Capsid variants and uses thereof

Abstract

This invention relates to compositions and methods for delivering transgenic (e.g., transgenic encoding one or more gene products) into target cells. Part of the invention is based on adeno-associated virus (AAV) protein coat protein variants characterized by tropism for certain cell types (e.g., neurons, muscle cells, bone cells, heart cells, etc.). In some embodiments, recombinant AAV (rAAV) comprising such protein coat protein variants (e.g., AAVv66, SEQ ID NO: 1) is packaged more efficiently than rAAV containing certain wild-type AAV protein coat proteins. The invention also describes methods for delivering rAAV comprising such AAV protein coat protein variants.

Description

Technical Field

[0001] This invention relates to compositions and methods for delivering transgenic materials (e.g., transgenic materials encoding one or more gene products) into target cells. Part of the invention is based on adeno-associated virus (AAV) protein coat protein variants characterized by tropism for certain cell types (e.g., neurons, muscle cells, bone cells, heart cells, etc.). In some embodiments, recombinant AAV (rAAV) comprising such protein coat protein variants (e.g., AAVv66, SEQ ID NO: 1) is packaged more efficiently than rAAV containing certain wild-type AAV protein coat proteins. The invention also describes methods for delivering rAAV comprising such AAV protein coat protein variants. Prior Technology

[0002] Recombinant adeno-associated virus (rAAV) can drive stable and sustained transgenic expression in target tissues without significant toxicity or host immunogenicity. Therefore, rAAV is a promising delivery medium for long-term gene expression therapy. However, the low transduction efficiency and limited tissue tropism of currently available rAAV vectors restrict their application as a feasible and effective therapy. Furthermore, the accurate clinical translation of major therapeutic AAV serotypes derived from non-human tissues is a concern. Therefore, there is still a need for novel AAV vectors for gene delivery. Summary of the Invention

[0003] This invention relates to compositions and methods for delivering transgenic materials (e.g., transgenic materials encoding one or more gene products) into target cells. Part of the invention is based on adeno-associated virus (AAV) protein coat protein variants characterized by tropism for certain cell types (e.g., neurons, muscle cells, bone cells, heart cells, etc.). In some embodiments, recombinant AAV (rAAV) containing these protein coat protein variants is packaged more efficiently than rAAV containing certain wild-type AAV protein coat proteins. The invention also describes methods for delivering rAAV containing these AAV protein coat protein variants.

[0004] In some embodiments, the present invention provides a method for delivering a transgene to target cells in a subject, the method comprising intracranial administration to the subject a recombinant adeno-associated virus (rAAV) comprising: isolated nucleic acid containing a transgene encoding one or more gene products of interest; and an adeno-associated virus (AAV) protein capsid protein having the sequence stated in SEQ ID NO: 1.

[0005] In some embodiments, intracranial administration includes intrahippocampal injection.

[0006] In some embodiments, the target cell line is a central nervous system (CNS) cell line. In some embodiments, the CNS cell line is a neuron, oligodendrocyte, astrocyte, or microglia.

[0007] In some embodiments, the subjects are mammals. In some embodiments, the subjects are humans. In some embodiments, the subjects are characterized by producing anti-AAV2 antibodies. In some embodiments, administration of rAAV does not produce a neutralizing immune response against rAAV in the subjects.

[0008] In some embodiments, the isolated nucleic acid comprises an AAV inverted terminal repeat (ITR) sequence side-attached to the transgene. In some embodiments, the nucleic acid sequence encoding one or more gene products is operatively linked to a promoter. In some embodiments, one or more gene products comprise a protein or a repressive nucleic acid.

[0009] In some embodiments, the present invention provides a method for delivering a transgene to target cells in a subject, the method comprising intravenously administering to the subject a recombinant adeno-associated virus (rAAV) comprising: isolated nucleic acid containing a transgene encoding one or more gene products of interest; and an adeno-associated virus (AAV) protein capsid protein having the sequence stated in SEQ ID NO: 1, wherein the administration causes rAAV to cross the blood-brain barrier (BBB) ​​of the subject.

[0010] In some embodiments, the target cell line is a central nervous system (CNS) cell line. In some embodiments, the CNS cell line is a neuron, oligodendrocyte, astrocyte, or microglia.

[0011] In some embodiments, the subjects are mammals. In some embodiments, the subjects are humans. In some embodiments, the subjects are characterized by producing anti-AAV2 antibodies. In some embodiments, administration of rAAV does not produce a neutralizing immune response against rAAV in the subjects.

[0012] In some embodiments, the isolated nucleic acid comprises an AAV inverted terminal repeat (ITR) sequence side-attached to the transgene. In some embodiments, the nucleic acid sequence encoding one or more gene products is operatively linked to a promoter. In some embodiments, one or more gene products comprise a protein or a repressive nucleic acid.

[0013] In some embodiments, recombinant AAV (rAAV) containing a protein shell protein variant described herein (e.g., AAVv66, SEQ ID NO: 1) has a higher packaging efficiency (e.g., 2x, 3x, 4x, 5x, 10x, 20x, 30x, 50x, 100x or higher) than rAAV containing certain wild-type AAV protein shell proteins (e.g., AAV2 protein shell protein, SEQ ID NO: 2). Simple Explanation of the Diagram

[0014] Figures 1A-1D illustrate the identification of novel proviral AAV protein cap sequences from human surgical specimens. Figure 1A shows the PCR amplification of the AAV protein cap proviral sequence from human surgical specimens using primers side-attached to the AAV Cap ORF. Single-molecule real-time (SMRT) sequencing was performed on the amplicon, and the resulting reads were analyzed using BWA-MEM alignment (relative to the current AAV serotype sequence), InDelFixer (to remove insertions / deletions associated with PCR or SMRT sequencing errors), and reassembly (to cluster reads with high sequence similarity). Figure 1B shows that the cap sequence of variant AAVv66 was the most abundant (45%) in the analysis. Figure 1C shows a summary of 13 unique residues in the AAVv66 protein cap sequence that differ from AAV2. (d) Phylogenetic tree of AAV2 variants (including AAVv66) and current serotypes. Figures 2A-2D illustrate the transduction and diffusion of rAAV2 and rAAVv66 after intrahippocampal injection. Figure 2A shows the expression of native EGFP after intralateral hippocampal injection of rAAV2-CB6-Egfp or rAAVv66-CB6-Egfp. Scale bar = 700 µm. Figure 2B shows the quantification of EGFP-positive surfaces normalized to DAPI-positive surfaces. Data are presented as mean ± SD; n = 3. ****P < 0.0001. Figure 2C shows a schematic diagram of the coronal brain illustrating the subanatomical regions of interest in the contralateral and ipsilateral hemispheres. Hippocampal horns (CA1, CA2, CA3, CA4), dentate gyrus (DG), corpus callosum (CC), and cortex (CTX). Figure 2C shows a high-magnification image of the subanatomical regions transduced by rAAVv66. Scale bar = 50 µm. Figures 3A-3P illustrate the transduction of rAAVv66 to major brain cell types. Figures 3A, 3E, 3I, and 3M show coronal sections of mouse brains transduced with rAAVv66-CB6-Egfp. IF-stained sections with antibodies against NEUN (Figure 3A, neurons), GFAP (Figure 3E, astrocytes), IBA1 (Figure 3I, microglia), or OLIG2 (Figure 3M, oligodendrocytes) indicate the distribution of each cell type in the brain. Co-localization of native EGFP with IF staining indicates the cell type that was positively transduced. Scale bar = 700 µm. Figures 3B, 3F, 3J, and 3N show 3D renderings of a single representative frame from the dashed rectangular box within the coronal section (top image) and sub-anatomical regions from single-cell representations of the area defined by the dashed square box (bottom three images). Left panel: Total EGFP and IF staining; Middle panel: Colocalized EGFP and total IF staining; Right panel: Colocalized EGFP and IF staining. Scale bar = 50 µm (top panel), 5 µm (bottom three panels). Figures 3C, 3G, 3K, and 3O show the quantification (normalized to DAPI signal) of cell type-specific IF staining in the indicated hippocampal region (x-axis). Figures 3D, 3H, 3L, and 3P show the quantification (normalized to total cell type IF and DAPI signal) of cell type-specific transduction in the indicated regions. Data are presented as mean ± SD; n = 3. Hippocampal horn (CA1, CA2, CA3, CA4), dentate gyrus (DG), corpus callosum (CC), and cortex (CTX). Figures 4A-4E illustrate the biophysical analysis of AAVv66. The heatmaps show differential scanning fluorometry (DSF) analysis at pH 7, 6, 5, and 4 to examine protein shell unfolding (uncoating) (Figure 4A) and DNA accessibility (vector gene body extrusion) (Figure 4B). Site-directed mutagenesis was used to convert each specified amino acid residue of AAVv66 to its equivalent in AAV2, and changes in packaging yield (Figure 4C), protein shell stability (Figure 4D), and gene body release (Figure 4D) at pH 7 were examined. Values ​​represent mean ± SD. p-values ​​were determined using single-factor ANOVA. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. n ³ 3. Figures 5A-5E show the main indicators, image reconstruction, and model generation of AAVv66 at low temperature EM. Figure 5A shows the density map of AAVv66. Gray scale structure indicates the topological distance (Å) from the center. Figure 5B shows the banded structure of the refined AAVv66 protein shell monomer. Amino acids that are different from AAV2 are highlighted. 2-fold (oval), 3-fold (triangular), and 5-fold (pentagonal) symmetry are labeled. Partial AAVv66 electron density (dark gray grid) and residues are shown in the regions close to (Figure 5C) L583, R487, Y533, and K532, (Figure 5D) S446, D499, and S501, and (Figure 5E) N407-T414. Figure 6 illustrates the structural differences between AAVv66 and AAV2. The AAVv66 60-mer structure (gray) is shown at the center. Unique amino acid residues of AAVv66 are highlighted in green, while amino acid residues shared with AAV2 in a single monomer are marked in color. Atomic models show the side chains of residues in selected regions where there are substantial differences between AAVv66 and AAV2. Comparisons are made using monomers of AAV2 (1lp3) and AAVv66, with modeled side chains of adjacent residues shown in gray. The labeled amino acids indicate whether they belong to AAVv66, their position number, and then whether they belong to AAV2. Figures 7A-7C show the electrostatic differences in the protein shell surfaces between AAV2 and AAVv66. Figure 7A shows the surface positive and negative charges of the 60-mer, trimer (3-fold symmetry), and pentamer (5-fold symmetry, external and internal) structures of AAV2 and AAVv66. The black arrows at the AAV2 60-mer and trimer structures indicate the approximate positions of R585 and R588 at the single 3-fold protrusion. Figure 7B shows a magnified view of the amino acid residues at 585-588 of AAV2 and AAVv66. Figure 7C shows a bar graph of the zeta potential of the purified vector, as measured by zetasizer. Values ​​represent mean ± SD, n=3. Figure 8 shows the amino acid sequence of the AAVv66 protein capsid protein, which is mutated relative to the provided AAV2. The amino acid differences between AAV2 and AAVv66 are highlighted. Variable region (VR) residues are indicated by short bars. The aH domain is marked by dashed bars, and residues forming b-sheets are indicated by black arrows. The start positions of VP1, VP2, and VP3 are marked by greater than signs (>). The PLA domain within VP1 is indicated by lines. Figure 9 shows that AAVv66 produced a higher vector yield than AAV2. Crude lysate PCR analysis was performed on the culture medium and cell lysates of HEK239 cells, which had undergone triple transfection with pAAV and either AAV2 or AAVv66 packaging plasmids. Values ​​represent mean gene copy number ± SD, n=3. Figure 10 shows that AAVv66 does not bind strongly to heparin. Heparin competition analysis shows the transduction efficiency of AAV2-CB6-FLuc and AAVv66-CB6-FLuc in HEK293 cells in the presence of increased heparin (x-axis). Luminescent values ​​were scaled to values ​​obtained for heparin-deficient wells and set to 1 (y-axis). Values ​​represent mean ± SD, n=3. **, p < 0.01, according to a 2-factor ANOVA. Figure 11 shows the in vitro infection efficiency of AAV2, AAV3b, and AAVv66 in HEK293 cells. The CB6-FLuc packaging vector was used. Cells were lysed 48 hours post-infection to assess vector infectivity by detecting luciferase activity (RLU, relative light units). Data are presented on a logarithmic scale. Values ​​represent mean ± SD, ***p < 0.0001, based on one-way ANOVA, n=3. Figures 12A-12D show that intravenous administration of the AAVv66 vector induces liver transduction. Systemic injection of AAVv66-CB6-Fluc also induces liver transduction. RAAV2-CB6-Fluc or AAVv66-CB6-Fluc (1.0E11 GC / mouse) was administered to mice via tail vein injection. Fourteen days later, luciferin receptors were injected intraperitoneally into the mice, and imaging was performed (Figure 12A). Although systemic bioluminescence quantification of luciferase activity did not reveal a significant difference in liver transduction between AAVv66-CB6-Fluc and AAV2-CB6-Fluc, isolated liver tissue and quantification of luciferase activity by qPCR, along with vector gene copy number detection, showed that AAVv66 was a significantly weaker liver transducer than AAV2. Total abdominal flux was recorded in the acquired images (Figure 12B). Tissues were harvested and luciferase activity (Fig. 12C) and vector gene abundance were analyzed by qPCR (Fig. 12D). Values ​​represent mean ± SD, n=3. *, p < 0.05, according to Student's t test. Figures 13A-13D demonstrate muscle transduction via intramuscular injection of the AAVv66 vector. Intramuscular injection of AAVv66 into the tibialis anterior muscle produced minimal difference in transduction capacity compared to AAV2 transduction. AAV2-CB6-FLuc or AAVv66-CB6-FLuc (4.0E10 GC / mouse) was injected intramuscularly into a hind limb (tibialis anterior muscle). Fourteen days later, luciferase receptors were injected intraperitoneally into mice and imaged (Figure 13A). Total throughput of the injected hind limb in the acquired images was recorded (Figure 13B). Tissue was harvested and luciferase activity and vector genotype abundance were analyzed by qPCR (Figure 13C) (Figure 13D). Values ​​represent mean ± SD, n=3. *, p < 0.05, according to Student's t-test. Figures 14A-14D illustrate the immunological characterization of AAVv66. Mice were intramuscularly administered the AAV2-CB6-Egfp vector (1E11 GC / mouse). Four weeks post-administration, serum was collected to test the titer of neutralizing antibodies (NAb) against AAV2 or AAVv66 infection. The NAb50 value for AAV2 (Figure 14A) and AAVv66 (Figure 14B) was defined as the titer dilution that could block 50% of the total transduction achieved by the LacZ reporter gene-packaged vector. Left panel: Summary of NAb values ​​for individual animals tested. Right panel: Plot of transduction efficiency against different serum dilutions. Values ​​represent mean ± SD. Dashed lines indicate mean NAb50 serum titer. After the 4-week period, mice were intramuscularly administered AAV2-hA1AT or AAVv66-hA1AT (1E11 GC / mouse) via the contralateral hind limb. Serum A1AT levels were measured by ELISA at weeks 5, 6, 7, and 8 (Figure 14C). Values ​​represent mean ± SD, n = 3. ns, not significant; *, p < 0.05; **, p < 0.01; and ***, p < 0.001, based on a two-factor ANOVA of cross-sectional data points. Figure 14D shows the cross-reactivity of rabbit anti-AAV sera. Relative cross-reactivity was evaluated by testing NAb in rabbit antisera generated against AAV serotypes using AAVv66 and homologous AAV serotypes. Log2 values ​​represent the highest antibody dilution achieving 50% transduction inhibition. Figures 15A-15B show the main indices, image reconstruction, and model generation of AAVv66 at low temperature. Figure 15A shows a low-temperature electron micrograph of AAVv66. The scale bar represents 100 Å. Figure 15B shows the Fourier shell correlation (FSC_part) of even-numbered and odd-numbered particles of AAVv66. Figure 16 shows the statistical comparison of RMSD (Å) between AAVv66 and AAV2 or AAV3b. The total and regional RMSD (Å) between AAVv66 and AAV2 (1LP3) or AAV3b (3KIC) are summarized using the rms_cur function in PyMOL for all indicator α-carbon pairs (AAV2 numbered). The complete protein shell structures of AAV2, 3b, and AAVv66 are compared via optimized fitting within the low-temperature EM density map of AAVv66. The distance values ​​(Å) between individual α-carbon pairs of AAV2 (top) or AAV3b (bottom) are quantified using a custom script in PyMOL, thus representing the color and radial thickness of the corresponding residues in AAVv66. Implementation

[0015] This invention relates to compositions and methods for delivering transgenic materials (e.g., transgenic materials encoding one or more gene products) into target cells. Part of the invention is based on adeno-associated virus (AAV) protein coat protein variants characterized by tropism for certain cell types (e.g., neurons, muscle cells, bone cells, heart cells, etc.). In some embodiments, recombinant AAV (rAAV) containing these protein coat protein variants has higher packaging efficiency than rAAV containing certain wild-type AAV protein coat proteins. The invention also describes methods for delivering rAAV containing these AAV protein coat protein variants.

[0016] AAVv66 protein shell protein In some embodiments, the present invention provides a method for delivering a transgene to target cells (e.g., target cells of the central nervous system (CNS)) in a subject, the method comprising administering to the subject (e.g., intracranial or intravenous) a recombinant adeno-associated virus (rAAV) comprising: isolated nucleic acid containing a transgene encoding one or more gene products of interest; and an adeno-associated virus (AAV) protein capsid protein comprising the AAVv66 protein capsid protein or a protein capsid protein substantially homologous to the AAVv66 protein capsid protein. In some embodiments, the AAVv66 protein comprises the amino acid sequence stated in SEQ ID NO: 1.

[0017] In some embodiments, the AAVv66 protein shell protein described herein, relative to AAV2, comprises mutations selected from the group consisting of: K39Q, V151A, R447K, T450A, Q457M, S492A, E499D, F533Y, G546D, E548G, R585S, R588T, and A593T. In some embodiments, the AAVv66 protein shell protein described herein, relative to AAV2, comprises each of the following mutations: K39Q, V151A, R447K, T450A, Q457M, S492A, E499D, F533Y, G546D, E548G, R585S, R588T, and A593T. In some embodiments, a protein shell protein substantially homologous to the AAVv66 protein shell protein contains one or more mutations selected from the group consisting of: K39Q, V151A, R447K, T450A, Q457M, S492A, E499D, F533Y, G546D, E548G, R585S, R588T, and A593T relative to AAV2. In some embodiments, the AAVv66 protein shell protein or a protein shell protein substantially homologous to the AAVv66 protein shell protein contains one or more mutations in its VP1, VP2, and / or VP3 regions relative to AAV2. In some embodiments, the AAVv66 protein shell protein or a protein shell protein substantially homologous to the AAVv66 protein shell protein contains one or more mutations in the variable region (VR)-IV, VR-V, VR-VI, VT-VII, and / or VR-VIII relative to AAV2. In some embodiments, the AAVv66 protein shell protein, or a protein shell protein that is substantially homologous to the AAVv66 protein shell protein, contains one or more mutations as shown in Figure 1C, relative to AAV2.

[0018] "Homology" refers to the percentage of similarity between two polynucleotides or two polypeptide fragments. When referring to nucleic acids or fragments thereof, the term "substantial homology" indicates that the nucleotide sequence similarity of the aligned sequence is approximately 90% to 100% when optimally aligned with another nucleic acid (or its complementary strand) having appropriate nucleotide insertions or deletions. When referring to polypeptides or fragments thereof, the term "substantial homology" indicates that the nucleotide sequence similarity of the aligned sequence is approximately 90% to 100% when optimally aligned with another polypeptide having appropriate gaps, insertions, or deletions. The term "highly conserved" means at least 80% similarity, preferably at least 90% similarity, and more preferably greater than 97% similarity. In some cases, high conservation may mean 100% similarity. Similarity can be readily determined by those skilled in this technique using, for example, algorithms and computer programs known to those skilled in this technique.

[0019] As described herein, nucleic acid or peptide sequences can be aligned using any of the various publicly available or commercially available multiple sequence alignment programs accessible via internet servers (e.g., "Clustal W"). Alternatively, the Vector NTI utility can be used. Numerous industry-known algorithms exist for measuring nucleotide sequence identity, including those included in the aforementioned programs. As another example, BLASTN can be used to compare polynucleotide sequences, providing an alignment of the best overlapping region between the query and search sequences and a percentage of sequence identity. Similar programs can be used to compare amino acid sequences, such as the "Clustal X" program and BLASTP. Typically, any of these programs is used with default settings, but those skilled in the art can change these settings as needed. Alternatively, those skilled in the art can use another algorithm or computer program that provides at least the same level of identity or alignment as the mentioned algorithms and programs. Alignment can be used to identify corresponding amino acids between two proteins or peptides. "Corresponding amino acid" refers to an amino acid in a protein or peptide sequence that is compared with an amino acid in another protein or peptide sequence. The corresponding amino acid may be the same or different. A corresponding amino acid that is different from another amino acid may be called a variant amino acid.

[0020] In some embodiments, the present invention relates to AAVv66 protein shell proteins (e.g., isolated nucleic acids encoding AAVv66 protein shell proteins, recombinant adeno-associated virus (rAAV) containing AAVv66 protein shell proteins, etc.) or protein shell proteins that have substantial homology with AAVv66 protein shell proteins. In some embodiments, the protein shell protein having substantial homology with AAVv66 protein shell proteins is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% identical to the amino acid sequence stated in SEQ ID NO: 1. In some embodiments, a protein shell protein substantially homologous to the AAVv66 protein shell protein relative to the amino acid sequence stated in SEQ ID NO:1 comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 amino acid substitutions, insertions, or deletions. In some embodiments, a protein shell protein substantially homologous to the AAVv66 protein shell protein relative to the amino acid sequence stated in SEQ ID NO:1 comprises more than 50 amino acid substitutions, insertions, or deletions.

[0021] In some embodiments, the present invention relates to the surprising discovery that rAAV containing the AAVv66 protein shell can be produced in higher quantities in mammalian cell lines (e.g., HEK-293 cells) compared to rAAV containing certain other AAV protein shells (e.g., AAV2 protein shell, AAV3B protein shell, etc.). In some embodiments, the amount of rAAV with the AAVv66 protein shell produced by transduced mammalian (e.g., HEK) production cells is about 1.5 to about 5 times (e.g., 1.5, 2, 3, 4, 5 times) that produced by transduced mammalian (e.g., HEK) production cells. In some embodiments, the amount of rAAV with the AAVv66 protein shell produced by transduced mammalian (e.g., HEK) production cells is about 5% to 50% (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, etc.) that produced by transduced mammalian (e.g., HEK) production cells containing the AAVv66 protein shell is greater than that produced by transduced mammalian (e.g., HEK) production cells containing the AAV3B protein shell.

[0022] This invention relates to the unexpected discovery that the transduction efficiency of AAVv66 protein-coating proteins (e.g., rAAV containing AAVv66 protein-coating proteins) is improved compared to rAAV containing AAV2 protein-coating proteins in central nervous system (CNS) cells. In some embodiments, the transduction efficiency of rAAV containing AAVv66 in CNS cells is at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 100%, 200%, 500%, 1000%, or more than that of rAAV containing AAV2. In some embodiments, the CNS cells comprise neurons, oligodendrocytes, astrocytes, or microglia.

[0023] This invention relates to certain AAV shell proteins (e.g., AAVv66 shell protein) that are serologically different from other AAV shell proteins (e.g., AAV1, AAV2, AAV3B, AAV8, AAV9, AAVrh.8, AAVrh.10, etc.). It is not intended that rAAV containing the AAVv66 shell protein will not produce a neutralizing antibody response in subjects who are seropositive for antibodies against certain other AAV shell proteins. Therefore, in some embodiments, rAAV containing the AAVv66 shell protein can be used as a second-line therapy to deliver transgenes to subjects who have previously received AAV therapy or are seropositive for neutralizing antibodies against certain AAV shell proteins.

[0024] In some embodiments, the present invention relates to rAAV shell proteins (e.g., AAVv66 shell proteins) that exhibit increased thermal stability relative to certain wild-type AAV shell proteins (e.g., AAV2 shell proteins). In some embodiments, the thermal stability of AAVv66 shell proteins is greater than that of AAV2 shell proteins at a pH between about pH 4 and about pH 7. In some embodiments, thermal stability is determined by calculating the melting temperature of the shell protein. In some embodiments, AAVv66 shell proteins are characterized in that their melting temperature at a given pH (e.g., between pH 4 and pH 7) is about 5°C to about 10°C higher than that of AAV2 shell proteins.

[0025] Nucleic acid isolation In some embodiments, the present invention relates to isolated nucleic acids encoding certain AAV protein shell variants (e.g., AAVv66 protein shell protein). The term "nucleic acid" refers to a DNA or RNA sequence. In some embodiments, the term nucleic acid has a sequence including any of the known base analogues of DNA and RNA, such base analogues being, for example (but not limited to), 4-Acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxy-methyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethyl-aminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil The following compounds are listed: 5-methoxy-amino-methyl-2-thiouracil, β-D-mannosyl purine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, methyl uracil-5-oxyacetate, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, purine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, methyl uracil-5-oxyacetate, uracil-5-oxyacetic acid, pseudouracil, purine, 2-thiocytosine, and 2,6-diaminopurine.

[0026] In some embodiments, the proteins and nucleic acids of the present invention are isolated. As used herein, the term "isolation" means artificially obtained or produced. As used herein with respect to nucleic acids, the term "isolation" generally means: (i) amplification in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinant production by selection; (iii) purification, such as by lysis and gel separation; or (iv) synthesis by, for example, chemical synthesis. Isolated nucleic acids can be readily manipulated by recombinant DNA techniques well known in the art. Thus, nucleotide sequences contained in vectors with known 5' and 3' restriction sites or revealed polymerase chain reaction (PCR) primer sequences can be considered isolated, but nucleic acid sequences present in the natural host in their native state are not isolated. Isolated nucleic acids may be substantially purified, but not necessarily. For example, nucleic acids isolated from selection or expression vectors are impure because they may constitute only a small fraction of the material in their resident cells. However, this nucleic acid is isolated (as used in this text) because it can be easily manipulated using standard techniques known to those skilled in the art. As used herein with respect to proteins or peptides, the term "isolated" generally refers to proteins or peptides that are artificially obtained or produced (e.g., through chemical synthesis, through recombinant DNA technology, etc.).

[0027] It should be understood that conserved amino acid substitutions can be made to provide functionally equivalent protein shell protein variants or homologues. In some cases, the present invention covers sequence alterations that produce conserved amino acid substitutions. As used herein, a conserved amino acid substitution refers to an amino acid substitution that does not alter the relative charge or size characteristics of the protein in which the substitution is made. Variants can be prepared according to methods of altering polypeptide sequences known to those skilled in the art, for example, see references that compile such methods, such as *Molecular Cloning: A Laboratory Manual*, edited by J. Sambrook et al., 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989; or *Current Protocols in Molecular Biology*, edited by FM Ausubel et al., John Wiley & Sons, Inc., New York. Conservative amino acid substitutions include substitutions between amino acids belonging to the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H; (d) A, G; (e) S, T; (f) Q, N; and (g) E, D. Therefore, conserved amino acid substitutions can be performed on the amino acid sequences of the proteins and polypeptides disclosed herein.

[0028] Recombinant AAV (rAAV) In some embodiments, the present invention provides isolated AAV. As used herein with respect to AAV, the term "isolated" refers to AAV obtained or produced artificially. Isolated AAV can be produced using recombinant methods. Such AAVs are referred to herein as "recombinant AAVs". Recombinant AAVs (rAAVs) preferably have tissue-specific targeting capabilities, thereby delivering the transgene-specific rAAV to one or more predetermined tissues. The AAV protein shell is an important element determining such tissue-specific targeting capabilities. Therefore, rAAVs having a protein shell suitable for the target tissue can be selected. In some embodiments, rAAVs comprise AAVv66 protein shell proteins. In some embodiments, rAAVs comprise protein shell proteins having an amino acid sequence as stated in SEQ ID NO: 1.

[0029] Methods for obtaining recombinant AAVs with desired shell proteins are well known in the art (see, for example, US 2003 / 0138772, the contents of which are incorporated herein by reference in their entirety). Typically, such methods involve culturing host cells containing: a nucleic acid sequence encoding an AAV shell protein (e.g., a nucleic acid encoding a polypeptide having the sequence stated in SEQ ID NO: 1) or a fragment thereof; a functional rep gene; a recombinant AAV vector consisting of an AAV inverted terminal repeat (ITR) sequence and a transgene; and sufficient helper functional units that allow the recombinant AAV vector to be packaged into the AAV shell protein. In some embodiments, the shell protein is a structural protein encoded by the AAV cap gene. In some embodiments, AAV comprises three shell proteins: virosomal proteins 1 to 3 (referred to as VP1, VP2, and VP3), each expressed from a single cap gene. Therefore, in some embodiments, VP1, VP2, and VP3 proteins share a common core sequence. In some embodiments, the molecular weights of VP1, VP2, and VP3 are approximately 87 kDa, 72 kDa, and 62 kDa, respectively. In some embodiments, after translation, the capsid proteins form a spherical 60-mer protein shell around the viral genome. In some embodiments, the protein shell primarily comprises the VP3 capsid protein. In some embodiments, the capsid proteins function to protect the viral genome, deliver the genome, and interact with the host. In some cases, the capsid proteins deliver the viral genome to the host in a tissue-specific manner. In some embodiments, the VP1 and / or VP2 capsid proteins may contribute to the tissue orientation of packaged AAV. In some embodiments, the tissue orientation of packaged AAV is determined by the VP3 capsid protein. In some embodiments, mutations occurring in the capsid proteins enhance or alter the tissue orientation of AAV.

[0030] In some embodiments, the AAV variants described herein are AAV2 variants. AAV2 is known to be effective at transducing human central nervous system (CNS) tissues, kidney tissues, ocular tissues (e.g., photoreceptor cells and retinal pigment epithelium (RPE)) and other tissues. Therefore, in some embodiments, the AAV2 variants described herein can be used to deliver gene therapy to CNS tissues, kidney tissues, or ocular tissues. In some embodiments, the AAV protein capsid protein described herein can be used to target other tissues (e.g., muscle tissue, liver tissue, or heart tissue). In some embodiments, the AAV protein capsid protein described herein (e.g., AAVv66 protein capsid protein) is able to cross the blood-brain barrier (BBB) ​​of the subject when delivered intravenously or systemically.

[0031] In some cases, the AAV variants described herein can be used to treat CNS-related conditions. As used herein, "CNS-related conditions" refers to diseases or symptoms of the central nervous system. CNS-related conditions can affect the spinal cord (e.g., spinal cord lesions), the brain (e.g., encephalopathy), or tissues surrounding the brain and spinal cord. CNS-related conditions can be of genetic origin, i.e., inherited or acquired through somatic mutations. CNS-related conditions can be psychological conditions or symptoms, such as attention deficit hyperactivity disorder, autism spectrum disorder, mood disorders, schizophrenia, depression, Rett syndrome, etc. CNS-related conditions can be autoimmune diseases. CNS-related conditions can also be CNS cancers, such as brain cancer. CNS-related conditions as cancers can be primary CNS cancers (e.g., astrocytoma, glioblastoma, etc.) or cancers that have metastasized to CNS tissues (e.g., lung cancer that has metastasized to the brain). Other non-limiting examples of CNS-related conditions include Parkinson's disease, lysosomal storage diseases, ischemia, neuropathic pain, amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), and Canavan disease (CD).

[0032] In some embodiments, the AAV variants described herein can target liver tissue. Therefore, in some embodiments, the AAV variants described herein can be used to treat liver diseases. As used herein, "liver disease" refers to a disease or condition of the liver. Liver diseases can be of genetic origin, i.e., inherited or acquired through somatic mutations. Liver diseases can be liver cancers, including (but not limited to) hepatocellular carcinoma (HCC), lamellar fibrocarcinoma, cholangiocarcinoma, angiosarcoma, and hepatoblastoma. Other non-limiting examples of lung diseases include Alagille syndrome, α1-antitrypsin deficiency, autoimmune hepatitis, biliary atresia, cirrhosis, cystic liver disease, fatty liver disease, galactosemia, gallstones, Gilbert's syndrome, hemochromatosis, liver disease of pregnancy, neonatal hepatitis, primary biliary cirrhosis, primary sclerosing cholangitis, porphyria, Reye's syndrome, sarcoidosis, toxic hepatitis, glycogen storage disease type 1, tyrosinemia, viral hepatitis A, B, and C, Wilson's disease, and schistosomiasis.

[0033] In some embodiments, the AAV variants described herein can be used to deliver gene therapy to ocular tissues (e.g., tissues or cells of the eye). Therefore, in some embodiments, the AAV variants described herein can be used to treat ocular conditions. As used herein, "ocular condition" refers to a disease or symptom of the eye. Ocular diseases can affect the eye, sclera, cornea, anterior chamber, posterior chamber, iris, pupil, lens, vitreous fluid, retina, or optic nerve. Ocular diseases can be of genetic origin, i.e., inherited or acquired through somatic mutations. Non-limiting examples of ocular diseases and conditions include (but are not limited to): age-related macular degeneration, retinopathy, diabetic retinopathy, macular edema, glaucoma, retinitis pigmentosa, and ocular cancer.

[0034] The component intended to be cultured in host cells to package the rAAV vector in an AAV protein shell can be trans-presented into the host cells. Alternatively, one or more of the desired components can be provided by means of methods known to those skilled in the art to a stable host cell containing one or more of the desired components (e.g., recombinant AAV vector, rep sequence, cap sequence, and / or helper protein). Most preferably, this stable host cell contains the desired component under the control of an inducible promoter. However, the desired component may be under the control of a constitutive promoter. Examples of suitable inducible and constitutive promoters are provided herein in the discussion of regulatory elements applicable to transgenic structures. In yet another alternative, the selected stable host cell may contain the selected component under the control of a constitutive promoter and other selected components under the control of one or more inducible promoters. For example, a stable host cell derived from 293 cells (which contain an E1 helper protein under the control of a constitutive promoter) but containing rep and / or cap proteins under the control of an inducible promoter can be generated. Those who are proficient in this technique can generate other stable host cells.

[0035] The recombinant AAV vector, rep sequence, cap sequence, and helper functional body required to generate the rAAV of the present invention can be delivered to the packaging host cell using any suitable genetic element (vector). In some embodiments, a single nucleic acid encoding all three shell proteins (e.g., VP1, VP2, and VP3) is delivered to the packaging host cell using a single vector. In some embodiments, nucleic acids encoding shell proteins are delivered to the packaging host cell using two vectors; the first vector contains a first nucleic acid encoding two shell proteins (e.g., VP1 and VP2), and the second vector contains a second nucleic acid encoding a single shell protein (e.g., VP3). In some embodiments, three vectors, each containing nucleic acids encoding different shell proteins, are delivered to the packaging host cell. Selected genetic elements can be delivered by any suitable method (including those set forth herein). Methods used to construct any embodiment of the present invention are known to those skilled in nucleic acid manipulation and include gene modification, recombination modification, and synthetic techniques. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for generating rAAV virions are well known, and suitable methods are not limited to this invention. See, for example, K. Fisher et al., J. Virol., 70:520-532 (1993) and U.S. Patent No. 5,478,745.

[0036] In some embodiments, a triple transfection method can be used to generate recombinant AAV (detailed in U.S. Patent No. 6,001,650). Typically, recombinant AAV is generated by transfecting host cells using a recombinant AAV vector (containing a transgene), an AAV helper vector, and an accessory function vector intended to be packaged into AAV particles. The AAV helper vector encodes "AAV helper function" sequences (e.g., rep and cap), which are transformed for productive AAV replication and capsid formation. Preferably, the AAV helper vector supports the generation of a functional AAV vector without generating any detectable wild-type AAV virions (e.g., AAV virions containing functional rep and cap genes). Non-limiting examples of vectors suitable for use in this invention include pHLP19 (described in U.S. Patent No. 6,001,650) and the pRep6cap6 vector (described in U.S. Patent No. 6,156,303), the entire contents of which are incorporated herein by reference. The accessory function vector encodes nucleotide sequences for non-AAV-derived viral and / or cellular functions (e.g., "accessory functions") upon which AAV replication depends. Accessory functions include those required for AAV replication, including (but not limited to) those involved in AAV gene transcriptional activation, stage-specific AAV mRNA splicing, AAV DNA replication, cap expression product synthesis, and AAV protein cap assembly. Viral accessory functions can be derived from any of the known helper viruses, such as adenoviruses, herpesviruses (except herpes simplex virus type 1), and vaccinia virus.

[0037] In some respects, the present invention provides transfected host cells. The term "transfection" is used to refer to the process by which cells take up foreign DNA, and the cells are "transfected" when the foreign DNA has been introduced into the cell (e.g., across the cell membrane). Many transfection techniques are generally known in the art. For example, see Graham et al. (1973) Virology, 52:456; Sambrook et al. (1989) Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York; Davis et al. (1986) Basic Methods in Molecular Biology, Elsevier; and Chu et al. (1981) Gene 13:197. These techniques can be used to introduce one or more foreign nucleic acids (e.g., nucleotide integrators and other nucleic acid molecules) into suitable host cells.

[0038] "Host cell" refers to any cell that contains or is capable of containing the substance of interest. Typically, host cells are mammalian cells. Host cells can be used as recipients of AAV helper builders, AAV microplasts, accessory functional vectors, or other transfer DNA related to the production of recombinant AAV. This term includes progeny of already transfected original cells. Therefore, as used herein, "host cell" may refer to a cell that has been transfected with an exogenous DNA sequence. It should be understood that due to natural, accidental, or intentional mutations, the morphology, genotype, or total DNA complement of progeny from a single parent cell may not be entirely identical to that of the original parent.

[0039] As used herein, the term "cell line" refers to a population of cells capable of continuous or prolonged growth and division in vitro. Typically, a cell line is derived from a pure population of a single progenitor cell. It is also known in the art that spontaneous or induced changes can occur in the karyotype during the storage or transfer of such pure populations. Therefore, cells derived from the mentioned cell line may not be identical to the progenitor cell or culture, and the mentioned cell line includes such variants.

[0040] As used herein, the term "recombinant cell" refers to a cell in which a foreign DNA segment has been introduced (e.g., a DNA segment that enables the transcription of biologically active polypeptides or the production of biologically active nucleic acids (e.g., RNA)).

[0041] Cell transfection can also be performed using vectors that provide helper functions to AAV (e.g., helper vectors). These helper vectors can provide adenoviral functions, including, for example, E1a, E1b, E2a, and E4ORF6. The sequences of the adenoviral genes providing these functions can be obtained from any known adenoviral serotype (e.g., serotypes 2, 3, 4, 7, 12, and 40, and further include any currently identified human types known in the art). Therefore, in some embodiments, these methods involve transfecting cells using vectors that express one or more genes required for AAV replication, AAV gene transcription, and / or AAV packaging.

[0042] As used herein, the term "vector" includes any genetic element capable of replicating when associated with a suitable control element and capable of transferring gene sequences between cells, such as plasmids, bacteriophages, transposons, granules, chromosomes, artificial chromosomes, viruses, virions, etc. Therefore, the term includes selection and expression agents as well as viral vectors. In some embodiments, useful vectors may be those in which the transcribed nucleic acid segment (e.g., nucleic acid sequence) is under the transcriptional control of a promoter. "Promoter" refers to a DNA sequence recognized by or introduced into a cellular synthetic apparatus as required to initiate specific gene transcription. The phrases "operably positioned," "under control," or "under transcriptional control" mean that the promoter is in the correct position and orientation relative to the nucleic acid to control RNA polymerase initiation and gene expression. The term "expression vector or construct" means any type of nucleic acid-containing gene construct capable of transcribing some or all of the nucleic acid coding sequence. In some embodiments, expression includes transcribing nucleic acids to, for example, generate bioactive polypeptide products or repressive RNAs (e.g., shRNA, miRNA, miRNA inhibitors) from transtranscribed genes.

[0043] In some embodiments, the promoter is the cytomegalovirus early enhancer / chicken β-actin (CB6) promoter.

[0044] In some cases, well-known methods can be used to construct and package recombinant AAVs using isolated shell genes to determine functional properties associated with the shell protein encoded by that gene. For example, isolated shell genes can be used to construct and package recombinant AAVs (rAAVs) containing reporter genes (e.g., β-galactosidase, GFP, luciferase, etc.). The rAAVs can then be delivered to animals (e.g., mice), and the tissue-targeting properties of the novel isolated shell gene can be determined by examining reporter gene expression in various tissues of the animal (e.g., heart, liver, kidney). Other methods for characterizing novel isolated shell genes are disclosed herein, and others are well-known in the art.

[0045] The aforementioned method of packaging the recombinant vector into the desired AAV protein shell to produce the rAAV of the present invention is not intended to be limiting, and those skilled in the art will understand that other suitable methods exist.

[0046] rAAV carrier The "recombinant AAV (rAAV) vector" of this invention typically consists of at least a transgene and its regulatory sequence, as well as 5' and 3' AAV inverted terminal repeats (ITRs). This recombinant AAV vector is packaged into a protein coat protein and delivered to selected target cells. In some embodiments, the transgene is a heterologous nucleic acid sequence of the vector sequence encoding a polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product of interest. The nucleic acid coding sequence is operatively linked to the regulatory component in a manner that allows transgene transcription, translation, and / or expression in the cells of the target tissue.

[0047] The AAV sequence of the vector typically contains cis-acting 5' and 3' inverted terminal repeats (see, for example, BJ Carter, "Handbook of Parvoviruses", edited by P. Tijsser, CRC Press, pp. 155-168 (1990)). The ITR sequence is approximately 145 bp in length. Preferably, the entire sequence encoding the ITR is used in the molecule, but some degree of minor modification of such sequences is permissible. The ability to modify such ITR sequences is known in the art (see, for example, Sambrook et al., "Molecular Cloning. A Laboratory Manual", 2nd edition, Cold Spring Harbor Laboratory, New York (1989); and K. Fisher et al., J Virol., 70:520-532 (1996)). One example of such a molecule used in this invention is a transgenic "cis-acting" plastid containing the selected transgenic sequence and associated regulatory elements flanked by 5' and 3' AAV ITR sequences. AAV ITR sequences can be obtained from any known AAV (including currently identified mammalian AAV types).

[0048] In some embodiments, the present invention provides a self-complementary AAV vector. As used herein, the term "self-complementary AAV vector" (scAAV) refers to a vector containing a double-stranded vector genome, which is generated by removing the terminal resolution site (TR) from one ITR of an AAV. Removing the TR prevents replication from initiating at the vector end where the TR is absent. Generally, scAAV vectors produce a single-stranded, inverted repeat sequence genome with wild-type (wt) AAV TRs at each end and a mutant TR (mTR) in the middle.

[0049] In some embodiments, the rAAV of the present invention is a pseudotyped rAAV. Pseudotypening is a process of generating a virus or viral vector combined with a foreign viral capsid protein. This produces pseudotyped viral particles. Using this method, foreign viral capsid proteins can be used to alter host tropism or increase / decrease the stability of viral particles. In some forms, pseudotyped rAAVs contain nucleic acids from two or more different AAVs, wherein the nucleic acid from one AAV encodes a protein capsid protein and at least one nucleic acid from another AAV encodes other viral proteins and / or viral genomes. In some embodiments, pseudotyped rAAV refers to an AAV containing an inverted terminal repeat (ITR) sequence of one AAV serotype and a protein capsid protein of a different AAV serotype. For example, a pseudotyped AAV vector containing an ITR of serotype X capsidated with the protein of serotype Y would be referred to as AAVX / Y (for example, AAV2 / 1 has the ITR of AAV2 and the protein capsid of AAV1). In some embodiments, pseudotyped rAAV can be used to combine the tissue-specific targeting ability of a protein coat protein from one AAV serotype with viral DNA from another AAV serotype, thereby allowing the transgene to be targeted to the target tissue.

[0050] In addition to the key elements identified above for the recombinant AAV vector, the vector also includes essential conventional control elements that are operatively linked to the transgene in a manner that allows transcription, translation, and / or expression of the transgene in cells transfected with or infected with the virus produced by this invention via a plasmid vector. As used herein, the "operatively linked" sequence includes expression control sequences adjacent to the gene of interest and trans or distant expression control sequences that act to control the gene of interest.

[0051] Expression control sequences include appropriate transcription initiation, termination, promoter, and enhancer sequences; effective RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., Kozak concordant sequences); sequences that enhance protein stability; and sequences that enhance the secretion of encoded products as needed. A large number of expression control sequences (including native, constitutive, inducible, and / or tissue-specific promoters) are known and available in the field.

[0052] As used herein, when nucleic acid sequences (e.g., coding sequences) and regulatory sequences are covalently linked in such a manner that they are expressed or transcribed under the influence or control of a regulatory sequence, they may be referred to as being "operably linked." When the goal is to translate a nucleic acid sequence into a functional protein, two DNA sequences may be referred to as being operably linked if the promoter in the 5' regulatory sequence is induced to transcribe the coding sequence and if the nature of the link between the two DNA sequences does not (1) introduce a frameshift mutation, (2) interfere with the ability of the promoter region to guide the transcription of the coding sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Therefore, if the promoter region enables the transcription of the DNA sequence so that the resulting transcript can be translated into the desired protein or polypeptide, the promoter region is operably linked to the nucleic acid sequence. Similarly, two or more coding regions are operably linked when their transcription from a universal promoter expresses two or more in-frame translated proteins. In some embodiments, operably linked coding sequences produce fusion proteins. In some embodiments, coding sequences operatively linked in an operable manner produce functional RNA (e.g., shRNA, miRNA, miRNA inhibitor).

[0053] For nucleic acids encoding proteins, polyadenylated sequences are typically inserted after the transgene sequence and before the 3' AAV ITR sequence. The rAAV constructs used in this invention may also contain introns, which are preferably located between the promoter / enhancer sequence and the transgene. One possible intron sequence is derived from SV-40 and is referred to as the SV-40 T intron sequence. Another usable vector element is the internal ribosome entry site (IRES). IRES sequences are used to generate more than one polypeptide from a single gene transcript. IRES sequences can be used to generate proteins containing more than one polypeptide chain. These and other commonly used vector elements are conventionally selected, and many such sequences can be utilized [see, for example, Sambrook et al., and references cited therein on (e.g.) pages 3.18, 3.26, and 16.17, 16.27; and Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989]. In some embodiments, the foot-and-mouth disease virus 2A sequence is included in the polyprotein; this sequence has been shown to be a small peptide (approximately 18 amino acids in length) that mediates polyprotein cleavage (Ryan, MD et al., EMBO, 1994; 4: 928-933; Mattion, NM et al., J Virology, November 1996; p. 8124-8127; Furler, S et al., Gene Therapy, 2001; 8: 864-873; and Halpin, C et al., The Plant Journal, 1999; 4: 453-459). The cleavage activity of the 2A sequence has previously been demonstrated in artificial systems including plasmids and gene therapy vectors (AAV and retroviruses) (Ryan, MD et al., EMBO, 1994;4: 928-933; Mattion, NM et al., J Virology, November 1996; p. 8124-8127; Furler, S et al., Gene Therapy, 2001;8: 864-873; and Halpin, C et al., The Plant Journal, 1999;4: 453-459; de Felipe, P et al., Gene Therapy, 1999;6: 198-208; de Felipe, P et al., Human Gene Therapy, 2000;11: 1921-1931; and Klump, H et al., Gene Therapy, 2001;8: 811-817).

[0054] The precise nature of the regulatory sequences required for gene expression in host cells may vary across species, tissues, or cell types, but generally should include, as needed, 5' non-transcriptional and 5' non-translational sequences (e.g., TATA boxes, capping sequences, CAAT sequences, enhancer elements, and the like). In particular, these 5' non-transcriptional regulatory sequences include promoter regions containing promoter sequences for transcriptional control of genes that are operatively bound. Regulatory sequences may also include enhancer sequences or upstream activation sequences as needed. The vectors of this invention may include 5' leader or signal sequences as appropriate. The selection and design of suitable vectors should be within the competence and judgment of a person skilled in the art.

[0055] Examples of constitutive promoters include (but are not limited to) the Rous sarcoma virus (RSV) LTR promoter (with RSV enhancer as appropriate), the cytomegalovirus (CMV) promoter (with CMV enhancer as appropriate) [see, for example, Boshart et al., Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the glycerol phosphokinase (PGK) promoter, and the EF1α promoter [Invitrogen].

[0056] Inducible promoters allow for the regulation of gene expression and can be regulated by the presence of exogenous supplied compounds, environmental factors (e.g., temperature), or specific physiological states (e.g., acute phase, specific cell differentiation state, or only in replicating cells). Inducible promoters and inducible systems are available from various commercial sources, including (but not limited to) Invitrogen, Clontech, and Ariad. Many other systems have been described and are readily available for selection by those skilled in the art. Examples of inducible promoters regulated by exogenous donor promoters include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088), the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline inhibition system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), and the tetracycline inducible system (Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518). (1998)), the RU486 inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4:432-441 (1997)), and the rapamycin inducible system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Other types of inducible promoters that can be used in this context are regulated by specific physiological states (e.g., temperature, acute phase, specific cell differentiation state, or only in replicating cells).

[0057] In another embodiment, a natural promoter for transgenes is used. A natural promoter is preferred when it is desired that transgene expression mimics natural expression. A natural promoter can be used when transgene expression must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimuli. In another embodiment, other natural expression control elements (e.g., enhancer elements, polyadenylation sites, or Kozak concordant sequences) may also be used to mimic natural expression.

[0058] In some embodiments, regulatory sequences confer tissue-specific gene expression capabilities. In some cases, tissue-specific regulatory sequences bind to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. Examples of tissue-specific regulatory sequences include (but are not limited to) the following tissue-specific promoters: liver-specific thyroxine-binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic polypeptide (PPY) promoter, synaptic protein-1 (Syn) promoter, creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, α-myosin heavy chain (a-MHC) promoter, gastrointestinal-specific mucin-2 promoter, eye-specific retinoschistosome promoter, eye-specific K12 promoter, respiratory tissue-specific CC10 promoter, respiratory tissue-specific surfactant protein C (SP-C) promoter, breast tissue-specific PRC1 promoter, breast tissue-specific RRM2 promoter, urinary tract tissue-specific urinary tract protein 2 (UPII) promoter, uterine tissue-specific lactoferrin promoter, or cardiac troponin T (cTnT) promoter. Other exemplary promoters include the β-actin promoter, the hepatitis B virus core promoter (Sandig et al., Gene Ther., 3:1002-9 (1996)), the α-fetoprotein (AFP) promoter (Arbuthnot et al., Hum. Gene Ther., 7:1503-14 (1996)), the osteocalcitonin promoter (Stein et al., Mol. Biol. Rep., 24:185-96 (1997)), the osteosialin promoter (Chen et al., J. Bone Miner. Res., 11:654-64 (1996)), the CD2 promoter (Hansal et al., J. Immunol., 161:1063-8 (1998), the immunoglobulin heavy chain promoter, the T cell receptor α chain promoter, and neuronal promoters (e.g., neuron-specific enolase (NSE) promoter) (Andersen et al., Cell. Mol.). Neurobiol., 13:503-15 (1993)), neurofilament light chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)) and neuron-specific vgf gene promoter (Piccioli et al., Neuron, 15:373-84 (1995)), and others as known to those skilled in this technique.

[0059] In some embodiments, tissue-specific regulatory sequences are CNS-specific promoters. Examples of CNS-specific promoters include (but are not limited to) neuron-specific enolase (NSE) promoters (Andersen et al., Cell. Mol. Neurobiol., 13:503-15 (1993)), neurofilament light chain gene promoters (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991)) and neuron-specific vgf gene promoters (Piccioli et al., Neuron, 15:373-84 (1995)). In some embodiments, CNS-specific promoters are astrocyte-specific promoters, such as glial fibrillary acidic protein promoters. In some embodiments, CNS-specific promoters are neuron promoters, such as synaptic protein (Syn) promoters. In some embodiments, CNS-specific promoter lines are selected from promoters of the following genes: neuronal nucleus (NeuN), glial fibrillary acidic protein (GFAP), adenomatous polyposis (APC) protein, and ionized calcium-binding aptamer 1 (Iba-1). In some embodiments, CNS-specific promoter lines are described as follows: Kügler S. (2016) Tissue-Specific Promoters in the CNS. Manfredsson F. (ed.) Gene Therapy for Neurological Disorders. Methods in Molecular Biology, Vol. 1382. Humana Press, New York, NY.

[0060] In some embodiments, a binding site for one or more miRNAs is incorporated into a transgene of an rAAV vector to inhibit the expression of the transgene in one or more tissues of a subject possessing the transgene (e.g., to induce off-target expression of the transgene in a cell type-specific manner). Those skilled in the art will understand that binding sites can be selected to control transgene expression in a tissue-specific manner. For example, a binding site for liver-specific miR-122 can be incorporated into a transgene to inhibit transgene expression in the liver. The target site in the mRNA can be located in the 5' UTR, 3' UTR, or coding region. Typically, the target site is located in the 3' UTR of the mRNA. Alternatively, transgenes can be designed so that multiple miRNAs regulate the mRNA by recognizing the same or multiple sites. The presence of multiple miRNA binding sites allows multiple RISCs to work synergistically and suppress expression highly effectively. The target site sequence can contain a total of 5-100, 10-60, or more nucleotides. The target site sequence can contain at least 5 nucleotides of the target gene binding site sequence.

[0061] In some embodiments, the transgene includes one or more (e.g., 1, 2, 3, 4, 5 or more) miRNA binding sites that cause off-target expression of the transgene in immune cells (e.g., antigen-presenting cells (APCs), such as macrophages, dendritic cells, etc.). Incorporating miRNA binding sites for immune-related miRNAs can cause off-target expression of the transgene from antigen-presenting cells and thereby reduce or eliminate the immune response (cellular and / or humoral) to the transgene product in a subject, as described, for example, in US 2018 / 0066279, the entire contents of which are incorporated herein by reference. In some embodiments, the immune-associated miRNAs are selected from: miR-15a, miR-16-1, miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, miR-21, miR-29a / b / c, miR-30b, miR-31, miR-34a, miR-92a-1, miR-106a, miR-125a / b, miR-142-3p, miR-146a, miR-150, miR-155, miR-181a, miR-223 and miR-424, miR-221, miR-222, let-7i, miR-148 and miR-152.

[0062] The composition of the transgenic sequence in an rAAV vector depends on the intended use of the resulting vector. For example, one type of transgenic sequence includes a reporter gene sequence that produces a detectable signal upon expression. In another example, the transgene encodes a therapeutic protein or therapeutic functional RNA. In yet another example, the transgene encodes a protein or functional RNA intended for research purposes (e.g., generating a somatic cell transgenic animal model containing the transgene, or studying the function of the transgene product). In yet another example, the transgene encodes a protein or functional RNA intended for generating an animal disease model. Appropriate transgenic coding sequences are readily apparent to those skilled in the art.

[0063] Reporter gene sequences available for transgenic applications include (but are not limited to) DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and others well-known in the industry. When associated with regulatory elements driving their expression, reporter gene sequences provide signals detectable by conventional methods, including enzymatic, radiometric, colorimetric, fluorescent or other spectroscopic analyses, fluorescence-activated cell sorting analysis, and immunological analyses (including enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and immunohistochemistry). For example, in the case of a LacZ gene marker sequence, the presence of a signal-carrying vector can be detected by analyzing β-galactosidase activity. In the case of green fluorescent protein or luciferase transgenic lines, the signal-carrying vector can be visually detected by color or light generation in a luminometer. These reporter genes can be used, for example, to verify the tissue-specific targeting ability and tissue-specific promoter regulatory activity of rAAV. [ , ]

[0064] In some embodiments, the present invention provides an rAAV vector for use in methods of: preventing or treating one or more gene defects or functional disorders in mammals, such as peptide defects or peptide overloads in mammals; and particularly treating or reducing the severity or extent of defects in humans exhibiting one or more conditions associated with defects of such peptides in cells and tissues. The method involves administering to a subject an rAAV vector encoding one or more therapeutic peptides, polypeptides, siRNAs, microRNAs, antisense nucleotides, etc., in a pharmaceutically acceptable carrier, the amount and duration of administration being sufficient to treat the defect or condition in the subject.

[0065] Therefore, this invention covers rAAV carriers that deliver peptides, polypeptides, or proteins that can be used to treat or prevent disease states in mammalian subjects. Exemplary therapeutic proteins include one or more polypeptides selected from the group consisting of: growth factors, interleukins, interferons, anti-apoptotic factors, cytokines, anti-diabetic factors, anti-apoptotic agents, coagulation factors, and anti-tumor factors. Other non-limiting examples of therapeutic proteins include BDNF, CNTF, CSF, EGF, FGF, G-SCF, GM-CSF, gonadotropins, IFN, IFG-1, M-CSF, NGF, PDGF, PEDF, TGF, VEGF, TGF-B2, TNF, prolactin, growth hormone, XIAP1, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-10 (187A), viral IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, and IL-18.

[0066] The rAAV vector may contain the gene intended to be transferred to a subject to treat a disease associated with reduced, absent, or dysfunctional expression of the gene. In some embodiments, the rAAV vector is used to treat diseases related to the central nervous system.Specific genes and related disease states include (but are not limited to): glucose-6-phosphatase associated with type 1A glycogen storage deficiency; phosphoenolpyruvate-carboxylkinase associated with Pepck deficiency; galactose-1-phosphate uridine transferase associated with galactosemia; phenylalanine hydroxylase associated with phenylketonuria; branched-chain α-ketoacid dehydrogenase associated with maple syrup diabetes; and fumarate acetyltransferase associated with type 1 tyrosinemia. Acetic acid hydrolase; methylmalonidic acidemia-related methylmalonic acidemia-related methylmalonic acidemia-related methylmalonic acidemia-related medium-chain acetyl-CoA dehydrogenase; ornithine transaminase-related methylmalonic acidemia-related ornithine transaminase-related methylmalonic acidemia-related argininosuccinate synthase; low-density lipoprotein receptor protein associated with familial hypercholesterolemia; and Crigler-Najjar disease. UDP-glucuronyltransferase associated with disease; adenosine deaminease associated with severe combined immunodeficiency; hypoxanthine-guanine phosphoribosyltransferase associated with gout and Lesch-Nyan syndrome; biotinylate associated with biotinase deficiency; β-glucocerebrosidase associated with Gaucher disease; β-glucuronidase associated with Sly syndrome; and 70% of enzymes associated with Zellweger syndrome. kDa peroxisome membrane protein; bile pigment deaminase associated with acute intermittent porphyria; α-1 antitrypsin for treating α-1 antitrypsin deficiency (emphysema); erythropoietin for treating anemia caused by thalassemia or renal failure; vascular endothelial growth factor, angiopoietin-1, and fibroblast growth factor for treating ischemic diseases; thrombomodulin and tissue factor pathway inhibitors for treating vascular occlusions such as those seen in atherosclerosis, thrombosis, or embolism; aromatic amino acid decarboxylase (AADC) and tyrosine hydroxylase (TH) for treating Parkinson's disease; β-adrenergic receptors, antisenses or mutant forms of phosphoproteins, and myoplasmic reticulum adenosine triphosphatase-2 for treating congestive heart failure. (SERCA2) and cardiac adenylate cyclase; tumor suppressor genes (e.g., p53) used to treat various cancers; cytokines (e.g., one of various interleukins) used to treat inflammatory and immune disorders and cancer; dystrophin or microdystrophin and utrophin or micromyotrophin used to treat muscle malnutrition; and insulin used to treat diabetes.

[0067] Those skilled in the art will also recognize that, in the case of transgenes encoding proteins or peptides, mutations that produce conserved amino acid substitutions can be made in the transgene to provide variants or homologues that are functionally equivalent to the protein or peptide. In some embodiments, the present invention covers sequence alterations that result in conserved amino acid substitutions in the transgene. In some embodiments, the transgene comprises a gene having a dominant negative mutation. For example, the transgene may be a variant that expresses a mutant protein that interacts with the same elements as the wild-type protein, thereby blocking the function of the wild-type protein.

[0068] Useful transgenic products also include miRNAs. miRNAs and other small interfering nucleic acids regulate gene expression through target RNA transcript cleavage / degradation or translational repression of target messenger RNAs (mRNAs). miRNAs typically manifest naturally as 19-25 final untranslated RNA products. miRNAs exhibit their activity through sequence-specific interactions with the 3' untranslated region (UTR) of the target mRNA. These endogenously expressed miRNAs form hairpin precursors, which are then processed into miRNA duplexes and further processed into "mature" single-stranded miRNA molecules. This mature miRNA guides the multiprotein complex miRISC, which identifies, for example, the target site in the 3' UTR region of the target mRNA based on the complementarity between the target mRNA and the mature miRNA.

[0069] In some method embodiments, the following non-limiting list of miRNA genes and their homologues may be used as transgenics or as targets of small interfering nucleic acids (e.g., miRNA sponges, antisense oligonucleotides, TuD RNA) encoded by transgenics: hsa-let-7a, hsa-let-7a*, hsa-let-7b, hsa-let-7b*, hsa-let-7c, hsa-let-7c*, hsa-let-7d, hsa-let-7d*, hsa-let-7e, hsa-let-7e*, hsa-let-7f, hsa-let-7f-1*, hsa-let-7f-2*, hsa-let-7g, hsa-let-7g*, hsa-let-7i, hsa-let-7i*, hsa-miR-1, hsa-miR-100, h sa-miR-100*, hsa-miR-101, hsa-miR-101*, hsa-miR-103, hsa-miR-105, hsa-miR-105*, hsa-miR-106a, hsa-miR-106a*, hsa-miR-106b, h sa-miR-106b*, hsa-miR-107, hsa-miR-10a, hsa-miR-10a*, hsa-miR-10b, hsa-miR-10b*, hsa-miR-1178, hsa-miR-1179, hsa-miR-1180, h sa-miR-1181, hsa-miR-1182, hsa-miR-1183, hsa-miR-1184, hsa-miR-1185, hsa-miR-1197, hsa-miR-1200, hsa-miR-1201, hsa-miR-1202 , hsa-miR-1203, hsa-miR-1204, hsa-miR-1205, hsa-miR-1206, hsa-miR-1207-3p, hsa-miR-1207-5p, hsa-miR-1208, hsa-miR-122, hsa-m iR-122*, hsa-miR-1224-3p, hsa-miR-1224-5p, hsa-miR-1225-3p, hsa-miR-1225-5p, hsa-miR-1226, hsa-miR-1226*, hsa-miR-1227, hsa -miR-1228, hsa-miR-1228*, hsa-miR-1229, hsa-miR-1231, hsa-miR-1233, hsa-miR-1234, hsa-miR-1236, hsa-miR-1237, hsa-miR-1238,hsa-miR-124, hsa-miR-124*, hsa-miR-1243, hsa-miR-1244, hsa-miR-1245, hsa-miR-1246, hsa-miR-1247, hsa-miR-1248, hsa-miR-1249, hsa-miR- 1250, hsa-miR-1251, hsa-miR-1252, hsa-miR-1253, hsa-miR-1254, hsa-miR-1255a, hsa-miR-1255b, hsa-miR-1256, hsa-miR-1257, hsa-miR-1258, h sa-miR-1259, hsa-miR-125a-3p, hsa-miR-125a-5p, hsa-miR-125b, hsa-miR-125b-1*, hsa-miR-125b-2*, hsa-miR-126, hsa-miR-126*, hsa-miR-12 60, hsa-miR-1261, hsa-miR-1262, hsa-miR-1263, hsa-miR-1264, hsa-miR-1265, hsa-miR-1266, hsa-miR-1267, hsa-miR-1268, hsa-miR-1269, hsa-m iR-1270, hsa-miR-1271, hsa-miR-1272, hsa-miR-1273, hsa-miR-127-3p, hsa-miR-1274a, hsa-miR-1274b, hsa-miR-1275, hsa-miR-127-5p, hsa-mi R-1276, hsa-miR-1277, hsa-miR-1278, hsa-miR-1279, hsa-miR-128, hsa-miR-1280, hsa-miR-1281, hsa-miR-1282, hsa-miR-1283, hsa-miR-1284, hs a-miR-1285, hsa-miR-1286, hsa-miR-1287, hsa-miR-1288, hsa-miR-1289, hsa-miR-129*, hsa-miR-1290, hsa-miR-1291, hsa-miR-1292, hsa-miR-1 293, hsa-miR-129-3p, hsa-miR-1294, hsa-miR-1295, hsa-miR-129-5p, hsa-miR-1296, hsa-miR-1297, hsa-miR-1298, hsa-miR-1299, hsa-miR-1300hsa-miR-1301, hsa-miR-1302, hsa-miR-1303, hsa-miR-1304, hsa-miR-1305, hsa-miR-1306, hsa-miR-1307, hsa-miR-1308, hsa-miR-130a, hsa-miR- 130a*、hsa-miR-130b、hsa-miR-130b*、hsa-miR-132、hsa-miR-132*、hsa- miR-1321、hsa-miR-1322、hsa-miR-1323、hsa-miR-1324、hsa-miR-133a、hs a-miR-133b, hsa-miR-134, hsa-miR-135a, hsa-miR-135a*, hsa-miR-135b, hsa-miR-135b*, hsa-miR-136, hsa-miR-136*, hsa-miR-137, hsa-miR-138 hsa-miR-138-1* hsa-miR-138-2* hsa-miR-139-3p hsa-miR-139-5p hsa-miR-140-3p hsa-miR-140-5p hsa-miR-141 hsa-miR-141* hsa-miR-1 42-3p, hsa-miR-142-5p, hsa-miR-143, hsa-miR-143*, hsa-miR-144, hsa-miR-144*, hsa-miR-145, hsa-miR-145*, hsa-miR-146a, hsa-miR-146a*, hs a-miR-146b-3p, hsa-miR-146b-5p, hsa-miR-147, hsa-miR-147b, hsa-miR-148a, hsa-miR-148a*, hsa-miR-148b, hsa-miR-148b*, hsa-miR-149, hsa- miR-149*, hsa-miR-150, hsa-miR-150*, hsa-miR-151-3p, hsa-miR-151-5p, hsa-miR-152, hsa-miR-153, hsa-miR-154, hsa-miR-154*, hsa-miR-155 hsa-miR-155*, hsa-miR-15a, hsa-miR-15a*, hsa-miR-15b, hsa-miR-15b*, hsa-miR-16, hsa-miR-16-1*, hsa-miR-16-2*, hsa-miR-17, hsa-miR-17*,hsa-miR-181a, hsa-miR-181a*, hsa-miR-181a-2*, hsa-miR-181b, hsa-miR-181c, hsa-miR-181c*, hsa-miR-181d, hsa-miR-182, hsa-miR-182*, hsa -miR-1825、hsa-miR-1826、hsa-miR-1827、hsa-miR-183、hsa-miR-183*、hsa-miR-184、hsa-miR-185、hsa-miR-185*、hsa-miR-186、hsa-miR-186*、h sa-miR-187, hsa-miR-187*, hsa-miR-188-3p, hsa-miR-188-5p, hsa-miR-18a, hsa-miR-18a*, hsa-miR-18b, hsa-miR-18b*, hsa-miR-190, hsa-miR- 190b, hsa-miR-191, hsa-miR-191*, hsa-miR-192, hsa-miR-192*, hsa-miR-193a-3p, hsa-miR-193a-5p, hsa-miR-193b, hsa-miR-193b*, hsa-miR-19 4、hsa-miR-194*、hsa-miR-195、hsa-miR-195*、hsa-miR-196a、hsa-miR-196a*、hsa-miR-196b、hsa-miR-197、hsa-miR-198、hsa-miR-199a-3p、hsa- miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a, hsa-miR-19a*, hsa-miR-19b, hsa-miR-19b-1*, hsa-miR-19b-2*, hsa-miR-200a, hsa-miR-200a*, hs a-miR-200b, hsa-miR-200b*, hsa-miR-200c, hsa-miR-200c*, hsa-miR-202, hsa-miR-202*, hsa-miR-203, hsa-miR-204, hsa-miR-205, hsa-miR-206 hsa-miR-208a hsa-miR-208b hsa-miR-20a hsa-miR-20a* hsa-miR-20b hsa-miR-20b* hsa-miR-21 hsa-miR-21* hsa-miR-210 hsa-miR-211hsa-miR-212, hsa-miR-214, hsa-miR-214*, hsa-miR-215, hsa-miR-216a, hsa-miR-216b, hsa-miR-217, hsa-miR-218, hsa-miR-218-1*, hsa-miR-21 8-2*, hsa-miR-219-1-3p, hsa-miR-219-2-3p, hsa-miR-219-5p, hsa-miR-22, hsa-miR-22*, hsa-miR-220a, hsa-miR-220b, hsa-miR-220c, hsa-miR- 221, hsa-miR-221*, hsa-miR-222, hsa-miR-222*, hsa-miR-223, hsa-miR-223*, hsa-miR-224, hsa-miR-23a, hsa-miR-23a*, hsa-miR-23b, hsa-miR- 23b*、hsa-miR-24、hsa-miR-24-1*、hsa-miR-24-2*、hsa-miR-25、hsa-miR-25*、hsa-miR-26a、hsa-miR-26a-1*、hsa-miR-26a-2*、hsa-miR-26b、hsa- miR-26b*, hsa-miR-27a, hsa-miR-27a*, hsa-miR-27b, hsa-miR-27b*, hsa-miR-28-3p, hsa-miR-28-5p, hsa-miR-296-3p, hsa-miR-296-5p, hsa-miR -297, hsa-miR-298, hsa-miR-299-3p, hsa-miR-299-5p, hsa-miR-29a, hsa-miR-29a*, hsa-miR-29b, hsa-miR-29b-1*, hsa-miR-29b-2*, hsa-miR-29 c、hsa-miR-29c*、hsa-miR-300、hsa-miR-301a、hsa-miR-301b、hsa-miR-3 02a、hsa-miR-302a*、hsa-miR-302b、hsa-miR-302b*、hsa-miR-302c、hsa- miR-302c*, hsa-miR-302d, hsa-miR-302d*, hsa-miR-302e, hsa-miR-302f, hsa-miR-30a, hsa-miR-30a*, hsa-miR-30b, hsa-miR-30b*, hsa-miR-30chsa-miR-30c-1*, hsa-miR-30c-2*, hsa-miR-30d, hsa-miR-30d*, hsa-miR-30e, hsa-miR-30e*, hsa-miR-31, hsa-miR-31*, hsa-miR-32, hsa-miR-32*, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-323-3p, hsa-miR-323-5p, hsa-miR-324-3p, hsa-miR-324-5p, hsa-miR-32 5, hsa-miR-326, hsa-miR-328, hsa-miR-329, hsa-miR-330-3p, hsa-miR-330-5p, hsa-miR-331-3p, hsa-miR-331-5p, hsa-miR-335, hsa-miR-335*, h sa-miR-337-3p, hsa-miR-337-5p, hsa-miR-338-3p, hsa-miR-338-5p, hsa-miR-339-3p, hsa-miR-339-5p, hsa-miR-33a, hsa-miR-33a*, hsa-miR-33b hsa-miR-33b* hsa-miR-340 hsa-miR-340* hsa-miR-342-3p hsa-miR-342-5p hsa-miR-345 hsa-miR-346 hsa-miR-34a hsa-miR-34a* hsa-mi R-34b, hsa-miR-34b*, hsa-miR-34c-3p, hsa-miR-34c-5p, hsa-miR-361-3p, hsa-miR-361-5p, hsa-miR-362-3p, hsa-miR-362-5p, hsa-miR-363, hsa -miR-363*, hsa-miR-365, hsa-miR-367, hsa-miR-367*, hsa-miR-369-3p, hsa-miR-369-5p, hsa-miR-370, hsa-miR-371-3p, hsa-miR-371-5p, hsa-m iR-372, hsa-miR-373, hsa-miR-373*, hsa-miR-374a, hsa-miR-374a*, hsa-miR-374b, hsa-miR-374b*, hsa-miR-375, hsa-miR-376a, hsa-miR-376a*hsa-miR-376b, hsa-miR-376c, hsa-miR-377, hsa-miR-377*, hsa-miR-378, hsa-miR-378*, hsa-miR-379, hsa-miR-379*, hsa-miR-380, hsa-miR-380 *, hsa-miR-381, hsa-miR-382, hsa-miR-383, hsa-miR-384, hsa-miR-409-3p, hsa-miR-409-5p, hsa-miR-410, hsa-miR-411, hsa-miR-411*, hsa-miR- 412, hsa-miR-421, hsa-miR-422a, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424, hsa-miR-424*, hsa-miR-425, hsa-miR-425*, hsa-miR-429, hsa -miR-431、hsa-miR-431*、hsa-miR-432、hsa-miR-432*、hsa-miR-433、hsa-miR-448、hsa-miR-449a、hsa-miR-449b、hsa-miR-450a、hsa-miR-450b-3p hsa-miR-450b-5p hsa-miR-451 hsa-miR-452 hsa-miR-452* hsa-miR-453 hsa-miR-454 hsa-miR-454* hsa-miR-455-3p hsa-miR-455-5p hsa -miR-483-3p, hsa-miR-483-5p, hsa-miR-484, hsa-miR-485-3p, hsa-miR-485-5p, hsa-miR-486-3p, hsa-miR-486-5p, hsa-miR-487a, hsa-miR-487b hsa-miR-488, hsa-miR-488*, hsa-miR-489, hsa-miR-490-3p, hsa-miR-490-5p, hsa-miR-491-3p, hsa-miR-491-5p, hsa-miR-492, hsa-miR-493, hsa -miR-493*, hsa-miR-494, hsa-miR-495, hsa-miR-496, hsa-miR-497, hsa-miR-497*, hsa-miR-498, hsa-miR-499-3p, hsa-miR-499-5p, hsa-miR-500hsa-miR-500*, hsa-miR-501-3p, hsa-miR-501-5p, hsa-miR-502-3p, hsa-miR-502-5p, hsa-miR-503, hsa-miR-504, hsa-miR-505, hsa-miR-505*, hsa -miR-506, hsa-miR-507, hsa-miR-508-3p, hsa-miR-508-5p, hsa-miR-509-3-5p, hsa-miR-509-3p, hsa-miR-509-5p, hsa-miR-510, hsa-miR-511, hsa -miR-512-3p, hsa-miR-512-5p, hsa-miR-513a-3p, hsa-miR-513a-5p, hsa-miR-513b, hsa-miR-513c, hsa-miR-514, hsa-miR-515-3p, hsa-miR-515-5 p, hsa-miR-516a-3p, hsa-miR-516a-5p, hsa-miR-516b, hsa-miR-517*, hsa-miR-517a, hsa-miR-517b, hsa-miR-517c, hsa-miR-518a-3p, hsa-miR-51 8a-5p、hsa-miR-518b、hsa-miR-518c、hsa-miR-518c*、hsa-miR-518d-3p、 hsa-miR-518d-5p、hsa-miR-518e、hsa-miR-518e*、hsa-miR-518f、hsa-miR -518f*、hsa-miR-519a、hsa-miR-519b-3p、hsa-miR-519c-3p、hsa-miR-51 9d、hsa-miR-519e、hsa-miR-519e*、hsa-miR-520a-3p、hsa-miR-520a-5p、h sa-miR-520b, hsa-miR-520c-3p, hsa-miR-520d-3p, hsa-miR-520d-5p, hsa-miR-520e, hsa-miR-520f, hsa-miR-520g, hsa-miR-520h, hsa-miR-521, h sa-miR-522, hsa-miR-523, hsa-miR-524-3p, hsa-miR-524-5p, hsa-miR-525-3p, hsa-miR-525-5p, hsa-miR-526b, hsa-miR-526b*, hsa-miR-532-3phsa-miR-532-5p, hsa-miR-539, hsa-miR-541, hsa-miR-541*, hsa-miR-542-3p, hsa-miR-542-5p, hsa-miR-543, hsa-miR-544, hsa-miR-545, hsa-mi R-545*, hsa-miR-548a-3p, hsa-miR-548a-5p, hsa-miR-548b-3p, hsa-miR-548b-5p, hsa-miR-548c-3p, hsa-miR-548c-5p, hsa-miR-548d-3p, hsa-mi R-548d-5p、hsa-miR-548e、hsa-miR-548f、hsa-miR-548g、hsa-miR-548h、 hsa-miR-548i、hsa-miR-548j、hsa-miR-548k、hsa-miR-548l、hsa-miR-54 8m, hsa-miR-548n, hsa-miR-548o, hsa-miR-548p, hsa-miR-549, hsa-miR-550, hsa-miR-550*, hsa-miR-551a, hsa-miR-551b, hsa-miR-551b*, hsa-mi R-552, hsa-miR-553, hsa-miR-554, hsa-miR-555, hsa-miR-556-3p, hsa-miR-556-5p, hsa-miR-557, hsa-miR-558, hsa-miR-559, hsa-miR-561, hsa- miR-562, hsa-miR-563, hsa-miR-564, hsa-miR-566, hsa-miR-567, hsa-miR-568, hsa-miR-569, hsa-miR-570, hsa-miR-571, hsa-miR-572, hsa-miR-5 73, hsa-miR-574-3p, hsa-miR-574-5p, hsa-miR-575, hsa-miR-576-3p, hsa-miR-576-5p, hsa-miR-577, hsa-miR-578, hsa-miR-579, hsa-miR-580, h sa-miR-581, hsa-miR-582-3p, hsa-miR-582-5p, hsa-miR-583, hsa-miR-584, hsa-miR-585, hsa-miR-586, hsa-miR-587, hsa-miR-588, hsa-miR-589hsa-miR-589*, hsa-miR-590-3p, hsa-miR-590-5p, hsa-miR-591, hsa-miR-592, hsa-miR-593, hsa-miR-593*, hsa-miR-595, hsa-miR-596, hsa-miR-597, hsa-miR-598, hsa-miR-599, hsa-miR-600, hsa-miR-601, hsa-miR-602, hsa-miR-603, hsa-miR-604, hsa-miR-605, hsa-miR-606, hsa-miR-607 hsa-miR-608 hsa-miR-609 hsa-miR-610 hsa-miR-611 hsa-miR-612 hsa-miR-613 hsa-miR-614 hsa-miR-615-3p hsa-miR-615-5p hsa-miR-6 16, hsa-miR-616*, hsa-miR-617, hsa-miR-618, hsa-miR-619, hsa-miR-620, hsa-miR-621, hsa-miR-622, hsa-miR-623, hsa-miR-624, hsa-miR-624* hsa-miR-625 hsa-miR-625* hsa-miR-626 hsa-miR-627 hsa-miR-628-3p hsa-miR-628-5p hsa-miR-629 hsa-miR-629* hsa-miR-630 hsa-mi R-631, hsa-miR-632, hsa-miR-633, hsa-miR-634, hsa-miR-635, hsa-miR-636, hsa-miR-637, hsa-miR-638, hsa-miR-639, hsa-miR-640, hsa-miR-64 1, hsa-miR-642, hsa-miR-643, hsa-miR-644, hsa-miR-645, hsa-miR-646, hsa-miR-647, hsa-miR-648, hsa-miR-649, hsa-miR-650, hsa-miR-651, hs a-miR-652, hsa-miR-653, hsa-miR-654-3p, hsa-miR-654-5p, hsa-miR-655, hsa-miR-656, hsa-miR-657, hsa-miR-658, hsa-miR-659, hsa-miR-660hsa-miR-661, hsa-miR-662, hsa-miR-663, hsa-miR-663b, hsa-miR-664, hsa-miR-664*, hsa-miR-665, hsa-miR-668, hsa-miR-671-3p, hsa-miR-671- 5p, hsa-miR-675, hsa-miR-7, hsa-miR-708, hsa-miR-708*, hsa-miR-7-1*, hsa-miR-7-2*, hsa-miR-720, hsa-miR-744, hsa-miR-744*, hsa-miR-758 hsa-miR-760, hsa-miR-765, hsa-miR-766, hsa-miR-767-3p, hsa-miR-767-5p, hsa-miR-768-3p, hsa-miR-768-5p, hsa-miR-769-3p, hsa-miR-769-5p hsa-miR-770-5p hsa-miR-802 hsa-miR-873 hsa-miR-874 hsa-miR-875-3p hsa-miR-875-5p hsa-miR-876-3p hsa-miR-876-5p hsa-miR-877 h sa-miR-877*, hsa-miR-885-3p, hsa-miR-885-5p, hsa-miR-886-3p, hsa-miR-886-5p, hsa-miR-887, hsa-miR-888, hsa-miR-888*, hsa-miR-889, hsa- miR-890, hsa-miR-891a, hsa-miR-891b, hsa-miR-892a, hsa-miR-892b, hsa-miR-9, hsa-miR-9*, hsa-miR-920, hsa-miR-921, hsa-miR-922, hsa-miR- 923, hsa-miR-924, hsa-miR-92a, hsa-miR-92a-1*, hsa-miR-92a-2*, hsa-miR-92b, hsa-miR-92b*, hsa-miR-93, hsa-miR-93*, hsa-miR-933, hsa-miR -934, hsa-miR-935, hsa-miR-936, hsa-miR-937, hsa-miR-938, hsa-miR-939, hsa-miR-940, hsa-miR-941, hsa-miR-942, hsa-miR-943, hsa-miR-944hsa-miR-95, hsa-miR-96, hsa-miR-96*, hsa-miR-98, hsa-miR-99a, hsa-miR-99a*, hsa-miR-99b and hsa-miR-99b*. ,

[0070] miRNAs inhibit the function of their target mRNAs and thereby inhibit the expression of peptides encoded by those mRNAs. Therefore, blocking (partially or completely) the activity of miRNAs (e.g., silencing the miRNA) can effectively induce or restore the expression of the suppressed peptide (de-repressed peptide). In one embodiment, the peptide encoded by the mRNA target of the miRNA is de-repressed by inhibiting the activity of miRNAs in the cell via any of various methods. For example, the activity of miRNAs can be blocked by hybridizing with small interfering nucleic acids (e.g., antisense oligonucleotides, miRNA sponges, TuD RNAs) that are complementary or substantially complementary to the miRNA, thereby blocking the interaction between the miRNA and its target mRNA. As used herein, small interfering nucleic acids substantially complementary to miRNAs are those capable of hybridizing with the miRNA and blocking its activity. In some embodiments, the small interfering nucleic acid (MIA) substantially complementary to the miRNA is an MIA complementary to the miRNA at all (excluding 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 bases). In some embodiments, the MIA sequence substantially complementary to the miRNA is an MIA sequence complementary to a miRNA having at least one base.

[0071] "miRNA inhibitors" are agents that block the function, expression, and / or treatment of miRNAs. Examples of such molecules include (but are not limited to) microRNA-specific antisenses, microRNA sponges, tough bait RNAs (TuD RNAs), and microRNA oligonucleotides (double-stranded, hairpin, and short oligonucleotides) that inhibit the interaction of miRNAs with the Drosha complex. MicroRNA inhibitors can be transgenic into cells via rAAV vectors, as discussed above. MicroRNA sponges specifically inhibit miRNAs via complementary heptameric seed sequences (Ebert, MS Nature Methods, Epub, August 12, 2007). In some embodiments, a single sponge sequence can be used to silence an entire miRNA family. TuD RNAs can effectively and persistently inhibit specific miRNAs in mammalian cells (see, for example, Takeshi Haraguchi et al., Nucleic Acids Research, 2009, Vol. 37, No. 6, e43, the content on TuD RNA in which is incorporated herein by reference). Other methods for silencing miRNA function in cells (miRNA de-blocking) are known to those familiar with this technique.

[0072] In some embodiments, the selectivity of recombinant RNA vectors may limit the desired coding sequence and may require complete replacement of the 4.8 kbp virus genome. Therefore, in some cases, large genomes may not be suitable for standard recombinant AAV vectors. Those skilled in the art will understand that options are available to overcome limited coding capacity. For example, the AAV ITRs of two genomes can be annealed to form head-to-tail conjoints, thereby doubling the vector's capacity. Insertion splicing sites can remove the ITR from the transcript. Other options for overcoming limited selectivity are apparent to those skilled in the art.

[0073] invest rAAV can be delivered to subjects in compositional form using any suitable method known in the art. rAAV, preferably suspended in a physiologically compatible carrier (e.g., in compositional form), can be administered to subjects (e.g., host animals, such as humans, mice, rats, cats, dogs, sheep, rabbits, horses, cattle, goats, pigs, guinea pigs, hamsters, chickens, turkeys, or non-human primates (e.g., macaques)). In some embodiments, the host animal does not include humans.

[0074] rAAV can be delivered to mammalian subjects by, for example, intramuscular injection or by administration into the bloodstream of the mammalian subject. Administration into the bloodstream can be achieved by injection into a vein, artery, or any other blood vessel. In some embodiments, rAAV is administered into the bloodstream via isolated limb perfusion (a technique well-known in the surgical field), which essentially allows the technician to isolate the limb from systemic circulation prior to administration of the rAAV virus. Variations of the isolated limb perfusion technique (described in U.S. Patent No. 6,177,403) can also be used to administer the virus into the vascular system of the isolated limb to potentially enhance transduction in muscle cells or tissues. Furthermore, in some cases, delivery of the virus to the subject's CNS may be desired. "CNS" refers to all cells and tissues of the brain and spinal cord in vertebrates. Therefore, the term includes (but is not limited to) neurons, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage, and the like. Recombinant AAVs can be delivered directly to the CNS or brain using known neurosurgical techniques (e.g., stereotactic injection) via needles, catheters, or related devices to (e.g.) the ventricular region and striatum (e.g., the caudate nucleus or lentiform putamen), spinal cord and neuromuscular junction, or cerebellar lobules (see, for example, Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther. 11:2315-2329, 2000).

[0075] The compositions of the present invention may comprise a single rAAV or a combination of rAAV with one or more other viruses (e.g., a second rAAV encoding one or more different transgenes). In some embodiments, the composition comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different rAAVs each having one or more different transgenes.

[0076] Those skilled in this art can easily select a suitable carrier based on the indications for which rAAV is intended. For example, a suitable carrier includes saline solution, which can be prepared with various buffer solutions (e.g., phosphate-buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The choice of carrier does not limit the invention.

[0077] Depending on the circumstances, in addition to rAAV and the carrier, the compositions of the present invention may also contain other conventional pharmaceutical ingredients (e.g., preservatives or chemical stabilizers). Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerin, phenol, and p-chlorophenol. Suitable chemical stabilizers include gelatin and albumin.

[0078] Adequate doses of rAAV are administered to transfect cells in the desired tissue and provide sufficient gene transfer and expression without excessive adverse effects. Pharmaceutically acceptable conventional routes of administration include (but are not limited to) direct delivery to the selected organ (e.g., intravenous delivery to the liver via the portal vein), oral, inhalation (including intranasal and intratracheal delivery), intraocular, intravenous, intramuscular, subcutaneous, intradermal, intratumoral, intracranial (e.g., intrahippocampal), and other non-enteral routes. Combinations of delivery routes may be used as needed.

[0079] The dosage of rAAV virus required to achieve a specific "therapeutic effect" (e.g., in the form of gene copies per kilogram of body weight (GC / kg)) will vary based on several factors, including (but not limited to): the route of rAAV virus administration, the level of gene or RNA expression required to achieve the therapeutic effect, the specific disease or condition being treated, and the stability of the gene or RNA product. Based on the factors mentioned above, as well as other factors well known in the field, those skilled in this technique can easily determine the range of rAAV virus dosages needed to treat patients with a specific disease or condition.

[0080] An effective dose of rAAV is an amount sufficient to target and infect an animal or a desired tissue. In some embodiments, an effective dose of rAAV is sufficient to produce a stable somatic transgenic animal model. The effective dose depends primarily on factors such as species, age, weight, subject health status, and the target tissue, and can therefore vary between animals or tissues. For example, an effective dose of rAAV is typically in the range of about 1 ml to about 100 ml of a solution containing about 10⁹ to 10¹⁶ gene copies. In some embodiments, rAAV is administered at a dose of 10¹⁰, 10¹¹, 10¹², 10¹³, 10¹⁴, or 10¹⁵ gene copies per subject. In some embodiments, rAAV is administered at a dose of 10¹⁰, 10¹¹, 10¹², 10¹³, or 10¹⁴ gene copies per kg. In some cases, a dose between about 10¹¹ and 10¹² rAAV gene copies is more appropriate. In some embodiments, 10¹² rAAV gene copies can effectively target heart, liver, and pancreatic tissues. In some cases, stable transgenic animals are produced using multiple doses of rAAV.

[0081] In some embodiments, the rAAV composition is formulated to reduce the aggregation of AAV particles in the composition, especially in the presence of high rAAV concentrations (e.g., about 10¹³ GC / ml or higher). Methods for reducing rAAV aggregation are well known in the art and include, for example, the addition of surfactants, pH adjustment, salt concentration adjustment, etc. (see, for example, Wright FR et al., Molecular Therapy (2005) 12, 171-178, the contents of which are incorporated herein by reference).

[0082] The formulation of pharmaceutically acceptable excipients and carrier solutions is well known to those skilled in this art, who are also familiar with the appropriate dosing and treatment regimens for the use of the specific compositions described herein in various treatment options.

[0083] Typically, such formulations may contain at least about 0.1% or more of the active compound, but the percentage of the active ingredient can, of course, vary and can conveniently be between about 1% or 2% and about 70% or 80% (or higher) of the total weight or volume of the formulation. Naturally, the amount of the active compound in each therapeutically useful composition can be prepared such that a suitable dose will be obtained at any given unit dose of the compound. Those skilled in the art of preparing such pharmaceutical formulations will consider factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations, and thereby anticipate various dosages and treatment regimens.

[0084] In certain circumstances, it is desirable to deliver rAAV-based therapeutic constructs in the form of appropriately formulated pharmaceutical compositions disclosed herein via subcutaneous, intrapancreatic, intranasal, non-intestinal, intravenous, intracranial (e.g., intrahippocampal), intramuscular, intrathecal, or oral, intraperitoneal, or inhalation. In some embodiments, rAAV may be delivered using administration methods as set forth in U.S. Patents 5,543,158, 5,641,515, and 5,399,363 (the entire contents of which are specifically incorporated herein by reference). In some embodiments, a preferred administration method is via portal vein injection.

[0085] Suitable pharmaceutical formulations for injectable applications include sterile aqueous solutions or dispersions and sterile powders for the temporary preparation of sterile injectable solutions or dispersions. Dispersions can also be prepared in glycerol, liquid polyethylene glycol and mixtures thereof, and in oils. Under normal storage and use conditions, these formulations contain preservatives to prevent microbial growth. In many cases, the form is sterile and fluid in a manner that allows for easy injection. It must be stable under manufacturing and storage conditions and must be protected against microbial contamination such as bacteria and fungi. The carrier can be a solvent or dispersion culture medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycol and the like), suitable mixtures thereof, and / or vegetable oils. Appropriate flowability can be maintained, for example, by using coatings such as lecithin, maintaining the desired particle size in the case of dispersions, and using surfactants. Microbial action can be prevented by various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like). In many cases, isotonic agents, such as sugar or sodium chloride, are preferred. Extended absorption of injectable compositions can be achieved by using absorption-retarding agents (such as aluminum monostearate and gelatin) in the composition.

[0086] For administration of injectable aqueous solutions, the solution may be buffered as needed, and the liquid diluent should first be made isotonic with adequate saline or glucose. Such specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. For this purpose, sterile aqueous culture media are known to those skilled in the art. For example, a dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous infusion fluid or injected at the indicated infusion site (see, for example, Remington's Pharmaceutical Sciences, 15th edition, pp. 1035-1038 and 1570-1580). Dosage variations will inevitably occur depending on the host condition. In any case, the person administering the medication will determine the appropriate dose for the individual host.

[0087] Sterile injectable solutions are prepared by incorporating the required amount of active rAAV into a suitable solvent containing, as desired, various other components listed herein, followed by filtration and sterilization. Typically, dispersions are prepared by incorporating various sterilized active ingredients into a sterile medium containing a basic dispersion medium and other desired components listed above. In the case of using sterile powders to prepare sterile injectable solutions, preferred methods are vacuum drying and freeze-drying techniques, which produce powders containing the active ingredient plus any other desired components from a pre-sterile filtered solution.

[0088] The rAAV compositions disclosed herein can also be formulated into neutral or salt forms. Pharmaceutically acceptable salts include acid addition salts (those that form with the free amino groups of proteins) and those that form with inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, and the like). Salts formed with free carboxyl groups can also be derived from inorganic bases such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or ferric hydroxide, or organic bases such as isopropylamine, trimethylamine, histidine, or procaine, and the like. After formulation, the solution is administered in a dosage-compatible manner and at a therapeutically effective amount. The formulation is readily administered in various dosage forms, such as injectable solutions, drug-release capsules, and the like.

[0089] As used herein, "carrier" includes any and all solvents, dispersion media, mordants, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption-retarding agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and reagents for pharmaceutically active substances is well-known in the industry. Supplemental active ingredients may also be incorporated into the composition. The phrase "pharmaceutically acceptable" means that the molecular entity and composition will not produce an allergic reaction or similar adverse reaction when administered to the host.

[0090] The compositions of the present invention can be introduced into suitable host cells using delivery media (e.g., liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like). Specifically, transgenes delivered via rAAV vectors can be formulated and delivered in the form of lipid particles, liposomes, vesicles, nanospheres, or nanoparticles, or the like.

[0091] These formulations are preferably used to introduce pharmaceutically acceptable formulations of the nucleic acids or rAAV constructs disclosed herein. The formation and use of liposomes are generally known to those skilled in the art. Recently, liposomes with improved serum stability and circulating half-life have been developed (US Patent No. 5,741,516). Furthermore, various methods for using liposomes and liposome-like formulations as potential drug carriers have been described (US Patent Nos. 5,567,434, 5,552,157, 5,565,213, 5,738,868, and 5,795,587).

[0092] Liposomes have been successfully used with many cell types that are typically resistant to transfection by other procedures. Furthermore, liposomes do not have the typical DNA length limitations of virus-based delivery systems. Liposomes have been effectively used to introduce genes, drugs, radiotherapeutic agents, viruses, transcription factors, and ectopic effectors into various cultured cell lines and animals. In addition, several successful clinical trials have been completed to test the effectiveness of liposome-mediated drug delivery.

[0093] The lipid system is formed from phospholipids dispersed in an aqueous medium and spontaneously forming multilayered concentric bilayered vesicles (also known as multilayered vesicles (MLVs)). MLVs typically have a diameter of 25 nm to 4 µm. Ultrasonic treatment of MLVs can form monolayer small vesicles (SUVs), which have a diameter in the range of 200 ANG. to 500 ANG. and contain an aqueous solution in their core.

[0094] Alternatively, rAAV nanocapsule formulations can be used. Nanocapsules typically encapsulate substances in a stable and reproducible manner. To avoid side effects from intracellular polymer overload, these ultrafine particles (approximately 0.1 μm in size) should be designed using polymers that are biodegradable in vivo. Biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements are considered.

[0095] In addition to the delivery methods described above, the following technologies are also considered as alternative methods for delivering rAAV compositions to the host. Ultrasonic permeation enhancement (i.e., ultrasound) has been used, and devices for enhancing the rate and efficacy of drug penetration into the body beyond the circulatory system are described in U.S. Patent No. 5,656,016. Other drug delivery alternatives considered include intraosseous injection (U.S. Patent No. 5,779,708), microchip devices (U.S. Patent No. 5,797,898), ocular formulations (Bourlais et al., 1998), transdermal matrix delivery (U.S. Patent Nos. 5,770,219 and 5,783,208), and feedback-controlled delivery (U.S. Patent No. 5,697,899).

[0096] Example Example 1 As a safe and reliable gene delivery medium, recombinant adeno-associated virus (rAAV) has recently attracted considerable attention in the field of human gene therapy. AAV2 is currently most commonly used in preclinical and clinical studies. However, Luxturna, an AAV2-based drug, is the only FDA-approved virus-based biotherapeutic agent, making the improvement of the pharmaceutical properties of AAV crucial.

[0097] AAV2 is known to be a "poor producer" of the vector and "performs poorly" in many tissue and cell types. The goal is to isolate a viral variant with modified properties.

[0098] A variant named AAVv66 was identified as the most abundant proviral shell variant in clinical pancreatic lesion samples. The AAVv66 shell contains 13 residues different from AAV2 (mutations relative to AAV2 include: K39Q, V151A, R447K, T450A, Q457M, S492A, E499D, F533Y, G546D, E548G, R585S, R588T, and A593T). This variant exhibits beneficial tropism in the CNS after intracranial (e.g., subcranial) injection. Furthermore, AAVv66 showed superior packaging efficiency compared to the original AAV2. Differential scanning fluorescence (DSF) analysis revealed that the melting temperature of AAVv66 was approximately 6°C higher than that of AAV2 across a pH range of 4–7. Additionally, DSF analysis showed that at pH 4, AAVv66 cleared its vector DNA at a higher temperature than AAV2.

[0099] It was also observed that AAVv66, compared to AAV2, conferred superior CNS transduction. Low-temperature EM structures at 2.9 Å resolution revealed structural differences between AAV2 and AAVv66 at the triple protrusion and the interface of the five-fold symmetry axis, indicating that residues at these locations improve the stability and function of the transduction vector.

[0100] Example 2 As an effective and proven gene therapy vector, AAV has recently attracted attention. Current types of AAV vectors confer stable long-term gene expression, exhibit broad tissue specificity, and demonstrate relatively low pathogenicity. To date, three serotypes of AAV shells (AAV1, AAV2, and AAV9) have received regulatory approval for commercial use in patients. Unfortunately, the current library of discovered and modified AAV shells is insufficient for certain clinical applications requiring targeting of specific tissues or cell types. Furthermore, patients may have pre-existing immunity to the vector via neutralizing antibodies, which limits therapeutic efficacy. Additionally, some shells are known to have problems with standard production protocols, failing to generate the high yields required for therapeutic doses. In response to these shortcomings, there is a need to identify and develop novel shells that exhibit better vector yield, evade innate immunity, and possess unique specificity characteristics.

[0101] This example illustrates the protein shell protein variant AAVv66 (SEQ ID NO: 1), identified by high-throughput single-molecule real-time (SMRT) sequencing, and whose properties are substantially different from those of AAV2 (despite high (98%) sequence similarity). First, AAVv66 exhibits better vector yield and greater thermostability compared to the prototype AAV2. Second, AAVv66 shows better distribution in brain tissue upon intracranial injection. Finally, AAVv66 differs from AAV2 in antigenicity.

[0102] To better understand the differences between AAVv66 and AAV2, cryo-electron microscopy (cryo-EM) was performed to explore and define the structure and functional properties of AAVv66. The 2.5-Å resolution structure of the AAVv66 protein shell revealed structural differences from AAV2 and provided insights into the functional properties of the protein shell. In summary, these observations elucidate the mechanistic nature of AAVv66.

[0103] Materials and Methods DNA extraction [] Pancreatic lesion samples were obtained from a 71-year-old female patient after tumor resection, and histopathological analysis was performed using frozen section examination and intraoperative frozen section diagnosis. Samples were stored in liquid nitrogen until DNA extraction. To avoid AAV DNA cross-contamination, DNA extraction and PCR procedures were performed in a UV-irradiated sterile biosafety cabinet. All surfaces and equipment were sprayed with DNA-Exitus Plus (Applichem, catalog number: A7089) and wiped clean with milli-Q water after 15 minutes. Frozen tissue was then thawed at room temperature, rapidly cut to approximately 25 mg of tissue using a disposable scalpel, and placed in 2 mL tubes. DNA was extracted from the tissue using the QIAamp DNA Mini kit (Qiagen, catalog number 51306) according to the manufacturer's recommended procedure.

[0104] SMRT ordering An amplicon library was generated from the genomic DNA using a standard PCR procedure. To amplify the AAV genomic DNA, PCR was performed using a Platinum™ PCR SuperMix High Fidelity (Invitrogen) under the following cycling conditions: 97°C for 1 min, 46 cycles of 98°C / 10 s, 60°C for 15 s, and 68°C for 2 min 30 s; followed by 68°C for 10 min. Correctly sized PCR products were purified using a PureLink™ PCR purification kit (Thermo Fisher) gels and used for a second round of 15 cycles of PCR for barcoding. The primer pairs used are as follows: First-round inoculants: CapF 5'-GACTGCATCTTTGAACAATAAATGA-3' (SEQ ID NO: 3) and CapR 5'-GAAACGAATTAACCGGTTTATTGATTAA-3' (SEQ ID NO: 4) Second-round induction: EF 5'-CATCACTACGCTAGATGACTGCATCTTTGAACAATAAATGA-3' (SEQ ID NO: 5) and ER 5'-TAGTATATCGAGACTCGAAACGAATTAACCGGTTTATTGATTAA-3' (SEQ ID NO: 6) Standard SMRT sequencing library generation was performed on the amplicon representing the protein shell variant ORF. Sequencing was performed on the RSII platform. SMRT sequencing using the BWA-MEM algorithm returned 17,727 DNA reads mapped to the AAV2 Cap ORF. To exclude artificial sequences, reads were then screened to exclude those shorter than 1,800 nt and longer than 2,500 nt, and then screened for read quality (Phred score >30). This screening reduced the number of reads to 14,500. Finally, reads were processed via InDelFixer to remove single nucleotide insertions and deletions that could originate from error-prone PCR or sequencing errors. To consider only unique protein shell sequences and exclude low-confidence variants, the screened reads were reassembled (Geneious R9) to cluster reads with 99% sequence similarity. Only read clusters represented by at least 10 reads were considered unique DNA protein shell sequences. The DNA sequence is then translated into an amino acid sequence to define the final list of unique AAV protein shells.

[0105] Complete AAV Cap ORFs from the current AAV serotype (hu.2 for AAV2 / 3) were obtained from NCBI, and the predicted amino acid sequences were compared using the MUSCLE algorithm, iterating until convergence was achieved. Then, a phylogenetic tree was generated using PhyML with preset parameters from SeaView55, and then observed via the interactive tree view in the Life online tool.

[0106] Viral vector production Viruses were generated in HEK293 cells using a triple transfection method and purified by CsCl gradient centrifugation. All described vectors were packaged using a self-complementary AAV vector expressing enhanced green fluorescent protein (scAAV-CB6-EGFP), a single-stranded vector expressing firefly luciferase (ssAAV-CB6-Fluc), a single-stranded vector expressing secretory human α1-antitrypsin (ssAAV-CB6-hA1AT), or a single-stranded vector expressing LacZ. All transgenes were driven by the CMV early enhancer / chicken β-actin (CB6) universal promoter.

[0107] animal The test vector was administered intravenously (IV), intramuscularly (IM), or intracranially to 6- to 8-week-old male C57BL / 6J mice (Jackson Laboratory). Mice receiving intravenous injection were given the ssAAV-CB6-Fluc transgenic packaged vector (1.0E11 vg / mouse) and sacrificed on day 14 post-injection. Mice receiving intramuscular injection (TA) were given the ssAAV-CB6-Fluc transgenic packaged vector (4.0E10 vg / mouse) and sacrificed on day 28 post-injection. D-luciferase receptors were administered weekly via intraperitoneal injection until sacrifice, and animals were sedated with isoflurane. Luteinase activity was quantified using the IVIS Spectrum CT imaging platform under 1-min exposure. Images were acquired using Living Image software. Mice undergoing intrahippocampal injection were administered a vector packaged with scAAV-CB6-Egfp (3.6E9 vg / mouse). Unilateral injections were performed in the right hemisphere using a stereotactic frame (Stoelting Co. Wood Dale, IL), a Hamilton Syringe (1207K95, Thomas Scientific), and a Hamilton Needle (77602-06, Hamilton). All intrahippocampal injections were performed using the following relative coordinates: x: -1.5 mm, y: -2 mm, z: -2 mm.

[0108] Immunostaining Four weeks post-injection, animals were perfused with 1X phosphate-buffered saline (PBS) followed by perfusion with 4% paraformaldehyde (PFA). Brains were extracted and subsequently fixed overnight in 4% PFA at 4°C. The brains were then immersed in 30% sucrose (prepared in 1X PBS) at 4°C until equilibrated with the sucrose mixture. The brains were embedded in a 1:2 OCT (Tissue Tek, Torrance, CA) and 30% sucrose mixture and sectioned at 40 µm (Cryostar NX70, ThermoScientific, Waltham, MA). Sections were infiltrated in 0.5% Triton X-100 for 1 hour, blocked in 5% goat serum (10% normal goat serum, 50062Z, Life Technologies) for 1 hour, and then incubated overnight at 4°C in primary antibodies (anti-NeuN, 1:1000, EMD Millipore MAB377; anti-Gfap, 1:500, EMD Millipore MAB360; anti-Olig2, 1:200, Abcam ab109186; anti-Iba1, 1:1000, Wako Chemicals NC9288364). Sections were washed three times in 1X PBS and incubated at room temperature in secondary antibodies (anti-mouse, Invitrogen A32744; or anti-rabbit, Invitrogen A32740) for 1 hour. Sections were washed three times in 1X PBS and loaded with Vectashield (Vector Laboratories, Burlingame, CA) containing DAPI.

[0109] Microscopy Brain slice images were acquired on a Leica SP8 Lightning High Resolution Confocal (Leica Microsystems, Wetzlar, Germany). For each individual magnification, whole-body brain images (10X tiled brain slices) and high-magnification images (63X region-specific regions) were collected at the same intensity and exposure threshold. For high-magnification images, 40–50 z-stack steps were collected at a size of 0.29 z-size. Analysis was performed using Imaris 9.3 software (Bitplane Inc., Zurich, Switzerland). 3D rendering was performed on each image, and thresholds were manually established. To ensure consistency, unbiased 3D rendering of the total subanatomical EGFP volume co-localized with DAPI volume and cell type-specific staining agent was used to represent cell counts and the number of positively transduced cells. The percentage of different cell types within each ipsilateral subanatomical region was quantified, followed by the percentage of each cell type. The transduction percentage was determined by normalizing the co-localized EGFP volume to the total volume of cell type-specific staining within each region. Based on cell-specific staining, n = 3 mice were analyzed. Statistical calculations as shown in Figure 2B were performed in Prism 7 (GraphPad Software, Inc., San Diego, CA), and the analysis was conducted using Stuttgart's unpaired t-test.

[0110] DSF Analysis In the protein shell stability assay, 5 µL of SYPRO Orange 5000X (Thermo Fisher Scientific) was diluted in 495 µL of PBS (Corning) to prepare a 50X stock solution. 45 µL of virus was mixed with 5 µL of 50X SYPRO Orange (final SYPRO Orange concentration: 5X). Fluorescence was quantified using a ViiA 7 real-time PCR instrument (Thermo Fisher Scientific) with the following parameters: the sample was incubated at 25°C for 2 min, followed by a temperature gradient (25°C to 99°C, 0.4°C per step, held for 2 min at each step). A ROX filter without a passive reference was used to monitor the fluorescence of SYPRO Orange at each temperature step. To investigate the effect of pH on the melting temperature of the AAV vector, 5 µL of viral vector, 5 µL of 50X SYPRO Orange, and 40 µL of 0.6M acetate buffer (pH adjusted from pH 7 to pH 4) were mixed. The Tm value reported in this study was defined as the maximum Dsignal / Dtemp detected between 25°C and 95°C. To investigate vector gene release, the SYBRO Orange dye was replaced with SYBR Gold (Thermo Fisher Scientific).

[0111] Targeted mutagenesis To generate point mutations in the AAVv66 protein shell ORF, the Q5 site-directed mutagenesis kit (New England Biolabs) and the following mutagenesis primer pairs were used: Table 1: [AAVv66] [Mutation in the Middle] [F.] [Introduction] [(] [lowercase letters] [=] [Mutated base] [) (SEQ ID NO: 7-19)] [R.] [Introduction (SEQ ID NO: 20-32)] Q39K AGAGCGGCATaagGACGACAGCA GCGGGCTTTGGTGGTGGT A151V GCATTCTCCTgtgGAGCCAGACT TCTACCGGCCTCTTTTTTCC K447R TTACTTGAGCagaACAAACGCTC TACAGATACTGGTCGATC A450T CAAAACAAACactCCAAGCGGAAC CTCAAGTAATACAGATACTGG M457Q AACCACCACGcagTCCAGGCTTC CCGCTTGGAGCGTTTGTT A492S ATCAAAAACAtctGCGGATAACAACAACAGTG ACTCGCTGCTGGCGGTAA D499E CAACAACAGTgaaTATTCGTGGAC TTATCCGCAGCTGTTTTTG Y533F TGAAGAAAAAtttTTTCCTCAGAGCGGGGTTC TCGTCCTTGTGGCTGGCC D546G TGGAAAACAAggcTCGGGAAAAA AAGATGAGAACCCCGCTC G548E ACAAGACTCGgagAAAACTAATGTG TTTCCAAAGATGAGAACC S585R CAACCTCCAGagaGGCAACACAC GTAGATACAGAACCATACTGCTC T588R GAGCGGCAACagaCAGGCAGCCA TGGAGGTTGGTAGATACAGAACCATACTG T593A GGCAGCCACCgcaGATGTCAACA TGTGTGTTGCCGCTCTGG

[0112] Low temperature EM AAVv66 was prepared on a grid (01824G, Ted Pella, Inc.) with a lace carbon support membrane for cryogenic EM. First, the grid was washed with acetyl acetate and dried overnight. Next, the grid was glow-discharged for 60 seconds using a negatively polarized 20 mA current in a PELCO easiGlow glow discharge unit. 3 µL of 1E13 vg / mL AAVv66-CB6-Egfp carrier in buffer (5% sorbitol and 0.001% pluronic acid F68 in PBS) was placed on the grid loaded into a Vitrobot Mark IV (ThermoFisher) cryogenic EM down-printing device. The grid was imprinted using Whatman No. 1 filter paper at 10°C and 95% relative humidity for 6 to 6.5 seconds, and then rapidly frozen in liquid ethane.

[0113] A dataset of 2,033 images was collected using SerialEM on a Titan Krios electron microscope (FEI) with a weak focal length of 0.5–2.2 µm, operated at 300 kV, and equipped with a Gatan Image Filter (GIF) and a K2 Summit direct electron detector (Gatan Inc.). Fifty frames were collected per image, and 34 frames were used at 1.43 e⁻ / Ų / frame to achieve a total dose of 48.62 e⁻ / Ų on the sample. The pixel size on the sample was 1.0588 Å. The images were imported into cisTEM and compared with dose screening, and CTF parameters were determined. A total of 52,874 particles were then automatically selected into cisTEM (characteristic and maximum radii: 130 Å and 140 Å, respectively). Note that particles encapsulated with vector transgenes and a small percentage of empty protein shells were used to determine the final structure. Within cisTEM, the Ab initio 3D reconstruction function is used to generate an initial reference for alignment from all particles. This reference and all particles are then refined using automatic refinement iterations to obtain a 2.95-Å resolution map, as determined from the FSC_part cutoff of 0.143. A per-particle CTF refinement in manual mode improves the map resolution to 2.62 Å. Finally, a beam tilt refinement and reconstruction improves the map resolution to 2.46 Å. 3D classification does not improve the map. The final map is B-factor sharpened using the PHENIX automatic sharpening function with a B-factor of -32.92 Ų.

[0114] The low-temperature EM structure of AAV2 (PDB ID: 1LP3) was used as the starting model for structural refinement. Variant residues were modeled using PyMOL (The PyMOL Molecular Graphics System, version 2.0, Schrödinger, LLC.). The AAVv66 model containing 60 VP3 copies was refined using PHENIX59 based on the low-temperature EM diagram. Real-space simulated annealing and B-factor refinement in PHENIX produced the stereochemically optimal model. The refinement results are summarized in Table 2. The model was checked and plotted using PyMOL.

[0115] The carrier was diluted to a concentration of approximately 1.0E9 vg / mL for zeta potential analysis using the Zetasizer Nano ZS system (Malvern). 500 µL of sample was added to a universal immersion unit (Malvern). The system was allowed to stabilize for 2 min before measurement. Three measurements were recorded for each sample. Table 2 [Low temperature] [EM] [Statistics on Data Collection, Refinement, and Validation] #1 Name (EMDB-20630) (PDB 6U3Q) [Data Collection and Processing] magnification 47,214 Voltage (kV) 300 Electron exposure (e- / A2) 48.62 Defocus range (μm) 0.4-5.0 Pixel size (A) 1.059 Apply symmetry I Initial grain image (quantity) 52,874 Final grain image (quantity) 52,874 Graph resolution (A) 2.46 FSC threshold 0.143 [Refurbished] Initial model used (PDB code) 1LP3 Model resolution (A) Z6 FSC threshold 0.5 Graph sharpening B factor (A2) 32.92 Model Composition non-hydrogen atoms 248,280 protein residues 31,140 ligands 0 Factor B (A2) protein 86.48 ligands 0 rms deviation Bond length (Å) 0.009 Bond angle (°) 0.603 verify MolProbity score 1.66 Clashscore 2.25 Poor rotational isomers (%) 4.15 Ramachandran drawing Beneficial (%) 96.91 allow(%) 4.15 Not allowed (%) 0.00

[0116] Immunological research scAAV-CB6-Egfp from 1.0E11 vg / mouse was administered intramuscularly to the left / right tibialis anterior muscle of C57BL / 6J mice. Four weeks later, ssAAVv66-CB6-hA1AT or ssAAV2-CB6-hA1AT from 1.0E11 vg / mouse was delivered to the contralateral leg. Serum was collected via facial vein sampling at weeks 4, 5, 6, 7, and 8 to evaluate neutralizing antibody titers and A1AT levels using ELISA.

[0117] Twenty-four hours prior to transduction, Huh-7.5 cells (5.0E4 cells / well) were seeded in 96-well plates at 37°C. Ad helper virus was then added to the cell monolayer at a 100:1 multiple of infection (MOI) and incubated for at least one hour. Serial dilutions of serum and ssAAV2-LacZ or ssAAVv66-LacZ mixtures were prepared in V-bottom 96-well plates and incubated at 37°C for 1 hour. The serum-AAV mixture was then added to the cells and incubated at 37°C for 24 hours. Cells were lysed and processed using a β-galactosidase receptor agonist, a Galacto-Star one-step analysis system (Invitrogen). The luminescence signal was detected using a Synergy HT microplate reader (BioTek, Winooski, VT).

[0118] A1AT ELISA First, coat 96-well plates with anti-A1AT antibody overnight at 4°C, and incubate the wells with blocking buffer (1% non-lipid emulsion and 0.05% Tween-20 in PBS buffer) for 1 hour at room temperature. Serum dilutions of 1 / 20, 1 / 200, and 1 / 2,000 were performed in the 96-well plates using sample buffer (0.05% Tween-20 in PBS buffer) and positive controls (100, 50, 25, 12.5, 6.25, and 3.125 ng / mL A1AT). After washing the plates three times, serum was added to each well and the plates were incubated overnight at 4°C. The plates were then washed three times and incubated for 2 hours with goat anti-trypsin-HRP antibody (1:5,500 dilution in sample buffer). The plates were washed six times to remove all residual protein before reacting with the substrate. Finally, ABTS was added to the well and the signal was read using a Synergy HT microplate reader (BioTek).

[0119] Identification of novel AAV variants in human tissue samples by long-read sequencing To identify novel full-length protein shell sequences from human tissues, SMRT sequencing was performed to obtain long DNA reads spanning the entire open reading frame (ORF) of the protein shell (Figure 1A). This method resolves long DNA fragment sequences without the sequence assembly required in short-read sequencing. This approach allows for the evaluation of protein shell diversity defined by point mutations and recombination events for individual intact molecules spanning the entire protein shell ORF. To explore AAV diversity, single tissues were selected from approximately 800 human surgical specimens. Primers with conserved sequences side-attached to the protein shell ORF in known serotypes were used to generate targeted PCR amplicon for SMRT sequencing analysis. A single protein shell sequence comprising approximately 45% of all sequences identified from the single tissue was isolated (Figure 1B). This major protein shell, named "Variant 66" (AAVv66), showed the closest homology to AAV2 (98% sequence similarity; Figures 1C-1D). Observations show that AAVv66 contains 13 amino acid residues different from AAV2 (Figures 1C and 8): one located in the VP1u region (K39Q), one located in the VP2 domain (V151A), and 11 located in VP3 (R447K, T450A, Q457M, S492A, E499D, F533Y, G546D, E548G, R585S, R588T, and A593T). Notably, the unique amino acid residues in VP3 are all located in or near the variable regions VR-IV to VR-VIII.

[0120] The VP3 region of AAVv66 was compared with its counterparts in other current AAV serotypes (AAV1-AAV9). The most significant differences were found at four positions (499, 533, 585, and 588), which are highly conserved across AAV serotypes (Figure 8). At position 499, most serotypes contain aspartic acid, while AAVv66, AAV2, AAV4, and AAV9 contain negatively charged aspartic acid or glutamic acid. The highly conserved phenylalanine at position 533 is replaced by tyrosine in AAVv66 (and also T533 in AAV5). Finally, unlike AAV2 (which contains positively charged arginine residues at positions 585 and 58823 that define AAV2’s ability to bind heparan sulfate proteoglycan (HSPG), AAVv66 contains S585 and T588 (the same as AAV1, AAV3, AAV5 and AAV6).

[0121] The production and infectivity of the AAVv66 vector differ from those of AAV2. AAV2's strong affinity for heparin and the resulting strong cell surface association are expected to lead to relatively poor viral packaging titer. It is believed that the limited vector production of AAV2 originates from nonproductive binding of vector particles to packaging cells and reinfection during production. Vector production and cellular infectivity of AAVv66 were compared with those of AAV2 and AAV3b. It should be noted that AAV3b is the closest unique cousin of AAV2 (89% sequence similarity), but uses a different electrostatic surface charge at the triple protrusion to weakly bind heparin. This difference between AAV3b and AAV2 may explain the increased packaging titer of AAV3b in HEK-producing cell transduction.

[0122] The packaging characteristics of AAVv66 were compared with those of AAV2 and AAV3b by measuring the yield of capsidated vector genotypes in cell lysates. To this end, an AAVv66 protein coat ORF was synthesized and selected for colonization into trans plasmids expressing AAV2 Rep under the AAV2 p5 promoter (pAAV2 / v66). Small-scale vector formulations of AAVv66, AAV2, and AAV3b were used to package single-stranded vectors consisting of firefly luciferase transgenes driven by a universal chicken β-actin promoter (AAV-CB6-Fluc). Quantification of viral vector yield by crude lysate qPCR29 revealed that the yield of capsidated DNase resistance genotypes in the AAVv66 vector was approximately 2.4 times that of AAV2 and approximately 30% higher than that of AAV3b (Figure 9, "combined" sample).

[0123] Next, we investigated whether the higher abundance of AAVv66 in the crude lysate was due to nonproductive binding of the particles to the packaging cells, which was manifested as AAVv66 particles being dominant in the culture medium rather than in the cell lysate. PCR analysis revealed that the abundance of capsidated AAVv66 genera in the culture medium was approximately three times that in the cell lysate (Figure 9). In contrast, very few AAV2 particles were detected in the culture medium of the packaging cells. To test whether the ability of AAVv66 to produce genera with greater DNase resistance was related to the weak reinfectivity of the packaging cells due to poor HSPG binding, a heparin competition analysis was performed (Figure 10). For this purpose, large-scale AAVv66 and AAV2 vectors packaged in the same CB6-Fluc were produced using a standard cesium chloride purification protocol. AAVv66 transduction was unaffected by the presence of heparin, while 1.25 µg / well of heparin blocked AAV2 transduction by 50% and 5 µg / well of heparin completely eliminated transduction. These results indicate that the improved production efficiency of AAVv66 is at least partly due to poorer heparin binding.

[0124] To determine whether the lower affinity of AAVv66 for heparin compared to AAV2 is related to smaller cell transduction, HEK293 cells were infected using purified AAVv66, AAV2, and AAV3b vectors. Data indicated that AAV2 exhibited greater transduction than AAVv66 (approximately 65-fold) and AAV3b (approximately 7.5-fold) (Figure 11). The vectorized AAVv66 proviral capsid sequence was effectively transduced in vivo, but its vector production and cellular infectivity differed from its closest serotype relative, AAV2.

[0125] AAVv66 exhibits CNS transduction characteristics different from AAV2. The transduction capacity of AAVv66 to selected target tissues was tested via different delivery routes. To this end, the biodistribution of AAVv66 in mice was evaluated via multiple delivery routes (Figs. 12A-13D). Of all the routes tested, transcranial delivery to target cells in the central nervous system (CNS) demonstrated the most significant transduction characteristics of AAVv66 (Figs. 2A-2D). To determine whether AAVv66 exhibited an increased tropism relative to AAV2 in the CNS, the Egfp transgene, driven by the ubiquitous chicken β-actin promoter, was packaged into the protein shells of both AAVv66 and AAV2. The vector was unilaterally injected into the right hemisphere of the hippocampus at a dose of 3.6E9 vg / animal. Four weeks post-injection, cryogenic sections of the treated brain showed approximately 13-fold increase in AAVv66-transduced CNS cell line AAV2, as confirmed by enhanced diffusion throughout the tissue, while AAV2 tended to remain localized to the injection site (Figs. 2A-2B). High-magnification imaging of the contralateral region of the injection site showed detectable levels of EGFP expression in all subanatomical regions of the brain (hippocampal horn [CA1, CA2, CA3, and CA4], dentate gyrus, and corpus callosum, Fig. 2C) (Fig. 2D), indicating that AAVv66 could effectively diffuse throughout the entire hippocampal hemisphere.

[0126] To investigate specific cell types transduced by AAVv66, antibody staining was performed using cell type-specific markers: anti-NEUN (neurons), anti-GFAP (astrocytes), anti-IBA1 (microglia), and anti-OLIG2 (oligodendrocytes) (Figs. 3A, 3E, 3I, and 3M). 3D volume reconstruction of the subanatomical CNS regions confirmed that EGFP expression colocalized with each investigated cell type (Figs. 3B, 3J, 3F, and 3N). Neurons were the predominant cell type found in the cortex and CA1 region (Fig. 3C). Interestingly, the CA2-4 region and dentate gyrus showed the highest transduction (approximately 20-40%). Astrocytes and microglia shared a similar distribution pattern, showing the highest enrichment in the dentate gyrus (Figs. 3G and 3K). Astrocytes showed approximately 1-7% transduction in all regions (Fig. 3H), while microglia showed a slightly higher transduction efficiency (2-12%) (Fig. 3L). Oligodendrocytes were enriched in the corpus callosum (Fig. 3O) and transduced by AAVv66 in approximately 1–7% of all regions (Fig. 3P). These data indicate that AAVv66 can transduce all major cell types in the CNS after intrahippocampal injection.

[0127] AAVv66 is serologically different from AAV2. AAV neutralization by the host immune system is a major limiting factor in the transduction efficiency of AAV vectors. Individuals whose AAV serotypes containing pre-existing antibodies, used as therapeutic vectors, are at greater risk of adverse effects and ineffective treatment. Furthermore, patients requiring repeated AAV gene therapy face the risk of poorer transduction efficiency and stronger immune responses, thus necessitating alternative vectors.

[0128] This study investigated whether AAVv66 transduction could be blocked by AAV2 pre-immunization. To generate pre-existing anti-AAV2 antibodies in circulation, the AAV2-Egfp vector (1E11 vg / mouse) was intramuscularly delivered to mice. Serum was collected after 4 weeks to evaluate the in vitro neutralizing antibody (NAb) titer (Figs. 13A-13D and 14A-14B). Only low NAb titers were required to achieve 50% neutralization of AAV2 infection in Huh-7.5 cells (NAb50) (1 / 1,280–1 / 2,560), indicating that antibodies generated from AAV2 pre-immunization were sufficient to inhibit AAV2 transduction. In contrast, the NAb50 for AAVv66 infection in serum from AAV2-treated mice was 1 / 20–1 / 40, indicating that AAVv66 could infect cells even in the presence of NAbs generated against AAV2.

[0129] To test these findings in vivo using the secretory therapeutic transgene, AAV2-immunized mice were re-administered with AAV2 or AAVv66 transgene-packaged with α-1 antitrypsin (AAV2-A1AT or AAVv66-A1AT). Serum was collected at weeks 5, 6, 7, and 8, and secretory A1AT levels were quantified by ELISA31 (Figure 14C). Low A1AT performance indicated that NAb generated from the first dose of the transgene prevented transduction of the second dose. To establish a baseline for “maximum” A1AT performance, the naïve mice were treated in the same manner. At weeks 6 and 7, A1AT performance in mice treated with AAV2-Egfp and then AAVv66-A1AT reached approximately 90% of the initial A1AT performance, while mice re-administered with AAV2-A1AT only reached approximately 40% of the initial level (Figure 14C). These results are consistent with the observation in vitro that AAVv66 is stably infectious in the presence of serum from mice pre-immunized with the AAV2 protein shell.

[0130] Pre-immunization was also tested to investigate whether a wide range of AAV serotypes (AAV1, AAV2, AAV3b, AAV8, AAV9, AAV-DJ, AAVrh.8, and AAVrh.10) could impair AAVv66 vector transduction. Antisera from rabbits pre-immunized individually with each of the eight serotypes were screened for AAVv66 vector neutralization. It was observed that AAV1, AAV3b, and AAV-DJ showed approximately one order of magnitude difference in NAb50 titer compared to AAVv66, while AAV2, AAV8, AAVrh.8, and AAVrh.10 showed two orders of magnitude difference, and AAV9 showed three orders of magnitude difference (Figure 14D). In summary, these data indicate that AAVv66 is serologically distinct from AAV2 and some other currently known AAV protein shells.

[0131] The AAVv66 protein shell exhibits greater thermal stability than AAV2 at multiple pH levels. Efficient protein shell formation and structural stability are crucial for the production, purification, and storage of viral vectors. Furthermore, for productive infection to occur, the vector particle must also remain stable throughout its entry and uncoat only when the delivered gene body is transducible into cells. Although AAV vectors have been extensively studied and used in various tissues due to their strong transduction characteristics, the processes of intracellular delivery, endosome escape, and protein shell transport within the cell nucleus are not fully understood. Endosome escape is best understood within the hypothetical intracellular checkpoints influencing AAV intracellular delivery and transduction, which are dependent on protein shell dynamics. This process is believed to be triggered by pH-dependent structural changes in the protein shell. Acidification of the endosome lumen causes conformational changes in the VP1 domain and exposes the PLA2 domain within VP1, triggering escape from the endosome chamber. In principle, a vector protein shell that remains stable throughout intracellular delivery is desirable and exhibits high transduction capacity.

[0132] To determine the overall stability of the AAVv66 protein shell, differential scanning fluorometry (DSF) analysis was used to measure the thermal stability of the AAVv66 protein shell at multiple physiological pH levels (pH 7–pH 4) (Figure 4). This range included pH 4.5, and observations were made in the lumens of late endosomes and lysosomes. In this analysis, carrier particles were suspended in SYPRO Orange dye, which fluoresces upon binding to hydrophobic residues in the protein. Therefore, the fluorescence peaks were read out between the maximally bound hydrophobic regions exposed after the protein unfolds. At all pH conditions tested, the melting temperature (maximum slope value [Dsignal / Dtemp], Tm) of AAVv66 was more than 5 degrees higher than that of AAV2. The greatest difference was observed at pH 7, where the Tm of AAVv66 (75.29 ± 0.34 °C) was nearly 10 degrees higher than that of AAV2 (65.85 ± 0.18 °C) (Figure 4A). Therefore, the thermal stability and pH resistance of the AAVv66 protein shell are greater than those of AAV2.

[0133] The effect of AAVv66 protein shell stability on vector gene release was investigated. Vector gene release varying with temperature range was used to replace DNA compression driven by pressure exerted by the nucleolar environment. The temperature dependence of AAVv66 and AAV2 gene release was compared at different pH levels. For this purpose, DSF analysis using SYBR Gold dye, which fluoresces upon binding to DNA, was employed. Peak fluorescence is an indirect measure of the maximum accessibility of capsiddized genes to the dye solution. Vector gene release at pH 7 was observed to be accompanied by protein shell stability, as evidenced by the signal peaks of AAV2 at approximately 65°C and AAVv66 at approximately 74°C. However, at lower pH levels, the detection temperature of the peak fluorescence of dye-accessible DNA was lower than that of the unfolded protein shell protein (Figure 4B). Furthermore, the DNA accessibility of AAVv66 is more pronounced than that of AAV2 – AAV2 shows peak DNA accessibility at pH 5 and 4 at approximately 53°C and 42°C, respectively; while AAVv66 exhibits a peak signal at 25°C. This surprising observation demonstrates that DNA is particularly accessible in the AAVv66 protein shell at low pH (4-5), even at room temperature.

[0134] The question of whether AAVv66-specific amino acid residues contribute to the structural and functional differences observed between AAVv66 and AAV2 was then investigated. Thirteen amino acid residues defining AAVv66 were mutated to their AAV2 counterparts, and their effects on vector gene body packaging during HEK293 cell production were tested (Fig. 4C). Furthermore, the thermal stability of the mutant protein shell and vector gene body release were evaluated (Figs. 4D and 4E). Except for four mutations (A151V, K447R, Y533F, and S585R), all mutations reduced DNase resistance gene body yield, similar to or lower than their AAV2 counterparts (Fig. 4C). Clearly, the relatively conserved mutation D499E (which does not involve charge changes) reduced packaging yield to approximately 5% of the AAV2 yield. This modification also affects protein shell stability, as the D499E and S585R and S585R / T588R double mutations reduce Tm by 5.9℃, 3.8℃, and 5.4℃, respectively (Figure 4D), while other mutations only affect Tm by 1-2℃. Vector gene accessibility with the same amino acid mutation shows a decreased peak signal temperature, while other mutations produce smaller changes or no changes (Figure 4E). Notably, it does not significantly affect the overall titer of the purified vector (Table 3). Therefore, the packaging yield of AAVv66 depends only partially on protein shell stability, indicating that partial protein shell destabilization is sufficient to promote gene release. Only residue D499 significantly affects packaging and protein shell stability. Table 3

[0135] Low-temperature EM structural analysis of protein shell differences between AAVv66 and AAV2 To characterize the structural properties of AAVv66, the AAV2v66-Egfp vector was purified for cryogenic EM analysis. Images of 52,874 particles were obtained at 2.5 Å resolution, generating cryogenic EM images (Fig. 5E and Fig. 16), and structural models with the best real-space fit and stereochemical parameters were obtained (Table 2). In summary, the AAVv66 structure is similar to AAV2 (root mean square deviation of atomic coordinates (RMSD) = 0.456 Å) (Fig. 16). Therefore, AAVv66 exhibits the specific characteristics of the AAV protein shell, including biaxial indentation, triple symmetry defined by three protrusions, and a five-fold porosity containing five monomers forming interfaces and pores for Rep binding (Fig. 5A). It should be noted that in each particle, the VP1u and VP2 domains each occupy approximately one-twelfth of the VP3 domain, and similar to other previously identified AAV structures, they were not resolved in symmetric cryogenic EM images. Therefore, only residues 219-736 were definitively resolved within the low-temperature EM map, including 11 of the 13 residues that define AAVv66 (Figure 5B).

[0136] Comparing the AAVv66 and AAV2 structures reveals several structural differences that could help improve DNA packaging and / or protein shell stability. The main difference occurs at the interface between VP3 monomers protruding around the triple axis. The D499 mutation to longer glutamate residues produces a significant defect in vector gene body packaging (Fig. 4C) and forms electrostatic interactions and / or hydrogen bonds with S501 (Fig. 5D). This region is tightly packed against adjacent VP3 monomers (Fig. 5D). Here, the backbone atoms of D499 and S501 interact with the side chains of symmetry-related N449 and T448, respectively, while the hydroxyl group of the S501 hydrogen bond interacts with the carbonyl group of the backbone of symmetry-related S446. The strong effect of the D499 mutation may thus be due to the disruption of the interface between VP3 monomers, thereby destabilizing the protein shell. In the same region, the residues K447 and A450 of adjacent monomers eliminate the possibility of electrostatic interactions between the corresponding AAV2-R447 and T450 side chains (Fig. 6D). Amino acid M457 is located on a triple overhang at the variable region IV of AAVv66, with the side chain oriented towards the solvent (Fig. 6E). Interestingly, this methionine is a unique feature in other serotypes (Fig. 8), suggesting a potentially unique interaction between the protein shell and cell receptors, host factors, or antibodies. The polar hydroxyl group in AAVv66-Y533 (AAV2-F533) may stabilize the polar environment between the side chains of R487 and K532 and may facilitate the interaction of the symmetry-associated monomer L583 (Fig. 6A). AAVv66-D546 and G548 can redistribute the surface charge conferred by AAV2-G546 and E548 (Fig. 6B) and are another typical feature of AAVv66.

[0137] The key functional regions of AAV2 involve positively charged arginine residues at positions 585 and 588. These residues, located on the surface of a triple-protrusion, control the interaction between the protein shell and the HSPG receptor, which is crucial for attachment and entry in many cell types. In contrast, similar to S586 and T589 in AAV3b (Figure 8), S585 and T588 in the AAVv66 protein shell are electrically neutral polar residues (Figures 5D and 6). The physical and functional interactions between AAV3b and HSPG depend on electrostatic interactions conferred by residues R447 and R594 (R447 and A593 in AAV2), but AAVv66 also lacks these arginine residues (K447 and T593). These differences relative to AAV2 and AAV3b indicate that AAVv66 associates with the canonical cell surface receptors that are typically utilized by the protein shells of AAV clades B and C in a different manner, consistent with the finding that AAVv66 does not bind to heparin.

[0138] AAV2 and AAVv66 demonstrate surface charge differences. Since the electrostatic properties of viruses are crucial for protein coat-receptor interactions, this study investigated the effect of the net loss of positive charge in the AAVv66 protein coat relative to AAV2 on the electrostatic properties of the protein coat. First, the calculated electrostatic potential values ​​of the AAV2 and AAVv66 structures were compared (Figure 7A). The electrostatic potential distribution on the surface of AAVv66 differs from that of AAV2. The most significant difference is located at the triple protrusions, where the positive charge imparted by R585 and R588 in AAV2 is significantly reduced by S585 and T588 in AAVv66 (Figure 7B).

[0139] The study then investigated whether different structures and surface electrostatics of AAVv66 affected the charge-dependent particle migration (zeta potential) of the protein shell (Figure 7C). The zeta potential of AAVv66 (-10 mV) differed significantly from that of AAV2 (-3.5 mV), consistent with the electrostatic potential differences between protein shells. To test the contribution of individual substitutions, particle migration of AAVv66 containing single amino acid substitutions that converted residues to the corresponding AAV2 residues was measured (Figure 7C). The single mutations S585R and T588R produced the most significant changes in zeta potential (each approximately 3 mV), making the zeta potential closer to that of AAV2 (Figure 7C). These observations indicate that the electrostatic properties of AAVv66 differ from those of AAV2, and this difference is mainly due to substitutions at positions 585 and 588. Therefore, the interactions of the protein shell AAVv66 with receptors, antibodies, and other proteins may be substantially different from those of other closely related protein shells.

[0140] Selected sequence AAVv66 amino acid sequence (SEQ ID NO: 1) MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHQDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPAEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSKTNAPSGTTTMSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTAADNNNSDYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKYFPQSGVLIFGKQDSGKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQSGNTQAATTDVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL Amino acid sequence of wild-type AAV2 capsid protein (SEQ ID NO: 2) MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

Claims

1. Use of a recombinant adeno-associated virus (rAAV) for the preparation of a pharmaceutical product for treating central nervous system (CNS) related conditions, wherein the treatment comprises delivering a transgene to the CNS cells of a subject, comprising administering the rAAV to the subject via intrahippocampal injection, wherein the rAAV comprises: (i) an isolated nucleic acid comprising a transgene encoding one or more products of the gene of interest; and (ii) an adeno-associated virus (AAV) protein capsid protein having the sequence stated in SEQ ID NO:

1.

2. As claimed in claim 1, wherein the CNS cell line is a neuron, oligodendrocyte, astrocyte, or microglia.

3. As requested in claim 1, wherein the subject is a mammal.

4. As requested in item 3, wherein the mammal is a human.

5. As requested in claim 1, wherein the subject is characterized by producing anti-AAV2 antibodies.

6. As requested in claim 5, wherein after administration of the rAAV, the subject does not elicit a neutralizing immune response against the rAAV.

7. As requested in claim 1, wherein the isolated nucleic acid comprises an AAV inverted terminal repeat (ITR) sequence side-attached to the transgene.

8. As requested in claim 1, wherein the nucleic acid sequence encoding the one or more gene products is operatively linked to a promoter.

9. As claimed in claim 1, wherein the one or more gene products comprise proteins or inhibitory nucleic acids.

Images