc tgggggtgtt atgggatata cactatatgg gccactttac cttcctaaaa tctgaaaaac ttcaactact gaaacatgga ctgaaggttt tgaatagtgg atggtgaatt tgaataccat cccgtgtgat ttttttttct agcacttt agtttttag agcccacacc aaaactgaga 17400 17460. ggaagataca gcaatttctc atataccccc tactaccttc cagtctcccc cattattgac atcccccacc cagagtggtc catttcttac aacccacgaa cctacattga cacatcatta ttactcaacg tccatagttt acattagggt tggctcttgg tgttgtacat tctatgggtt 17580 tagacaattt tcaggagttt cactgacctg aaaatcctct gtgtccctcc tattcacccc 17640 tccttccctc ctaaccactg gtaaccaccg atcctattcc catcttctcc atagttttgc 17700 ctttcccacc caggatgtca tatagtgaa tcattcagta tgtggccttt ccagattagc 17760 ctctttcact tagtaatgtg catttaagtt tcctccatgt cttttcatga tcgctcattt 17820 cttttttatt gctaaatact atgccactgt ctggatgtgt cacagtttat ttatcacct 17880 actgaaggac atcttgcttg tttccaagtt gtggcaattg cgaattaagc tgctacagac 17940 acccatgtgt gggtttttgt gtggacatgt ttaccccaca caatttttaa agttgctcaa 18000 <![CDATA[ <210> 3]]> <![CDATA[ <211> 19]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Introduction <![CDATA[ <400> 3]]> ccctgatggg agccagtgt 19 <![CDATA[ <210> 4]]> <![CDATA[ <211> 19]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Introduction <![CDATA[ <400> 4]]> agcagggaga agcccttca 19 <![CDATA[ <210> 5]]> <![CDATA[ <211> 27]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> probe <![CDATA[ <400> 5]]> ccctggcttt caacacctac gtccact 27 <![CDATA[ <210> 6]]> <![CDATA[ <211> 20]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Introduction <![CDATA[ <400> 6]]> ggacaaggtg gagggtctca 20 <![CDATA[ <210> 7]]> <![CDATA[ <211> 21]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Introduction <![CDATA[ <400> 7]]> agatccttgc agcaccagtt g 21 <![CDATA[ <210> 8]]> <![CDATA[ <211> 29]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Probe <![CDATA[ <400> 8]]> atgaagaaac tatctccccg gaccatcca 29 <![CDATA[ <210> 9]]> <![CDATA[ <211> 19]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Introduction <![CDATA[ <400> 9]]> gaaggtgaag gtcggagtc 19 <![CDATA[ <210> 10]]> <![CDATA[ <211> 20]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Introduction <![CDATA[ <400> 10]]> gaagatggtg atgggatttc 20 <![CDATA[ <210> 11]]> <![CDATA[ <211> 20]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> probe <![CDATA[ <400> 11]]> caagcttccc gttctcagcc 20 <![CDATA[ <210> 12]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 12]]> cgctgatttg tccggg 16 <![CDATA[ <210> 13]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 13]]> tcggttggaa ttcttt 16 <![CDATA[ <210> 14]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <220> ]]> <![CDATA[ <221> misc_feature]]> <![CDATA[ <222> (5)..(5)]]> <![CDATA[ <223> The bases at these positions are RNA. <![CDATA[ <400> 14]]> tcggutggaa ttcttt 16 <![CDATA[ <210> 15]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 15]]> gtcggttgga attctt 16 <![CDATA[ <210> 16]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <220> ]]> <![CDATA[ <221> misc_feature]]> <![CDATA[ <222> (6)..(6)]]> <![CDATA[ <223> The bases at these positions are RNA. <![CDATA[ <400> 16]]> ctcatugtgg atgacg 16 <![CDATA[ <210> 17]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 17]]> ctcattgtgg atgacg 16 <![CDATA[ <210> 18]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <220> ]]> <![CDATA[ <221> misc_feature]]> <![CDATA[ <222> (6)..(6)]]> <![CDATA[ <223> The base at these positions is RNA. <![CDATA[ <400> 18]]> tgaatuggag caggta 16 <![CDATA[ <210> 19]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 19]]> tgaattggag caggta 16 <![CDATA[ <210> 20]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 20]]> cggtgtcaag ttttgc 16 <![CDATA[ <210> 21]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 21]]> gttgggtaga ctctgt 16 <![CDATA[ <210> 22]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 22]]> gttggaattc tttttg 16 <![CDATA[ <210> 23]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 23]]> gttaagctgt tgggta 16 <![CDATA[ <210> 24]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <220> ]]> <![CDATA[ <221> misc_feature]]> <![CDATA[ <222> (5)..(5)]]> <![CDATA[ <223> The bases at these positions are RNA. <![CDATA[ <400> 24]]> tgaautggag caggta 16 <![CDATA[ <210> 25]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 25]]> ttgcaggttc agctcg 16 <![CDATA[ <210> 26]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 26]]> ggtagactct gtgggc 16 <![CDATA[ <210> 27]]> <![CDATA[ <211> 16]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 27]]> gttggaattc tttttg 16 <![CDATA[ <210> 28]]> <![CDATA[ <211> 20]]> <![CDATA[ <212> DNA <![CDATA[ <213> Artificial sequence <![CDATA[ <220> ]]> <![CDATA[ <223> Synthetic oligonucleotides <![CDATA[ <400> 28]]> cacaaacaag ctggtcggtt 20
[0355]
Claims
1. An oligomeric compound having the nucleobase sequence of SEQ ID NO: 12 and a chemical structure thereof, or a salt thereof.
2. An oligomeric compound having the nucleobase sequence of SEQ ID NO: 12 and a chemical structure according to the following.
3. An oligomeric compound comprising an oligonucleotide having the nucleobase sequence of SEQ ID NO: 12 and modified according to the following chemical notation: mCesGeomCkoTdsGdsAdsTdsTdsTdsGdsTdsmCdsmCdsGkoGksGe, wherein: A = adenine nucleobase, mC = 5-methylcytosine nucleobase, G = guanine nucleobase, T = thymine nucleobase, e = 2'-β-D-MOE sugar moiety, k = cEt sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety, s = thiophosphate nucleoside linkage, and o = phosphodiester nucleoside linkage.
4. The oligomeric compound or its salt as claimed in claim 1, which is a sodium or potassium salt.
5. The oligomeric compound of claim 3, comprising the modified oligonucleotide covalently linked to a binding group.
6. An oligomeric duplex comprising an oligomeric compound as claimed in claim 1 or 4 or a salt thereof, or an oligomeric compound as claimed in claim 2, 3 or 5.
7. An antisense compound comprising or composed of: an oligomeric compound of claim 1 or 4 or a salt thereof, or an oligomeric compound of any one of claims 2, 3 or 5.
8. A group of oligomeric compounds as claimed in claim 1 or 4, or a salt thereof, or as claimed in any one of claims 2, 3 or 5, wherein all thiophosphate nucleoside linkages in the oligomeric compound are stereo-random.
9. A pharmaceutical composition comprising an oligomeric compound as claimed in claim 1 or 4 or a salt thereof, or an oligomeric compound as claimed in claim 2, 3 or 5, and a pharmaceutically acceptable carrier or diluent.
10. The pharmaceutical composition of claim 9, wherein the pharmaceutically acceptable diluent is water or PBS.
11. Use of an oligomeric compound as claimed in claim 1 or 4, or a salt thereof, or an oligomeric compound as claimed in claim 2, 3, or 5, for the preparation of a medicament for treating RAAS pathway-related diseases in individuals suffering from or at risk of suffering from such diseases.
12. As requested in item 11, wherein the disease is a cardiovascular disease.
13. As requested in claim 11, wherein the disease is selected from hypertension, Marfan syndrome, heart failure, kidney disease, obesity, and metabolic syndrome.
14. As used in claim 11, wherein at least one symptom or sign of the disease is improved.
15. For the purposes of claim 14, wherein the symptom or sign is any of the following: hypertension, stroke, preeclampsia, aneurysm, peripheral artery disease, or injury to the heart, kidneys, eyes, or brain.
16. As claimed in claim 11, wherein the oligomeric compound or a salt thereof is administered systemically.
17. As claimed in claim 11, wherein the oligomeric compound or its salt is administered subcutaneously or intramuscularly.
18. Use of an oligomeric compound as claimed in claim 1 or 4 or a salt thereof, or an oligomeric compound as claimed in claim 2, 3 or 5, for the preparation of an agent for reducing AGT expression in cells.
19. As requested in item 18, in which the level of AGT RNA is reduced.
20. As used in claim 18, wherein the level of AGT protein is reduced.
21. As requested in claim 11, wherein the disease is selected from refractory hypertension, NASH, and NAFLD.
22. As used in claim 14, wherein the symptom or sign is any of a hypertensive emergency (i.e., malignant hypertension), an abdominal aneurysm, or pulmonary hypertension.
23. As claimed in claim 11, wherein the oligomeric compound or a salt thereof is contained in a pharmaceutical composition, the pharmaceutical composition further comprising a pharmaceutically acceptable carrier or diluent.
24. As claimed in claim 11, wherein the oligomer or its salt is in a group of oligomers, wherein all thiophosphate nucleoside linkages of the oligomer are stereo-random.
Citation Information
Patent Citations
Compounds and methods for modulating angiotensinogen expression
CN108271351A