A novel glutamine-hydrolyzing gmp synthase variant and a method of producing 5'-guanosine monophosphate using the same

Abstract

This disclosure relates to a novel glutamine-hydrolyzed GMP synthase variant and a method for producing 5'-guanosine monophosphate using it, and high-yield GMP production can be achieved by culturing microorganisms incorporating the glutamine-hydrolyzed GMP synthase variant disclosed herein.

Description

[Technical Field]

[0001] This disclosure relates to a novel variant of glutamine-hydrolyzed GMP synthase and a method for producing 5'-guanosine monophosphate using the same. Cross-reference to related applications.

[0002] This disclosure claims priority based on Korean Patent Application No. 10-2024-0009487, filed on January 22, 2024, and all contents described in the documents of the corresponding Korean Patent Application are incorporated herein by reference. [Previous Technology]

[0003] 5'-Guanine monophosphate (hereinafter, GMP) is an intermediate in the nucleic acid biosynthesis metabolic system and has physiological significance not only in animals and plants but also in various medical applications in food, medicine, and many other fields. Specifically, it is a nucleic acid-based seasoning that exhibits a synergistic taste effect when used with sodium glutamate (MSG), and is therefore attracting attention as a savory seasoning.

[0004] Methods for producing GMP include (1) a method for breaking down yeast RNA using microbial enzymes or chemicals, (2) a method for directly producing nucleotides via microorganisms in a culture medium containing sugars and nitrogen sources, and (3) a method for chemically or enzymatically converting intermediates for nucleotide synthesis. Currently, combined production methods of fermentation, chemical synthesis, and enzymatic conversion are widely used in industry.

[0005] This combined production method consists of the following: a fermentation process that produces 5'-xanthocyanin monophosphate (hereinafter, XMP), an intermediate product of the purine nucleotide biosynthesis metabolic system; and an enzymatic reaction process that converts the fermentation product into GMP, using microorganisms that produce XMP and microorganisms capable of converting XMP into GMP. Therefore, in order to efficiently produce GMP, the microorganisms involved in GMP production should inhibit GMP decomposition, and specifically, the microorganisms added during the enzymatic reaction process should have a highly sophisticated ability to convert XMP into GMP.

[0006] For this reason, various studies are conducted to develop technologies for efficient production of microorganisms and fermentation processes. For example, target-specific methods are mainly used, such as increasing the expression of genes encoding enzymes involved in the biosynthesis of XMP or GMP or removing genes that are not necessary in the biosynthesis (US 2020-0347346 A1). [Summary of the Invention]

[0007] [Technical Issues]

[0008] One specific example of this disclosure provides a polypeptide having glutamine hydrolyzing GMP synthase activity.

[0009] The polypeptide may comprise an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 1, i) the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, ii) the amino acid corresponding to the 441st residue of the amino acid sequence of SEQ ID NO: 1 is substituted with another residue, or iii) a combination thereof.

[0010] Another specific example of this disclosure provides a polynucleotide encoding a polypeptide.

[0011] Other specific examples of this disclosure provide a recombinant vector containing polynucleotides.

[0012] Other specific examples of this disclosure provide a microorganism comprising at least one of the following: a polypeptide having glutamine-hydrolyzing GMP synthase activity, a polynucleotide encoding the polypeptide, and a carrier comprising the polynucleotide.

[0013] Another specific example of this disclosure provides a method for producing GMP, which includes culturing microorganisms in a culture medium.

[0014] Other specific examples of this disclosure provide a composition for the production of 5'-guanosine monophosphate containing microorganisms.

[0015] Other specific examples disclosed herein provide the use of microorganisms for the production of purine 5'-guanosine monophosphate.

[0016] Other specific examples disclosed herein provide the use of microorganisms for producing components for the production of 5'-guanosine monophosphate. [Technical Solution]

[0017] In this disclosure, recombinant microorganisms with excellent production capacity (conversion efficiency) of 5'-guanosine monophosphate (hereinafter, GMP) are provided by searching for variants that enhance the activity of glutamine hydrolyzing GMP synthase and introducing them into microorganisms or constructing microorganisms containing variants.

[0018] In this disclosure, it has been confirmed that when an amino acid mutation is introduced into a specific position of the glutamine hydrolysate GMP synthase, the production energy (conversion efficiency) of 5'-guanosine monophosphate (GMP) is further increased.

[0019] One specific example of this disclosure provides a polypeptide having glutamine-hydrolyzing GMP synthase activity. The polypeptide may be a variant of glutamine-hydrolyzing GMP synthase derived from Corynebacterium microorganisms, and may be a variant that enhances the activity of glutamine-hydrolyzing GMP synthase.

[0020] In one specific example, the polypeptide may comprise an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 1, wherein the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, or the amino acid corresponding to the 441st residue is substituted with another amino acid, or a combination thereof.

[0021] In another specific example, the polypeptide may comprise an amino acid sequence in which, starting from the N-terminus of an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 96, the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 96 is substituted with another amino acid, or the amino acid corresponding to the 441st residue is substituted with another amino acid, or a combination thereof.

[0022] The amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1, starting from the N-terminus of an amino acid sequence having 90% or higher sequence identity with the amino acid sequence of SEQ ID NO: 96, may be the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 96, starting from the N-terminus of an amino acid sequence having 90% or higher sequence identity with the amino acid sequence of SEQ ID NO: 1, and the amino acid corresponding to the 441st residue of the amino acid sequence of SEQ ID NO: 1, starting from the N-terminus of an amino acid sequence having 90% or higher sequence identity with the amino acid sequence of SEQ ID NO: 96, may be the amino acid sequence corresponding to the 441st residue of the amino acid sequence of SEQ ID NO: 96, starting from the N-terminus of an amino acid sequence having 90% or higher sequence identity with the amino acid sequence of SEQ ID NO: 96.

[0023] Counting amino acids from the N-terminus of the amino acid sequence as described above can mean counting methionine (Met, M) translated from the start codon as the first amino acid.

[0024] Another specific example of this disclosure provides a polynucleotide encoding a polypeptide.

[0025] Another specific example of this disclosure provides a recombinant vector containing polynucleotides. The recombinant vector can be used as an expression vector for peptides.

[0026] Another specific example of this disclosure provides a microorganism with enhanced activity of glutamine hydrolyzing GMP synthase. The microorganism may be a GMP-producing microorganism.

[0027] Compared with homogeneous microorganisms with unenhanced glutamine hydrolyzing GMP synthase activity, microorganisms with enhanced glutamine hydrolyzing GMP synthase activity can have higher GMP production energy.

[0028] Another specific example of this disclosure provides a method for producing GMP, which includes culturing microorganisms with enhanced activity of glutamine-hydrolyzing GMP synthase in a culture medium.

[0029] Another specific example of this disclosure provides a composition for the production of GMP, which includes microorganisms having enhanced activity of glutamine-hydrolyzing GMP synthase.

[0030] This will be described in more detail below.

[0031] In this specification, the term "glutamine-hydrolyzing GMP synthase" refers to an enzyme involved in the conversion of 5'-xanthocyanin monophosphate (XMP) to 5'-guanosine monophosphate (hereinafter, GMP), and means an enzyme with the activity of the chemical reaction ATP + H2O + L-glutamine + XMP → AMP + diphosphate + GMP + 2H+ + L-glutamine ester. For the purposes of this disclosure, the enzyme is a protein involved in the production of 5'-guanosine monophosphate (hereinafter, GMP). Specifically, the glutamine-hydrolyzing GMP synthase disclosed herein can be used interchangeably with "GMP synthesizing enzyme," "GMP synthase," "GMP synthetase," "5'-guanosine monophosphate biosynthetase," and "GuaA protein." In this disclosure, the sequence of the glutamine-hydrolyzing GMP synthase can be obtained from known databases in NCBI's GenBank (e.g., WP_194285183.1 or WP_025387107.1).

[0032] The protein introduced by the mutation disclosed herein may be a wild-type protein with glutamine-hydrolyzed GMP synthase activity. Specifically, the glutamine-hydrolyzed GMP synthase introduced by the mutation may have or contain, be composed of, or be substantially composed of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96, but is not limited thereto. In other words, insignificant sequence additions before or after the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96, or naturally occurring mutations, or silencing mutations thereof, are not excluded, and when the synthase has the same or corresponding activity as a protein containing the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96, it may correspond to the protein introduced by the mutation disclosed herein. For example, the mutated proteins disclosed herein may be proteins composed of amino acid sequences having 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.3%, 99.5%, 99.7%, or 99.9% or higher, but less than 100%, of sequence homology or identity with the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96. Furthermore, proteins having amino acid sequences with deletions, modifications, substitutions, or additions thereof, provided they possess such homology or identity and exhibit the corresponding protein function, may be included within the scope of mutated proteins disclosed herein.

[0033] In this disclosure, the glutamine hydrolyzing GMP synthase may be derived from microorganisms of the genus Corynebacterium, specifically from Corynebacterium stationis (Corynebacterium ammoniagenes) or Corynebacterium casei, but is not limited thereto.

[0034] One specific example of this disclosure provides a polypeptide with glutamine-GMP synthase activity, wherein a mutation is included at the 123rd and / or 144th position corresponding to the amino acid sequence of SEQ ID NO: 1, starting from the N-terminus of an amino acid sequence having 90% or higher sequence identity with the amino acid sequence of SEQ ID NO: 1. The polypeptide may be a variant of glutamine-GMP synthase. Variants of glutamine-GMP synthase may increase the activity of glutamine-GMP synthase and / or GMP production energy (conversion efficiency). A variant of glutamine-hydrolyzed GMP synthase may refer to a variant in which the amino acids corresponding to the 123rd and / or 441st amino acids of the amino acid sequence of SEQ ID NO: 1, starting from the N-terminus described above, and / or amino acids having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher homology or identity with SEQ ID NO: 1, are mutated.

[0035] As an example, a polypeptide having glutamine-hydrolyzing GMP synthase activity may be composed of a polypeptide comprising the following amino acid sequence: starting from the N-terminus of an amino acid sequence having 90% or higher sequence identity with the amino acid sequence of SEQ ID NO: 1, i) the amino acid corresponding to residue 123 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, ii) the amino acid corresponding to residue 441 of the amino acid sequence of SEQ ID NO: 1 is substituted with another residue, or the amino acid corresponding to residue 123 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, and the amino acid corresponding to residue 441 of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid. The aforementioned "other amino acid" may refer to an amino acid other than the original amino acid.

[0036] Another specific embodiment of this disclosure provides a polypeptide with glutamine-hydrolyzed GMP synthase activity, wherein a mutation is included at the 123rd and / or 441st positions corresponding to the amino acid sequence of SEQ ID NO: 96, starting from the N-terminus of an amino acid sequence having 90% or higher sequence identity with the amino acid sequence of SEQ ID NO: 96. The polypeptide may be a variant of glutamine-hydrolyzed GMP synthase. Variants of glutamine-hydrolyzed GMP synthase may increase the activity of glutamine-hydrolyzed GMP synthase and / or increase GMP production energy (conversion efficiency). A variant of glutamine-hydrolyzed GMP synthase may refer to a variant in which the amino acids corresponding to the 123rd and / or 441st amino acids of the amino acid sequence of SEQ ID NO: 96, starting from the N-terminus described above, and / or amino acids having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher homology or identity with SEQ ID NO: 96, are mutated.

[0037] As an example, a polypeptide having glutamine-hydrolyzing GMP synthase activity may be composed of a polypeptide comprising the following amino acid sequence: starting from the N-terminus of an amino acid sequence having 90% or higher sequence identity with the amino acid sequence of SEQ ID NO: 96, i) the amino acid corresponding to residue 123 of the amino acid sequence of SEQ ID NO: 96 is substituted with another amino acid, ii) the amino acid corresponding to residue 441 of the amino acid sequence of SEQ ID NO: 96 is substituted with another amino acid, or iii) the amino acid corresponding to residue 123 of the amino acid sequence of SEQ ID NO: 96 is substituted with another amino acid, and the amino acid corresponding to residue 441 of the amino acid sequence of SEQ ID NO: 96 is substituted with another amino acid. The aforementioned "other amino acid" may refer to an amino acid other than the original amino acid.

[0038] In one specific example, in a polypeptide having glutamine hydrolytic GMP synthase activity, the amino acid corresponding to the 123rd residue (position) of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 may be substituted by another amino acid. The aforementioned other amino acid may refer to an amino acid that is different from the original amino acid aspartic acid, and specifically, it may be any amino acid selected from the group consisting of: lysine, alanine, cysteine, glutamic acid, phenylalanine, glycine, histidine, isoleucine, leucine, methionine, aspartic acid, proline, glutamic acid, arginine, serine, threonine, valine, tryptophan, and tyrosine. Specifically, it may be any amino acid selected from the group consisting of: lysine, glutamic acid, histidine, methionine, glutamic acid, arginine, serine, and tyrosine. In a particular specific instance, a polypeptide (in which an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 96, is substituted with another amino acid for the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96) may comprise, or be composed of, any amino acid sequence selected from the group consisting of SEQ ID NO: 52 to SEQ ID NO: 59 and SEQ ID NO: 109.

[0039] In one specific example, in a polypeptide having glutamine hydrolytic GMP synthase activity, the amino acid corresponding to the 441st residue (position) of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 is substituted with another amino acid. The aforementioned other amino acid may refer to an amino acid that is different from the original amino acid aspartic acid, and specifically, it may be any amino acid selected from the group consisting of: valine, alanine, cysteine, glutamic acid, phenylalanine, glycine, histidine, isoleucine, lysine, leucine, methionine, aspartic acid, proline, glutamic acid, arginine, serine, threonine, tryptophan, and tyrosine. Specifically, it may be any amino acid selected from the group consisting of: valine, alanine, cysteine, glutamic acid, phenylalanine, histidine, isoleucine, lysine, leucine, aspartic acid, glutamic acid, threonine, and tryptophan. In a particular specific instance, the polypeptide in which the amino acid corresponding to the 441st residue of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 is substituted by another amino acid may comprise, or consist of, any amino acid sequence selected from the group consisting of SEQ ID NO: 60 to SEQ ID NO: 72 and SEQ ID NO: 110.

[0040] In one specific example, in a polypeptide having glutamine-hydrolyzing GMP synthase activity, the amino acid corresponding to residue 123 of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 may be substituted with another amino acid, and the amino acid corresponding to residue 441 of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 may be substituted with another amino acid. The aforementioned other amino acid may refer to an amino acid different from the original amino acid, and specifically, the amino acid corresponding to residue 123 may be substituted with lysine and the amino acid corresponding to residue 441 may be substituted with valine. In a particular specific instance, a polypeptide (where the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, and the amino acid corresponding to the 441st residue of the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid) may comprise, or be composed of, the amino acid sequence of SEQ ID NO: 73.

[0041] Furthermore, the polypeptides disclosed herein that possess glutamine-hydrolyzing GMP synthase activity may comprise polypeptides having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher homology or identity with the amino acid sequence, wherein, starting from the N-terminus of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96, the 123rd amino acid is substituted with another amino acid and / or the 441st amino acid is substituted with another amino acid. Additionally, it is apparent that proteins having amino acid sequences with some of these sequences being deleted, modified, substituted, or added, as long as they possess this homology or identity and exhibit the corresponding protein activity, are included within the scope of this disclosure.

[0042] In a particular specific instance, the polypeptide having glutamine-hydrolyzing GMP synthase activity may comprise any of the SEQ ID NOs selected from the group consisting of SEQ ID NOs: 52 to 73. The amino acid sequence of NO has the following homology or identity with the following amino acid sequences: 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 96% or higher, 96.3% or higher, 96.5% or higher, 96.7% or higher, 96.9% or higher, 97% or higher, 97.1% or higher, 97.2% or higher, 97.4% or higher, 97.6% or higher, 97.8% or higher, 98% or higher, 98.2% or higher, 98.4% or higher, 98.6% or higher, 98.9% or higher, 99% or higher, 99.1% or higher, 99.3% or higher, 99.5% or higher, 99.7% or 99.9% or higher, or is composed of the amino acid sequence.

[0043] In a particular specific instance, the polypeptide having glutamine-hydrolyzing GMP synthase activity may comprise any SEQ ID NO: 106 to 108. The amino acid sequence of NO has the following homology or identity with the following amino acid sequences: 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 96% or higher, 96.3% or higher, 96.5% or higher, 96.7% or higher, 96.9% or higher, 97% or higher, 97.1% or higher, 97.2% or higher, 97.4% or higher, 97.6% or higher, 97.8% or higher, 98% or higher, 98.2% or higher, 98.4% or higher, 98.6% or higher, 98.9% or higher, 99% or higher, 99.1% or higher, 99.3% or higher, 99.5% or higher, 99.7% or 99.9% or higher, or is composed of the amino acid sequence.

[0044] Furthermore, any polypeptide exhibiting activity corresponding to a polypeptide with homology or consistency and possessing glutamine-hydrolyzing GMP synthase activity may be included in the variants disclosed herein, even if it contains amino acid sequences with some deletions, modifications, substitutions, conserved substitutions, and / or additions. For example, this may be the case of sequence additions or deletions, naturally occurring mutations, silencing mutations, or conserved substitutions, which do not alter the activity of the variants of the glutamine-hydrolyzing GMP synthase disclosed herein, including the N-terminus, C-terminus, and / or the internal amino acid sequences.

[0045] "Conservative substitution" means replacing one amino acid with another amino acid that has similar structure and / or chemical properties. This amino acid substitution can generally be based on the similarity of the residue's polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphilic properties. In general, conservative substitution can have little or no effect on the activity of a protein or polypeptide.

[0046] In one specific example, in an amino acid sequence having 90% or higher sequence identity with the amino acid sequence of SEQ ID NO: 1, the amino acid corresponding to the 123rd residue and / or the amino acid corresponding to the 441st residue of the amino acid sequence of SEQ ID NO: 1 may be aspartate (Aspartate, Asp, D), but is not limited thereto.

[0047] In one specific example, in an amino acid sequence having 90% or higher sequence identity with the amino acid sequence of SEQ ID NO: 96, the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 96 may be aspartic acid (aspartate, Asp, D), and the amino acid corresponding to the 441st residue may be glutamate (glutamate, Glu, E), but is not limited thereto.

[0048] Compared with wild-type polypeptides with glutamine hydrolyzing GMP synthase activity, the polypeptides disclosed herein with glutamine hydrolyzing GMP synthase activity can have the characteristic of increasing GMP production energy (conversion efficiency).

[0049] In this disclosure, the term "GMP (5'-guanosine monophosphate; hereinafter, GMP)" refers to a nucleotide used as a unit type in RNA and is an intermediate in the nucleic acid biosynthetic metabolic system. "GMP" is used interchangeably with "5'-guanosine monophosphate" and can be synthesized by adding ammonia molecules to XMP using a glutamylamine-hydrolyzed GMP synthase. Methods for preparing GMP from XMP and / or means for using such methods may be selected from known techniques.

[0050] In one specific instance, GMP can be prepared by conversion from XMP, but is not limited thereto.

[0051] In this disclosure, the term "variant" refers to a polypeptide whose amino acid sequence differs from that before modification, because at least one amino acid is conserved and / or modified, but the function or properties are maintained. Such variants can generally be identified by examining at least one amino acid in the amino acid sequence of the modified polypeptide and assessing the properties of the modified polypeptide. In other words, the ability of a variant may be increased, unchanged, or decreased compared to the polypeptide before modification. In addition, some variants may include variants in which at least a portion (such as an N-terminal leader sequence or a transmembrane domain) is removed. Other variants may include variants in which a portion is removed from the N-terminus and / or C-terminus of a mature protein. The term "variant" may be used interchangeably with the terms mutant, modified, mutant polypeptide, mutant protein, mutation and variant and their analogues (in English, modified, modified polypeptide, modified protein, mutant, mutant protein (mutein), divergent, variant, etc.), and is not limited thereto as long as it is a term used in the sense of mutation. For the purposes of this disclosure, the variant may be a polypeptide having glutamine-hydrolyzing GMP synthase activity, and the polypeptide comprises the following amino acid sequence: in an amino acid sequence having 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 1 or 90% or more sequence identity with the amino acid sequence of SEQ ID NO: 96, the amino acid corresponding to the 123rd residue of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96 is substituted with another amino acid, or the amino acid corresponding to the 441st residue is substituted with another amino acid, or a combination thereof.

[0052] In addition, variants may contain the deletion or addition of amino acids that have minimal impact on the properties and secondary structure of the polypeptide. For example, a signal (or leader) sequence involving protein co-translation or post-translational translocation may bind at the N-terminus of the variant. Furthermore, variants may bind to another sequence or linker to be identified, purified, or synthesized.

[0053] In one specific instance, the variant may be encoded by a nucleic acid sequence comprising any one of SEQ ID NO: 74 to SEQ ID NO: 95 and SEQ ID NO: 109 to 111, or a polynucleotide composed of such nucleic acid sequences.

[0054] Other specific examples of this disclosure provide a polynucleotide that encodes a polypeptide (e.g., a variant of glutamine-hydrolyzed GMP synthase) having glutamine-hydrolyzed GMP synthase activity.

[0055] In this disclosure, the term "polynucleotide" means a DNA or RNA strand of a length or longer, which is a polymer of nucleotides in which nucleotide monomers are linked together in a long chain shape by covalent bonds.

[0056] This may include (but is not limited to) polynucleotides encoding polypeptides (e.g., variants of glutamine-GMP synthase) with glutamine-hydrolyzing GMP synthase activity as disclosed herein, provided that such polynucleotide sequences encode polypeptides with glutamine-GMP synthase activity. In this disclosure, the gene encoding the amino acid sequence of glutamine-GMP synthase is the guaA gene, and may be derived from microorganisms of the genus Corynebacterium, specifically from Corynebacterium tarda or Corynebacterium casei, but is not limited thereto.

[0057] In one specific example, the polynucleotide may comprise a nucleic acid sequence (base sequence) described as being selected from any of SEQ ID NOs: 74 to 95 and SEQ ID NOs: 109 to 111, or consist of or substantially consist of a nucleic acid sequence selected from any of SEQ ID NOs: 74 to 95 and SEQ ID NOs: 109 to 111.

[0058] A polynucleotide consisting of or containing any of the nucleic acid sequences selected from SEQ ID NO: 74 to SEQ ID NO: 95 and SEQ ID NO: 109 to 111 may encode an amino acid sequence described as selected from any of SEQ ID NO: 52 to 73 and SEQ ID NO: 106 to 108.

[0059] Considering codon degeneracy or the better codons in organisms that need to express the variants disclosed herein, the polynucleotides disclosed herein can be modified in various ways in the coding region without changing the amino acid sequence of the variants disclosed herein. Specifically, the polynucleotide disclosed herein may have or contain a base sequence having 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, 99.1% or higher, 99.2% or higher, 99.3% or higher, 99.4% or higher, 99.5% or higher, 99.6% or higher, 99.7% or higher, 99.8% or higher, or 99.9% or higher homology or identity with any base sequence selected from SEQ ID NO: 74 to SEQ ID NO: 95 and SEQ ID NO: 109 to 111, or may be composed of a base sequence selected from SEQ ID NO: 74 to SEQ ID NO: 95 and SEQ ID NO: 109 to 111. Any sequence from 109 to 111 has or is substantially composed of, but is not limited to, 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, 99.1% or higher, 99.2% or higher, 99.3% or higher, 99.4% or higher, 99.5% or higher, 99.6% or higher, 99.7% or higher, 99.8% or higher, or 99.9% or higher homology or identity of the base sequence.

[0060] The polynucleotides disclosed herein may include (but are not limited to) probes that can be prepared from known gene sequences, such as sequences that can hybridize with all or part of the polynucleotide sequence disclosed herein under stringent conditions. "Stringent condition" means a condition under which specific hybridization can occur between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, the following conditions can be listed: heterozygous polynucleotides with high homology or homology, having 70% or higher, 75% or higher, 80% or higher, 85% or higher, 90% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, 99% or higher, 99.1% or higher, 99.2% or higher, 99.3% or higher, 99.4% or higher, 99.5% or higher, 99.6% or higher, 99.7% or higher, 99.8% or higher, or 99.9% or higher homology or homology, and not hybridized with polynucleotides with homology or homology lower than that, or common southern hybridization washing conditions, i.e., corresponding to 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1%. SDS, more specifically, refers to washing once at a salt concentration of 68°C, 0.1×SSC, and 0.1% SDS, or more specifically, washing twice or three times.

[0061] Heterolysis requires two complementary nucleotide sequences, but depending on the strictness of heterolysis, the heterogenized polynucleotide may contain some mismatches between bases. The term "complementary" is used to describe the relationship between the bases of nucleotides that can heterogeneously heterogeneous with each other. For example, relative to DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides disclosed herein may also contain isolated nucleic acid fragments complementary to the entire sequence, as well as substantially similar nucleic acid sequences.

[0062] Specifically, the hybridization conditions, which include a hybridization step at a Tm value of 55°C, can be used to detect polynucleotides that are homologous or identical to the polynucleotides disclosed herein. Furthermore, the Tm value can be 60°C, 63°C, or 65°C, but is not limited thereto, and can be appropriately adjusted by those skilled in the art for their purposes.

[0063] The appropriate stringency of the heteropolynucleotide depends on the length and complementarity of the polynucleotide, and the variables are well known in the relevant technical field (e.g., J. Sambrook et al., ibid.).

[0064] In this specification, a polynucleotide (which may be used interchangeably with "gene") or a polypeptide (which may be used interchangeably with "protein") "contains or is composed of or represents a specific nucleic acid sequence or amino acid sequence" means that the polynucleotide or polypeptide substantially contains a specific nucleic acid sequence or amino acid sequence, and can be interpreted as containing "substantially equivalent sequences" wherein insignificant mutations (deletions, substitutions, modifications and / or additions) are added to the specific nucleic acid sequence or amino acid sequence to the extent that the original function and / or target function of the polynucleotide or polypeptide is maintained (or insignificant mutations are not excluded).

[0065] In this specification, the terms "homology" or "identity" mean the degree of similarity between two specified amino acid sequences or base sequences, and may be expressed as a percentage. The terms homology and identity are generally used interchangeably.

[0066] Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by a standard array algorithm, and preset gap penalties established by the program can be used together. Essentially, homologous or identical sequences can generally hybridize with all or part of a sequence under moderate to high stringency conditions. Clearly, hybridization includes hybridization with polynucleotides containing general codons or codons that take into account codon degeneracy within the polynucleotide.

[0067] Regardless of whether any two polynucleotide or polypeptide sequences are homologous or identical, they can be determined using the preset parameters in Pearson et al. (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444, using known computer algorithms such as the "FASTA" program. Furthermore, as performed in the Needleman program of the EMOSS suite (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), it can utilize the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) (including the GCG package (Devereux, J. et al., Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Francisco). Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073) to determine homology or similarity. For example, homology or similarity can be determined using BLAST or ClustalW from the National Center of Biotechnology Information Database.

[0068] Homology or identity of polynucleotides or polypeptides can be determined by comparing sequence information using GAP computer programs, such as Needleman et al. (1970), J Mol Biol. 48:443, and as known for example in Smith and Waterman, Adv. Appl. Math (1981) 2:482. Generally, the GAP program can be defined as the total number of symbols in the shorter sequence of two sequences divided by the number of symbols in similar arrangements (i.e., nucleotides or amino acids). The default parameters of the GAP program may include (1) a binary comparison matrix (containing a consistency value of 1 and a non-consistency value of 0) and a weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res. 14: 6745, disclosed in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979) (or EDNAFULL (the EMBOSS version of NCBI NUC4.4) to replace the matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a penalty of 10 for gap opening and 0.5 for gap expansion); and (3) no penalty for terminal gaps.

[0069] In this specification, the term "corresponding to" refers to an amino acid residue at a position listed in the polypeptide, or an amino acid residue that is similar to, identical to, or homologous to a residue listed in the polypeptide. Identifying an amino acid at a corresponding position allows for the identification of a specific amino acid in a sequence referencing a specific sequence. The term "corresponding region" as used in this disclosure generally refers to a similar or corresponding position in the relevant protein or a reference protein.

[0070] For example, any amino acid sequence can be compared with SEQ ID NO: 1, and based on this, each amino acid residue in the amino acid sequence can be numbered by referring to the numbering position of the amino acid residue corresponding to the amino acid residue in SEQ ID NO: 1. For example, the sequence alignment algorithm described in this disclosure can identify the position of an amino acid, or the position where a modification such as substitution, insertion, or deletion or similar occurs, by comparing it with a query sequence (also referred to as a "reference sequence").

[0071] For this alignment, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program of the EMBOSS suite (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) and similar algorithms may be used, but not limited thereto, and sequence alignment programs, pairwise sequence comparison algorithms and similar algorithms known in this art may be used as appropriate.

[0072] Other specific examples of this disclosure provide a vector comprising a polynucleotide encoding a polypeptide (e.g., a variant of glutamine-GMP synthase) having glutamine-GMP synthase activity. The vector may be an insertion vector or an expression vector.

[0073] In this specification, the term "vector" means a DNA product for delivering a target polynucleotide in a suitable host or host cell. As an example, it may comprise, but is not limited to, a base sequence of a polynucleotide operatively linked to a suitable expression regulatory region (or expression regulatory sequence) for expressing the target polypeptide in a suitable host cell. The regulatory sequence may comprise a promoter capable of initiating transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and / or a sequence regulating transcription and / or translation termination. The vector may be maintained independently of the host cell's genome or inserted into the host cell's genome after transfection into a suitable host cell. As an example, a target polynucleotide can be inserted into a chromosome using a vector for insertion. Insertion of a polynucleotide into a chromosome can be achieved by any method known in this art, such as homologous recombination, but is not limited to.

[0074] In this specification, the vectors used are not particularly limited, as long as they can replicate in the host cell and can be selected from all commonly used vectors. Examples of commonly used vectors may include plasmids, myxosomes, viruses, bacteriophages, and their analogues in their native or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A and their analogues may be used as phage vectors or myxosome vectors, and pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors and their analogues may be used as plasmid vectors. Specifically, examples include pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pDCM2, pDC24 and similar vectors, but are not limited thereto.

[0075] The vector may further include a selection marker for confirming the introduction of the transformed cells or the insertion of the transformed cells into the genome. The selection marker is used to confirm the insertion of cells transformed with the vector or polynucleotide and may be used in accordance with a gene form conferring an optional phenotype, such as drug resistance, auxotrophic symptom, resistance to cytotoxic agents, or expression of surface proteins. In an environment treated with a selection agent, only cells exhibiting the selection marker survive or display other phenotypes, thus allowing selection of the transformed cells.

[0076] Expression of polypeptides (variants) in microorganisms can be carried out by introducing a polynucleotide encoding the variant or a vector containing it into a host cell and culturing recombinant cells (e.g., microorganisms) containing it.

[0077] The introduction of a polynucleotide encoding a polypeptide (variant) or a vector containing it into a microorganism can be carried out by a person skilled in the art, using known transformation methods. In this specification, the term "transformation" refers to the introduction of a target polynucleotide or a vector containing it into a host cell (microorganism) to alter the genetic characteristics of the host cell (microorganism). The transformed polynucleotide may be inserted into and placed within the chromosome of the host cell or placed outside the chromosome. Depending on the purpose of the introduction, the polynucleotide may be introduced in an appropriate form. For example, the polynucleotide may be introduced into the host cell in the form of an expression cartridge, which is a genetic structure containing all the elements required for its own expression. The expression cartridge typically contains expression regulatory elements operatively linked to the promoter of the polynucleotide, transcription termination signals, ribosome binding sites, and / or translation termination signals, and the like. The expression cartridge may be in the form of a self-replicating expression vector. Alternatively, the polynucleotide may be introduced into the host cell in its own form and operatively linked to a sequence required for expression in the host cell. In the above text, the term "operably linked" can mean that regulatory elements (e.g., promoters) and polynucleotides can be functionally linked to enable transcriptional regulation of the polynucleotide (e.g., transcription initiation). Operable links can be performed using gene recombination techniques known in this field.

[0078] The method for transforming polynucleotides into host cells can be carried out by any method used for introducing nucleic acids into cells (microorganisms), and can be carried out by appropriately selecting a transformation technique known in this art. Examples of known transformation methods include electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) precipitation (PEG-mediated absorption), DEAE-polydextrose method, cationic liposome method, liposome transfection, lithium citrate-DMSO method, and similar methods, but are not limited thereto.

[0079] Another specific example of this disclosure provides a microorganism with enhanced glutamylamine hydrolyzing GMP synthase activity.

[0080] The microorganism may be a microorganism comprising at least one of the following (e.g., one or more, two or more, or one, two or three): the aforementioned polypeptide (variant) having glutamine hydrolytic GMP synthase activity, the polynucleotide encoding (or writing) the polypeptide, and the carrier comprising the polynucleotide.

[0081] Other specific examples disclosed herein provide microorganisms with enhanced activity.

[0082] The microorganism may be at least one of the following groups (e.g., one or more, two or more, or one, two or three): the above-mentioned active polypeptide (variant), the polynucleotide encoding (or writing) the polypeptide, and the carrier containing the polynucleotide.

[0083] In this specification, the term "enhancement" for peptide activity (e.g., glutamine hydrolase synthase activity) means an increase in the activity of a peptide in a host cell (microorganism) compared to its intrinsic activity. Enhancement may be used interchangeably with terms such as activation, upregulation, overexpression, increase, and the like. In this context, activation, enhancement, upregulation, overexpression, and increase may include exhibiting activity that was not initially present, or exhibiting an improved activity compared to intrinsic activity or activity prior to modification. "Intrinsic activity" means the activity of a specific peptide that the parent strain initially possessed before the trait change or in the unmodified microorganism when the trait is altered by genetic mutation due to natural or artificial factors. This may be used interchangeably with "activity prior to modification." "Enhancement," "upregulation," "overexpression," or "increase" of peptide activity compared to intrinsic activity means that it is improved compared to the activity and / or concentration (expression level) of the specific peptide initially possessed by the parent strain before the trait change or in the unmodified microorganism.

[0084] Enhancement can be achieved by introducing foreign peptides or enhancing the activity and / or concentration (performance level) of intrinsic peptides. Whether the activity of a peptide is enhanced can be confirmed by the degree of activity, the performance level of the corresponding peptide, or the increase in the amount of product released from the corresponding peptide.

[0085] To enhance the activity of the peptide, various methods well known in this technique can be applied, and there are no limitations, as long as the activity of the target peptide is enhanced compared to the unmodified microorganism. Specifically, genetic engineering and / or protein engineering, which are conventional methods of molecular biology well known to those skilled in the art, can be used, but are not limited to these (e.g., Sitnicka et al., Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al., Molecular Cloning 2012, etc.).

[0086] Specifically, the enhancement of the polypeptide disclosed herein may be: 1) increasing the number of polynucleotides encoding the polypeptide in the cell; 2) replacing the gene expression regulatory region on the chromosome encoding the polypeptide with a sequence of high activity; 3) modifying the start codon or 5'-UTR sequence of the total transcript of the gene encoding the polypeptide; 4) modifying the amino acid sequence of the polypeptide to enhance its activity; 5) modifying the polynucleotide sequence encoding the polypeptide to enhance its activity (e.g., modifying the polynucleotide of the polypeptide gene to encode a polypeptide modified to enhance its activity); 6) introducing a foreign polypeptide that displays the activity of the polypeptide or encodes its foreign polynucleotide; 7) codon optimization of the polynucleotide encoding the polypeptide; 8) modification or chemical modification by analyzing the tertiary structure of the polypeptide and selecting exposure sites; or 9) regulating the cellular localization of the protein (polypeptide); or 10) a combination of at least two of 1) to 9), but not particularly limited thereto. More specifically,

[0087] 1) Increasing the number of polynucleotides encoding polypeptides in cells can be achieved by introducing a vector that is replicable and functional regardless of the host, wherein the polynucleotides encoding the corresponding polypeptides are operatively linked. Furthermore, this can be achieved by introducing one, two, or more copies of the polynucleotides encoding the corresponding polypeptides into the chromosomes of the host cell. Introduction into the chromosomes can be carried out by introducing a vector capable of inserting the polynucleotides into the chromosomes of the host cell, but is not limited thereto. Vectors are as described above.

[0088] 2) Replacing the expression regulatory region (or expression regulatory sequence) of a gene encoding a polypeptide on a chromosome with a sequence of strong activity can, for example, be achieved by mutation in the sequence through deletion, insertion, non-conserved or conserved substitution or a combination thereof, to further enhance the activity of the expression regulatory region, or by replacing it with a sequence of stronger activity. The expression regulatory region is not particularly limited to this, but may include promoters, operator sequences, sequences encoding ribosome binding sites, and sequences regulating the termination of transcription and translation, and the like. As an example, a strong promoter can replace the original promoter, but this is not limited to this.

[0089] Examples of known strong promoters include, but are not limited to, the CJ1 to CJ7 promoters (US Patent 7662943 B2), the lac promoter, the trp promoter, the trc promoter, the tac promoter, the λ phage PR promoter, the PL promoter, the tet promoter, the gapA promoter, the SPL7 promoter, the SPL13(sm3) promoter (US Patent 10584338 B2), the O2 promoter (US Patent 10273491 B2), the tkt promoter, the yccA promoter, and similar promoters.

[0090] 3) The start codon or 5'-UTR sequence of the total transcript of the gene encoding the polypeptide may be replaced, for example, with a sequence encoding another start codon that has a higher polypeptide expression rate than the original start codon, but is not limited thereto.

[0091] Modifications to the amino acid sequences or polynucleotide sequences of [4) and [5] may be achieved by mutations in the sequence through deletion, insertion, non-conservative or conserved substitution, or a combination thereof, or by substitution with an amino acid sequence or polynucleotide sequence modified to have greater activity for the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide in order to enhance the activity of the polypeptide, but are not limited thereto. Substitution may specifically be performed by inserting the polynucleotide into the chromosome through homologous recombination, but is not limited thereto. The vector used may then further include selection markers for determining chromosomal insertion. Selection markers are as described above.

[0092] 6) Introducing a foreign polypeptide exhibiting polypeptide activity can be achieved by introducing a foreign polynucleotide encoding the polypeptide that exhibits the same / similar activity as the polypeptide into the host cell. The foreign polynucleotide is not limited in its source or sequence, as long as it exhibits the same / similar activity as the polypeptide. The method of introduction can be carried out by someone of ordinary skill in the art by appropriately selecting known transformation methods, and by expressing the introduced polynucleotide in the host cell, the polypeptide can be produced and its activity can be increased.

[0093] 7) Codon optimization of polynucleotides encoding polypeptides may be codon optimization that increases the transcription or translation of intrinsic polynucleotides in the host cell, or codon optimization that optimizes foreign polynucleotides in the host cell to achieve transcription and translation.

[0094] 8) By analyzing the tertiary structure of the polypeptide and selecting exposure sites for modification or chemical modification, the similarity of the visible sequences is used to determine template protein candidates by comparing the sequence information of the polypeptide to be analyzed, and based on this, the structure is confirmed, and exposure sites to be modified or chemically modified are selected, and then transformed or modified.

[0095] 9) Regulating the cellular localization of a peptide can target the peptide to specific organelles or specific intracellular spaces. For example, by adding or removing a leader sequence that functions in the target peptide, it can be targeted to the extracellular matrix or cytoplasm, but is not limited thereto.

[0096] This enhancement of peptide activity means, but is not limited to, increasing the level of activity or concentration of the corresponding peptide based on the activity or concentration of the peptide in wild-type or pre-transformed microbial strains, or increasing the amount of product produced by the corresponding peptide.

[0097] In this specification, the term "microorganism (or strain)" can include all wild-type microorganisms or those that have undergone genetic modification in a natural or artificial manner. A microorganism is one in which a particular mechanism is enhanced or weakened due to reasons such as the insertion of an exogenous gene or the enhancement or weakening of the activity of an endogenous gene, and may contain genetic modifications for the production of target peptides, proteins, or products (e.g., GMP). In this disclosure, the terms "microorganism," "strain," "host," and "host cell" are used interchangeably.

[0098] The microorganisms disclosed herein may be microorganisms with enhanced activity of glutamine hydrolyzing GMP synthase, or with improved (or increased) GMP conversion efficiency, or with GMP production energy (or generating) or with improved (or increased) GMP production energy.

[0099] In this disclosure, "GMP production capacity" can be used interchangeably with "GMP conversion efficiency".

[0100] As an example, the microorganism disclosed herein may be a microorganism that provides or improves GMP production energy, because the polypeptide (variant) of the disclosed present invention having glutamine hydrolytic GMP synthase activity or the polynucleotide encoding it is introduced into a microorganism that does not have GMP production energy (conversion efficiency) or a microorganism that naturally has GMP production energy, but is not limited thereto.

[0101] In this specification, the term "microorganism with enhanced glutamine-hydrolyzing GMP synthase activity" may mean that a microorganism that does not have GMP production capacity has GMP production energy, or has GMP production energy higher than the original GMP production energy, such as the aforementioned polypeptide (variant) that has been engineered (mutated) to exhibit glutamine-hydrolyzing GMP synthase activity.

[0102] In this disclosure, "non-modified microorganism" does not exclude mutant strains that can exist naturally in microorganisms, and may mean the wild-type strain or the natural strain itself, or the strain before its traits were altered by genetic mutation due to natural or artificial factors. For example, unmodified microorganism may mean a strain that does not contain the polypeptide (variant) with glutamine-hydrolyzing GMP synthase activity disclosed herein, or a polynucleotide encoding a polypeptide (variant) with glutamine-hydrolyzing GMP synthase activity, or a strain before its introduction according to a specific example. "Non-modified microorganism" may be used interchangeably with "unmodified strain," "unmodified microorganism," "unmutated microorganism," or "reference microorganism."

[0103] In this disclosure, the reference microorganism may be a wild-type microorganism known to produce GMP, and for example, it may be *Corynebacterium tarda* ATCC6872. Furthermore, the reference microorganism may be a microorganism known to produce GMP or convert XMP to GMP, and for example, it may be *Corynebacterium tarda* KCCM13320P, but is not limited thereto. Additionally, the reference microorganism may be a wild-type *Corynebacterium casei*, and specifically, it may be *Corynebacterium casei* strain LMG S-19264, but is not limited thereto.

[0104] The microorganisms used in the production of GMP disclosed herein are not subject to any particular restrictions, as long as they can produce GMP, but they can be microorganisms of the genus Corynebacterium. Microorganisms of the genus *Corynebacterium* can be selected from at least one group of the following: *Corynebacterium stagnantum*, *Corynebacterium casei*, *Corynebacterium thermoaminogenes*, *Corynebacterium glutamicum*, *Brevibacterium flavum*, *Brevibacterium lactofermentum*, *Corynebacterium crudilactis*, *Corynebacterium deserti*, *Corynebacterium efficiens*, *Corynebacterium callunae*, *Corynebacterium singulare*, *Corynebacterium halotolerans*, *Corynebacterium striatum*, *Corynebacterium pollutisoli*, and *Corynebacterium mimicryum*. The species include, but are not limited to, Corynebacterium testudinoris and Corynebacterium flavescens.

[0105] Another specific example of this disclosure provides a method for producing GMP, which includes: culturing microorganisms with enhanced activity of glutamine hydrolyzing GMP synthase in a culture medium.

[0106] Microorganisms with enhanced glutamylamine hydrolyzing GMP synthase activity and GMP as described above.

[0107] In this disclosure, "culturing" means the growth of microorganisms, such as Corynebacterium spp., under appropriate and controlled environmental conditions, wherein the polypeptide or gene encoding the glutamine-hydrolyzing GMP synthase activity disclosed herein is introduced, or its activity is enhanced. The culturing process disclosed herein can be carried out according to appropriate culture media and culturing conditions known in this art. This culturing process can be readily adapted and used by those skilled in the art based on the selected strain. Specifically, the culturing can be batch, continuous, and / or fed-batch, but is not limited thereto.

[0108] In this disclosure, "medium" means a substance in which nutrients required for culturing microorganisms (e.g., Corynebacterium) are mixed as the main components, wherein the polypeptide with glutamine-hydrolyzing GMP synthase activity disclosed herein is introduced or the gene encoding it is introduced or its activity is enhanced, and the substance supplies nutrients and growth factors, including water necessary for survival and development. Additionally, XMP may be included in the culture medium used for GMP synthesis. Specifically, the culture medium and other culture conditions used to culture the microorganisms disclosed herein are not subject to specific restrictions, as long as they are culture media used for culturing common microorganisms. However, the microorganisms disclosed herein can be cultured under aerobic conditions in common culture media containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids and / or vitamins and their analogues, while adjusting temperature, pH and their analogues.

[0109] In this disclosure, carbon sources may include carbohydrates such as glucose, sucrose, lactose, fructose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactate, citrate, etc.; amino acids such as glutamic acid, methionine, lysine, etc., and their analogues. Additionally, natural organic nutrients such as starch hydrolysates, molasses (e.g., blackstrap molasses), rice bran, cassava, bagasse, and corn extract may be used. Specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted to reducing sugars) and their analogues may be used, and various other suitable carbon sources may be used without restriction. These carbon sources may be used alone or in combinations of two or more categories, but are not limited thereto.

[0110] As a nitrogen source, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium citrate, ammonium phosphate, ammonium carbonate, ammonium nitrate, and the like can be used; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, and the like, protein, NZ-amine, meat extract, yeast extract, malt extract, corn extract, casein hydrolysate, fish or its decomposition products, defatted soybean meal or its decomposition products, and the like. These nitrogen sources can be used alone or in combination of two or more categories, but are not limited thereto.

[0111] The phosphorus source may include potassium dihydrogen phosphate, dipotassium phosphate, or their corresponding sodium-containing salts and analogues. As inorganic compounds, sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, and analogues may be used, and may contain other amino acids, vitamins, and / or suitable precursors and analogues. These components or precursors may be added to the culture medium in batches or continuously. However, it is not limited thereto.

[0112] Furthermore, during the cultivation of the microorganisms disclosed herein, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphate, sulfate, and similar substances are added to the culture medium by appropriate methods to adjust the pH of the culture medium. In addition, during cultivation, antifoaming agents, such as polyethylene glycol fatty acids, are used to suppress air formation. Furthermore, to maintain aerobic conditions in the culture medium, oxygen or oxygen-containing gas may be injected into the culture medium; or to maintain anaerobic and non-aerobic conditions, no gas may be injected, or nitrogen, hydrogen, or carbon dioxide gas may be injected, but these are not limited to these methods.

[0113] The culture temperature in the culture disclosed herein can be maintained at 20 to 45°C or 25 to 37°C, specifically 25 to 37°C, and the culture can be carried out for about 10 to 160 hours or about 20 to 120 hours, but is not limited thereto.

[0114] The GMP produced by the culture disclosed herein may be secreted into the culture medium or retained in the cells.

[0115] The method disclosed herein for producing GMP may include adding an enzyme or adding a microorganism expressing the enzyme to a culture medium. For example, the method may further include adding an enzyme that converts XMP to GMP or a microorganism expressing the enzyme and / or culturing the microorganism after culturing a microorganism that produces XMP.

[0116] In one specific example, the method disclosed herein for producing GMP may further include, prior to the step of culturing microorganisms with enhanced glutamylamine hydrolyzing GMP synthase activity in a culture medium, a step of culturing microorganisms that produce 5'-xanogenic acid (XMP), or a step of adding XMP to the culture medium.

[0117] The method for producing GMP disclosed herein may further include recovering GMP from the cultured microorganisms (e.g., Corynebacterium spp.), the culture medium (in which the culture is carried out), or both. Recovery may be further included after culture.

[0118] The target purine nucleotides can be recovered from the culture medium or microorganisms using appropriate methods known in this art, according to the microbial culture methods disclosed herein, such as batch, continuous, or fed-batch culture methods. For example, centrifugation, filtration, treatment with a protein precipitant (salting out method), extraction, ultrasonic destruction, ultrafiltration, dialysis, various types of chromatography (such as molecular sieve chromatography (gel filtration), absorption chromatography, ion exchange chromatography, affinity chromatography and similar chromatography), HPLC, or combinations thereof, using suitable methods known in this art.

[0119] The method for producing GMP disclosed herein may additionally include a purification step. Purification may be performed using appropriate methods known in this art. In one specific instance, when the method for producing GMP includes both a recovery step and a purification step, the recovery step and the purification step may be performed sequentially or discontinuously, in no particular order, or simultaneously or integrated into a single step, but are not limited thereto.

[0120] Another specific example of this disclosure provides a composition for the production of GMP, which includes a microorganism having enhanced activity of a glutamine-hydrolyzing GMP synthase, or a culture medium for culturing the microorganism, or a combination thereof.

[0121] Microorganisms with enhanced glutamylamine hydrolyzing GMP synthase activity and GMP as described above.

[0122] Other specific examples provide an application for GMP production of microorganisms.

[0123] Other specific examples provide a use for preparing a composition for the production of microorganisms in GMP.

[0124] The compositions disclosed herein may further include any suitable excipients commonly used in the production of GMP compositions, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, or tension modifiers or the like, but are not limited thereto. [Advantageous Effects]

[0125] This disclosure relates to a novel glutamine hydrolyzing GMP synthase variant and a method for producing 5'-guanosine monophosphate using the same, and high-yield GMP production is possible by culturing microorganisms containing the glutamine hydrolyzing GMP synthase variant disclosed herein.

Implementation Method

[0127] The present disclosure will be described in more detail below by way of examples. However, the following examples are merely preferred embodiments for illustrating the present disclosure and are therefore not intended to limit the scope of the disclosure. On the other hand, those skilled in the art or similar art will fully understand and readily implement technical matters not described in this specification. Example 1: Identification of mutations for enhancing the activity of glutamine hydrolyzing GMP synthase

[0128] According to the following examples, the activity of glutamine-hydrolyzing GMP synthase (GuaA protein) encoded by the guaA gene (SEQ ID NO: 2), a protein inherently present in Corynebacterium spp., was enhanced to identify protein mutations that increase GMP conversion efficiency. Example 1-1: Construction of a vector containing guaA

[0129] In order to construct a guaA library for identifying mutations that enhance the activity of GuaA, which is predicted to be related to GMP conversion efficiency, a pCES208-Pn vector containing the guaA promoter and 500 bp (SEQ ID NO: 51) upstream nucleotides of guaA was first constructed.

[0130] Specifically, the chromosomal gene of wild-type Corynebacterium ATCC6872 was isolated using the G-spin total DNA extraction mini kit (catalog number 17045) from Intron, according to the protocol provided in the kit. The guaA gene fragment was obtained by polymerase chain reaction using primer pairs SEQ ID NO: 3 and SEQ ID NO: 4. The reaction was performed under PCR amplification conditions of denaturation at 95°C for 5 minutes, followed by repeated denaturation at 95°C for 30 seconds, bonding at 55°C for 30 seconds, polymerization at 72°C for 40 seconds 25 times, and then polymerization at 72°C for 5 minutes.

[0131] The gene fragment obtained above was mixed with the pCES208 vector prepared by digestion with XbaI and BamHI restriction enzymes, and the recombinant plasmid was selected and colonized using the Gibson assembly method (DG Gibson et al., NATURE METHODS, Vol. 6, No. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix) and named pCES208-Pn.

[0132] On the other hand, a vector was constructed to serve as a control group for evaluating random mutations in guaA by the following method.

[0133] Specifically, by PCR, using the chromosomal DNA of Corynebacterium ATCC6872 strain as a template, the gene fragment SEQ ID NO: 1 used for constructing the vector was obtained. The PCR product was obtained using primers SEQ ID NO: 5 and SEQ ID NO: 6, and Solg™ Pfu-X DNA polymerase was used as the polymerase. The PCR amplification conditions were as follows: denaturation at 95°C for 5 minutes, repeated denaturation at 95°C for 30 seconds, bonding at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes 25 times, followed by polymerization at 72°C for 5 minutes to obtain the PCR product. The amplified product was mixed with the pCES208-Pn vector previously prepared by digestion with XbaI and BamHI restriction enzymes, and the recombinant plasmid was obtained by selection using the Gibson assembly method (DG Gibson et al., NATURE METHODS, Vol. 6, No. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix), and named pCES208-Pn-guaA(wt).

[0134] The sequence of primers used in Example 1-1 is shown in Table 1 below. [Table 1] name Sequence (5'->3') SEQ ID NO pCES208-Pn-F GGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGTGGCAGTAGCTGAAATCATT SEQ ID NO: 3 pCES208-Pn-R GGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTTGGATCCCACAGGTAGTTTAACACACCC SEQ ID NO: 4 pCES208-Pn-guaA(wt)-F GTTTACCGCCGTAGGCCGCGGGTGtGTTAAACTACCTGTATGACTCAACCTGCAACAACT SEQ ID NO: 5 pCES208-Pn-guaA(wt)-R CTATAGGGCGAATTGGAGCTCCACCGCGGTGGCGGCCGCTTTACTCCCACTCGATGTGTTC SEQ ID NO: 6 Examples 1-2: Construction of the guaA Mutant Library

[0135] Based on the vector constructed in Example 1-1, the guaA mutant library vector was constructed by the following method. By PCR, using the chromosomal DNA of Corynebacterium ATCC6872 strain as a template, gene fragments for constructing the random library vector were obtained.

[0136] Specifically, a vector was constructed in which the polynucleotide encoding the guaA gene (in which the mutation is introduced into the endogenous guaA gene locus of Corynebacterium tarda) can be substituted, and an error-prone PCR kit (clontech Diversify® PCR random mutation induction kit) was used as a library. Mutations were randomly induced using primers SEQ ID NO: 5 and SEQ ID NO: 6 according to the manufacturer's manual to obtain guaA mutant PCR products with different sequences. The amplified products were mixed with the pCES208-Pn vector previously prepared by digestion with XbaI and BamHI restriction enzymes, and selected using the Gibson assembly method (DG Gibson et al., NATURE METHODS, Vol. 6, No. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain recombinant plasmids, which were named the pCES208-Pn-guaA random library. Examples 1-3: Evaluation of the constructed guaA random library and selection of strains.

[0137] The pCES208-Pn-guaA random library constructed in Examples 1-2 was transformed into GMP-transformed strain KCCM13320P (KR 10-2024-0133212 A) or Corynebacterium ATCC6872 (Appl. Microbiol. Biotechnol. (1999) 52:541-545) by electroporation, and then 10,000 bacterial colonies with the inserted mutant gene were obtained by dispersing them on seed culture medium containing 25 mg / L succinate and 2% agar. Each colony was named pCES208-Pn-guaA(mt)_1 to pCES208-Pn-guaA(mt)_10000.

[0138] Using a Qpix420 device (a colony selection device from Molecular Devices), 10,000 colonies were inoculated into 96-well discs containing 350 mg / L seed medium containing comycin (25 mg / L), corresponding to a 17% fill rate per well. Four wells of *Corynebacterium ATCC6872* containing the vector pCES208-Pn-guaA(wt) encoding wild-type guaA were inoculated into the same disc and used as a control group for screening variants with high GMP transformation efficiency. The 96-well discs containing the control strain and variants were sealed using an Azenta gas permeable seal mark 2 and then incubated for 48 hours at 30°C and 1,000 rpm in a Multitron device (an incubator from Infortr. HT). 1% xylene was added to the cultured strains and variants, and the mixture was incubated for an additional hour. Then, 150 μL of potency assessment solution containing XMP was added, and the mixture was incubated for an additional 12 hours in a Multitron apparatus (Infors-HT shaking incubator) at 30°C and 1,000 rpm. After 12 hours of incubation, the 96-well deep-well plates were centrifuged for 20 minutes at 15°C and 4,000 rpm in a Centrifuge 5810R centrifuge (Eppendorf centrifuge). Subsequently, for NIR spectroscopy, 100 μL of the culture supernatant used for separating microbial cells was transferred to a Corning 96-well black polystyrene microplate using a Biomek i5 (Beckman Coulter liquid processor). Subsequently, individual analytical spectra of each well were obtained using NIR spectroscopy. Based on the quantified culture samples with GMP concentrations obtained through initial HPLC analysis, a regression analysis prediction model was used. For the established GMP concentration range of 0-20 g / L, the coefficient of determination was 0.96. Applying a selection logic of 15% or more GMP concentration improvement compared to the control group, six strains were initially selected from 10,000 variants. These six selected strains were then cultured using the same method, ultimately leading to the selection of two strains with high GMP concentrations.

[0139] The composition of the seed culture medium and potency evaluation solution used in Examples 1-3 is as follows: <Seed Culture Medium> 30 g / L glucose, 15 g / L peptone, 15 g / L yeast extract, 2.5 g / L sodium chloride, 3 g / L urea, 150 mg / L adenine, 150 mg / L guanine, 20 g / L agar, pH 7.0 (based on 1 liter of distilled water) <Potency Evaluation Solution> 24.20 g / L Trizma base, 30 g / L ATP, 30 g / L XMP-2Na-7H2O, 15 g / L magnesium sulfate, 20 g / L ammonium sulfate Examples 1-4: Confirmation of guaA mutation by gene sequencing

[0140] In order to confirm the mutant sequences of the guaA gene of the two mutant strains selected in Examples 1-3, PCR and sequencing were performed on the pCES208-Pn-guaA(mt)_2338 and pCES208-Pn-guaA(mt)_3450 strains using the primer pairs of SEQ ID NO: 7 and SEQ ID NO: 8, and the sequences were compared with the guaA gene sequence of the wild-type Corynebacterium ATCC6872 strain.

[0141] Based on the comparison with the guaA gene sequence of the wild-type strain, it was confirmed that strain pCES208-Pn-guaA(mt)_2338 contains a mutation in which the 123rd amino acid encoded by the guaA gene (SEQ ID NO: 1) is replaced by lysine (K) instead of aspartic acid (D), and strain pCES208-Pn-guaA(mt)_3450 contains a mutation in which the 441st amino acid encoded by the guaA gene is replaced by valine (V) instead of aspartic acid (D), as described above.

[0142] The sequences of primers used in Examples 1-4 are shown in Table 2 below. [Table 2] name Sequence (5'->3') SEQ ID NO pCES208-Pn-guaA seq-F TTCGAGCTCGGTACCCGTCAGCAGTGGAACGAAGGCGAC SEQ ID NO: 7 pCES208-Pn-guaA seq-R CTCTAGAGGATccccAGATATCGGTCAGGTGGTCATCG SEQ ID NO: 8

[0143] The following examples will demonstrate whether the guaA mutation affects GMP transformation efficiency. Example 2: Construction of strains with guaA variant and evaluation of GMP production capacity (conversion efficiency) Example 2-1: Construction of recombinant vectors for introducing guaA variant

[0144] In order to verify the effects of the D123K mutation and D441V mutation identified in Examples 1-4 on GMP production energy (conversion efficiency), a vector was constructed to introduce the mutation into the endogenous guaA gene of the Corynebacterium tumefaciens strain.

[0145] First, in order to verify the effect of the mutant guaA (D123K) in which the aspartic acid at position 123 of the amino acid sequence of the GuaA protein is replaced by lysine on the GMP transformation efficiency, the plastid pDC244 (SEQ ID NO: 112), which is used to insert and replace genes in the chromosome of Corynebacterium, was used to construct a vector to construct a strain that expresses it.

[0146] Using the pCES208-Pn-guaA(mt)_2338 vector as a template, PCR was performed using the primer pairs of SEQ ID NO: 9 and SEQ ID NO: 10. Solg™ Pfu-X DNA polymerase was used as the polymerase, and the PCR amplification conditions were: denaturation at 95°C for 5 minutes, followed by repeated denaturation at 95°C for 30 seconds, binding at 55°C for 30 seconds, and polymerization at 72°C for 2 minutes 25 times, followed by polymerization at 72°C for 5 minutes to obtain the PCR product. The obtained PCR product was mixed with the pDC24 vector prepared by previous digestion with XbaI restriction enzyme, and selected using the Gibson assembly method (DG Gibson et al., NATURE METHODS, Vol. 6, No. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain recombinant plasmids, which were named pDC24-guaA (D123K).

[0147] Using the same method, in order to verify the effect of the mutant guaA (D441V) in which the aspartic acid at position 441 of the amino acid sequence of the GuaA protein is replaced by valine on the GMP conversion efficiency, the pCES208-Pn-guaA(mt)_3450 vector was used as a template and the primer pair of SEQ ID NO: 9 and SEQ ID NO: 10 was used to obtain the PCR product, which was then colonized into the pDC24 vector cut by XbaI to construct a recombinant plasmid, and named pDC24-guaA (D441V).

[0148] The sequence of primers used in Example 2-1 is shown in Table 3 below. [Table 3] name Sequence (5'->3') SEQ ID NO pDC24-guaA(mt)-F acgacggccagtgaattcgagctcggtacccggggatcctTGGCAGTAGCTGAAATCATT SEQ ID NO: 9 pDC24-guaA(mt)-R gaccatgattacgccaagcttgcatgcctgcaggtcgactTTACTCCCACTCGATGGTTC SEQ ID NO: 10 Example 2-2: Construction of strains representing the guaA variant

[0149] In order to verify the effect of the D123K mutation and D441V mutation identified in Examples 1-4 on GMP production energy (conversion efficiency), a strain with the endogenous guaA gene of the stationary Corynebacterium strain was constructed.

[0150] The pDC24-guaA (D123K) and pDC24-guaA (D441V) vectors constructed in Example 2-1 were transformed into GMP-transformed strains, namely, *Corynebacterium tumefaciens* KCCM13320P, by electroporation. Strains that inserted the vector into the chromosome through recombinant homologous sequences in a selective medium containing 25 mg / L conomycin were selected as the primary candidate strains. The selected primary strains were subcultured again through secondary crossover, and strains with mutations in the target gene were selected. After PCR using the primer pairs SEQ ID NO: 11 and SEQ ID NO: 12, the gene mutations of the finally transformed strains were confirmed by sequencing SEQ ID NO: 11 and SEQ ID NO: 12. The obtained strains were named KCCM13320P::guaA(D123K) or ATCC6872::guaA(D123K), KCCM13320P::guaA(D441V) or ATCC6872::guaA(D441V), respectively.

[0151] The sequence of primers used in Examples 2-2 is shown in Table 4 below. [Table 4] name Sequence (5'->3') SEQ ID NO pDC24-guaA seq-F TGTGATTGCCGGTGCCAGCA SEQ ID NO: 11 pDC24-guaA seq-R CCTACTAAAGGCGAAGCCCC SEQ ID NO: 12 Examples 2-3: Evaluation of GMP production capacity of strains exhibiting the guaA variant

[0152] In order to verify the GMP transformation efficiency of the two strains KCCM13320P::guaA (D123K) and KCCM13320P::guaA (D441V) produced in Example 2-2, they were cultured by the following method.

[0153] Specifically, the parent strain (Corynebacterium tarda KCCM13320P) and the two mutant strains produced in Examples 2-2 were inoculated into 250 ml Erlenmeyer flasks (corner-baffled flasks) containing 25 ml of seed medium as described in Examples 1-3, and then cultured at 30°C with shaking at 200 rpm for 20 hours. 800 ml of the potency evaluation solution described in Examples 1-3 was added to 200 ml of culture medium, and the mixture was reacted at 42°C for 30 minutes to convert XMP to GMP. After the culture was completed, the amount of GMP produced was measured using liquid high performance chromatography, and the GMP concentration in the culture medium of each experimental strain is shown in Table 5 below. [Table 5] Comparison of GMP conversion efficiency of Corynebacterium tarda KCCM13320P, KCCM13320P::guaA (D123K), and KCCM13320P::guaA (D441V) strain number XMP Concentration (g / l) GMP Concentration (g / l) Increase / decrease in GMP production compared to parent strain (%) KCCM13320P (parental strain) 8.30 2.06 - KCCM13320P:: guaA (D123K) 7.10 3.28 159% KCCM13320P:: guaA (D441V) 6.53 3.83 186%

[0154] Therefore, as shown in Table 5, it was confirmed that the parent strain Corynebacterium tarda (ammonia-producing Corynebacterium) KCCM13320P produced (transformed) GMP at a concentration of 2.06 g / l, but the mutant strains KCCM13320P::guaA (D123K) and KCCM13320P::guaA (D441V) which introduced mutations into the GuaA protein transformed GMP at concentrations of 3.28 g / l and 3.83 g / l, respectively.

[0155] These results confirm that, compared with strains without introduced mutations, strains with mutations in the amino acid sequence encoding the guaA gene, either with lysine substitution at amino acid position 123 or valine substitution at amino acid position 441, exhibit increased GMP production. Examples 2-4: Assessment of GDP Production Energy of Strains Exhibiting the guaA Variant

[0156] In addition to the GMP conversion efficiency of the two mutant strains KCCM13320P::guaA (D123K) and KCCM13320P::guaA (D441V) produced in Examples 2-2, to verify the effect of factors increasing the GMP synthesis pathway, namely GDP production energy, the two mutant strains were cultured using the same method as in Examples 2-3, and 800 μL of the potency evaluation solution described in Examples 1-3 was added to 200 μL of culture solution, and the mixture was reacted at 42°C for 30 minutes to convert XMP to GMP. After the culture was completed, the production of GMP and GDP was measured using liquid high performance chromatography, and the concentrations are shown in Table 6 below. [Table 6] strain number XMP Concentration (g / l) GMP Concentration (g / l) GDP Concentration (g / l) KCCM13320P (parental strain) 6.30 2.01 0.31 KCCM13320P:: guaA (D123K) 5.10 3.14 0.48 KCCM13320P:: guaA (D441V) 4.53 3.69 0.52

[0157] Therefore, as shown in Table 6 above, it was confirmed that the parent strain Corynebacterium tarda KCCM13320P produced GMP at a concentration of 2.01 g / l and GDP at a concentration of 0.31 g / l. Among them, the mutant strains KCCM13320P::guaA (D123K) and KCCM13320P::guaA (D441V) which introduced the mutation into the GuaA protein were transformed into GMP at concentrations of 3.14 g / l and 3.69 g / l, respectively, and produced GDP at concentrations of 0.48 g / l and 0.52 g / l, respectively.

[0158] These results confirm that, compared with strains without introduced mutations, strains with mutations in the amino acid sequence encoding the guaA gene, either by substitution of the 123rd amino acid with lysine or by substitution of the 441st amino acid with valine, exhibit increased GMP production energy (conversion efficiency) and GDP production energy. Example 3: Substitution of the GuaA (D123K) mutant amino acid with another amino acid Example 3-1: Construction of a vector for inserting a substitution of the GuaA (D123) mutant amino acid

[0159] Through the above Example 2, it was confirmed that GMP conversion efficiency can be improved by mutation at the position of GuaA (D123). Therefore, in order to confirm the positional importance of GuaA (D123), a carrier was developed that replaced the 123rd amino acid with another amino acid, and it was confirmed whether it affected GMP conversion efficiency.

[0160] Site-directed mutagenesis was induced using the pDC24-guaA(D123K) vector constructed in Example 2-1 as a template. Specifically, the GuaA (D123E) mutation is introduced using the primer pairs SEQ ID NO: 9 and SEQ ID NO: 13 and SEQ ID NO: 14 and SEQ ID NO: 10; the GuaA (D123H) mutation is introduced using the primer pairs SEQ ID NO: 9 and SEQ ID NO: 15 and SEQ ID NO: 16 and SEQ ID NO: 10; the GuaA (D123M) mutation is introduced using the primer pairs SEQ ID NO: 9 and SEQ ID NO: 17 and SEQ ID NO: 18 and SEQ ID NO: 10; the GuaA (D123Q) mutation is introduced using the primer pairs SEQ ID NO: 9 and SEQ ID NO: 19 and SEQ ID NO: 20 and SEQ ID NO: 10; and the GuaA (D123Q) mutation is introduced using the primer pairs SEQ ID NO: 9 and SEQ ID NO: 21 and SEQ ID NO: 22 and SEQ ID NO: 10. The primer pair 10 was used to introduce the GuaA (D123R) mutation. The primer pairs SEQ ID NO: 9 and SEQ ID NO: 23 and SEQ ID NO: 24 and SEQ ID NO: 10 were used to introduce the GuaA (D123S) mutation. The primer pairs SEQ ID NO: 9 and SEQ ID NO: 25 and SEQ ID NO: 26 and SEQ ID NO: 10 were used to introduce the GuaA (D123Y) mutation. Site-directed PCR was performed on each of these primer pairs. Solg™ Pfu-X DNA polymerase was used as the polymerase and the PCR amplification conditions were as follows: denaturation at 95°C for 5 minutes, followed by repeated denaturation at 95°C for 30 seconds, binding at 55°C for 30 seconds, and polymerization at 72°C for 1 minute and 30 seconds 25 times, followed by polymerization at 72°C for 5 minutes to obtain the PCR products. Each amplification product was treated with DpnI restriction enzyme to remove pDC24-guaA (D123K) used as template, and then transformed into DH5α to obtain plastids, in which the 123rd amino acid of GuaA was modified to the target amino acid.

[0161] The information on the obtained plasmids is shown in Table 7 below: [Table 7] List of vectors used for inserting substitutions of GuaA (D123) mutant amino acids serial number plastid name 1 pDC24-guaA(D123E) 2 pDC24-guaA(D123H) 3 pDC24-guaA (D123M) 4 pDC24-guaA(D123Q) 5 pDC24-guaA(D123R) 6 pDC24-guaA(D123S) 7 pDC24-guaA(D123Y) Example 3-2: Construction of a mutant strain with a 123rd amino acid variant of GuaA substituted with another amino acid and confirmation of its GMP transformation efficiency.

[0162] The seven vectors used to introduce mutations produced in Example 3-1 were transformed into Corynebacterium tumefaciens strain KCCM13320P by electroporation, and strains that inserted the vectors into chromosomes by recombinant homologous sequences were selected in a medium containing 25 mg / L conomycin. The selected master strains were subcultured again through a second crossover, and strains that introduced mutations into the target gene were selected. The introduction of gene mutations in the final transformed strains was confirmed by PCR and sequencing using the primer pair of SEQ ID NO: 11 and SEQ ID NO: 12, and the strains with inserted mutations are shown in Table 8 below: [Table 8] List of strains with mutations of the 123rd amino acid variant of GuaA substituted with another amino acid. serial number strain name 1 KCCM13320P::guaA(D123E) 2 KCCM13320P::guaA(D123H) 3 KCCM13320P::guaA(D123M) 4 KCCM13320P::guaA(D123Q) 5 KCCM13320P::guaA(D123R) 6 KCCM13320P::guaA(D123S) 7 KCCM13320P::guaA(D123Y)

[0163] The seven strains produced above, as well as strains KCCM13320P and KCCM13320P::guaA (D123K), were cultured using the same method as in Examples 2-3 to evaluate the GMP transformation efficiency. The evaluation results are shown in Table 9 below: [Table 9] Evaluation results of GMP transformation efficiency of strains with mutations of the 123rd amino acid variant of GuaA substituted with another amino acid. strain number XMP concentration (g / l) GMP concentration (g / l) Increase / decrease in GMP production compared to parent strain (%) KCCM13320P (parental strain) 8.40 2.63 - KCCM13320P::guaA(D123K) 7.03 3.98 151% KCCM13320P::guaA(D123E) 8.23 2.72 103% KCCM13320P::guaA(D123H) 8.08 2.67 101% KCCM13320P::guaA(D123M) 7.96 2.65 101% KCCM13320P::guaA(D123Q) 8.15 2.77 105% KCCM13320P::guaA(D123R) 8.17 2.79 106% KCCM13320P::guaA(D123S) 8.27 2.66 101% KCCM13320P::guaA(D123Y) 8.32 2.72 103%

[0164] Therefore, as shown in Table 9, it can be confirmed that among GMP-producing strains, strains containing the guaA mutant gene (where the 123rd amino acid of the amino acid sequence encoded by the guaA gene is substituted with another amino acid) have increased GMP production compared to the parent strain KCCM13320P (which does not contain the mutation). In other words, it has been confirmed that the 123rd amino acid of the amino acid sequence encoded by the guaA gene is an important mutation site in GMP production (conversion). More specifically, it has been confirmed that microorganisms containing the following mutations have significantly increased GMP production energy (conversion efficiency) when the 123rd amino acid of the amino acid sequence encoded by the guaA gene is substituted with lysine, glutamic acid, histidine, methionine, glutamic acid, arginine, serine, or tyrosine. Example 4: Substitution of the GuaA (D441V) mutant amino acid with another amino acid. Example 4-1: Construction of a vector for inserting a substitution of the GuaA (D441) mutant amino acid.

[0165] Through the above Example 2, it was confirmed that the GMP conversion efficiency can be improved by the mutation at the position of GuaA (D441). Therefore, in order to confirm the positional importance of GuaA (D441), a carrier was developed that replaced the 123rd amino acid with another amino acid, and it was confirmed whether it affected the GMP conversion efficiency.

[0166] Site-directed mutagenesis was induced using the pDC24-guaA (D441V) vector constructed in Example 2-1 as a template. Specifically, the GuaA (D441A) mutation is introduced using the primer pairs SEQ ID NO: 9 and SEQ ID NO: 27 and SEQ ID NO: 28 and SEQ ID NO: 10; the GuaA (D441C) mutation is introduced using the primer pairs SEQ ID NO: 9 and SEQ ID NO: 29 and SEQ ID NO: 30 and SEQ ID NO: 10; the GuaA (D441E) mutation is introduced using the primer pairs SEQ ID NO: 9 and SEQ ID NO: 33 and SEQ ID NO: 34 and SEQ ID NO: 10; and the GuaA (D441F) mutation is introduced using the primer pairs SEQ ID NO: 9 and SEQ ID NO: 35 and SEQ ID NO: 36 and SEQ ID NO: 27. The primer pair 10 introduces the GuaA (D441H) mutation; the primer pairs SEQ ID NO: 9 and SEQ ID NO: 37 and SEQ ID NO: 38 and SEQ ID NO: 10 introduce the GuaA (D441I) mutation; the primer pairs SEQ ID NO: 9 and SEQ ID NO: 39 and SEQ ID NO: 40 and SEQ ID NO: 10 introduce the GuaA (D441K) mutation; the primer pairs SEQ ID NO: 9 and SEQ ID NO: 41 and SEQ ID NO: 42 and SEQ ID NO: 10 introduce the GuaA (D441L) mutation; the primer pairs SEQ ID NO: 9 and SEQ ID NO: 43 and SEQ ID NO: 44 and SEQ ID NO: 10 introduce the GuaA (D441N) mutation; and the primer pairs SEQ ID NO: 9 and SEQ ID NO: 10 introduce the GuaA (D441N) mutation. The GuaA (D441Q) mutation was introduced using primer pair 45 and primer pairs SEQ ID NO: 46 and SEQ ID NO: 10, and the GuaA (D441T) mutation was introduced using primer pairs SEQ ID NO: 9 and SEQ ID NO: 47 and primer pairs SEQ ID NO: 48 and SEQ ID NO: 10.The GuaA (D441W) mutation was introduced using primer pairs SEQ ID NO: 9 and SEQ ID NO: 49, and primer pairs SEQ ID NO: 50 and SEQ ID NO: 10. Site-directed PCR was performed, followed by Solg™ Pfu-X DNA polymerase as the polymerase. The PCR amplification conditions were: denaturation at 95°C for 5 minutes, followed by repeated denaturation at 95°C for 30 seconds, adhesion at 55°C for 30 seconds, polymerization at 72°C for 1 minute and 30 seconds (25 times), and finally polymerization at 72°C for 5 minutes to obtain the PCR products. The amplified products were treated with DpnI restriction enzyme to remove pDC24-guaA (D123K) used as template, and then transfected to DH5α to obtain plasmids, wherein the 441st amino acid of GuaA was modified to a target amino acid.

[0167] The information on the obtained plasmids is shown in Table 10 below: [Table 10] List of vectors used for inserting substitutions of GuaA (D441) mutant amino acids serial number plastid name 1 pDC24-guaA (D441A) 2 pDC24-guaA(D441C) 3 pDC24-guaA(D441E) 4 pDC24-guaA(D441F) 6 pDC24-guaA(D441H) 7 pDC24-guaA(D441I) 8 pDC24-guaA(D441K) 9 pDC24-guaA (D441L) 11 pDC24-guaA(D441N) 13 pDC24-guaA (D441Q) 16 pDC24-guaA(D441T) 17 pDC24-guaA(D441W) Example 4-2: Construction of a mutant strain with a variant of GuaA containing the 441st amino acid substituted with another amino acid and confirmation of its GMP transformation efficiency.

[0168] The 18 vectors used to introduce mutations produced in Example 4-1 were transformed into Corynebacterium tarda KCCM13320P strains by electroporation, and strains that inserted the vectors into chromosomes by recombinant homologous sequences were selected in a medium containing 25 mg / L conomycin. The selected master strains were subcultured again through a second crossover, and strains that introduced mutations into the target gene were selected. The introduction of gene mutations in the final transformed strains was confirmed by PCR using the primer pairs of SEQ ID NO: 11 and SEQ ID NO: 12 and sequencing, and the strains with inserted mutations are shown in Table 11 below: [Table 11] List of strains with mutations of the 441st amino acid variant of GuaA substituted with another amino acid. serial number strain name 1 KCCM13320P::guaA(D441A) 2 KCCM13320P::guaA(D441C) 3 KCCM13320P::guaA(D441E) 4 KCCM13320P::guaA(D441F) 6 KCCM13320P::guaA(D441H) 7 KCCM13320P::guaA(D441I) 8 KCCM13320P::guaA(D441K) 9 KCCM13320P::guaA(D441L) 11 KCCM13320P::guaA(D441N) 13 KCCM13320P::guaA(D441Q) 16 KCCM13320P::guaA(D441T) 17 KCCM13320P::guaA(D441W)

[0169] The 18 strains produced above, as well as strains KCCM13320P and KCCM13320P::guaA (D441V), were cultured using the same method as in Examples 2-3 to evaluate GMP transformation efficiency. The evaluation results are shown in Table 12 below: [Table 12] Evaluation results of GMP transformation efficiency of strains with mutations of the 441st amino acid variant of GuaA substituted with another amino acid. strain number XMP Concentration (g / l) GMP Concentration (g / l) Increase / decrease in GMP production compared to parent strain (%) KCCM13320P (parental strain) 8.29 2.88 - KCCM13320P::guaA(D441V) 4.92 7.05 245% KCCM13320P::guaA(D441A) 8.08 3.06 106% KCCM13320P::guaA(D441C) 5.98 5.46 190% KCCM13320P::guaA(D441E) 6.61 4.96 172% KCCM13320P::guaA(D441F) 6.35 5.06 176% KCCM13320P::guaA(D441H) 7.81 4.01 139% KCCM13320P::guaA(D441I) 5.10 6.72 234% KCCM13320P::guaA(D441K) 7.44 4.50 157% KCCM13320P::guaA(D441L) 5.79 5.59 194% KCCM13320P::guaA(D441N) 5.58 6.07 211% KCCM13320P::guaA(D441Q) 5.99 5.31 185% KCCM13320P::guaA(D441T) 8.05 3.67 127% KCCM13320P::guaA(D441W) 8.17 3.26 113%

[0170] Therefore, as shown in Table 12, it can be confirmed that strains containing the guaA mutant gene (where the 441st amino acid of the amino acid sequence encoded by the guaA gene is replaced by another amino acid) have increased GMP production compared to the non-mutated KCCM13320P (parental strain). In other words, it is confirmed that the 441st amino acid of the amino acid sequence encoded by the guaA gene is an important mutation site in GMP production (transformation). More specifically, it was confirmed that microorganisms containing the following mutations significantly increased GMP production energy (conversion efficiency): substitution of the 441st amino acid sequence encoded by the guaA gene with sine, alanine, cysteine, glutamic acid, phenylalanine, histidine, isoleucine, lysine, leucine, aspartic acid, glutamic acid, threonine, or tryptophan. Example 5: Confirmation of the effect of the GuaA protein D123K + D441V combined variant. Example 5-1: Production of strains expressing the GuaA protein D123K + D441V combined variant.

[0171] The pDC24-guaA (D441V) vector constructed in Example 2-1 was transformed into the KCCM13320P::guaA (D123K) strain produced in Example 2-2 by electroporation. Strains that had their vectors inserted into chromosomes via recombinant homologous sequences were selected in a culture medium containing 25 mg / L conomycin. The selected master strains were subcultured again through a second crossover, and strains with mutations in the target gene were selected. The introduction of gene mutations in the final transformed strains was confirmed by PCR using the primer pair of SEQ ID NO: 11 and SEQ ID NO: 12, followed by sequencing using SEQ ID NO: 11 and SEQ ID NO: 12. The obtained strain was named KCCM13320P::guaA (D123K, D441V). Example 5-2: Evaluation of GMP-compliant energy production by strains exhibiting the GuaA protein D123K+D441V covariate

[0172] To verify the GMP transformation efficiency of the two mutant strains KCCM13320P::guaA(D123K) and KCCM13320P::guaA(D441V) produced in Example 2-2, and the mutant strains KCCM13320P::guaA(D123K, D441V) produced in Example 5-1, each strain was cultured using the method of Example 2-3 to analyze the GMP transformation efficiency. The analysis results are shown in Table 13 below: [Table 13] Evaluation results of GMP transformation efficiency of Corynebacterium tumefaciens KCCM13320P, KCCM13320P::guaA(D123K), KCCM13320P::guaA(D441V), and KCCM13320P::guaA(D123K, D441V). strain number XMP Concentration (g / l) GMP Concentration (g / l) Increase / decrease in GMP production compared to parent strain (%) KCCM13320P (parental strain) 7.94 2.16 100% KCCM13320P::guaA(D123K) 6.56 3.31 153% KCCM13320P::guaA(D441V) 5.77 3.89 180% KCCM13320P::guaA (D123K, D441V) 5.01 4.72 218%

[0173] The results, as shown in Table 13, confirmed that the parent strain of *Corynebacterium tumefaciens* KCCM13320P produced (transformed) GMP at a concentration of 2.16 g / L of guaA. However, the mutant strains KCCM13320P::guaA(D123K) and KCCM13320P::guaA(D441V), which introduced mutations into the GuaA protein, transformed GMP at concentrations of 3.31 g / L and 3.89 g / L, respectively. Furthermore, the KCCM13320P::guaA(D123K, D441V) strain, which introduced the D123K + D441V combined mutation of the GuaA protein, transformed GMP at a concentration of 4.72 g / L. Example 6: Confirmation of the influence of variants in guaA of another species of *Corynebacterium*.

[0174] To confirm whether the D123K and D441 mutations identified in Examples 1-4 are mutations that improve GMP energy production (conversion efficiency) in other Corynebacterium species, the effect of these mutations on the GuaA protein (SEQ ID NO: 96) of Corynebacterium casei (C. ca), which has approximately 95% sequence identity with the GuaA protein of Corynebacterium catarrhalis, was first confirmed. Example 6-1: Construction of a vector for representing the guaA variant

[0175] In order to verify the effects of guaA (D123K) (where the aspartic acid at position 123 of the amino acid sequence of the GuaA protein is replaced by lysine) and guaA (E441V) on GMP transformation efficiency, the following was conducted: a vector was constructed using plastid pDC24, which is used to insert and replace genes (SEQ ID NO: 97) in the chromosome of Corynebacterium, for the production of strains expressing it (Korean Patent Publication No. 10-20202-0136813).

[0176] Using the G-spin total DNA extraction mini kit (catalog number 17045) from Intron, the chromosomal gene of wild-type Corynebacterium casei LMG S-19264 was isolated according to the protocol provided in the kit and used as a template. The GuaA (D123K) mutation was introduced using the primer pairs SEQ ID NO: 98 and SEQ ID NO: 100 and the primer pairs SEQ ID NO: 101 and SEQ ID NO: 99, and the GuaA (E441V) mutation was introduced using the primer pairs SEQ ID NO: 98 and SEQ ID NO: 102 and the primer pairs SEQ ID NO: 103 and SEQ ID NO: 99 for site-directed mutagenesis. Subsequently, Solg™ Pfu-X DNA polymerase was used as the polymerase and as the PCR amplification conditions. The amplification process involved denaturation at 95°C for 5 minutes, repeated denaturation at 95°C for 30 seconds, binding at 55°C for 30 seconds, and polymerization at 72°C for 1 minute and 30 seconds 25 times, followed by polymerization at 72°C for 5 minutes to obtain the PCR products. The gene fragments obtained above were mixed with the pDC24 vector prepared by XbaI restriction enzyme digestion and selected using the Gibson assembly method (DG Gibson et al., NATURE METHODS, Vol. 6, No. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain recombinant plasmids, which were named pDC24-guaA (C.ca, D123K) and pDC24-guaA (C.ca, E441V).

[0177] The information on the obtained plasmids is shown in Table 14 below: [Table 14] List of vectors used for inserting substitutions of GuaA (D123) mutant amino acids serial number plastid name 1 pDC24-guaA (C.ca, D123K) 2 pDC24-guaA (C.ca, E441V)

[0178] The sequence of primers used in Example 6-1 is shown in Table 15 below. [Table 15] name Sequence (5'->3') SEQ ID NO pDC24-guaA(mt)-F acgacggccagtgaattcgagctcggtacccggggatcctGAAGAGATCAAAGAACGCGC SEQ ID NO: 98 pDC24-guaA(mt)-R gaccatgattacgccaagcttgcatgcctgcaggtcgactCACCCAGAGGGTCTATAACC SEQ ID NO: 99 pDC24-guaA (C.ca, D123K) CGTGCGACATCCACACCTTGTGGTTGGCCTCCAAGCCtTtGTGCAGCACGCCACCGGTGT SEQ ID NO: 100 pDC24-guaA (C.ca, D123K) aAaGGCTTGGAGGCCAACCACAA SEQ ID NO: 101 pDC24-guaA (C.ca, E441V) CGGACATCGGCGAGAAGAACGACTGGGCACTGCCAGATcaCGTTATCCAGGCCGGCGTTG SEQ ID NO: 102 pDC24-guaA (C.ca, E441V) tgATCTGGCAGTGCCCAGTCGT SEQ ID NO: 103 Example 6-2: Construction of a strain expressing the guaA variant of Corynebacterium casei

[0179] In order to verify the effect of the lysine mutation at position 123 and the valence mutation at position 441 of the guaA amino acid identified in Examples 1-4 on GMP production energy (conversion efficiency), a strain in which the mutation was introduced into the endogenous guaA gene of the Corynebacterium casei strain was constructed.

[0180] The pDC24-guaA (C.ca, D123K) and pDC24-guaA (C.ca, E441V) vectors constructed in Example 6-1 were transformed into *Corynebacterium casei* LMG S-19264 strains by electroporation. Subsequently, strains in which the vectors were inserted into the chromosome by recombination of homologous sequences in a selective medium containing 25 mg / L conomycin were selected as the primary candidate group. The selected primary strains were subcultured again through a second crossover, and strains with mutations in the target gene were selected. The introduction of gene mutations in the final transformed strains was confirmed by PCR using the primer pair of SEQ ID NO: 104 and SEQ ID NO: 105, followed by sequencing using SEQ ID NO: 104 and SEQ ID NO: 105. The obtained strains were named LMG S-19264::guaA (D123K) or LMG S-19264::guaA (E441V), respectively.

[0181] In addition, the pDC24-guaA (C.ca, E441V) vector constructed in Example 6-1 was transformed into the LMG S-19264::guaA (D123K) strain by electroporation, and strains in which the vector was inserted into the chromosome by recombination homologous sequences were selected in a medium containing 25 mg / L conomycin. The selected master strains were subcultured again through a second crossover, and strains with mutations of the target gene were selected. The introduction of gene mutations in the final transformed strains was confirmed by PCR using the primer pair of SEQ ID NO: 104 and SEQ ID NO: 105, and then confirmed by sequencing using SEQ ID NO: 104 and SEQ ID NO: 105. The obtained strain was named LMG S-19264::guaA (C.ca, D123K, E441V).

[0182] The sequence of primers used in Example 6-2 is shown in Table 16 below. [Table 16] name Sequence (5'->3') SEQ ID NO pDC24-guaA seq-F GTGACTCAACCTGCAACAAC SEQ ID NO: 104 pDC24-guaA seq-R TTACTCCCACTCGATGGTTC SEQ ID NO: 105 Example 6-3: Evaluation of GMP production capacity of strains exhibiting the guaA variant of Corynebacterium casei.

[0183] In order to verify the GMP transformation efficiency of the three strains LMG S-19264::guaA (D123K), LMG S-19264::guaA (E441V), and LMG S-19264::guaA (C.ca, D123K, D441V) produced in Example 2-2, they were cultured by the following method.

[0184] Specifically, the parent strain (Corynebacterium casei LMG S-19264) and the three mutant strains produced in Examples 6-2 were inoculated into 250 ml Erlenmeyer flasks containing 25 ml of seed culture medium as described in Examples 1-3, and then cultured at 30°C with shaking at 200 rpm for 20 hours. 800 ml of the potency evaluation solution described in Examples 1-3 was added to 200 ml of culture medium, and the mixture was reacted at 42°C for 30 minutes to convert XMP to GMP. After the culture was completed, the amount of GMP produced was measured using liquid high performance chromatography, and the GMP concentration in the culture medium of each experimental strain is shown in Table 17 below. [Table 17] Comparison of GMP transformation efficiency of *Corynebacterium casei* LMG S-19264, LMG S-19264::guaA (D123K), LMG S-19264::guaA (E441V), and LMG S-19264::guaA (C.ca, D123K, E441V). strain number XMP Concentration (g / l) GMP Concentration (g / l) Increase / decrease in GMP production compared to parent strain (%) LMG S-19264 (parental strain) 8.59 0.94 - LMG S-19264:: guaA (D123K) 8.33 1.18 126% LMG S-19264:: guaA (E441V) 8.23 1.33 141% LMG S-19264:: guaA (D123K, E441V) 8.01 1.59 169%

[0185] Therefore, as shown in Table 17, it was confirmed that the parent strain *Corynebacterium casei* LMG S-19264 produced (transformed) GMP at a concentration of 0.94 g / l, but the mutant strains LMG S-19264::guaA (D123K), LMG S-19264::guaA (E441V), and LMG S-19264::guaA (C.ca, D123K, E441V) which introduced mutations into the GuaA protein transformed GMP at concentrations of 1.18 g / l, 1.33 g / l, and 1.59 g / l, respectively.

[0186] The results confirmed that, compared with strains without introduced mutations, strains with mutations in which the 123rd amino acid encoded by the guaA gene is replaced by lysine or the 441st amino acid is replaced by valine had increased GMP production.

[0187] Based on the above description, those skilled in the art to which this disclosure pertains will understand that the present invention may be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, the embodiments described above should be understood as illustrative and non-limiting in all respects. The scope of this disclosure should be interpreted as including the meaning of the claims described later, all variations or modifications of the scope, and their equivalent concepts, rather than the detailed description above. [Simplified Explanation of the Diagram]

[0126] None [Biomaterial Storage]

[0189] Name of depository: Korean Center for Microbial Preservation (KCCM) Deposit Number: KCCM13320P Deposit Date: January 10, 2023

Claims

1. A polypeptide having glutamine-hydrolyzing GMP synthase activity and comprising an amino acid sequence having 95% or higher sequence identity with the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96, wherein the amino acid corresponding to residue 123 is substituted with lysine, glutamic acid, histidine, methionine, glutamine, arginine, serine, or tyrosine.

2. The polypeptide of claim 1, wherein the polypeptide comprises an amino acid sequence having 98% or higher sequence identity with the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 96, wherein the amino acid corresponding to residue 123 is substituted with lysine, glutamic acid, histidine, methionine, glutamic acid, arginine, serine, or tyrosine.

3. The polypeptide of claim 1, wherein the sequence identity with SEQ ID NO: 1 or SEQ ID NO: 96 is 99% or higher.

4. The polypeptide of claim 1, wherein the polypeptide comprises an amino acid sequence selected from any one of SEQ ID NO: 52 to SEQ ID NO: 59 and SEQ ID NO:

106.

5. A polynucleotide encoding a polypeptide as claimed in any one of claims 1 to 4.

6. The polynucleotide of claim 5, wherein the polynucleotide comprises a nucleic acid sequence selected from any one of SEQ ID NO: 74 to SEQ ID NO: 81 and SEQ ID NO:

109.

7. A recombinant vector comprising the polynucleotide of claim 5.

8. A microorganism comprising at least one of the following: a polypeptide as claimed in any one of claims 1 to 4, a polynucleotide encoding the polypeptide, and a carrier comprising the polynucleotide.

9. The microorganism of claim 8, wherein the microorganism has the capacity to increase the production of 5'-guanosine monophosphate (GMP).

10. The microorganism as claimed in claim 8, wherein the microorganism is a microorganism of the genus Corynebacterium.

11. The microorganism as claimed in claim 10, wherein the microorganism is Corynebacterium stationis or Corynebacterium casei.

12. A method for producing 5'-guanosine monophosphate, comprising culturing microorganisms in a culture medium, the microorganisms comprising at least one of the following: a polypeptide as claimed in any one of claims 1 to 4, a polynucleotide encoding the polypeptide, and a carrier comprising the polynucleotide.

13. The method for producing 5'-guanosine monophosphate as claimed in claim 12, further comprising recovering 5'-guanosine monophosphate from cultured microorganisms, culture medium, or both.

14. The method for producing 5'-guanosine monophosphate as claimed in claim 12, further comprising, prior to the step of culturing the microorganism in a culture medium, a step of culturing the microorganism for producing 5'-xanogenic acid (XMP), or a step of adding XMP to the culture medium.

15. A composition for producing 5'-guanosine monophosphate, comprising microorganisms comprising at least one of the following: a polypeptide as claimed in any one of claims 1 to 4, a polynucleotide encoding the polypeptide, and a carrier comprising the polynucleotide.