ALPHA-1 ANTITRYPSIN (AAT) RNAi AGENTS, COMPOSITIONS INCLUDING AAT RNAi AGENTS, AND METHODS OF USE
Patent Information
- Application Number
- TW112146924
- Authority / Receiving Office
- TW · TW
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2017-12-08
- Filing Date
- 2018-01-10
- Publication Date
- 2026-09-01
- Estimated Expiration
- 2038-01-09
Smart Images

Figure TWG2TB001908432_001 
Figure TWG2TB001908432_002 
Figure TWG2TB001908432_003
Abstract
Description
α-1 Antitrypsin (AAT) RNAi Agent, Composition Comprising the AAT RNAi Agent, and Method of Use Disclosed herein are RNA interference (RNAi) agents for inhibiting α-1 antitrypsin gene expression, compositions comprising the AAT RNAi agent, and methods of using the same. Alpha-1 antitrypsin (AAT, α1-antitrypsin or A1AT) deficiency is an inherited autosomal dominant genetic disorder that results in a defect in the production of α1-antitrypsin, leading to lung and liver diseases. The incidence of AAT deficiency is approximately 1 in 1,500 to 3,500 individuals. Alpha-1 antitrypsin deficiency most commonly affects individuals of European ancestry. Alpha-1 antitrypsin is a protease inhibitor belonging to the serine protease inhibitor superfamily. The normal AAT protein is a circulating glycoprotein protease inhibitor that is mainly synthesized by hepatocytes in the liver and secreted into the blood. The known physiological function of AAT is to inhibit neutrophil proteases, which are used to protect host tissues from non-specific damage during inflammation. The most clinically significant form of AAT deficiency (AATD) is a genetic disorder associated with liver disease in children and adults and lung disease in adults, which is caused by the Z mutation. The Z-mutant allele (PiZ) causes abnormal folding of the mutant Z-form AAT protein ("Z-AAT protein") through a single-point mutation, resulting in intracellular retention. Mutant Z-AAT protein monomers can form polymeric chains that aggregate into tangles, sometimes called "globules". The insoluble Z-AAT protein globules are ineffective when passing through the secretory pathway and accumulate in the endoplasmic reticulum (ER) of hepatocytes. The polymeric globule material compresses the ER and causes continuous hepatocyte damage, leading to fibrosis, cirrhosis, and an increased risk of hepatocellular carcinoma. In addition, the lack of circulating anti-protease activity makes the lungs vulnerable to damage by neutrophil elastase, resulting in respiratory complications such as emphysema. Individuals with the homozygous PiZZ genotype have a severe deficiency of functional AAT, which leads to lung disease and hepatocyte damage as well as liver disease. Weekly AAT augmentation therapy, which uses purified human AAT, results in almost normal AAT plasma levels in individuals with AATD and helps prevent lung damage in affected individuals. However, although administration of purified AAT can improve or help prevent lung damage caused by a lack of endogenously secreted AAT, patients with AATD are still prone to endoplasmic reticulum liver storage diseases caused by the deposition and accumulation of excessive abnormally folded AAT protein. The accumulation of Z-AAT protein in the globular conformation in hepatocytes is a well-known feature of AATD liver disease, and it is believed to cause the proteotoxic effects responsible for inducing liver damage (including hepatocyte damage and death and chronic liver damage) in individuals with AATD. (D. Lindblad, K. Blomenkamp and J. Teckman, Hepatology 2007, 46: 1228-1235). Patients with AATD usually develop liver disease even in infancy, which can be severe or fatal. Clinical manifestations of liver damage include chronic hepatitis, cirrhosis, hepatocellular carcinoma, elevated transaminases, cholestasis, fibrosis, and even fulminant liver failure. There is currently no clinically approved treatment to prevent the onset or slow the progression of liver disease caused by AATD.In addition, although US Patent Application Publication No. 2015 / 0361427 discloses an RNAi agent capable of suppressing AAT gene expression, there is still a need for a novel and highly effective AAT RNAi agent with improved efficacy that can selectively and effectively inhibit the expression of the AAT gene, thereby preventing and potentially reversing liver injury and fibrosis associated with Z-AAT accumulation. There is a need for novel AAT-specific RNA interference (RNAi) agents (also referred to herein as RNAi agents, RNAi triggers or triggers) that can selectively and efficiently inhibit AAT gene expression. Additionally, there is a need for compositions of novel AAT-specific RNAi agents for the treatment and prevention of diseases associated with AAT deficiency. Since liver injury caused by AATD occurs through a gain-of-function mechanism, inhibition of AAT gene expression is applicable to prevent the accumulation of Z-AAT protein in the liver. Additionally, the reduction or removal of Z-AAT polymer aggregates reduces ER stress in hepatocytes and provides additional advantages in reducing the likelihood and aiding in the prevention and treatment of hepatocyte injury and chronic liver injury, such as fibrosis, cirrhosis, hepatocellular carcinoma, and other conditions and diseases caused by AATD. The reduction of the inflammatory Z-AAT protein, which has been clearly defined as the cause of progressive liver disease in AATD patients, is important because it can slow or interrupt the progression of liver disease and allow for the repair of fibrotic tissue. Described herein is a novel AAT RNAi agent, including a composition of AAT RNAi agents, and methods for inhibiting AAT gene expression in vivo and in vitro using the AAT RNAi agent and the composition comprising the AAT RNAi agent. Also described herein are methods for treating AATD-related diseases using the AAT RNAi agent and the composition comprising the AAT RNAi agent described herein. The AAT RNAi agents and methods disclosed herein can provide treatment for AATD and conditions and diseases caused by AATD, such as chronic hepatitis, cirrhosis, hepatocellular carcinoma, and fulminant liver failure. The AAT RNAi agents disclosed herein can prevent and / or reverse liver injury and fibrosis associated with Z-AAT accumulation when administered to an individual. The AAT RNAi agents described herein can be administered to an individual, such as a human or animal individual, by any suitable method known in the art, such as subcutaneous injection or intravenous administration. Described herein are RNAi agents for inhibiting the expression of the α-1 antitrypsin (AAT) gene, wherein the RNAi agent comprises a sense strand and an antisense strand. Also described herein are compositions comprising an RNAi agent capable of inhibiting the expression of the α-1 antitrypsin gene, wherein the RNAi agent comprises a sense strand and an antisense strand, and at least one pharmaceutically acceptable excipient. Each AAT RNAi agent described herein comprises a sense strand and an antisense strand. The sense strand and the antisense strand can be partially, substantially or completely complementary to each other. The lengths of the sense and antisense strands of the RNAi agents described herein can each be 16 to 30 nucleotide lengths. In some embodiments, the sense strand and the antisense strand are independently 17 to 26 nucleotide lengths. In some embodiments, the sense and antisense strands are independently 21 to 26 nucleotide lengths. In some embodiments, the sense and antisense strands are independently 21 to 24 nucleotide lengths. The sense strand and the antisense strand can be of the same length or different lengths.When the RNAi agents described herein are delivered to cells expressing AAT, the expression of one or more AAT genes is inhibited in vivo or in vitro. The AAT RNAi agents comprise a sense strand (also referred to as the passenger strand) and an antisense strand (also referred to as the guide strand). The sense strand of the AAT RNAi agents described herein comprises a nucleotide sequence having at least 85% identity with a core extension portion of at least 16 contiguous nucleotides of the sequence in the AAT mRNA. In some embodiments, the length of the core extension portion of the sense strand having at least 85% identity with the sequence in the AAT mRNA is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. The antisense strand of the AAT RNAi agent comprises a nucleotide sequence having at least 85% complementarity with a core extension portion of at least 16 contiguous nucleotides of the sequence in the AAT mRNA and the corresponding sense strand. In some embodiments, the length of the core nucleotide extension portion of the antisense strand having at least 85% complementarity with the sequence in the AAT mRNA or the corresponding sense strand is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. In some embodiments, the AAT RNAi agents disclosed herein target a portion of the AAT gene having a sequence of any of the sequences disclosed in Table 1. Examples of the sense and antisense strands of the AAT RNAi agents useful in the AAT RNAi agents are provided in Tables 2, 3, 4, and 5. Examples of the double helices comprising the AAT RNAi agents are provided in Table 6. Examples of the 19-nucleotide core extension sequences that can be composed of or included in the sense and antisense strands of certain AAT RNAi agents disclosed herein are provided in Table 2. Methods for in vivo delivery of the AAT RNAi agents to hepatocytes of an individual, such as a mammal, are described herein. In some embodiments, one or more AAT RNAi agents are delivered to the target cells or tissues using any oligonucleotide delivery technique known in the art. Nucleic acid delivery methods include (but are not limited to) encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles such as hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, protein carriers, or Dynamic Polyconjugates™ (DPC) (see, for example, WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, each of which is incorporated herein by reference). In some embodiments, delivery vehicles such as polymers, amphiphilic polymers, membrane-active polymers, peptides such as melittin or melittin-like peptides, reversibly modified polymers or peptides, or lipids can be used with the AAT RNAi agents disclosed herein. In some embodiments, the AAT RNAi agents are delivered to the target cells or tissues by covalently linking or conjugating the RNAi agent to a targeting group such as an asialoglycoprotein receptor ligand.In some embodiments, the asialoglycoprotein receptor ligand comprises, consists of, or consists essentially of a cluster of galactose or galactose derivatives. In some embodiments, the AAT RNAi agent is linked to a targeting ligand comprising the galactose derivative N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster comprises an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. In some embodiments, the galactose derivative cluster is an N-acetyl-galactosamine trimer or an N-acetyl-galactosamine tetramer. Examples of targeting groups suitable for delivering RNAi agents are disclosed, for example, in U.S. Patent Application No. 15 / 452,324 and U.S. Patent Publication No. US 2017 / 0253875, which are incorporated herein by reference in their entireties. The targeting group can be linked to the 3' or 5' end of the sense or antisense strand of the AAT RNAi agent. In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is linked to the 5' end of the sense strand. In some embodiments, the targeting group is internally linked to nucleotides on the sense and / or antisense strands of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker. The targeting group (with or without a linker) can be linked to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 5. The linker can be linked to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, and 5 with or without a targeting group. In some embodiments, the present disclosure describes a composition comprising one or more AAT RNAi agents having the double helix structure disclosed in Table 6. In some embodiments, the present disclosure describes a composition comprising a combination or mixture of at least two AAT RNAi agents having different nucleotide sequences. In some embodiments, two or more different AAT RNAi agents are each separately and independently linked to a targeting group. In some embodiments, two or more different AAT RNAi agents are each linked to a targeting group comprising or consisting of a targeting ligand that comprises one or more moieties that target the asialoglycoprotein receptor. In some embodiments, two or more different AAT RNAi agents are each linked to a targeting group comprising or consisting of a targeting ligand that comprises one or more galactose derivatives. In some embodiments, two or more different AAT RNAi agents are each linked to a targeting group comprising or consisting of a targeting ligand that comprises one or more N-acetyl-galactosamines. In some embodiments, when two or more RNAi agents are included in the composition, each RNAi agent is independently linked to the same targeting group.In some embodiments, when the composition contains two or more RNAi agents, each RNAi agent is independently linked to a different targeting group, such as targeting groups having different chemical structures. In some embodiments, the targeting group is linked to the AAT RNAi agent without using an additional linker. In some embodiments, the targeting group is designed to have a linker that is readily available to facilitate linkage to the AAT RNAi agent. In some embodiments, when the composition contains two or more RNAi agents, the two or more RNAi agents can be linked to their respective targeting groups using the same linker. In some embodiments, when the composition contains two or more RNAi agents, the two or more RNAi agents are linked to their respective targeting groups using different linkers. In another aspect, methods for inhibiting the expression of alpha-1 antitrypsin in an individual are described herein, which include administering to the individual an amount of an RNAi agent capable of inhibiting the expression of the AAT gene, wherein the RNAi agent includes a sense strand and an antisense strand. Methods for treating, preventing, or managing a condition or disease caused by alpha-1 antitrypsin deficiency are also described herein, the method including administering to an individual a therapeutically effective amount of an RNAi agent as described herein. Methods for inhibiting the expression of the AAT gene are additionally described, the methods including administering the AAT RNAi agent described herein. In some embodiments, methods for treating, preventing, or managing a condition or disease caused by alpha-1 antitrypsin deficiency are disclosed herein, the methods including administering to an individual a therapeutically effective amount of an RNAi agent having an antisense strand comprising any one of the sequences in Tables 2, 3, or 4. In some embodiments, methods for inhibiting the expression of the AAT gene are disclosed herein, the methods including administering an AAT RNAi agent comprising an antisense strand comprising any one of the sequences in Tables 2, 3, or 4. In some embodiments, methods for treating, preventing, or managing a condition or disease caused by alpha-1 antitrypsin deficiency are disclosed herein, the methods including administering to an individual a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any one of the sequences in Tables 2, 3, or 5. In some embodiments, methods for inhibiting the expression of the AAT gene are disclosed herein, the methods including administering an AAT RNAi agent comprising a sense strand comprising any one of the sequences in Tables 2, 3, or 5. In some embodiments, methods for treating, preventing, or managing a condition or disease caused by alpha-1 antitrypsin deficiency are disclosed herein, the methods including administering to an individual a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any one of the sequences in Table 5 and an antisense strand comprising any one of the sequences in Table 4.In some embodiments, methods for inhibiting AAT gene expression are disclosed herein, the methods comprising administering to an individual a therapeutically effective amount of an RNAi agent comprising a sense strand comprising a sequence of any one of the sequences in Table 5, and an antisense strand comprising a sequence of any one of the sequences in Table 4. In some embodiments, methods for inhibiting AAT gene expression are disclosed herein, the methods comprising administering an AAT RNAi agent comprising a sense strand consisting of the nucleobase sequence of any one of the sequences in Table 5, and an antisense strand consisting of the nucleobase sequence of any one of the sequences in Table 4. In other embodiments, methods for inhibiting AAT gene expression are disclosed herein, the methods comprising administering an AAT RNAi agent comprising a sense strand consisting of a modified sequence of any one of the modified sequences in Table 5, and an antisense strand consisting of a modified sequence of any one of the modified sequences in Table 4. In some embodiments, methods for inhibiting AAT gene expression in cells are disclosed herein, the methods comprising administering one or more AAT RNAi agents having a double helix structure set forth in Table 6. In some embodiments, the AAT RNAi agents disclosed herein have a structure comprising, consisting of, or consisting essentially of the structure shown in any one of FIGS. 1, 2, 3, 4, 5, 6, 7, or 8. The AAT RNAi agents disclosed herein are designed to target a specific location on the AAT gene (SEQ ID NO:1). As defined herein, when the 5'-terminal nucleobase of the antisense strand base pairs with a position 19 nucleotides downstream (towards the 3'-end) of the position where the base pairs with the gene, the antisense strand sequence is designed to target the AAT gene at a predetermined location on the gene. For example, as depicted in Tables 1, 2, and 3 herein, the antisense strand sequence designed to target the AAT gene at position 1000 requires the 5'-terminal nucleobase of the antisense strand to align with position 1018 of the AAT gene when the base pairs with the gene. As provided herein, the AAT RNAi agent does not require position 1 (5' of the antisense strand). The nucleobase at the 3') is complementary to the gene, provided that there is at least 85% complementarity between the antisense strand and the core extension sequence of the gene spanning at least 16 consecutive nucleotides. For example, for the AAT RNAi agent disclosed herein designed to target position 1000 of the AAT gene, the 5'-terminal nucleobase of the antisense strand of the AAT RNAi agent must be aligned with position 1018 of the gene; however, the 5'-terminal nucleobase of the antisense strand may but does not have to be complementary to position 1018 of the AAT gene, provided that there is at least 85% complementarity between the antisense strand and the core extension sequence of the gene spanning at least 16 consecutive nucleotides. As shown in various examples disclosed herein in particular, the degree of inhibition of the AAT RNAi agent by the gene through the specific binding site of the antisense strand of the AAT RNAi agent (e.g., regardless of whether the AAT RNAi agent is designed to target the AAT gene at position 1000, position 1142, or some other position) is extremely important. In some embodiments, the antisense strand sequence is designed to have a sequence targeting position 1000 of the AAT gene (SEQ ID NO: 1). In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein all or substantially all of the nucleotides are modified nucleotides. In some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein all or substantially all of the nucleotides are modified nucleotides.In some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein all or substantially all nucleotides are modified nucleotides. In some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO: 429), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACG (SEQ ID NO: 80), wherein one or more nucleotides are modified nucleotides. In some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO: 430), wherein one or more nucleotides are modified nucleotides, and the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of AGUUAAACAUGCCUAAACG (SEQ ID NO: 81), wherein one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein all or substantially all nucleotides are modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein all or substantially all nucleotides are modified nucleotides.In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein all or substantially all nucleotides are modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein at least one or more nucleotides are modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801), wherein all or substantially all nucleotides are modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794), wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857). In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839), wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885). In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800), wherein at least one or more nucleotides are modified nucleotides, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGCUUUAGGCAUGUUUAACA (SEQ ID NO: 864).In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO:801) that differs by 0, 1, 2, or 3 nucleotides, wherein at least one or more of the nucleotides are modified nucleotides, and the sense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence AGCGUUUAGGCAUGUUUAACA (SEQ ID NO:866) that differs by 0, 1, 2, or 3 nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO:794) that differs by 0, 1, 2, or 3 nucleotides, wherein at least one or more of the nucleotides are modified nucleotides, and the sense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence CGUUUAGGCAUGUUUAACAUU (SEQ ID NO:857) that differs by 0, 1, 2, or 3 nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO:839) that differs by 0, 1, 2, or 3 nucleotides, wherein at least one or more of the nucleotides are modified nucleotides, and the sense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO:885) that differs by 0, 1, 2, or 3 nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO:800) that differs by 0, 1, 2, or 3 nucleotides, wherein at least one or more of the nucleotides are modified nucleotides, and the sense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence CGCGUUUAGGCAUGUUUAACA (SEQ ID NO:864) that differs by 0, 1, 2, or 3 nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO:801) that differs by 0, 1, 2, or 3 nucleotides, wherein at least one or more of the nucleotides are modified nucleotides, and the sense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence AGCGUUUAGGCAUGUUUAACA (SEQ ID NO:866) that differs by 0, 1, 2, or 3 nucleotides.In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04824 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04825 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04826 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04827 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04828 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04829 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04830 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04831 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the duplex AD04832. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04833 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04834 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04835 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04836 double helix structure. In some embodiments, the AAT RNAi agent comprises, consists of, or consists essentially of the AD04837 double helix structure. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACG (SEQ ID NO:80), wherein one or more nucleotides are modified nucleotides, and wherein SEQ ID NO:80 is located at positions 1 to 19 (5'. 3') of the antisense strand. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of UGUUAAACAUGCCUAAACG (SEQ ID NO:80), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 80 is located at positions 1 to 19 (5' at position 1 to 19 (5' 3') of the antisense strand. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of AGUUAAACAUGCCUAAACG (SEQ ID NO:81), wherein one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 81 is located at position 1 to 19 (5' at position 1 to 19 (5' 3') of the antisense strand. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of AGUUAAACAUGCCUAAACG (SEQ ID NO:81), wherein all or substantially all nucleotides are modified nucleotides, and wherein SEQ ID NO:81 is located at position 1 to 19 (5' at position 1 to 19 (5' 3') of the antisense strand. In some embodiments, the sense strand of the AAT RNAi agent comprises the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO:429), wherein one or more nucleotides are modified nucleotides, and wherein position 19 of SEQ ID NO: 429 base pairs with the nucleotide located at the 5' end of the antisense strand. In some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACA (SEQ ID NO:429), wherein all or substantially all nucleotides are modified nucleotides, and wherein position 19 of SEQ ID NO: 429 base pairs with the nucleotide located at the 5' end of the antisense strand. In some embodiments, the sense strand of the AAT RNAi agent comprises the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO:430), wherein one or more nucleotides are modified nucleotides, and wherein position 19 of SEQ ID NO:430 base pairs with the nucleotide located at the 5' end of the antisense strand. In some embodiments, the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence of CGUUUAGGCAUGUUUAACU (SEQ ID NO:430), wherein all or substantially all nucleotides are modified nucleotides, and wherein position 19 of SEQ ID NO:430 base pairs with the nucleotide located at the 5' end of the antisense strand. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO:794), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 794 is located at position 1 to 21 (5' at position 1 to 21 (5' 3') of the antisense strand. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO:794), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 794 is located at position 1 to 22 (5' 3') of the antisense strand. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO:839), wherein at least one or more of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 839 is located at position 1 to 22 (5' 3') of the antisense strand. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO:839), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 839 is located at position 1 to 21 (5' 3') of the antisense strand. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO:800), wherein at least one or more of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 800 is located at position 1 to 21 (5' 3') of the antisense strand. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO:800), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 800 is located at position 1 to 21 (5' 3') of the antisense strand. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO:801), wherein at least one or more of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 801 is located at 3'). In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO:801), wherein all or substantially all of the nucleotides are modified nucleotides, and wherein SEQ ID NO: 801 is located at positions 1 to 21 of the antisense strand (5' at position 3'). In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGUU (SEQ ID NO:794), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO:794 is at the 5' end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGUUUAGGCAUGUUUAACAUU (SEQ ID NO:857). In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO:839), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 839 is at the 5' end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO:885). In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO:800), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 800 is at the 5' end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGCGUUUAGGCAUGUUUAACA (SEQ ID NO:864). In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO:801), wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 801 is at the 5' end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence AGCGUUUAGGCAUGUUUAACA (SEQ ID NO:866). In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of UGUUAAACAUGCCUAAACGUU (SEQ ID NO:794) with a difference of 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 794 is at the 5' end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of the nucleobase sequence CGUUUAGGCAUGUUUAACAUU (SEQ ID NO:857) with a difference of 0, 1, 2, or 3 nucleotides.In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence UGUUAAACAUGCCUAAACGCUU (SEQ ID NO:839) that differs by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 839 is located at the 5'-end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO:885) that differs by 0, 1, 2, or 3 nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence UGUUAAACAUGCCUAAACGCG (SEQ ID NO:800) that differs by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 800 is located at the 5'-end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence CGCGUUUAGGCAUGUUUAACA (SEQ ID NO:864) that differs by 0, 1, 2, or 3 nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence UGUUAAACAUGCCUAAACGCU (SEQ ID NO:801) that differs by 0, 1, 2, or 3 nucleotides, wherein at least one or more nucleotides are modified nucleotides, and wherein SEQ ID NO: 801 is located at the 5'-end of the antisense strand, and the sense strand of the AAT RNAi agent comprises or consists of a nucleobase sequence AGCGUUUAGGCAUGUUUAACA (SEQ ID NO:866) that differs by 0, 1, 2, or 3 nucleotides. The AAT RNAi agents described herein may comprise one or more modified nucleotides. The AAT RNAi agents described herein may also comprise one or more phosphorothioate internucleotide linkages. The AAT RNAi agents described herein may also include one or more targeting groups or linking groups. In some embodiments, the AAT RNAi agents disclosed herein include one or more targeting groups. In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand comprises a cluster of galactose or galactose derivatives. In some embodiments, the cluster of galactose derivatives comprises N-acetyl-galactosamine. In some embodiments, the targeting ligand comprises an N-acetyl-galactosamine trimer. In some embodiments, the targeting group binds to the sense strand of the AAT RNAi agent disclosed herein.In some embodiments, the AAT RNAi agents described herein may comprise one or more targeting groups having the structures (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. In some embodiments, the AAT RNAi agents described herein comprise a targeting group at the 5' end of the sense strand having the structures (PAZ), (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. The AAT RNAi agents disclosed herein can be incorporated into a composition comprising one or more of the disclosed AAT RNAi agents and at least one pharmaceutically acceptable excipient. In some embodiments, the compositions disclosed herein comprising one or more of the disclosed AAT RNAi agents and at least one pharmaceutically acceptable excipient are pharmaceutical compositions. Pharmaceutical compositions comprising one or more AAT RNAi agents can be administered in a variety of ways, depending on the need for local or systemic treatment. Administration can be (but is not limited to) intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implanted device), and intracerebral administration. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection. In some embodiments, a composition comprising one or more of the disclosed AAT RNAi agents and at least one pharmaceutically acceptable excipient may further comprise one or more additional therapies or treatments. In some embodiments, the compositions described herein comprising one or more AAT RNAi agents can be packaged in a kit, container, sachet, dispenser, prefilled syringe, or vial.In some embodiments, the compositions described herein can be administered parenterally. The AAT RNAi agents and compositions comprising the same disclosed herein can be administered to an individual to inhibit the expression of the α-1 antitrypsin gene in the individual. In some embodiments, the individual is a human. In some embodiments, the individual is a human diagnosed with AATD. In some embodiments, methods are disclosed herein for inhibiting the expression of the AAT gene in a cell, the methods comprising administering an AAT RNAi agent having an antisense strand that is at least partially complementary to a portion of an AAT mRNA having any one of the sequences listed in Table 1. The AAT RNAi agents and compositions comprising the same disclosed herein can be administered to an individual for treating, preventing or managing a condition or disease caused by α-1 antitrypsin deficiency. Conditions or diseases that can be treated, prevented or managed by administering the AAT RNAi agents and compositions comprising the same disclosed herein include chronic hepatitis, cirrhosis, hepatocellular carcinoma, elevated transaminases, cholestasis, fibrosis or fulminant hepatic failure. As used herein, the terms "oligonucleotide" and "polynucleotide" mean polymers of linked nucleosides, where each can be independently modified or unmodified. As used herein, "RNAi agent" or "RNAi trigger" means a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of reducing or inhibiting the translation of a messenger RNA (mRNA) transcript of a target mRNA in a sequence-specific manner. As used herein, an RNAi agent can act via the RNA interference mechanism (i.e., by interacting with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) of mammalian cells to induce RNA interference) or by any alternative mechanism or pathway. Although it is believed that RNAi agents (as the term is used herein) act primarily via the RNA interference mechanism, the disclosed RNAi agents are not bound or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein include a sense strand and an antisense strand, and include (but are not limited to): short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNAs), short hairpin RNA (shRNA) and endonuclease substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the targeted mRNA (e.g., AAT mRNA). The RNAi agents can include modified nucleotides and / or one or more non-phosphodiester linkages.As used herein, when referring to the expression of a given gene, the terms "silence", "reduce", "inhibit", "downregulate", or "block gene expression" mean that when a cell, cell population, tissue, organ, or individual is treated with an RNAi agent as described herein, the expression of the gene is reduced compared to a second cell, cell population, tissue, organ, or individual that has not undergone such treatment, as measured by the content of RNA transcribed from the gene, or the content of polypeptide, protein, or protein subunit translated from the mRNA, in the cell, tissue, organ, or population of individuals in which the gene is transcribed. As used herein, the term "sequence" or "nucleotide sequence" means a continuous or sequential series of nucleobases or nucleotides described by a string of letters using standard nomenclature. As used herein, "nucleotide base" or "nucleobase" is a heterocyclic pyrimidine or purine compound, which is a standard component of all nucleic acids, and includes the bases adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U) that form nucleotides. Nucleobases can be further modified to include (but are not limited to) universal bases, hydrophobic bases, wobble bases, size-expanded bases, and fluorinated bases. As used herein and unless otherwise indicated, the term "complementary", when used to describe a first nucleotide sequence (e.g., the sense strand of an RNAi agent or the targeted mRNA) relative to a second nucleotide sequence (e.g., the antisense strand of an RNAi agent or a single-stranded antisense oligonucleotide), means the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or similar in vitro conditions)) with an oligonucleotide or polynucleotide containing the second nucleotide sequence and form a double helix or duplex structure. To the extent that the above hybridization requirements are met, complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics. Sequence identity or complementarity is independent of modification. For purposes of determining identity or complementarity, for example, a and Af are complementary to U (or T) and identical to A. As used herein, "perfect complementarity" or "complete complementarity" means that all (100%) of the bases in the adjacent sequence of the first polynucleotide will hybridize with the same number of bases in the adjacent sequence of the second polynucleotide. The adjacent sequence can include all or a portion of the first or second nucleotide sequence. As used herein, "partial complementarity" means that at least 70% (but not all) of the bases in the adjacent sequence of the first polynucleotide will hybridize with the same number of bases in the adjacent sequence of the second polynucleotide in the nucleobase sequence pairs of the hybridization. As used herein, "substantially complementary" means that at least 85% (but not all) of the bases in the continuous sequence of the first polynucleotide will hybridize with the same number of bases in the continuous sequence of the second polynucleotide in the nucleobase sequence pairs of the hybridization.The terms "complementary", "fully complementary", "partially complementary", and "substantially complementary" as used herein can be used with respect to base pairing between the sense and antisense strands of an RNAi agent or between the antisense strand of an RNAi agent and the sequence of AAT mRNA. As used herein, the term "substantially identical" or "substantially consistent" when applied to a nucleic acid sequence means that the nucleic acid sequence comprises a sequence having at least about 85% sequence identity or higher, preferably at least 90%, at least 95% or at least 99% identity, compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences in a comparison window. The percentage is calculated by determining the number of positions at which identical nucleic acid bases exist in the two sequences, obtaining the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window and multiplying the result by 100 to obtain the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences that are substantially consistent with those disclosed herein. As used herein, the term "treatment" and its like terms mean a method or procedure for providing a reduction or alleviation in the number, severity and / or frequency of occurrence of one or more symptoms of a disease in an individual. As used herein, when referring to an RNAi agent, the term "introducing into a cell" means functionally delivering the RNAi agent into the cell. The term "functionally delivering" means delivering the RNAi agent into the cell in such a way that the RNAi agent can have the desired biological activity (e.g., sequence-specific inhibition of gene expression). Unless otherwise indicated, the symbols used herein are used. It means that any group can be connected thereto within the scope of the invention described herein. As used herein, the term "isomer" refers to compounds having the same molecular formula but different in properties or in the sequence of bonding of their atoms or in the configuration of their atoms in space. Isomers that differ in the spatial arrangement of atoms are called "stereoisomers". Stereoisomers that are not mirror images of each other are called "diastereoisomers" and stereoisomers that are non-superimposable mirror images are called "enantiomers" or sometimes "optical isomers". A carbon atom bonded to four different substituents is called a "chiral center". As used herein, unless specifically identified as having a particular configuration in the structure, for each structure in which there are asymmetric centers and thus enantiomers, diastereoisomers or other stereoisomeric configurations are generated, each structure disclosed herein is intended to represent all such possible isomers, including their optically pure and racemic forms. For example, the structures disclosed herein are intended to cover mixtures of diastereoisomers as well as single stereoisomers. As used in the claims of the present invention, the phrase "consisting of" does not include any element, step or component not specified in the claims. When used in the claims of the present invention, the term "consisting essentially of" limits the scope of the claims to the specified materials or steps and materials or steps that do not materially affect the basic and novel features of the present invention. Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (such as N, O or S atoms) in a protonated or deprotonated state, depending on the placement of the compound or composition. Accordingly, as used herein, the structures disclosed herein cover certain functional groups that can be protonated or deprotonated, such as OH, SH or NH. The disclosure herein is intended to cover the compounds and compositions of the present invention regardless of their protonation state based on the environment (such as pH value), as can be readily understood by those of ordinary skill in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, the present specification (including definitions) will prevail. In addition, the materials, methods and examples described herein are illustrative only and are not intended to be limiting. Other objects, features, aspects and advantages of the present invention will become apparent from the following embodiments, drawings and claims. This text describes RNAi agents (referred to herein as AAT RNAi agents or AAT RNAi triggers) for inhibiting the expression of the AAT gene. Each AAT RNAi agent includes a sense strand and an antisense strand. The lengths of the sense strand and the antisense strand can each be 16 to 30 nucleotides. In some embodiments, the lengths of the sense and antisense strands can each be 17 to 26 nucleotides. The sense strand and the antisense strand can be of the same length or they can be of different lengths. In some embodiments, the lengths of the sense and antisense strands are each independently 17-21 nucleotides. In some embodiments, the sense and antisense strands are each 21-26 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length and the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each 26 nucleotides in length. In some embodiments, the sense strand is 22 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, the sense strand is 19 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, the lengths of the sense and antisense strands of the RNAi agent are each independently 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides. In some embodiments, the double-stranded RNAi agent has a double helix length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides. The length of this perfectly or substantially complementary region between the sense strand and the antisense strand is typically 15-26 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides and is present at or near the 5' end of the antisense strand (e.g., this region can be spaced 0, 1, 2, 3, or 4 imperfect or substantially complementary nucleotides from the 5' end of the antisense strand). Each of the sense strand and the antisense strand contains a core extension sequence that is 16 to 23 nucleobases in length. The antisense strand core extension sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to the nucleotide sequence (sometimes referred to as the target sequence) present in the AAT mRNA target. The sense strand core extension sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to the core extension sequence in the antisense strand and thus the sense strand core extension sequence is identical or at least about 85% identical to the nucleotide sequence (target sequence) present in the AAT mRNA target. The sense strand core extension sequence can have the same length as the corresponding antisense core sequence or it can be of a different length. In some embodiments, the length of the antisense strand core extension sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.In some embodiments, the length of the sense strand core extension sequence is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides. Examples of nucleotide sequences for forming AAT RNAi agents are provided in Tables 2, 3, 4, and 5. Examples of AAT RNAi agent duplexes containing the sense and antisense strand sequences in Tables 2, 3, 4, and 5 are shown in Table 6. The sense and antisense strands of the AAT RNAi agent anneal to form a duplex. The sense and antisense strands of the AAT RNAi agent are partially, substantially, or completely complementary to each other. Within the complementary duplex region, the sense strand core extension sequence is at least 85% or 100% complementary to the antisense core extension sequence. In some embodiments, the sense strand core extension sequence contains at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% or 100% complementary to the corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core extension sequence (i.e., the sense and antisense core extension sequences of the AAT RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides with at least 85% base pairing or 100% base pairing). In some embodiments, the antisense strand of the AAT RNAi agent disclosed herein differs from any one of the antisense strand sequences in Table 2, Table 3, or Table 4 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the AAT RNAi agent disclosed herein differs from any one of the sense strand sequences in Table 2, Table 3, or Table 5 by 0, 1, 2, or 3 nucleotides. The sense and / or antisense strands may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3' end, 5' end, or both the 3' and 5' ends of the core extension sequence. If present, the antisense strand additional nucleotides may or may not be complementary to the corresponding sequence in the AAT mRNA. If present, the sense strand additional nucleotides may or may not be identical to the corresponding sequence in the AAT mRNA. The antisense strand additional nucleotides (if present) may or may not be complementary to the additional nucleotides of the corresponding sense strand (if present). As used herein, the extension portion includes 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core extension sequence and / or the antisense strand core extension sequence. The extension nucleotides on the sense strand may or may not be complementary to the nucleotides (core extension sequence nucleotides or extension nucleotides) in the corresponding antisense strand. Conversely, the extension nucleotides on the antisense strand may or may not be complementary to the nucleotides (core extension sequence nucleotides or extension nucleotides) in the corresponding sense strand. In some embodiments, the sense and antisense strands of the RNAi agent contain 3' and 5' extension portions. In some embodiments, one or more 3' extension nucleotides of one strand base pair with one or more 5' extension nucleotides of the other strand.In other embodiments, one or more 3'-extended nucleotides of one strand do not base pair with one or more 5'-extended nucleotides of the other strand. In some embodiments, an AAT RNAi agent has an antisense strand containing a 3'-extended portion and a sense strand containing a 5'-extended portion. In some embodiments, the AAT RNAi agent includes an antisense strand having a 3'-extended portion that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the AAT RNAi agent includes an antisense strand having a 3'-extended portion that is 1, 2, or 3 nucleotides in length. In some embodiments, one or more antisense strand extended nucleotides include uracil or thymidine nucleotides or nucleotides complementary to the corresponding AAT mRNA sequence. In some embodiments, the 3'-antisense strand extended portion comprises (but is not limited to) one or more of the following sequences or consists of: AUA, UGCUU, CUG, UG, UGCC, CUGCC, CGU, CUU, UGCCUA, CUGCCU, UGCCU, UGAUU, GCCUAU, T, TT, U, UU (listed 5' to 3' each). In some embodiments, the 3'-end of the antisense strand may include an additional abasic site (Ab). An "abasic site" is a nucleotide or nucleoside that does not have a nucleobase at the 1'-position of the sugar. In some embodiments, Ab or AbAb may be added to the 3'-end of the antisense strand. In some embodiments, the abasic site may be added as a reverse abasic site (see Table 7). In some embodiments, the AAT RNAi agent includes an antisense strand having a 5'-extended portion that is 1, 2, 3, 4, or 5 nucleotides in length. In other embodiments, the AAT RNAi agent includes an antisense strand having a 5'-extended portion that is 1 or 2 nucleotides in length. In some embodiments, one or more antisense strand extended nucleotides include uracil or thymidine nucleotides or nucleotides complementary to the corresponding AAT mRNA sequence. In some embodiments, the 5'-antisense strand extended portion comprises (but is not limited to) one or more of the following sequences or consists of: UA, TU, U, T, UU, TT, CUC (listed 5' to 3' each). The antisense strand can have any combination of any of the above 3'-extended portions and any of the 5'-antisense strand extended portions (if present). In some embodiments, the AAT RNAi agent includes a sense strand having a 3'-extended portion that is 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more sense strand extended nucleotides include adenosine, uracil or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to nucleotides in the AAT mRNA sequence. In some embodiments, the 3'-sense strand extended portion comprises (but is not limited to) one or more of the following sequences or consists of: T, UT, TT, UU, UUT, TTT, or TTTT (listed 5' to 3' each). In some embodiments, the 3'-end of the sense strand may include an additional abasic site.In some embodiments, UUAb, UAb, or Ab can be added to the 3' end of the sense strand. In some embodiments, one or more abasic sites added to the 3' end of the sense strand can be inverted (invAb). In some embodiments, one or more inverted abasic sites can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, including one or more inverted abasic sites at or near the end of the sense strand of the RNAi agent can allow for enhanced activity or other desired properties of the RNAi agent. In some embodiments, the sense strand of the AAT RNAi agent includes a sense strand having a 5' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides include uracil or adenosine nucleotides or nucleotides corresponding to the nucleotides in the AAT mRNA sequence. In some embodiments, the sense strand 5' extension can be (but is not limited to) one of the following sequences: CA, AUAGGC, AUAGG, AUAG, AUA, A, AA, AC, GCA, GGCA, GGC, UAUCA, UAUC, UCA, UAU, U, UU (listed 5' to 3' each). The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, the 5' end of the sense strand can include one or more additional abasic sites (e.g., (Ab) or (AbAb)). In some embodiments, one or more abasic sites added to the 5' end of the sense strand can be inverted (e.g., invAb). In some embodiments, one or more inverted abasic sites can be inserted between the targeting ligand and the nucleobase sequence of the sense strand of the RNAi agent. In some embodiments, including one or more inverted abasic sites at or near the end of the sense strand of the RNAi agent can allow for enhanced activity or other desired properties of the RNAi agent. In some embodiments, the 3' end of the antisense strand core extension sequence or the 3' end of the antisense strand sequence can include an inverted abasic site (invAb (see Table 7)). In some embodiments, the 5' end of the antisense core extension or the 5' end of the antisense strand sequence can include an inverted abasic site. In some embodiments, both the 3' and 5' ends of the antisense strand core extension sequence can include inverted abasic sites. In some embodiments, both the 3' and 5' ends of the antisense strand sequence can include inverted abasic sites. Examples of sequences for forming the AAT RNAi agent are provided in Tables 2, 3, 4, and 5. In some embodiments, the antisense strand of the AAT RNAi agent includes the sequence of any one of the sequences in Tables 2, 3, or 4. In some embodiments, the antisense strand of the AAT RNAi agent (from the 5' end... The sequence containing nucleotides 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26 of any of the sequences in Table 2, Table 3, or Table 4 at the 3' end). In certain embodiments, the antisense strand of the AAT RNAi agent comprises or consists of a modified sequence of any of the modified sequences in Table 4. In some embodiments, the sense strand of the AAT RNAi agent comprises a sequence of any of the sequences in Table 2, 3, or 5. In some embodiments, the sense strand of the AAT RNAi agent (from the 5' end The 3'-end) contains the sequences of nucleotides 1-18, 1-19, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-26, 2-19, 2-20, 2-21, 2-22, 2-23, 2-24, 2-25, 2-26, 3-20, 3-21, 3-22, 3-23, 3-24, 3-25, 3-26, 4-21, 4-22, 4-23, 4-24, 4-25, 4-26, 5-22, 5-23, 5-24, 5-25, 5-26, 6-23, 6-24, 6-25, 6-26, 7-24, 7-25, 7-25, 8-25, 8-26 in any of the sequences in Table 2, 3 or 5. In certain embodiments, the sense strand of the AAT RNAi agent comprises or consists of a modified sequence of any of the modified sequences in Table 5. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agents described herein contain different numbers of nucleotides. In some embodiments, the 5'-end of the sense strand and the 3'-end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, the 3'-end of the sense strand and the 5'-end of the antisense strand of the RNAi agent form blunt ends. In some embodiments, both ends of the RNAi agent form blunt ends. In some embodiments, neither end of the RNAi agent is a blunt end. As used herein, a blunt end refers to one end of a double RNAi agent where the terminal nucleotides of the two annealed strands are complementary (forming complementary base pairs). In some embodiments, the 5'-end of the sense strand and the 3'-end of the antisense strand of the RNAi agent form frayed ends. In some embodiments, the 3'-end of the sense strand and the 5'-end of the antisense strand of the RNAi agent form frayed ends. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, a frayed end refers to one end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands pair (i.e., do not form overhangs), but are not complementary (i.e., form non-complementary pairs). As used herein, an overhang is an extension of one or more unpaired nucleotides located at the end of one strand of a double-stranded RNAi agent. The unpaired nucleotides can be located on the sense or antisense strand, creating 3' or 5' overhangs. In some embodiments, the RNAi agent contains: blunt ends and frayed ends, blunt ends and 5' overhangs, blunt ends and 3' overhangs, frayed ends and 5' overhangs, frayed ends and 3' overhangs, two 5' overhangs, two 3' overhangs, 5' overhangs and 3' overhangs, two frayed ends or two blunt ends. Nucleotide bases (or nucleobases) are heterocyclic pyrimidine or purine compounds that are components of all nucleic acids and include adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U).As used herein, the term "nucleotide" can include modified nucleotides (such as nucleotide mimics, abasic sites (Ab) or alternative substitution moieties). When used in various polynucleotide or oligonucleotide constructs, the modified nucleotides can preserve the activity of the compounds in cells while increasing the serum stability of such compounds, and can also minimize the likelihood of activating interferon activity in humans when administering the polynucleotide or oligonucleotide construct. In some embodiments, the AAT RNAi agent is prepared or provided as a salt, mixed salt or free acid. In some embodiments, the AAT RNAi agent is prepared as a sodium salt. Such forms are within the scope of the invention disclosed herein. Modified nucleotides In some embodiments, the AAT RNAi agent contains one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (such as at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides include (but are not limited to): deoxyribonucleotides, nucleotide mimics, abasic nucleotides (denoted herein as Ab), 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides (denoted herein as invdN, invN, invn, invAb), nucleotides including modified nucleobases, bridged nucleotides, peptide nucleic acids (PNA), 2',3'-open loop nucleotide mimics (unlocked nucleobase analogs, denoted herein as N. UNA or NUNA), locked nucleotides (denoted herein as N LNA or NLNA), 3'-O-methoxy (2'-nucleoside internucleotide linkage) nucleotides (denoted herein as 3'-OMeN), 2'-F-arabinonucleotides (denoted herein as NfANA or Nf ANA) 5'-Me, 2'-fluoronucleotides (denoted herein as 5Me-Nf), morpholino nucleotides, vinyl phosphonate deoxyribonucleotides (denoted herein as vpdN), nucleotides containing vinyl phosphonate, and nucleotides containing cyclopropyl phosphate (cPrpN). 2'-Modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2'-position of the five-membered sugar ring) include (but are not limited to) 2'-O-methyl nucleotides (denoted herein as the lowercase letter 'n' in a nucleotide sequence), 2'-deoxy-2'-fluoronucleotides (denoted herein as Nf, also denoted herein as 2'-fluoronucleotides), 2'-deoxynucleotides (denoted herein as dN), 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (denoted herein as NM or 2'-MOE), 2'-aminonucleotides, and 2'-alkyl nucleotides. All positions of a given compound need not be uniformly modified. In contrast, more than one modification can be incorporated in a single AAT RNAi agent or even in a single nucleotide thereof. The sense and antisense strands of the AAT RNAi agent can be synthesized and / or modified by methods known in the art. The modification at one nucleotide is independent of the modification at another nucleotide. Modified nucleobases include synthetic and natural nucleobases such as 5-substituted pyrimidines, 6-azapyrimidines, and purines substituted at N-2, N-6, and O-6 (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azauracil, 6-azacytosine, 6-azathymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-mercapto, 8-alkylthio, 8-hydroxy, and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine. In some embodiments, all or substantially all of the nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides are modified nucleotides is an RNAi agent in which there are four or fewer (i.e., 0, 1, 2, 3, or 4) ribonucleotides present in the sense and antisense strands.As used herein, a sense strand in which substantially all nucleotides are modified nucleotides is a sense strand in which there are two or fewer (i.e., 0, 1, or 2) nucleotides that are ribonucleotides in the sense strand. As used herein, an antisense strand in which substantially all nucleotides are modified nucleotides is an antisense strand in which there are two or fewer (i.e., 0, 1, or 2) nucleotides that are ribonucleotides in the sense strand. In some embodiments, one or more nucleotides of the RNAi agent are ribonucleotides. Modified internucleoside linkages In some embodiments, one or more nucleotides of the AAT RNAi agent are linked by non-standard linkages or backbones (i.e., modified internucleoside linkages or modified backbones). Modified internucleoside linkages or backbones include, but are not limited to, 5'-thio-phosphate groups (represented herein by the lowercase letter "s"), chiral phosphorothioates, phosphorothioates, dithiophosphates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonate or 3'-alkylene phosphonate), chiral phosphonates, phosphonites, aminophosphates (e.g., 3'-aminoaminophosphate, aminoalkylaminophosphate or thiocarbonylaminophosphate), thiocarbonylalkyl-phosphonate, thiocarbonylalkyl phosphotriester, N-morpholino linkages, boranophosphates with normal 3'-5' linkages, analogs of 2'-5' linkages of boranophosphates or boranophosphates with reverse polarity, where adjacent nucleoside units pair to make a 3'-5' connection to 5'-3' or a 2'-5' connection to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone does not have a phosphorus atom. Modified internucleoside linkages that do not have a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl sugar linkages, mixed heteroatom and alkyl or cycloalkyl sugar linkages, or one or more short-chain heteroatom or heterocyclic sugar linkages. In some embodiments, the modified internucleoside backbone includes, but is not limited to, siloxane backbones, thioether backbones, sulfoxide backbones, sulfone backbones, formyl and thiocarbonyl formyl backbones, methylene formyl and thiocarbonyl formyl backbones, backbones containing olefins, aminosulfonate backbones, methyleneimine and methylenehydrazine backbones, sulfonate and sulfonamide backbones, amide backbones and others having a mixture of N, O, S and CH. 2The backbone of the component. In some embodiments, the sense strand of the AAT RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate bonds, the antisense strand of the AAT RNAi agent may contain 1, 2, 3, 4, 5, or 6 phosphorothioate bonds, or both the sense strand and the antisense strand may independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate bonds. In some embodiments, the sense strand of the AAT RNAi agent may contain 1, 2, 3, or 4 phosphorothioate bonds, the antisense strand of the AAT RNAi agent may contain 1, 2, 3, or 4 phosphorothioate bonds, or both the sense strand and the antisense strand may independently contain 1, 2, 3, or 4 phosphorothioate bonds. In some embodiments, the sense strand of the AAT RNAi agent contains at least two phosphorothioate internucleoside bonds. In some embodiments, at least two phosphorothioate internucleoside bonds are located between nucleotides at positions 1-3 from the 3'-end of the sense strand. In some embodiments, at least two phosphorothioate internucleoside bonds are between nucleotides at positions 1-3, 2-4, 3-5, 4-6, 4-5, or 6-8 from the 5'-end of the sense strand. In some embodiments, the antisense strand of the AAT RNAi agent contains four phosphorothioate internucleoside bonds. In some embodiments, the four phosphorothioate internucleoside bonds are between nucleotides at positions 1-3 relative to the 5'-end of the sense strand and nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 relative to the 5'-end. In some embodiments, the AAT RNAi agent contains at least two phosphorothioate internucleoside bonds in the sense strand and three or four phosphorothioate inter-nucleotide bonds in the antisense strand. In some embodiments, the AAT RNAi agent contains one or more modified nucleotides and one or more modified internucleoside bonds. In some embodiments, 2'-modified nucleosides are combined with modified internucleoside bonds. AAT RNAi agent In some embodiments, the AAT RNAi agents disclosed herein target the AAT gene at or near the positions of the AAT genome shown in Table 1. In some embodiments, the antisense strand of the AAT RNAi agents disclosed herein contains a core extension sequence that is fully, substantially, or at least partially complementary to the target AAT 19-mer sequence disclosed in Table 1. Table 1 . AAT 19-mer mRNA target sequence (obtained from human AAT cDNA, GenBank NM_000295.4 (SEQ ID NO:1)). In some embodiments, position 19 of the antisense strand of the AAT RNAi agent contains (5' 3') An antisense strand capable of base pairing with position 1 of the 19-mer target sequence disclosed in Table 1. In some embodiments, position 1 of the antisense strand of the AAT RNAi agent (5' 3') An antisense strand capable of base pairing with position 19 of the 19-mer target sequence disclosed in Table 1. In some embodiments, position 2 of the antisense strand of the AAT RNAi agent (5' 3') An antisense strand capable of base pairing with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, positions 2 to 18 of the antisense strand of the AAT RNAi agent (5' 3') An antisense strand capable of base pairing with each of the corresponding complementary bases at positions 18 to 2 of the 19-mer target sequence disclosed in Table 1. For the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5' end 3' end) may be perfectly complementary to the AAT gene or may be non-complementary to the AAT gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5' end 3' end) is U, A or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5' end 3' end) forms an A:U or U:A base pair with the sense strand. In some embodiments, the antisense strand of the AAT RNAi agent includes the nucleotide sequence (5' end 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3 or Table 4. In some embodiments, the sense strand of the AAT RNAi agent includes the nucleotide sequence (5' end 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 3 or Table 5. In some embodiments, the AAT RNAi agent includes (i) an antisense strand including the nucleotide sequence (5' end 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3 or Table 4, and (ii) a sense strand including the nucleotide sequence (5' end 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 3 or Table 5. In some embodiments, the AAT RNAi agent contains the core 19-mer nucleotide sequence shown in Table 2 below. Table 2 . Example AAT RNAi agent antisense and sense strand core extended base sequences (N = any nucleobase). Table 3 . Antisense strand and sense strand base sequences of additional AAT RNAi agents. The sense and antisense strands of the AAT RNAi agent comprising or consisting of the nucleotide sequences in Table 2 or Table 3 can be modified nucleotides or unmodified nucleotides. In some embodiments, the AAT RNAi agent having sense and antisense strand sequences comprising or consisting of any one of the nucleotide sequences in Table 2 or Table 3 is all or substantially all modified nucleotides. In some embodiments, the antisense strand of the AAT RNAi agent disclosed herein differs from any one of the antisense strand sequences in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the AAT RNAi agent disclosed herein differs from any one of the sense strand sequences in Table 2 or Table 3 by 0, 1, 2, or 3 nucleotides. As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected. In some embodiments, the N nucleotide listed in the sequences disclosed in Table 2 has a nucleobase complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotide listed in the sequences disclosed in Table 2 has a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotide listed in the sequences disclosed in Table 2 has the same nucleobase as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotide listed in the sequences disclosed in Table 2 has a different nucleobase from the N nucleotide at the corresponding position on the other strand. Specific modified sense and antisense strands of the AAT RNAi agent are provided in Tables 4 and 5. The modified antisense strand of the AAT RNAi agent and its underlying unmodified nucleobase sequence are provided in Table 4. The modified sense strand of the AAT RNAi agent and its underlying unmodified sequence are provided in Table 5. In forming the AAT RNAi agent, each nucleotide in each of the unmodified sequences listed in Tables 4 and 5 and Tables 2 and 3 above can be a modified nucleotide. The AAT RNAi agent described herein is formed by the adhesion of the antisense strand and the sense strand. The sense strand containing the sequence listed in Table 2, Table 3, or Table 5 can hybridize with any antisense strand containing the sequence listed in Table 2, Table 3, or Table 4, as long as the two sequences have at least 85% complementary regions in a 16-, 17-, 18-, 19-, 20-, or 21-nucleotide sequence. In some embodiments, the antisense strand of the AAT RNAi agent comprises the nucleotide sequence of any one of the sequences in Table 2, Table 3, or Table 4. In some embodiments, the AAT RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the AAT RNAi agent comprises a duplex having the nucleobase sequences of the sense and antisense strands of any one of the sequences in Table 2 or Table 3. In some embodiments, the AAT RNAi agent consists of a duplex having the nucleobase sequences of the sense and antisense strands of any one of the sequences in Table 2 or Table 3. Examples of antisense strands containing modified nucleotides are provided in Table 4.Examples of the sense strand containing modified nucleotides are provided in Table 5. As used in Tables 4 and 5, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups. As readily understood by one of ordinary skill in the art, unless the sequence indicates otherwise, monomers are linked to each other by 5'-3' phosphodiester bonds when present in an oligonucleotide. A = adenosine-3'-phosphate; C = cytidine-3'-phosphate; G = guanosine-3'-phosphate; U = uridine-3'-phosphate I = inosine-3'-phosphate n = any 2'-OMe modified nucleotide a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-thiophosphate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-thiophosphate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-thiophosphate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-thiophosphate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-thiophosphate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-thiophosphate Nf = any 2'-fluoro modified nucleotide Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-thiophosphate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-thiophosphate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-thiophosphate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-thiophosphate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-thiophosphate dN = any 2'-deoxyribonucleotide dT = 2'-deoxythymidine-3'-phosphate N. UNA = 2',3'-cyclic nucleotide mimetic (unlocked nucleobase analogue)-3'-phosphate N UNA s = 2',3'-cyclic nucleotide mimetic (unlocked nucleobase analogue)-3'-thiophosphate U UNA = 2',3'-cyclic-uridine-3'-phosphate U UNAs = 2',3'-cyclic uridine-3'-thiol phosphate a_2N = see Table 7 a_2Ns = see Table 7 pu_2N = see Table 7 pu_2Ns = see Table 7 Npu = see Table 7 Nus = see Table 7 N LNA = locked nucleotide Nf ANA= 2'-F-Arabinonucleotide NM = 2'-Methoxyethylnucleotide AM = 2'-Methoxyethyladenosine-3'-phosphate AMs = 2'-Methoxyethyladenosine-3'-thiophosphate TM = 2'-Methoxyethylthymidine-3'-phosphate TMs = 2'-Methoxyethylthymidine-3'-thiophosphate R = Ribitol (invdN) = Any inverted deoxyribonucleotide (3'-3' linked nucleotide) (invAb) = Inverted (3'-3' linked) abasic deoxyribonucleotide, see Table 7 (invAb)s = Inverted (3'-3' linked) abasic deoxyribonucleotide-5'-thiophosphate, see Table 7 (invn) = Any inverted 2'-OMe nucleotide (3'-3' linked nucleotide) s = Thiophosphate bond vpdN = Vinylphosphonate deoxyribonucleotide (5Me-Nf) = 5'-Me, 2'-fluoronucleotide cPrp = Cyclopropylphosphonate, see Table 7 epTcPr = See Table 7 epTM = See Table 7 (Chol-TEG) = See Table 7 (TEG-Biotin) = See Table 7 (PEG-C3-SS) = See Table 7 (Alk-SS-C6) = See Table 7 (C6-SS-Alk) = See Table 7 (C6-SS-Alk-Me) = See Table 7 It will be readily understood by one of ordinary skill in the art that the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) at the respective 3' position of the given monomer rather than an in vitro phosphate moiety. Such an understanding of one of ordinary skill in the art is used herein when describing the AAT RNAi agents and the compositions of the AAT RNAi agents disclosed herein, unless otherwise expressly indicated. The targeting groups and linking groups include the following, the chemical structures of which are provided in Table 7 below: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s.Each sense strand and / or antisense strand can have any of the targeting or linking groups listed above, as well as other targeting or linking groups, which are attached to the 5' and / or 3' end of the sequence. Table 4 .AAT RNAi agent antisense strand sequences. Table 5 .AAT RNAi agent sense strand sequences. The AAT RNAi agents described herein are formed by the annealing of an antisense strand and a sense strand. A sense strand containing a sequence listed in Table 2, Table 3, or Table 5 can hybridize with any antisense strand containing a sequence listed in Table 2, Table 3, or Table 4, provided that the two sequences have a region of at least 85% complementarity over a continuous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the antisense strand of the AAT RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 4 by 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the AAT RNAi agent disclosed herein differs from any of the sense strand sequences in Table 5 by 0, 1, 2, or 3 nucleotides. In some embodiments, the AAT RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 4. In some embodiments, the AAT RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 4 (5' end 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, 2-24, 1-25, 2-25, 1-26, or 2-26. In certain embodiments, the AAT RNAi agent antisense strand comprises or consists of a modified sequence of any of the modified sequences in Table 4. In some embodiments, the AAT RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 5. In some embodiments, the AAT RNAi agent sense strand comprises the nucleotide sequence of any of the sequences in Table 2, Table 3, or Table 5 (5' end 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, 4-24, 1-25, 2-25, 3-25, 4-25, 1-26, 2-26, 3-26 or 4-26. In certain embodiments, the sense strand of the AAT RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 5. For the AAT RNAi agents disclosed herein, the nucleotide at position 1 (5' end 3' end) of the antisense strand may be perfectly complementary to the AAT gene or may be non-complementary to the AAT gene. In some embodiments, the nucleotide at position 1 (5' end 3' end) of the antisense strand is U, A or dT (or a modified form thereof). In some embodiments, the nucleotide at position 1 (5' end 3' end) of the antisense strand forms an A:U or U:A base pair with the sense strand. In some embodiments, the antisense strand of the AAT RNAi agent comprises the nucleotide sequence (5' end 3' end) 2-18 or 2-19 of any one of the antisense strand sequences in Table 2, Table 3 or Table 4. In some embodiments, the sense strand of the AAT RNAi comprises the nucleotide sequence (5' end 3' end) 1-17 or 1-18 of any one of the sense strand sequences in Table 2, Table 3 or Table 5. In some embodiments, the AAT RNAi agent comprises (i) an antisense strand comprising the nucleotide sequence (5' end 3' end) 2-18 or 2-19 of any one of the antisense strand sequences in Table 2, Table 3 or Table 4, and (ii) a sense strand comprising the nucleotide sequence (5' end The sense strand of 1-17 or 1-18 at the 3' end). A sense strand containing a sequence listed in Table 2, Table 3, or Table 5 can hybridize with any antisense strand containing a sequence listed in Table 2, Table 3, or Table 5, provided that the two sequences have at least an 85% complementary region over a 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, the AAT RNAi agent has a sense strand composed of a modified sequence of any one of the modified sequences in Table 5, and an antisense strand composed of a modified sequence of any one of the modified sequences in Table 4. Representative sequence pairs are exemplified by the double helix ID numbers shown in Table 6. In some embodiments, the AAT RNAi agent comprises any duplex represented by any one of the double helix ID numbers provided herein. In some embodiments, the AAT RNAi agent consists of any duplex represented by any one of the double helix ID numbers provided herein. In some embodiments, the AAT RNAi agent comprises the nucleotide sequences of the sense and antisense strands of any duplex represented by any one of the double helix ID numbers provided herein. In some embodiments, the AAT RNAi agent comprises the nucleotide sequences of the sense and antisense strands of any duplex represented by any one of the double helix ID numbers provided herein and a targeting group and / or a linking group, wherein the targeting group and / or the linking group is covalently linked (i.e., bound) to the sense or antisense strand. In some embodiments, the AAT RNAi agent comprises the modified nucleotide sequences of the sense and antisense strands of any duplex represented by any one of the double helix ID numbers provided herein. In some embodiments, the AAT RNAi agent comprises the modified nucleotide sequences of the sense and antisense strands of any duplex represented by any one of the double helix ID numbers provided herein and a targeting group and / or a linking group, wherein the targeting group and / or the linking group is covalently linked to the sense or antisense strand. In some embodiments, the AAT RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any one of the antisense / sense strand duplexes of Table 2, Table 3, or Table 6, and comprises an asialoglycoprotein receptor ligand targeting group.In some embodiments, the AAT RNAi agent includes an antisense strand and a sense strand having a nucleotide sequence of any one of the antisense strand / sense strand double helices of Table 2 or Table 5, and further includes a targeting group selected from the group consisting of: (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39), (NAG39)s. In some embodiments, the targeting group is (NAG25) or (NAG25)s. In other embodiments, the targeting group is (NAG37) or (NAG37)s. In some embodiments, the AAT RNAi agent includes an antisense strand and a sense strand having a modified nucleotide sequence of any one of the antisense strand and / or sense strand nucleotide sequences of any one of the double helices of Table 6. In some embodiments, the AAT RNAi agent includes an antisense strand and a sense strand having a modified nucleotide sequence of any one of the antisense strand and / or sense strand nucleotide sequences of any one of the double helices of Table 6, and includes an asialoglycoprotein receptor ligand targeting group. In some embodiments, the AAT RNAi agent includes the double helix structure of any one of the double helices in Table 6. In some embodiments, the AAT RNAi agent consists of the double helix structure of any one of the double helices in Table 6.. Table 6 . AAT RNAi agents identified by the double helix ID numbers of the corresponding sense and antisense strands. In some embodiments, the AAT RNAi agent is prepared or provided as a salt, mixed salt, or free acid. The RNAi agents described herein inhibit or block the expression of one or more AAT genes in vivo when delivered to cells expressing the AAT gene. Targeting groups, linking groups, and delivery agents In some embodiments, the AAT RNAi agent is conjugated to one or more non-nucleotide groups, including but not limited to, targeting groups, linking groups, delivery polymers, or delivery agents. The non-nucleotide groups can facilitate the targeting, delivery, or attachment of the RNAi agent. Examples of targeting groups and linking groups are provided in Table 7. The non-nucleotide groups can be covalently linked to the 3'-end and / or 5'-end of the sense strand and / or the antisense strand. In some embodiments, the AAT RNAi agent contains a non-nucleotide group linked to the 3'- and / or 5'-end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5'-end of the sense strand of the AAT RNAi agent. The non-nucleotide group can be directly or indirectly linked to the RNAi agent via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker. In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or the conjugate attached thereto to improve the cell-specific or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, the non-nucleotide group increases the endocytosis of the RNAi agent. The targeting group or targeting moiety can enhance the pharmacokinetic or biodistribution properties of the conjugate or RNAi agent to which it is attached to increase the cell-specific distribution and cell-specific uptake of the conjugate or RNAi agent. The targeting group can be monovalent, divalent, trivalent, tetravalent, or have a higher valence for the target to which it is directed. Representative targeting groups include but are not limited to compounds having an affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics having an affinity for cell surface molecules. In some embodiments, a linker such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) groups is used to link the targeting group to the RNAi agent. In some embodiments, the targeting group includes a cluster of galactose derivatives. The AAT RNAi agents described herein can be synthesized to have a reactive group, such as an amine group, at the 5'-terminus. The reactive group can be used to subsequently link the targeting group using methods typical in the art. In some embodiments, the targeting group includes an asialoglycoprotein receptor ligand. In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes galactose and galactose derivatives having an affinity for the asialoglycoprotein receptor equal to or greater than galactose.Galactose derivatives include (but are not limited to): galactose, galactosamine, N-formylgalactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butyryl-galactosamine, and N-isobutyryl galactosamine (see, for example, Iobst, S. T. and Drickamer, K.). J.B.C. 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives that are suitable for in vivo targeting of oligonucleotides and other molecules to the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945). Galactose derivatives have been used for in vivo targeting of molecules to hepatocytes by virtue of their binding to the asialoglycoprotein receptor expressed on the surface of hepatocytes. Binding of an asialoglycoprotein receptor ligand to the asialoglycoprotein receptor promotes cell-specific targeting of hepatocytes and endocytosis of the molecule into hepatocytes. The asialoglycoprotein receptor ligand can be a monomer (e.g., having a single galactose derivative) or a multimer (e.g., having multiple galactose derivatives). The galactose derivative or cluster of galactose derivatives can be linked to the 3' or 5' end of the sense or antisense strand of an RNAi agent using methods known in the art. The preparation of targeting groups such as clusters of galactose derivatives is described, for example, in U.S. Patent Application No. 15 / 452,324 and U.S. Patent Publication No. US 2017 / 0253875, the contents of both of which are incorporated herein by reference in their entirety. As used herein, a cluster of galactose derivatives includes a molecule having two to four terminal galactose derivatives. The terminal galactose derivatives are attached to the molecule via their C-1 carbon. In some embodiments, the cluster of galactose derivatives is a galactose derivative trimer (also referred to as a three-pronged galactose derivative or trivalent galactose derivative). In some embodiments, the cluster of galactose derivatives includes N-acetyl-galactosamine. In some embodiments, the cluster of galactose derivatives includes three N-acetyl-galactosamine. In some embodiments, the cluster of galactose derivatives is a galactose derivative tetramer (also referred to as a four-pronged galactose derivative or tetravalent galactose derivative). In some embodiments, the cluster of galactose derivatives includes four N-acetyl-galactosamine. As used herein, a galactose derivative trimer contains three galactose derivatives each attached to a central branching point. As used herein, a galactose derivative tetramer contains four galactose derivatives each attached to a central branching point. The galactose derivatives can be attached to the central branching point via the C-1 carbon in the sugar. In some embodiments, the galactose derivative is attached to the branching point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer such as a PEG group (see, for example, U.S. Patent No. 5,885,968; Biessen et al., J. Med. Chem. 1995. Vol. 39. pp. 1538-1546). In some embodiments, the PEG spacer is PEG 3Spacer. The branching point can be any small molecule that allows the attachment of three galactose derivatives and further allows the branching point to be attached to an RNAi agent. Examples of branching point groups are di-lysine or di-glutamic acid. The attachment of the branching point to the RNAi agent can occur via a linker or a spacer. In some embodiments, the linker or spacer includes a flexible hydrophilic spacer, such as (but not limited to) a PEG spacer. In some embodiments, the linker includes a rigid linker, such as a cyclic group. In some embodiments, the galactose derivative includes N-acetyl-galactosamine or consists of it. In some embodiments, the galactose derivative cluster includes a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer. In some embodiments, pharmaceutical compositions for in vivo delivery of an AAT RNAi agent to hepatocytes are described. Such pharmaceutical compositions can include, for example, an AAT RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster includes a galactose derivative trimer, which can be, for example, an N-acetyl-galactosamine trimer, or a galactose derivative tetramer, which can be, for example, an N-acetyl-galactosamine tetramer. Targeting groups include (but are not limited to) (PAZ), (NAG13), (NAG13)s, (NAG18), (NAG18)s, (NAG24), (NAG24)s, (NAG25), (NAG25)s, (NAG26), (NAG26)s, (NAG27), (NAG27)s, (NAG28), (NAG28)s, (NAG29), (NAG29)s, (NAG30), (NAG30)s, (NAG31), (NAG31)s, (NAG32), (NAG32)s, (NAG33), (NAG33)s, (NAG34), (NAG34)s, (NAG35), (NAG35)s, (NAG36), (NAG36)s, (NAG37), (NAG37)s, (NAG38), (NAG38)s, (NAG39) and (NAG39)s. Other targeting groups (including galactose cluster targeting ligands) are known in the art. In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates the covalent attachment of the agent to the targeting group or the delivery polymer or delivery vehicle. The linking group can be linked to the 3' or 5' end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is linked to the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' or 3' end of the sense strand of the RNAi agent. In some embodiments, the linking group is conjugated to the 5' end of the sense strand of the RNAi agent. Examples of linking groups include (but are not limited to): reactive groups, such as primary amines and alkynes, alkyl groups, abasic nucleosides, ribitol (abasic ribose) and / or PEG groups.A linker or linking group is a connection between two atoms that covalently attaches one relevant chemical group (such as an RNAi agent) or segment to another relevant chemical group (such as a targeting group or delivery polymer) or segment via one or more covalent bonds. A labile linkage contains a labile bond. The linkage may optionally contain a spacer that increases the distance between the two connected atoms. The spacer may further increase the flexibility and / or length of the linkage. The spacer may include (but is not limited to) alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aralkynyl; each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and saccharides. Spacer groups are well known in the art and the foregoing list is not intended to limit the scope of the invention. Any of the AAT RNAi agent nucleotide sequences listed in Tables 2, 3, 4, or 5, whether modified or unmodified, may contain a 3' or 5' targeting group or linking group. Any of the AAT RNAi agents containing a 3' or 5' targeting group or linking group listed in Table 4 or 5 may alternatively not contain a 3' or 5' targeting group or linking group, or may contain a different 3' or 5' targeting group or linking group, including (but not limited to) those depicted in Table 7. Any of the AAT RNAi agent duplexes listed in Tables 2, 3, or 6, whether modified or unmodified, may further include a targeting group or linking group (including (but not limited to) those depicted in Table 7), and the targeting group or linking group may be attached to the 3' or 5' end of the sense or antisense strand of the AAT RNAi agent duplex. Examples of targeting groups and linking groups are provided in Table 7. Table 5 provides several examples of the sense strand of the AAT RNAi agent having a targeting group or linking group attached to the 5' or 3' end. Table 7. Structures representing various modified nucleotides, targeting groups, and linking groups. In each of the above structures in Table 7, NAG includes N-acetyl-galactosamine or another asialoglycoprotein receptor ligand that one skilled in the art would understand is intended to be attached in view of the above structures and the description provided herein. For example, in some embodiments, NAG in the structures provided in Table 7 is represented by the following structure: (N-acetyl-galactosamine) Each (NAGx) may be linked to the AAT RNAi agent via a phosphate group (such as in (NAG25), (NAG30), and (NAG31)), a phosphorothioate group (such as (NAG25)s, (NAG29)s, (NAG30)s, (NAG31)s, or (NAG37)s), or another linking group. Phosphate ester groups and thiophosphate ester groups may use other linking groups known in the art. Delivery agents In some embodiments, a delivery agent can be used to deliver an RNAi agent to a cell or tissue. A delivery agent is a compound that improves the delivery of an RNAi agent to a cell or tissue. A delivery agent can comprise, but is not limited to, the following or consist of: polymers such as amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines. In some embodiments, the RNAi agent can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPC, or other delivery systems available in the art. The RNAi agent can also be chemically conjugated to targeting groups, lipids (including, but not limited to, cholesterol and cholesterol-based derivatives), nanoparticles, polymers, liposomes, micelles, DPC (see, e.g., WO 2000 / 053722, WO 2008 / 0022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), or other delivery systems available in the art. Pharmaceutical compositions and formulations The AAT RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations. In some embodiments, a pharmaceutical composition comprises at least one AAT RNAi agent. These pharmaceutical compositions are particularly suitable for inhibiting the expression of a target mRNA in a target cell, cell population, tissue, or organism. The pharmaceutical composition can be used to treat an individual suffering from a disease or disorder that would benefit from a reduction in the level of the target mRNA or inhibition of the expression of the target gene. The pharmaceutical composition can be used to treat an individual at risk of developing a disease or disorder that would benefit from a reduction in the level of the target mRNA or inhibition of the expression of the target gene. In one embodiment, the method comprises administering to an individual to be treated an AAT RNAi agent linked to a targeting ligand as described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising an AAT RNAi agent, thereby forming a drug formulation suitable for in vivo delivery to an individual, including a human. The pharmaceutical compositions and methods disclosed herein that comprise an AAT RNAi agent can reduce the level of a target mRNA in a cell, cell population, tissue, or individual, including administering to the individual a therapeutically effective amount of the AAT RNAi agent described herein, thereby inhibiting the expression of AAT mRNA in the individual. In some embodiments, the individual has previously been identified as having a pathogenic upregulation of the target gene in the target cell or tissue. In some embodiments, the pharmaceutical composition comprising the AAT RNAi agent is used to treat or manage the clinical manifestations associated with AATD.In some embodiments, one or more pharmaceutical compositions in a therapeutically effective amount are administered to an individual in need of such treatment, prevention, or management. In some embodiments, administration of any of the disclosed AAT RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in an individual. The pharmaceutical composition comprising the AAT RNAi agent can be used to treat at least one symptom of an individual suffering from a disease or disorder that would benefit from reducing or inhibiting AAT mRNA expression. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions comprising the AAT RNAi agent is administered to an individual, thereby treating the symptom. In other embodiments, a prophylactically effective amount of one or more AAT RNAi agents is administered to an individual, thereby preventing at least one symptom. The route of administration is the route by which the AAT RNAi agent comes into contact with the body. Generally, methods of administering drugs and nucleic acids for treating mammals are well known in the art and can be applied to the administration of the compositions described herein. The AAT RNAi agents disclosed herein can be administered via any suitable route in a formulation appropriately customized for the particular route. Thus, the pharmaceutical compositions described herein can be administered by injection (e.g., intravenous, intramuscular, intradermal, subcutaneous, intra-articular, or intraperitoneal). In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection. The pharmaceutical compositions comprising the AAT RNAi agents described herein can be delivered to cells, cell populations, tissues, or individuals using oligonucleotide delivery techniques known in the art. Generally, any suitable method recognized in the art for delivering nucleic acid molecules (in vitro or in vivo) can be suitable for use with the compositions described herein. For example, delivery can be achieved by topical administration (e.g., direct injection, implantation, or surface administration), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intracerebral, and intrathecal), intramuscular, transdermal, respiratory (aerosol), nasal, oral, rectal, or surface (including buccal and sublingual) administration. In certain embodiments, the composition is administered by subcutaneous or intravenous infusion or injection. Thus, in some embodiments, the pharmaceutical compositions described herein can include one or more pharmaceutically acceptable excipients. In some embodiments, the pharmaceutical compositions described herein can be formulated for administration to an individual. As used herein, a pharmaceutical composition or agent comprises a pharmacologically effective amount of at least one of the described AAT RNAi agents and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance deliberately included in a drug delivery system in addition to the active pharmaceutical ingredient (API, therapeutic product, e.g., an AAT RNAi agent). Excipients do not exert or are not intended to exert a therapeutic effect at the intended dosage.Excipients can be used for a) assisting in the processing of drug delivery systems during manufacture, b) protecting, supporting, or enhancing the stability, bioavailability, or patient acceptability of the API, c) facilitating product identification, and / or d) enhancing any other properties of the overall safety and efficacy of API delivery during storage or use. Pharmaceutically acceptable excipients may or may not be inert substances. Excipients include (but are not limited to): absorption enhancers, anti-adhesives, anti-foaming agents, antioxidants, binders, buffers, carriers, coating agents, pigments, delivery enhancers, polydextrose, dextrose, diluents, disintegrants, emulsifiers, extenders, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, physiological saline, salts, solvents, sugars, suspending agents, sustained-release matrices, sweetening agents, thickening agents, tonicity agents, vehicles, water repellents, and wetting agents. Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where soluble in water) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, N.J.), or phosphate-buffered saline (PBS). It should be stable under manufacturing and storage conditions and should protect it from the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (such as glycerol, propylene glycol, and liquid polyethylene glycol) and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by using coatings such as lecithin, by maintaining the required particle size in the case of dispersions, and by using surfactants. In many cases, isotonic agents such as sugars, polyols (such as mannitol, sorbitol), and sodium chloride will preferably be included in the composition. Extended absorption of injectable compositions can be achieved by including agents that delay absorption (such as aluminum monostearate and gelatin) in the composition. Sterile injectable solutions can be prepared by incorporating the required amount of the active compound into a suitable solvent with one or a combination of the ingredients listed above, followed by filtration sterilization as required. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the required other ingredients of those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preparation methods include vacuum drying and freeze-drying, which yield a powder of the active ingredient plus any other required ingredients from its previously sterile filtered solution. Formulations suitable for intra-articular administration can be in the form of a sterile aqueous preparation of the drug, which can be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Lipid formulations or biodegradable polymer systems can also be used to deliver the drug for intra-articular and ophthalmic administration. The active compounds can be prepared with carriers that will prevent the compound from being rapidly eliminated from the body, such as controlled-release formulations, including implants and microencapsulation delivery systems.Biodegradable and biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be apparent to those of ordinary skill in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These substances can be prepared according to methods known to those of ordinary skill in the art, such as those described in U.S. Patent No. 4,522,811. The AAT RNAi agent can be formulated in the composition in unit dosage form for ease of administration and uniform dosing. A unit dosage form refers to a physically discrete unit suitable as a single dose for the individual to be treated; each unit contains a predetermined amount of the active compound combined with the required pharmaceutical carrier, calculated to produce the desired therapeutic effect. The specifications of the unit dosage forms of the present invention are defined by and directly depend on the unique characteristics of the active compound and the therapeutic effect to be achieved, as well as the limitations inherent in the art of compounding such active compounds for treating individuals. The pharmaceutical composition can contain other additional components commonly found in pharmaceutical compositions. Such additional components include (but are not limited to): antipruritics, astringents, local anesthetics, or anti-inflammatory agents (such as antihistamines, diphenhydramine, etc.). It is also contemplated that cells, tissues, or isolated organs expressing or including the RNAi agent as defined herein can be used as a "pharmaceutical composition". As used herein, "pharmacologically effective amount", "therapeutically effective amount", or simply "effective amount" refers to the amount of the RNAi agent that can produce a pharmacological, therapeutic, or prophylactic result. Generally, an effective amount of the active compound will be in the range of about 0.1 to about 100 mg / kg body weight / day, such as about 1.0 to about 50 mg / kg body weight / day. In some embodiments, the effective amount of the active compound will be in the range of about 0.25 to about 5 mg / kg body weight per dose. In some embodiments, the effective amount of the active ingredient will be in the range of about 0.5 to about 4 mg / kg body weight per dose. The dosage can also depend on variables such as the overall health of the patient, the relative biological efficacy of the compound being delivered, the formulation of the drug, the presence and type of excipients in the formulation, and the route of administration. In addition, it should be understood that the initial dose administered can be increased beyond the above upper limit to rapidly achieve the desired blood or tissue level, or the initial dose can be less than the optimal value. For treating a disease or forming an agent or composition for treating a disease, the pharmaceutical composition comprising the AAT RNAi agent described herein can be combined with an excipient or a second therapeutic agent or treatment combination, including (but not limited to): a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer. When added to a pharmaceutically acceptable excipient or adjuvant, the described AAT RNAi agent can be packaged in a kit, container, packet, or dispenser. The pharmaceutical composition described herein can be packaged in a pre-filled syringe or vial.Therapeutic Methods and Expression Suppression The AAT RNAi agents disclosed herein can be used to treat an individual (e.g., a human or other mammal) suffering from a disease or disorder that would benefit from administration of the compound. In some embodiments, the RNAi agents disclosed herein can be used to treat an individual (e.g., a human) suffering from a disease or disorder that would benefit from reducing or suppressing AAT mRNA expression. Administer to the individual a therapeutically effective amount of any one or more of the AAT RNAi agents described herein. The individual can be a human, a patient, or a human patient. The individual can be an adult, a youth, a child, or an infant. The described pharmaceutical compositions comprising the AAT RNAi agent can be used to provide a method for therapeutically treating a disease. Such methods comprise administering to a human or an animal the pharmaceutical composition described herein. In some embodiments, the AAT RNAi agents described herein are used to treat an individual suffering from an AAT-related disease or disorder. "AAT-related disease or disorder" refers to a condition, disease, or disorder in which the level of AAT expression is altered or elevated and the increased level of AAT expression is associated with an increased risk of developing a condition, disease, or disorder. AAT-related diseases or disorders include (but are not limited to) chronic hepatitis, cirrhosis, hepatocellular carcinoma, elevated transaminases, cholestasis, fibrosis, and even fulminant liver failure. In some embodiments, the described AAT RNAi agents are used to treat at least one symptom of an individual suffering from an AAT-related disease or disorder. Administer to the individual a therapeutically effective amount of any one or more of the described RNAi agents. In some embodiments, the AAT RNAi agent is used to treat or manage the clinical manifestations of an individual suffering from an AAT-related disease or disorder. Administer to the individual a therapeutically effective amount of one or more of the AAT RNAi agents described herein or a composition comprising the AAT RNAi agent. In some embodiments, the method comprises administering to the individual to be treated a composition comprising the AAT RNAi agent described herein. In some embodiments, relative to the individual before administration of the AAT RNAi agent or an individual not receiving the AAT RNAi agent, the degree of gene expression and / or mRNA content of the AAT gene in the individual administered the described AAT RNAi agent is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or more than 99%. In the cells, cell populations, and / or tissues of the individual, the degree of gene expression and / or mRNA content of the individual can be reduced.In some embodiments, relative to an individual before administration of an AAT RNAi agent or an individual not receiving an AAT RNAi agent, the AAT protein content of an individual to whom the described AAT RNAi agent has been administered is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more than 99%. In the cells, cell populations, tissues, blood and / or other body fluids of an individual, the protein content of the individual can be reduced. The reduction in gene expression, mRNA or protein content can be assessed by any method known in the art. The reduction or decrease in AAT mRNA content and / or protein content is collectively referred to herein as the reduction or decrease or inhibition of AAT or the reduction of AAT expression. Cells, tissues and non-human organisms encompass cells, tissues and non-human organisms comprising at least one AAT RNAi agent described herein. Cells, tissues or non-human organisms are produced by delivering the RNAi agent to the cells, tissues or non-human organisms. The embodiments and items provided above are now illustrated by the following non-limiting examples. Example Example 1 . Identification RNAi Agent Sequences and Synthesis RNAi Agent The selection method for identifying a leading sequence for inhibiting AAT gene expression begins with an in silico hybridization method to identify conserved sequences of AAT gene (SEQ ID NO: 1) variants. Initially, AAT sequences were screened using bioinformatics for sequences of 19 nucleotides that have complementary sequences among known variants of human AAT. Sequences known to have manufacturing difficulties and sequences predicted to have poor RNAi activity based on known parameters were eliminated. Then, cross-species reactivity analysis of the sequences was performed to select candidates that would cross-react with cynomolgus monkey AAT. The specificity of the sequences was also evaluated to avoid off-target effects against the human and cynomolgus monkey genomes. One hundred fifteen (115) sequence families of 19-mers were selected as potential candidates. The synthesis procedure for the AAT RNAi agents disclosed herein is briefly described below: Synthesis. The sense and antisense strands of the AAT RNAi agent were synthesized according to the phosphoramidite technology on a solid support used in oligonucleotide synthesis. Depending on the scale, MerMade96E® (Bioautomation) or MerMade12® (Bioautomation) was used. The synthesis was carried out on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the following 2'-O-methyl phosphoramidites were used: (5'-O-dimethoxytrityl-N 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5'-O-dimethoxytrityl-N 2-(Isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)aminophosphate and 5'-O-dimethoxy-trityl-2'-O-methyluridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)aminophosphate. The 2'-deoxy-2'-fluoro-aminophosphate bears the same protecting groups as the 2'-O-methyl RNA amino acid ester. The following UNA aminophosphates were used: 5'-(4,4'-dimethoxytrityl)-N-benzoyl-2',3'-cyclic adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-aminophosphate, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-cyclic cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-aminophosphate, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-cyclic guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-aminophosphate and 5'-(4,4'-dimethoxy-trityl)-2',3'-cyclic uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-aminophosphate. The targeting ligands containing aminophosphates were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while all other amino acid esters were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-Benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. The coupling times were 10 minutes (RNA), 15 minutes (targeting ligand), 90 seconds (2'OMe) and 60 seconds (2'F). To introduce phosphorothioate bonds, a 100 mM solution of 3-phenyl-1,2,4-dithiazolidin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. Cleavage and Deprotection of the Carrier-Bound Oligomers . After completion of the solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% aqueous methylamine and 28% ammonium hydroxide solution (Aldrich) at 30 °C for two hours. The solution was evaporated and the solid residue was resuspended in water (see below). Purification. The crude oligomer was purified by anion-exchange HPLC using a TKSgel SuperQ-5PW 13u column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0 and contained 20% acetonitrile, and buffer B was the same as buffer A with the addition of 1.5 M sodium chloride. UV traces were recorded at 260 nm. Subsequently, the appropriate elution fractions were run on size-exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G25 medium, with an operating buffer of 100 mM ammonium bicarbonate (pH 6.7) and 20% acetonitrile. Adhesion . Complementary strands were mixed to form RNAi agents by combining equimolar RNA solutions (sense and antisense strands) in 0.2× PBS (phosphate buffered saline, 1×, Corning, Cellgro). The solution was placed in a 70 °C thermal mixer, heated to 95 °C, held at 95 °C for 5 minutes and slowly cooled to room temperature. Some RNAi agents were lyophilized and stored at -15 to -25 °C. The duplex concentration was determined by measuring the absorbance of the solution in 0.2× PBS using a UV-Vis spectrometer. Subsequently, the absorbance of the solution at 260 nm was multiplied by the conversion factor and the dilution factor to determine the duplex concentration. Unless otherwise specified, all conversion factors were 0.037 mg / (mL∙cm). For some experiments, the conversion factor was calculated using the experimentally determined extinction coefficient. Examples 2 . AAT RNAi In vitro testing of agents. The duplexes of the candidate sequences were tested in vitro. The antisense strand sequence and the sense strand sequence were annealed to form duplexes of 21-mer strands (with 19 base pairs and dinucleotide UU overhangs at each 3' end) for in vitro testing, as shown in Table 8 below: Table 8 . Sequences of the AAT RNAi agents in Example 2. The evaluation of AAT RNAi agents was carried out by transfecting human hepatocellular carcinoma cell line Hep3B cells. The cells were plated at approximately 10,000 cells / well in a 96-well format and each of the 115 AAT RNAi agent duplexes was transfected at three concentrations (10 nM, 1 nM, and 0.1 nM) using the LipoFectamine RNAiMax (Thermo Fisher) transfection reagent. As shown in Table 9, by comparing the expression levels of AAT mRNA with that of an endogenous control group and normalizing to untreated Hep3B cells (ΔΔC T analysis), the relative expression of each of the 115 AAT RNAi agents was determined by qR T -PCR. Table 9. In vitro data for candidate duplexes from Example 2. Example 3 . PiZ in mice NAG binding AAT RNAi in vivo testing of agents Evaluate RNAi agents in vivo using a transgenic PiZ mouse model (PiZ mice). PiZ mice carry the human PiZ AAT mutant allele and model human AATD (Carlson et al., Journal of Clinical Investigation 1989). NAG-conjugated AAT RNAi agents are prepared in a pharmaceutically acceptable saline buffer and administered to PiZ mice to assess gene expression blockade of AAT gene expression. On day 1, each mouse received a single subcutaneous (SQ) administration of 5.0 mg / kg (mpk) of any one of the following at the loose back skin between the shoulders: AD04446, AD04447, AD04448, AD04449, AD04450, AD04451, AD04454, AD04455, AD04456, AD04457, AD04458, or AD04459. (See Tables 4-7 for modified AAT RNAi agents and NAG ligand structures). AAT RNAi agents AD04451 and AD04459 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1000; AAT RNAi agents AD04446 and AD04454 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1142; AAT RNAi agents AD04447 and AD04455 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1211; AAT RNAi agents AD04448 and AD04456 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1326; AAT RNAi agents AD04449 and AD04457 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1338; and AAT RNAi agents AD04450 and AD04458 contain modified nucleotide antisense strand sequences designed to target the AAT gene (SEQ ID NO: 1) at position 1427. (See also Tables 1 and 2). Three mice were given each AAT RNAi agent (n = 3). Plasma samples were drawn and the AAT (Z-AAT) protein content was analyzed on day 1 (before dosing), day 8, day 15, day 22, day 29, and day 36. The AAT content was normalized according to the AAT plasma content on day 1 (before dosing). Protein content was measured by quantifying the circulating human Z-AAT content in plasma using an ELISA kit.The average normalized AAT (Z-AAT) content of each RNAi agent is reported in Table 10 below:. Table 10 . Average normalized AAT protein from Example 3 (normalized according to pre-treatment). As shown in the data in Table 10 above, although the AAT RNAi agent AD04447 showed substantially no reduction in AAT protein, the AAT RNAi agents AD04458 (which contains a modified nucleotide sequence designed to target the AAT gene (SEQ ID NO: 1) at position 1427) and AD04459 (which contains a modified nucleotide sequence designed to target the AAT gene (SEQ ID NO: 1) at position 1000) showed a significant reduction in AAT protein at all time points. For example, AD04458 showed approximately 69% gene expression blockade (0.308) on day 8; approximately 83% (0.174) on day 15, and approximately 82% (0.177) on day 22. Additionally, for example, AD04459 showed approximately 74% gene expression blockade (0.256) on day 8; approximately 87% (0.134) on day 15, and approximately 83% (0.174) on day 22. Example 4 . In cynomolgus monkeys NAG Bound AAT RNAi In Vivo Testing of Agents. Prepare AAT RNAi agents that bind to NAG and incorporate them in a pharmaceutically acceptable saline buffer known in the art for subcutaneous (SC) injection. On Day 1, cynomolgus monkeys (Macaca fascicularis) (referred to herein as "cyno" or "monkey") are subcutaneously injected with any one of 3 mg / kg of AD04824, AD04825, AD04826, or AD04827. (See Tables 4-7 for modified AAT RNAi agents and NAG ligand structures). Each of these AAT RNAi agents contains a modified nucleotide sequence designed to target the AAT gene at position 1000 (SEQ ID NO: 1) and is cross-reactive with cyno. Three monkeys are tested per group (n = 3). Serum samples are taken from the treated cynomolgus monkeys on Day -7 and Day 1 (before dosing) and on Days 8, 15, 22, and 29 to monitor gene expression blockade. On Day 36, measurements are also taken on cynos injected with AD04825 and AD04826. At the designated time points, blood samples are drawn and cynomolgus monkey AAT (cAAT) is analyzed. Blood is collected from the femoral vein. The cAAT content is determined on a Cobas Integra 400 Plus (Roche Diagnostics) according to the manufacturer's recommendations. The AAT content of each animal at the corresponding time point is divided by the degree of pre-treatment expression of that animal (the average of Day -7 and Day 1 (before dosing)) to determine the "normalized according to pre-dose" expression ratio. The average normalized cynomolgus monkey AAT (cAAT) protein content after treatment with each corresponding AAT RNAi agent is reported in Table 11 below: Table 11 . Average normalized cAAT protein (normalized according to pre-treatment) from cynomolgus monkeys of Example 4. The average normalized cAAT content for each of the corresponding treatment groups is shown in the bar graph of Figure 9. As shown in Table 11 and Figure 9 above, each of the tested AAT RNAi agents shows substantial gene expression blockade of cAAT in cynomolgus monkeys at all measured time points. Example 5 . In cynomolgus monkeys NAG Binding AAT RNAi In Vivo Testing of Agents. Prepare AAT RNAi agents that bind NAG and incorporate them in a pharmaceutically acceptable saline buffer known in the art for subcutaneous (SC) injection. On Day 1, inject 3 mg / kg of AD04828, AD04831, AD04836, or AD04837 subcutaneously into cynomolgus monkey (Macaca fascicularis) primates. (See Table 4-7 for modified AAT RNAi agents and NAG ligand structures). Each of these AAT RNAi agents contains a modified nucleotide sequence designed to target the AAT gene (SEQ ID NO: 1) at position 1000 and is cross-reactive with cyno. Three monkeys per group were tested for AD04828 and AD04831 (n = 3), and two monkeys per group were tested for AD04836 and AD04837 (n = 2). Serum samples were taken from the treated cynos on Day -35 and Day 1 (before dosing) and on Days 8, 15, 21, and 29 to monitor gene expression blockade. At the designated time points, blood samples were taken and cAAT was analyzed. Blood was collected from the femoral vein. The cAAT content was determined on a Cobas Integra 400 Plus (Roche Diagnostics) according to the manufacturer's recommendations. The cAAT content of each animal at the corresponding time point was divided by the pre-treatment expression level (average of Day -35 and Day 1 (before dosing)) of that animal to determine the "normalized according to pre-dose" expression ratio. The average normalized cynomolgus monkey AAT (cAAT) protein content after treatment with each corresponding AAT RNAi agent is reported in Table 12 below: Table 12 . Mean normalized AAT protein (normalized according to pre-treatment) from cynomolgus monkeys of Example 5. The mean normalized cAAT content for each of the corresponding treatment groups is shown in the bar graph of Figure 10. Each of the AAT RNAi agents tested showed substantial gene expression blockade of cAAT in cynomolgus monkeys at all measurement time points. Example 6 . PiZ in mice NAG binding AAT RNAi In Vivo Testing of Agents. The AAT RNAi agents were evaluated in vivo using the transgenic PiZ mouse model (PiZ mice) described in Example 3. The NAG-conjugated AAT RNAi agents were prepared in a pharmaceutically acceptable saline buffer and administered to PiZ mice to evaluate gene expression blockade of AAT gene expression. On Day 1, each mouse received a single subcutaneous (SQ) administration of 2.0 mg / kg (mpk) of any one of the following at the loose back skin between the shoulders: AD04824, AD04828, AD04829, AD04830, AD04831, AD04832, AD04833, AD04834, AD04836, AD04837, AD04838, AD04839, or AD04857. (See Tables 4-7 for the modified AAT RNAi agents and NAG ligand structures). Each of the AAT RNAi agents in this study contained a modified nucleotide antisense strand sequence designed to target the AAT gene at position 1000 (SEQ ID NO: 1). (See also Tables 1 and 2). Three mice were given each AAT RNAi agent (n = 3). Plasma samples were drawn and the AAT (Z-AAT) protein content was analyzed on Day -2, Day 1 (before dosing), Day 8, Day 15, Day 22, Day 29, and Day 36. The AAT content was normalized according to the AAT plasma content on Day 1 (before dosing). The protein content was measured by quantifying the circulating human Z-AAT content in plasma using an ELISA kit. The mean normalized AAT (Z-AAT) content for each RNAi agent is reported in Table 13 below: Table 13 . Mean normalized AAT protein from Example 6 (normalized according to pre-treatment). As shown from the data in Table 13 above, each of the AAT RNAi agents showed a substantial reduction in AAT protein up to at least Day 29. For example, on Day 15, each of the tested AAT RNAi agents achieved at least about 70% protein gene expression blockade compared to the pre-treatment level, with multiple groups achieving 90% or better gene expression blockade. Example 7 . PiZ mice NAG -conjugated AAT RNAi In vivo testing of agents using the transgenic PiZ mouse model described in Example 3 Each mouse was 5 weeks old at the start of the study. From day 1 onwards, each mouse received a subcutaneous (SQ) dose of q2w (i.e., biweekly injections for a total of 4 injections) of 4.0 mg / kg (mpk) of any of the following AT RNAi agents comprising modified nucleotide antisense strand sequences designed to target the AAT gene at position 1000 (SEQ ID NO: 1); Single subcutaneous injection in the RNAi agent group Seven (7) mice were administered with saline aqueous medium for q2w (group 1); RNAi agent administration (group 3) (Z-AAT) Protein content was taken at day 43, day 50, and day 57. The AAT content was normalized according to the AAT plasma content on day 1 (before administration). table 14. Mean standardized AAT protein from instance 7 (normalized according to pretreatment). As shown in the data in Table 14 above, the HBV RNAi agent was successfully carried out as a negative control, showing substantially no AAT inhibition. In addition, compared with the physiological saline and the HBV RNAi agent negative control at all time points, the AAT RNAi agent achieved significant gene expression blockade. When administered q2w, the AAT RNAi agent in Example 7 showed approximately 96% AAT protein gene expression blockade (0.040) on day 36 and maintained a similar level of blocked gene expression until day 57. In addition to monitoring serum AAT levels, further analysis of homogenized liver tissue from PiZ mice treated with the AAT RNAi agent was performed to determine whether soluble Z-AAT (which is expected to be mainly monomeric protein) and insoluble polymers of Z-AAT (which are expected to be polymeric proteins) were effectively reduced. As previously described (Mueller et al. Molecular Therapy 2012), soluble and insoluble Z-AAT fractions were separated under non-denaturing conditions using a modified Western blot protocol. Western blots were prepared to examine the livers of certain sacrificed mice. Specifically, the livers of (i) 6 baseline mice; (ii) 5 AAT RNAi agent mice; and (iii) 4 physiological saline mice were examined. (The gels used for Western blot analysis contained 15 wells). The animal samples used for this Western blot were randomly selected from multiple groups. Figures 11 and 12 show bar graphs reflecting the Z-AAT polymer and Z-AAT monomer content quantified from Western blot analysis. As seen in Figure 11 reporting the monomer protein content, each mouse given the AAT RNAi agent showed a significant decrease in AAT monomer protein at all time points compared to the baseline, indicating significant gene inhibition. Additionally, as shown in Figure 12 reporting the polymeric protein content, animals treated with the physiological saline vehicle continued to have an increased polymeric AAT load after 8 weeks. In contrast, animals treated with the AAT RNAi agent showed a ~50% decrease in polymeric load over the course of 8 weeks compared to baseline (5-week-old) mice, indicating that the AAR RNAi agent was able to prevent and potentially reverse the production of polymeric AAT protein. Example 8 . PiZ in mice NAG bound AAT RNAi In Vivo Testing of Agents To evaluate RNAi agents in vivo, the transgenic PiZ mouse model described in Example 3 was used. Each mouse received a single subcutaneous (SQ) dose of any of the following on Day 1 at the loose back skin between the shoulders: (1) physiological saline; (2) 1.0 mg / kg of the AAT RNAi agent used in Example 5, which contains a modified nucleotide antisense strand sequence designed to target the AAT gene (SEQ ID NO: 1) at position 1000; (3) 2.0 mg / kg of the AAT RNAi agent used in Example 5, which contains a modified nucleotide antisense strand sequence designed to target the AAT gene (SEQ ID NO: 1) at position 1000; (4) 4.0 mg / kg of the AAT RNAi agent used in Example 5, which contains a modified nucleotide antisense strand sequence designed to target the AAT gene (SEQ ID NO: 1) at position 1000; or (5) 8.0 mg / kg of the AAT RNAi agent used in Example 5, which contains a modified nucleotide antisense strand sequence designed to target the AAT gene (SEQ ID NO: 1) at position 1000. Four (4) animals in Group 1 were dosed (with physiological saline), and all four were sacrificed on Day 43. Fifteen (15) animals in each of Groups 2, 3, 4, and 5 were dosed, and 3 animals from each group were sacrificed on Days 8, 15, 22, 29, and 43. Plasma samples were drawn and the AAT (Z-AAT) protein content of all groups was analyzed on Day 1 (before dosing), Days 8, 15, 22, 29, 36, and 43. For the sacrificed mice, serum was separated from the heart bar for Z-AAT protein content determination (200 μl plasma). The AAT content was normalized according to the AAT plasma content on Day 1 (before dosing). The protein content was measured by quantifying the circulating human Z-AAT content in plasma using an ELISA kit. The mean normalized AAT (Z-AAT) content of the physiological saline vehicle and each RNAi agent is reported in the table below: Table 15 . Mean normalized plasma AAT protein from Example 8 (normalized according to pre-treatment). As shown in the data in Table 15 above, compared with physiological saline at all measurement time points, the tested AAT RNAi agents achieved significant gene expression blockade. In addition, the AAT mRNA content of the mice sacrificed at each corresponding time point was also evaluated. As described above, for Groups 2 to 5 (i.e., the RNAi agent groups), 3 mice were sacrificed each day on Days 8, 15, 22, 29, and 43; for Group 1, all 4 mice were sacrificed on Day 43. Half of the left hepatic lobe was collected and snap-frozen in liquid nitrogen for RNA isolation. Table 16 . Relative AAT mRNA content in PiZ mice after a single SQ injection of physiological saline or AAT RNAi agent. As shown in Table 16 above, compared with the physiological saline vehicle, the relative AAT mRNA expression levels at all measurement time points were significantly reduced. For example, on Day 15, Group 2 (1.0 mg / kg AAT RNAi agent) showed a decrease in AAT mRNA content of approximately 58% (0.419); Group 3 (2.0 mg / kg AAT RNAi agent) showed a decrease in AAT mRNA content of approximately 67% (0.327); Group 4 (4.0 mg / kg AAT RNAi agent) showed a decrease in AAT mRNA content of approximately 84% (0.161); and Group 5 (8.0 mg / kg AAT RNAi agent) showed a decrease in Z-AAT mRNA content of approximately 94% (0.055) at Day 1 with a single SQ dose. Other embodiments should be understood that although the present invention has been described in connection with its embodiments, the foregoing description is intended to illustrate and not limit the scope of the present invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims. Figure 1 shows the chemical double helix structure of AD04828 shown as the sodium salt. Figure 2 shows the chemical double helix structure of AD04828 shown as the free acid. Figure 3 shows the chemical double helix structure of AD04831 shown as the sodium salt. Figure 4 shows the chemical double helix structure of AD04831 shown as the free acid. Figure 5 shows the chemical double helix structure of AD04836 shown as the sodium salt. Figure 6 represents the chemical double helix structure of AD04836 shown as the free acid. Figure 7 represents the chemical double helix structure of AD04837 shown as the sodium salt. Figure 8 represents the chemical double helix structure of AD04837 shown as the free acid. Figure Figure 9 is a bar graph showing the mean normalized cyno AAT (cAAT) serum levels in cynomolgus monkeys (cyno) (n = 3) after single subcutaneous administration of 3 mg / kg of any one of AD04824, AD04825, AD04826, or AD04827 according to Example 4. The AAT serum levels were normalized to the pre-treatment mean. Experimental error is shown as standard deviation. Figure Figure 10 is a bar graph showing the mean normalized cAAT serum levels in cynos (n = 2 or n = 3) after single subcutaneous administration of 3 mg / kg of any one of AD04828, AD04836, AD04831, or AD04837 according to Example 5. The AAT serum levels were normalized to the pre-treatment mean. Experimental error is shown as standard deviation. Figure Figure 11 is a bar graph showing the results of Western blot analysis of the soluble fraction (Z-AAT monomer) of the liver from PiZ mice dosed with saline or an AAT RNAi agent (dosed for 8 weeks, q2w, normalized to the baseline control group) according to Example 7. Individual mouse measurement results are shown grouped by treatment, and experimental error is shown as standard deviation. Figure Figure 12 is a bar graph showing the results of Western blot analysis of the insoluble fraction (Z-AAT monomer) of the liver from PiZ mice dosed with saline or an AAT RNAi agent according to Example 7. Individual mouse measurement results are shown grouped by treatment, and experimental error is shown as standard deviation. <![CDATA[<110> Arrowhead Pharmaceuticals, Inc.]]> <![CDATA[<120> Alpha-1 Antitrypsin (AAT) RNAi Agent, Composition Comprising the AAT RNAi Agent, and Method of Use]]> <![CDATA[<130> 30650]]>-WO1 <![CDATA[<140> ]]> <![CDATA[<141> ]]> <![CDATA[<150> US 62 / 444,452]]> <![CDATA[<151> 2017-01-10]]> <![CDATA[<150> US 62 / 486,720]]> <![CDATA[<151> 2017-04-18]]> <![CDATA[<150> US 62 / 596,232]]> <![CDATA[<151> 2017-12-08]]> <![CDATA[<160> 1275]]> <![CDATA[<210> 1]]> <![CDATA[<211> 3220]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Homo sapiens serine protease inhibitor family A member 1 (SERPINA1), transcript variant 1, complete gene (NM_000295.4)]]> <![CDATA[<400> 1]]> acaatgactc ctttcggtaa gtgcagtgga agctgtacac tgcccaggca aagcgtccgg 60 gcagcgtagg cgggcgactc agatcccagc cagtggactt agcccctgtt tgctcctccg 120 ataactgggg tgaccttggt taatattcac cagcagcctc ccccgttgcc cctctggatc 180 cactgcttaa atacggacga ggacagggcc ctgtctcctc agcttcaggc accaccactg 240 acctgggaca gtgaatcgac aatgccgtct tctgtctcgt ggggcatcct cctgctggca 300 ggcctgtgct gcctggtccc tgtctccctg gctgaggatc cccagggaga tgctgcccag 360 aagacagata catcccacca tgatcaggat cacccaacct tcaacaagat cacccccaac 420 ctggctgagt tcgccttcag cctataccgc cagctggcac accagtccaa cagcaccaat 480 atcttcttct ccccagtgag catcgctaca gcctttgcaa tgctctccct ggggaccaag 540 gctgacactc acgatgaaat cctggagggc ctgaatttca acctcacgga gattccggag 600 gctcagatcc atgaaggctt ccaggaactc ctccgtaccc tcaaccagcc agacagccag 660 ctccagctga ccaccggcaa tggcctgttc ctcagcgagg gcctgaagct agtggataag 720 tttttggagg atgttaaaaa gttgtaccac tcagaagcct tcactgtcaa cttcggggac 780 accgaagagg ccaagaaaca gatcaacgat tacgtggaga agggtactca agggaaaatt 840 gtggatttgg tcaaggagct tgacagagac acagtttttg ctctggtgaa ttacatcttc 900 tttaaaggca aatgggagag accctttgaa gtcaaggaca ccgaggaaga ggacttccac 960 gtggaccagg tgaccaccgt gaaggtgcct atgatgaagc gtttaggcat gtttaacatc 1020 cagcactgta agaagctgtc cagctgggtg ctgctgatga aatacctggg caatgccacc gccatcttct tcctgcctga tgaggggaa ctacagcacc tggaaaatga actcacccac gatatcatca ccaagttcct ggaaatgaa gacagaaggt ctgccagctt acatttaccc 1260. aaactgtcca ttactggaac ctatgatctg aagagcgtcc tgggtcaact gggcatcact aaggtcttca gcaatggggc tgacctctcc ggggtcacag aggaggcacc cctgaagctc tccaaggccg tgcataaggc tgtgctgacc atcgacgaga aagggactga agctgctggg 1380 gccatgtttt tagaggccat acccatgtct atcccccccg aggtcaagtt caacaaaccc tttgtcttct tttgtctga acaaaatacc aagtctcccc tcttcatggg aaaagtggtg aatcccaccc aaaaataact gcctctcgct cctcaacccc tcccctccat ccctggcccc 1560 ctccctggat gacattaaag aagggttgag ctggtccctg cctgcatgtg actgtaaatc cctcccatgt tttctctgag tctccctttg cctgctgagg ctgtatgtgg gctccaggta 1680 acagtgctgt cttcggggccc cctgaactgt gttcatggag catctggctg ggtaggcaca 1740. tgctgggctt gaatccaggg gggactgaat cctcagctta cggacctggg cccatctgtt 1800 tctggagggc tccagtcttc cttgtcctgt cttggagtcc ccaagaagga atcacagggg 1860 aggaaccaga taccagccat gaccccaggc tccaccaagc atcttcatgt ccccctgctc 1920 atcccccact cccccccacc cagagttgct catcctgcca gggctggctg tgcccacccc 1980 aaggctgccc tcctgggggc cccagaactg cctgatcgtg ccgtggccca gttttgtggc 2040 atctgcagca acacaagaga gaggacaatg tcctcctctt gacccgctgt cacctaacca 2100 gactcgggcc ctgcacctct caggcacttc tggaaaatga ctgaggcaga ttcttcctga 2160 agcccattct ccatggggca acaaggacac ctattctgtc cttgtccttc catcgctgcc 2220 ccagaaagcc tcacatatct ccgtttagaa tcaggtccct tctccccaga tgaagaggag 2280 ggtctctgct ttgttttctc tatctcctcc tcagacttga ccaggcccag caggccccag 2340 aagaccatta ccctatatcc cttctcctcc ctagtcacat ggccataggc ctgctgatgg 2400 ctcaggaagg ccattgcaag gactcctcag ctatgggaga ggaagcacat cacccattga 2460 cccccgcaac ccctcccttt cctcctctga gtcccgactg gggccacatg cagcctgact 2520 tctttgtgcc tgttgctgtc cctgcagtct tcagagggcc accgcagctc cagtgccacg 2580 gcaggaggct gttcctgaat agcccctgtg gtaagggcca ggagagtcct tccatcctcc 2640 aaggccctgc taaaggacac agcagccagg aagtcccctg ggcccctagc tgaaggacag 2700 cctgctccct ccgtctctac caggaatggc cttgtcctat ggaaggcact gccccatccc 2760 aaactaatct aggaatcact gtctaaccac tcactgtcat gaatgtgtac ttaaaggatg 2820 aggttgagtc ataccaaata gtgatttcga tagttcaaaa tggtgaaatt agcaattcta 2880 catgattcag tctaatcaat ggataccgac tgtttcccac acaagtctcc tgttctctta 2940 agcttactca ctgacagcct ttcactctcc acaaatacat taaagatatg gccatcacca 3000 agccccctag gatgacacca gacctgagag tctgaagacc tggatccaag ttctgacttt 3060 tccccctgac agctgtgtga ccttcgtgaa gtcgccaaac ctctctgagc cccagtcatt 3120 gctagtaaga cctgcctttg agttggtatg atgttcaagt tagataacaa aatgtttata 3180 cccattagaa cagagaataa atagaactac atttcttgca 3220 <![CDATA[<210> 2]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 2]]> cguuuaggca uguuuaaca 19 <![CDATA[<210> 3]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 3]]> aacagcacca auaucuucu 19 <![CDATA[<210> 4]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 4]]> auaucaucac caaguuccu 19 <![CDATA[<210> 5]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 5]]> agaugcugcc cagaagaca 19 <![CDATA[<210> 6]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 6]]> cuggcacacc aguccaaca 19 <![CDATA[<210> 7]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 7]]> uggcacacca guccaacag 19 <![CDATA[<210> 8]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 8]]> gcacaccagu ccaacagca 19 <![CDATA[<210> 9]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 9]]> caguccaaca gcaccaaua 19 <![CDATA[<210> 10]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 10]]> aguccaacag caccaauau 19 <![CDATA[<210> 11]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 11]]> guccaacagc accaauauc 19 <![CDATA[<210> 12]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 12]]> ccaacagcac caauaucuu 19 <![CDATA[<210> 13]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 13]]> ccccagugag caucgcuac 19 <![CDATA[<210> 14]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 14]]> gagcaucgcu acagccuuu 19 <![CDATA[<210> 15]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 15]]> gcaucgcuac agccuuugc 19 <![CDATA[<210> 16]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 16]]> caucgcuaca gccuuugca 19 <![CDATA[<210> 17]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 17]]> ucgcuacagc cuuugcaau 19 <![CDATA[<210> 18]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 18]]> cuacagccuu ugcaaugcu 19 <![CDATA[<210> 19]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 19]]> acagccuuug caaugcucu 19 <![CDATA[<210> 20]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 20]]> gaaggcuucc aggaacucc 19 <![CDATA[<210> 21]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 21]]> uaguggauaa guuuuugga 19 <![CDATA[<210> 22]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 22]]> uguaccacuc agaagccuu 19 <![CDATA[<210> 23]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 23]]> guaccacuca gaagccuuc 19 <![CDATA[<210> 24]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 24]]> acaccgaaga ggccaagaa 19 <![CDATA[<210> 25]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 25]]> accgaagagg ccaagaaac 19 <![CDATA[<210> 26]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 26]]> aggccaagaa acagaucaa 19 <![CDATA[<210> 27]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 27]]> ggccaagaaa cagaucaac 19 <![CDATA[<210> 28]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT]]> mRNA target sequence <![CDATA[<400> 28]]> gccaagaaac agaucaacg 19 <![CDATA[<210> 29]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 29]]> uacucaaggg aaaauugug 19 <![CDATA[<210> 30]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 30]]> cucaagggaa aauugugga 19 <![CDATA[<210> 31]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 31]]> ucaagggaaa auuguggau 19 <![CDATA[<210> 32]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 32]]> uuggucaagg agcuugaca 19 <![CDATA[<210> 33]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 33]]> aggagcuuga cagagacac 19 <![CDATA[<210> 34]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 34]]> agcuugacag agacacagu 19 <![CDATA[<210> 35]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 35]]> uuugcucugg ugaauuaca 19 <![CDATA[<210> 36]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 36]]> agcguuuagg cauguuuaa 19 <![CDATA[<210> 37]]> <![CDATA[<211> ]]> 19 <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 37]]> gcguuuaggc auguuuaac 19 <![CDATA[<210> 38]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 38]]> uuaggcaugu uuaacaucc 19 <![CDATA[<210> 39]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 39]]> ugggugcugc ugaugaaau 19 <![CDATA[<210> 40]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 40]]> ugccaccgcc aucuucuuc 19 <![CDATA[<210> 41]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 41]]> ccuggaaaau gaacucacc 19 <![CDATA[<210> 42]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRN]]>A target sequence <![CDATA[<400> 42]]> cgauaucauc accaaguuc 19 <![CDATA[<210> 43]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 43]]> accaaguucc uggaaaaug 19 <![CDATA[<210> 44]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 44]]> uccauuacug gaaccuaug 19 <![CDATA[<210> 45]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 45]]> ccauuacugg aaccuauga 19 <![CDATA[<210> 46]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 46]]> acuggaaccu augaucuga 19 <![CDATA[<210> 47]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<21]]>3> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 47]]> <![CDATA[ggaaccuaug aucugaaga 19 <![CDATA[<210> 48]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 48]]> gaaccuauga ucugaagag 19 <![CDATA[<210> 49]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 49]]> cagcaauggg gcugaccuc 19 <![CDATA[<210> 50]]> <![CDATA[<21]]>1> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 50]]> <![CDATA[gcaauggggc ugaccucuc 19 <![CDATA[<210> 51]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 51]]> agaggaggca ccccugaag 19 <![CDATA[<210> 52]]> <![CDATA[<211> 19]]> <![CDATA[<21]]>2> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 52]]> <![CDATA[aggcaccccu gaagcucuc 19 <![CDATA[<210> 53]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 53]]> ucuccaaggc cgugcauaa 19 <![CDATA[<210> 54]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 54]]> uccaaggccg ugcauaagg 19 <![CDATA[<210> 55]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 55]]> ccaaggccgu gcauaaggc 19 <![CDATA[<210> 56]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 56]]> caaggccgug cauaaggcu 19 <![CDATA[<210> ]]> 57 <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 57]]> aaggcugugc ugaccaucg 19 <![CDATA[<210> 58]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 58]]> ggcugugcug accaucgac 19 <![CDATA[<210> 59]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA Target Sequence]]> <![CDATA[<400> 59]]> cugcuggggc cauguuuuu 19 <![CDATA[<210> 60]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA Target Sequence]]> <![CDATA[<400> 60]]> gcuggggcca uguuuuuag 19 <![CDATA[<210> 61]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA Target Sequence]]> <![CDATA[<400> 61]]> cuggggccau guuuuuaga 19 <![CDATA[<210> 62]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA Target Sequence]]> <![CDATA[<400> 62]]> ggggccaugu uuuuagagg 19 <![CDATA[<210> 63]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 63]]> gggccauguu uuuagaggc 19 <![CDATA[<210> 64]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 64]]> gaggccauac ccaugucua 19 <![CDATA[<210> 65]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 65]]> ggccauaccc augucuauc 19 <![CDATA[<210> 66]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 66]]> cccgagguca aguucaaca 19 <![CDATA[<210> 67]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 67]]> aggucaaguu caacaaacc 19 <![CDATA[<210> 68]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 68]]> caaguucaac aaacccuuu 19 <![CDATA[<210> 69]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 69]]> aguucaacaa acccuuugu 19 <![CDATA[<210> 70]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 70]]> guucaacaaa cccuuuguc 19 <![CDATA[<210> 71]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 71]]> ucaacaaacc cuuugucuu 19 <![CDATA[<210> 72]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 72]]> acccuuuguc uucuuaaug 19 <![CDATA[<210> 73]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 73]]> ccuuugucuu cuuaaugau 19 <![CDATA[<210> 74]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 74]]> uaccaagucu ccccucuuc 19 <![CDATA[<210> 75]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 75]]> aagucucccc ucuucaugg 19 <![CDATA[<210> 76]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 76]]> agucuccccu cuucauggg 19 <![CDATA[<210> 77]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 77]]> ucuccccucu ucaugggaa 19 <![CDATA[<210> 78]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 78]]> cuccccucuu caugggaaa 19 <![CDATA[<210> 79]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT mRNA target sequence]]> <![CDATA[<400> 79]]> augacauuaa agaaggguu 19 <![CDATA[<210> 80]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 80]]> uguuaaacau gccuaaacg 19 <![CDATA[<210> 81]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 81]]> aguuaaacau gccuaaacg 19 <![CDATA[<210> 82]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 82]]> nguuaaacau gccuaaacg 19 <![CDATA[<210> 83]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 83]]> nguuaaacau gccuaaacn 19 <![CDATA[<210> 84]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 84]]> agaagauauu ggugcuguu 19 <![CDATA[<210> 85]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 85]]> ugaagauauu ggugcuguu 19 <![CDATA[<210> 86]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 86]]> ngaagauauu ggugcuguu 19 <![CDATA[<210> 87]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 87]]> ngaagauauu ggugcugun 19 <![CDATA[<210> 88]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 88]]> aggaacuugg ugaugauau 19 <![CDATA[<210> 89]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 89]]> uggaacuugg ugaugauau 19 <![CDATA[<210> 90]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 90]]> nggaacuugg ugaugauau 19 <![CDATA[<210> ]]> 91 <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 91]]> nggaacuugg ugaugauan 19 <![CDATA[<210> 92]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial]] sequence <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 92]]> ugucuucugg gcagcaucu 19 <![CDATA[<210> 93]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 93]]> agucuucugg gcagcaucu 19 <![CDATA[<210> 94]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 94]]> ngucuucugg gcagcaucu 19 <![CDATA[<210> 95]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 95]]> ngucuucugg gcagcaucn 19 <![CDATA[<210> 96]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<400> 96]]> uguuggacug gugugccag 19 <![CDATA[<210> 97]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<400> 97]]> aguuggacug gugugccag 19 <![CDATA[<210> 98]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 98]]> nguuggacug gugugccag 19 <![CDATA[<210> 99]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 99]]> nguuggacug gugugccan 19 <![CDATA[<210> 100]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 100]]> cuguuggacu ggugugcca 19 <![CDATA[<210> 101]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 101]]> uuguuggacu ggugugcca 19 <![CDATA[<210> 102]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 102]]> auguuggacu ggugugcca 19 <![CDATA[<210> 103]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 103]]> nuguuggacu ggugugcca 19 <![CDATA[<210> 104]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 104]]> nuguuggacu ggugugccn 19 <![CDATA[<210> 105]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 105]]> ugcuguugga cuggugugc 19 <![CDATA[<210> 106]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 106]]> agcuguugga cuggugugc 19 <![CDATA[<210> 107]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 107]]> ngcuguugga cuggugugc 19 <![CDATA[<210> 108]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 10]]>8 ngcuguugga cuggugugn 19 <![CDATA[<210> 109]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 109]]> uauuggugcu guuggacug 19 <![CDATA[<210> 110]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 110]]> aauuggugcu guuggacug 19 <![CDATA[<210> 111]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 111]]> nauuggugcu guuggacug 19 <![CDATA[<210> 112]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT]]> RNAi agent <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 112]]> nauuggugcu guuggacun 19 <![CDATA[<210> 113]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> The core region base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 113]]> auauuggugc uguuggacu 19 <![CDATA[<210> 114]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> The core region base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 114]]> uuauuggugc uguuggacu 19 <![CDATA[<210> 115]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 115]]> nuauuggugc uguuggacu 19 <![CDATA[<210> 116]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 116]]> nuauuggugc uguuggacn 19 <![CDATA[<210> 117]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 117]]> gauauuggug cuguuggac 19 <![CDATA[<210> 118]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 118]]> uauauuggug cuguuggac 19 <![CDATA[<210> 119]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 119]]> aauauuggug cuguuggac 19 <![CDATA[<210> 120]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 120]]> nauauuggug cuguuggac 19 <![CDATA[<210> 121]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 121]]> nauauuggug cuguuggan 19 <![CDATA[<210> 122]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 122]]> aagauauugg ugcuguugg 19 <![CDATA[<210> 123]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 123]]> uagauauugg ugcuguugg 19 <![CDATA[<210> 124]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 124]]> nagauauugg ugcuguugg 19 <![CDATA[<210> 125]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 125]]> nagauauugg ugcuguugn 19 <![CDATA[<210> 126]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 126]]> guagcgaugc ucacugggg 19 <![CDATA[<210> 127]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 127]]> uuagcgaugc ucacugggg 19 <![CDATA[<210> 128]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 128]]> auagcgaugc ucacugggg 19 <![CDATA[<210> 129]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 129]]> nuagcgaugc ucacugggg 19 <![CDATA[<210> 130]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 130]]> nuagcgaugc ucacugggn 19 <![CDATA[<210> 131]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 131]]> aaaggcugua gcgaugcuc 19 <![CDATA[<210> 132]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 132]]> uaaggcugua gcgaugcuc 19 <![CDATA[<210> 133]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 133]]> naaggcugua gcgaugcuc 19 <![CDATA[<210> 134]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 134]]> naaggcugua gcgaugcun 19 <![CDATA[<210> 135]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 135]]> gcaaaggcug uagcgaugc 19 <![CDATA[<210> 136]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 136]]> ucaaaggcug uagcgaugc 19 <![CDATA[<210> 137]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 137]]> acaaaggcug uagcgaugc 19 <![CDATA[<210> 138]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 138]]> ncaaaggcug uagcgaugc 19 <![CDATA[<210> 139]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221>]]> modified_base <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 139]]> ncaaaggcug uagcgaugn 19 <![CDATA[<210> 140]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 140]]> ugcaaaggcu guagcgaug 19 <![CDATA[<210> 141]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 141]]> agcaaaggcu guagcgaug 19 <![CDATA[<210> 142]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 142]]> ngcaaaggcu guagcgaug 19 <![CDATA[<210> 143]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> ]]>1, 19 <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 143]]> ngcaaaggcu guagcgaun 19 <![CDATA[<210> 144]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base]]> sequence <![CDATA[<400> 144]]> auugcaaagg cuguagcga 19 <![CDATA[<210> 145]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 145]]> uuugcaaagg cuguagcga 19 <![CDATA[<210> 146]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 146]]> nuugcaaagg cuguagcga 19 <![CDATA[<210> 147]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 147]]> nuugcaaagg cuguagcgn 19 <![CDATA[<210> 148]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 148]]> agcauugcaa aggcuguag 19 <![CDATA[<210> 149]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 149]]> ugcauugcaa aggcuguag 19 <![CDATA[<210> 150]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 150]]> ngcauugcaa aggcuguag 19 <![CDATA[<210> 151]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base]] sequence <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 151]]> ngcauugcaa aggcuguan 19 <![CDATA[<210> 152]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 152]]> agagcauugc aaaggcugu 19 <![CDATA[<210> 153]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 153]]> ugagcauugc aaaggcugu 19 <![CDATA[<210> 154]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 154]]> ngagcauugc aaaggcugu 19 <![CDATA[<210> 155]]> <![CDATA[<21]]>1> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 155]]> <![CDATA[ngagcauugc aaaggcugu 19 <![CDATA[<210> 156]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 156]]> ggaguuccug gaagccuuc 19 <![CDATA[<210> 157]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 157]]> ugaguuccug gaagccuuc 19 <![CDATA[<210> 158]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 158]]> agaguuccug gaagccuuc 19 <![CDATA[<210> 159]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 159]]> ngaguuccug gaagccuuc 19 <![CDATA[<210> 160]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 160]]> ngaguuccug gaagccuun 19 <![CDATA[<210> 161]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 161]]> uccaaaaacu uauccacua 19 <![CDATA[<210> 162]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 162]]> accaaaaacu uauccacua 19 <![CDATA[<210> 163]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 163]]> nccaaaaacu uauccacua 19 <![CDATA[<210> 164]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 164]]> nccaaaaacu uauccacun 19 <![CDATA[<210> 165]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 165]]> aaggcuucug agugguaca 19 <![CDATA[<210> 166]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 166]]> uaggcuucug agugguaca 19 <![CDATA[<210> 167]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 167]]> naggcuucug agugguaca 19 <![CDATA[<210> 168]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 168]]> naggcuucug agugguacn 19 <![CDATA[<210> 169]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 169]]> gaaggcuucu gagugguac 19 <![CDATA[<210> 170]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 170]]> uaaggcuucu gagugguac 19 <![CDATA[<210> 171]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 171]]> aaaggcuucu gagugguac 19 <![CDATA[<210> 172]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 172]]> naaggcuucu gagugguac 19 <![CDATA[<210> 173]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 173]]> naaggcuucu gagugguan 19 <![CDATA[<210> 174]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 174]]> uucuuggccu cuucggugu 19 <![CDATA[<210> 175]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 175]]> aucuuggccu cuucggugu 19 <![CDATA[<210> 176]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 176]]> nucuuggccu cuucggugu 19 <![CDATA[<210> 177]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 177]]> nucuuggccu cuucggugn 19 <![CDATA[<210> 178]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 178]]> guuucuuggc cucuucggu 19 <![CDATA[<210> 179]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 179]]> uuuucuuggc cucuucggu 19 <![CDATA[<210> 180]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 180]]> auuucuuggc cucuucggu 19 <![CDATA[<210> 181]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 181]]> nuuucuuggc cucuucggu 19 <![CDATA[<210> 182]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 182]]> nuuucuuggc cucuucggn 19 <![CDATA[<210> 183]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 183]]> uugaucuguu ucuuggccu 19 <![CDATA[<210> 184]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 184]]> augaucuguu ucuuggccu 19 <![CDATA[<210> 185]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 185]]> nugaucuguu ucuuggccu 19 <![CDATA[<210> 186]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 18]]>6 nugaucuguu ucuuggccn 19 <![CDATA[<210> 187]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial se]]quence <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 187]]> guugaucugu uucuuggcc 19 <![CDATA[<210> 188]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 188]]> uuugaucugu uucuuggcc 19 <![CDATA[<210> 189]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 189]]> auugaucugu uucuuggcc 19 <![CDATA[<210> 190]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n ]]= Any nucleotide <![CDATA[<400> 190]]> nuugaucugu uucuuggcc 19 <![CDATA[<210> 191]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> The base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = Any nucleotide]]> <![CDATA[<400> 191]]> nuugaucugu uucuuggcn 19 <![CDATA[<210> 192]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> The base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 192]]> cguugaucug uuucuuggc 19 <![CDATA[<210> 193]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 193]]> uguugaucug uuucuuggc 19 <![CDATA[<210> 194]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 194]]> aguugaucug uuucuuggc 19 <![CDATA[<210> 195]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 195]]> nguugaucug uuucuuggc 19 <![CDATA[<210> 196]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 196]]> nguugaucug uuucuuggn 19 <![CDATA[<210> 197]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<400> 197]]> cacaauuuuc ccuugagua 19 <![CDATA[<210> 198]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<400]]>> 198]]> <![CDATA[uacaauuuuc ccuugagua 19 <![CDATA[<210> ]]> 199 <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 199]]> aacaauuuuc ccuugagua 19 <![CDATA[<210> 200]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 200]]> nacaauuuuc ccuugagua 19 <![CDATA[<210> 201]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 201]]> nacaauuuuc ccuugagun 19 <![CDATA[<210> 202]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 202]]> uccacaauuu ucccuugag 19 <![CDATA[<210> 203]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 203]]> accacaauuu ucccuugag 19 <![CDATA[<210> 204]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 204]]> nccacaauuu ucccuugag 19 <![CDATA[<210> 205]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 205]]> nccacaauuu ucccuugan 19 <![CDATA[<210> 206]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213]]>> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 206]]> <![CDATA[auccacaauu uucccuuga 19 <![CDATA[<210> 207]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 207]]> uuccacaauu uucccuuga 19 <![CDATA[<210> 208]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 208]]> nuccacaauu uucccuuga 19 <![CDATA[<210]]>> 209]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 209]]> <![CDATA[nuccacaauu uucccuugn 19 <![CDATA[<210> 210]]> <![CDATA[<211>]]> 19 <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 210]]> ugucaagcuc cuugaccaa 19 <![CDATA[<210> 211]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 211]]> agucaagcuc cuugaccaa 19 <![CDATA[<210> 212]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 212]]> ngucaagcuc cuugaccaa 19 <![CDATA[<210> 213]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 213]]> ngucaagcuc cuugaccaa 19 <![CDATA[<210> 214]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<22]]>0>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 214]]> <![CDATA[gugucucugu caagcuccu 19 <![CDATA[<210> 215]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 215]]> uugucucugu caagcuccu 19 <![CDATA[<210> 216]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 216]]> augucucugu caagcuccu 19 <![CDATA[<210> 217]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 217]]> nugucucugu caagcuccu 19 <![CDATA[<210> 218]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 218]]> nugucucugu caagcuccn 19 <![CDATA[<210> 219]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of the AAT RNAi Agent]]> <![CDATA[<400> 219]]> acugugucuc ugucaagcu 19 <![CDATA[<210> 220]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of the AAT RNAi Agent]]> <![CDATA[<400> 220]]> ucugugucuc ugucaagcu 19 <![CDATA[<210> 221]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of the AAT RNAi Agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 221]]> ncugugucuc ugucaagcu 19 <![CDATA[<210> 222]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 222]]> ncugugucuc ugucaagcn 19 <![CDATA[<210> 223]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 223]]> uguaauucac cagagcaaa 19 <![CDATA[<210> 224]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 224]]> aguaauucac cagagcaaa 19 <![CDATA[<210> 225]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 225]]> nguaauucac cagagcaaa 19 <![CDATA[<210> 226]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 226]]> nguaauucac cagagcaan 19 <![CDATA[<210> 227]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 227]]> uuaaacaugc cuaaacgcu 19 <![CDATA[<210> 228]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 228]]> auaaacaugc cuaaacgcu 19 <![CDATA[<210> 229]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 229]]> nuaaacaugc cuaaacgcu 19 <![CDATA[<210> 230]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 230]]> nuaaacaugc cuaaacgcn 19 <![CDATA[<210> 231]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<400> 231]]> guuaaacaug ccuaaacgc 19 <![CDATA[<210> 232]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<400> 232]]> uuuaaacaug ccuaaacgc 19 <![CDATA[<210> 233]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 233]]> auuaaacaug ccuaaacgc 19 <![CDATA[<210> 234]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 234]]> nuuaaacaug ccuaaacgc 19 <![CDATA[<210> 235]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 235]]> nuuaaacaug ccuaaacgn 19 <![CDATA[<210> 236]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 236]]> ggauguuaaa caugccuaa 19 <![CDATA[<210> 237]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 237]]> ugauguuaaa caugccuaa 19 <![CDATA[<210> 238]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 238]]> agauguuaaa caugccuaa 19 <![CDATA[<210> 239]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 239]]> ngauguuaaa caugccuaa 19 <![CDATA[<210> 240]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 240]]> ngauguuaaa caugccuan 19 <![CDATA[<210> 241]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 241]]> auuucaucag cagcaccca 19 <![CDATA[<210> 242]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 242]]> uuuucaucag cagcaccca 19 <![CDATA[<210> 243]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 243]]> nuuucaucag cagcaccca 19 <![CDATA[<210> 244]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 244]]> nuuucaucag cagcacccn 19 <![CDATA[<210> 245]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 245]]> gaagaagaug gcgguggca 19 <![CDATA[<210> 246]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 246]]> uaagaagaug gcgguggca 19 <![CDATA[<210> 247]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 247]]> aaagaagaug gcgguggca 19 <![CDATA[<210> 248]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 248]]> naagaagaug gcgguggca 19 <![CDATA[<210> 249]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 249]]> naagaagaug gcgguggcn 19 <![CDATA[<210> 250]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 250]]> ggugaguuca uuuuccagg 19 <![CDATA[<210> 251]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 251]]> ugugaguuca uuuuccagg 19 <![CDATA[<210> 252]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 252]]> agugaguuca uuuuccagg 19 <![CDATA[<210> 253]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 253]]> ngugaguuca uuuuccagg 19 <![CDATA[<210> 254]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 254]]> ngugaguuca uuuuccagn 19 <![CDATA[<210> 255]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 255]]> gaacuuggug augauaucg 19 <![CDATA[<210> 256]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 256]]> uaacuuggug augauaucg 19 <![CDATA[<210> 257]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 257]]> aaacuuggug augauaucg 19 <![CDATA[<210> 258]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223>> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 258]]> <![CDATA[naacuuggug augauaucg 19 <![CDATA[<210> 259]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 259]]> naacuuggug augauaucn 19 <![CDATA[<210> 260]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 260]]> cauuuuccag gaacuuggu 19 <![CDATA[<210> 261]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 261]]> uauuuuccag gaacuuggu 19 <![CDATA[<210> 262]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 262]]> aauuuuccag gaacuuggu 19 <![CDATA[<210> 263]]> <![CDATA[<211> 19]]> <![CDATA[<212> RN]]>A <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 263]]> nauuuuccag gaacuuggu 19 <![CDATA[<210> 264]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 264]]> nauuuuccag gaacuuggn 19 <![CDATA[<210> 265]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 265]]> cauagguucc aguaaugga 19 <![CDATA[<210> 266]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 266]]> uauagguucc aguaaugga 19 <![CDATA[<210> 267]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 267]]> aauagguucc aguaaugga 19 <![CDATA[<210> 268]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 268]]> nauagguucc aguaaugga 19 <![CDATA[<210> 269]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nu]]>cleotide <![CDATA[<400> 269]]> nauagguucc aguaauggn 19 <![CDATA[<210> ]]> 270 <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 270]]> ucauagguuc caguaaugg 19 <![CDATA[<210> 271]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 271]]> acauagguuc caguaaugg 19 <![CDATA[<210> 272]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 272]]> ncauagguuc caguaaugg 19 <![CDATA[<210> 273]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 273]]> ncauagguuc caguaaugn 19 <![CDATA[<210> 274]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 274]]> ucagaucaua gguuccagu 19 <![CDATA[<210> 275]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 275]]> acagaucaua gguuccagu 19 <![CDATA[<210> 276]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 276]]> ncagaucaua gguuccagu 19 <![CDATA[<210> 277]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 277]]> ncagaucaua gguuccagn 19 <![CDATA[<210> 278]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 278]]> ucuucagauc auagguucc 19 <![CDATA[<210> 279]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 279]]> acuucagauc auagguucc 19 <![CDATA[<210> 280]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 280]]> ncuucagauc auagguucc 19 <![CDATA[<210> 281]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 281]]> ncuucagauc auagguucn 19 <![CDATA[<210> 282]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 282]]> cucuucagau cauagguuc 19 <![CDATA[<210> 283]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 283]]> uucuucagau cauagguuc 19 <![CDATA[<210> 284]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 284]]> aucuucagau cauagguuc 19 <![CDATA[<210> 285]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core nucleotide sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 285]]> nucuucagau cauagguuc 19 <![CDATA[<210> 286]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core nucleotide sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 286]]> nucuucagau cauagguun 19 <![CDATA[<210> 287]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<400> 287]]> gaggucagcc ccauugcug 19 <![CDATA[<210> 288]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<400> 288]]> uaggucagcc ccauugcug 19 <![CDATA[<210> 289]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base of AAT RNAi agent antisense strand]]> sequence <![CDATA[<400> 289]]> aaggucagcc ccauugcug 19 <![CDATA[<210> 290]]> <![CDATA[<211> ]]>19 <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 290]]> naggucagcc ccauugcug 19 <![CDATA[<210> 291]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 291]]> naggucagcc ccauugcun 19 <![CDATA[<210> 292]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 292]]> gagaggucag ccccauugc 19 <![CDATA[<210> 293]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<400> 293]]> uagaggucag ccccauugc 19 <![CDATA[<210> 294]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<400> 294]]> aagaggucag ccccauugc 19 <![CDATA[<210> 295]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 295]]> nagaggucag ccccauugc 19 <![CDATA[<210> 296]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core nucleotide sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 296]]> nagaggucag ccccauugn 19 <![CDATA[<210> 297]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core nucleotide sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 297]]> cuucaggggu gccuccucu 19 <![CDATA[<210> 298]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 298]]> uuucaggggu gccuccucu 19 <![CDATA[<210> ]]> 299 <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 299]]> auucaggggu gccuccucu 19 <![CDATA[<210> 300]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 300]]> nuucaggggu gccuccucu 19 <![CDATA[<210> 301]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 301]]> nuucaggggu gccuccucn 19 <![CDATA[<210> 302]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 302]]> gagagcuuca ggggugccu 19 <![CDATA[<210> 303]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 303]]> uagagcuuca ggggugccu 19 <![CDATA[<210> 304]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 304]]> aagagcuuca ggggugccu 19 <![CDATA[<210> 305]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 305]]> nagagcuuca ggggugccu 19 <![CDATA[<210> 306]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 306]]> nagagcuuca ggggugccn 19 <![CDATA[<210> 307]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 307]]> uuaugcacgg ccuuggaga 19 <![CDATA[<210> 308]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 308]]> auaugcacgg ccuuggaga 19 <![CDATA[<210> 309]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 309]]> nuaugcacgg ccuuggaga 19 <![CDATA[<210> 310]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 310]]> nuaugcacgg ccuuggagn 19 <![CDATA[<210> 311]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 311]]> ccuuaugcac ggccuugga 19 <![CDATA[<210> 312]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<400> 312]]> ucuuaugcac ggccuugga 19 <![CDATA[<210> 313]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<400> 313]]> acuuaugcac ggccuugga 19 <![CDATA[<210> 314]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 314]]> ncuuaugcac ggccuugga 19 <![CDATA[<210> 315]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 315]]> ncuuaugcac ggccuuggn 19 <![CDATA[<210> 316]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 316]]> gccuuaugca cggccuugg 19 <![CDATA[<210> 317]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 317]]> uccuuaugca cggccuugg 19 <![CDATA[<210> 318]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core nucleotide sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 318]]> accuuaugca cggccuugg 19 <![CDATA[<210> 319]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core nucleotide sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 319]]> nccuuaugca cggccuugg 19 <![CDATA[<210> 320]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 320]]> nccuuaugca cggccuugn 19 <![CDATA[<210> 321]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 321]]> agccuuaugc acggccuug 19 <![CDATA[<210> 322]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 322]]> ugccuuaugc acggccuug 19 <![CDATA[<210> 323]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 323]]> ngccuuaugc acggccuug 19 <![CDATA[<210> 324]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 324]]> ngccuuaugc acggccuun 19 <![CDATA[<210> 325]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 325]]> cgauggucag cacagccuu 19 <![CDATA[<210> 326]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 326]]> ugauggucag cacagccuu 19 <![CDATA[<210> 327]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 327]]> agauggucag cacagccuu 19 <![CDATA[<210> 328]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 328]]> ngauggucag cacagccuu 19 <![CDATA[<210> 329]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 329]]> ngauggucag cacagccun 19 <![CDATA[<210> 330]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 330]]> gucgaugguc agcacagcc 19 <![CDATA[<210> 331]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 331]]> uucgaugguc agcacagcc 19 <![CDATA[<210> 332]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 332]]> aucgaugguc agcacagcc 19 <![CDATA[<210> 333]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 333]]> nucgaugguc agcacagcc 19 <![CDATA[<210> 334]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 334]]> nucgaugguc agcacagcn 19 <![CDATA[<210> 335]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<400> 335]]> aaaaacaugg ccccagcag 19 <![CDATA[<210> 336]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base Sequence of the Core Region of the Antisense Strand of AAT RNAi Agent]]> <![CDATA[<400> 336]]> uaaaacaugg ccccagcag 19 <![CDATA[<210> 337]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213>]]> Synthetic sequence <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 337]]> naaaacaugg ccccagcag 19 <![CDATA[<210> 338]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Synthetic sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 338]]> naaaacaugg ccccagcan 19 <![CDATA[<210> 339]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Synthetic sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 339]]> cuaaaaacau ggccccagc 19 <![CDATA[<210> 340]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 340]]> uuaaaaacau ggccccagc 19 <![CDATA[<210> 341]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 341]]> auaaaaacau ggccccagc 19 <![CDATA[<210> 342]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 342]]> nuaaaaacau ggccccagc 19 <![CDATA[<210> 343]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 343]]> nuaaaaacau ggccccagn 19 <![CDATA[<210> 344]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 344]]> ucuaaaaaca uggccccag 19 <![CDATA[<210> 345]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 345]]> acuaaaaaca uggccccag 19 <![CDATA[<210> 346]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 346]]> ncuaaaaaca uggccccag 19 <![CDATA[<210> 347]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 347]]> ncuaaaaaca uggccccan 19 <![CDATA[<210> 348]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 348]]> ccucuaaaaa cauggcccc 19 <![CDATA[<210> 349]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 349]]> ucucuaaaaa cauggcccc 19 <![CDATA[<210> 350]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 350]]> acucuaaaaa cauggcccc 19 <![CDATA[<210> 351]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 351]]> ncucuaaaaa cauggcccc 19 <![CDATA[<210> 352]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 352]]> ncucuaaaaa cauggcccn 19 <![CDATA[<210> 353]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<400> 353]]> gccucuaaaa acauggccc 19 <![CDATA[<210> 354]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<400> 354]]> uccucuaaaa acauggccc 19 <![CDATA[<210> 355]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core segment base sequence of AAT RNAi agent antisense strand]]> <![CDATA[<400> 355]]> accucuaaaa acauggccc 19 <![CDATA[<210> 356]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 356]]> nccucuaaaa acauggccc 19 <![CDATA[<210> 357]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 357]]> nccucuaaaa acauggccn 19 <![CDATA[<210> 358]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 358]]> uagacauggg uauggccuc 19 <![CDATA[<210> 359]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 359]]> aagacauggg uauggccuc 19 <![CDATA[<210> 360]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core region of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 360]]> nagacauggg uauggccuc 19 <![CDATA[<210> 361]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base]] sequence of the core region of the antisense strand of AAT RNAi agent <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 361]]> nagacauggg uauggccun 19 <![CDATA[<210> 362]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 362]]> gauagacaug gguauggcc 19 <![CDATA[<210> 363]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core region base sequence of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 363]]> uauagacaug gguauggcc 19 <![CDATA[<210> 364]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 364]]> aauagacaug gguauggcc 19 <![CDATA[<210> 365]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 365]]> nauagacaug gguauggcc 19 <![CDATA[<210> 366]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 366]]> nauagacaug gguauggcn 19 <![CDATA[<210> 367]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 367]]> uguugaacuu gaccucggg 19 <![CDATA[<210> 368]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<400> 368]]> aguugaacuu gaccucggg 19 <![CDATA[<210> 369]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Core base sequence of the antisense strand of AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 369]]> nguugaacuu gaccucggg 19 <![CDATA[<210> 370]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 370]]> nguugaacuu gaccucggn 19 <![CDATA[<210> 371]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Base sequence of the core segment of the antisense strand of the AAT RNAi agent]]> <![CDATA[<400> 371]]> gguuuguuga acuugaccu 19 <![CDATA[<210> 372]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<400> 372]]> uguuuguuga acuugaccu 19 <![CDATA[<210> 373]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223>]]> AAT RNAi agent antisense strand core region base sequence <![CDATA[<400> 373]]> aguuuguuga acuugaccu 19 <![CDATA[<210> 374]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223>]]> AAT RNAi agent antisense strand core region base sequence <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 374]]> nguuuguuga acuugaccu 19 <![CDATA[<210> 375]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213> Artificial sequence]]> <![CDATA[<220>]]> <![CDATA[<223> AAT RNAi agent antisense strand core region base sequence]]> <![CDATA[<220> ]]> <![CDATA[<221> modified_base]]> <![CDATA[<222> 1, 19]]> <![CDATA[<223> n = any nucleotide]]> <![CDATA[<400> 375]]> nguuuguuga acuugaccn 19 <![CDATA[<210> 376]]> <![CDATA[<211> 19]]> <![CDATA[<212> RNA]]> <![CDATA[<213>...
Claims
1. An RNA interference (RNAi) agent for inhibiting the expression of the α-1 antitrypsin (AAT) gene, comprising a sense strand and an antisense strand, wherein nucleotides 2-18 of the antisense strand comprise nucleotides 2-18 of NGUUAAACAUGCCUAAACN (SEQ ID NO: 83), wherein the sense strand is at least substantially complementary to the antisense strand; and wherein the antisense strand comprises (i) two or three phosphate thioester bonds at its 5' end, (ii) at least eight nucleotides selected from 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine and 2'-fluorouridine, and (iii) at least eleven nucleotides selected from 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine and 2'-O-methyluridine.
2. The RNAi agent of claim 1, wherein the antisense strand comprises a nucleotide sequence (5'→3') selected from the following: (i) UGUUAAACAUGCCUAAACGUU (SEQ ID NO: 794); (ii) UGUUAAACAUGCCUAAACGCUU (SEQ ID NO: 839); (iii) UGUUAAACAUGCCUAAACGCG (SEQ ID NO: 800); and (iv) UGUUAAACAUGCCUAAACGCU (SEQ ID NO: 801).
3. The RNAi agent of claim 1 or 2, wherein the sense strand comprises a nucleotide sequence selected from the following (5'→3'): (i) AGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 866); (ii) CGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 857); (iii) GCGUUUAGGCAUGUUUAACAUU (SEQ ID NO: 885); and (iv) CGCGUUUAGGCAUGUUUAACA (SEQ ID NO: 864).
4. An RNAi agent as requested in claim 1 or 2, wherein the antisense strand is 21 or 22 nucleotides in length.
5. The RNAi agent as requested in claim 1 or 2, wherein each nucleotide of the antisense strand is a modified nucleotide.
6. An RNAi agent as claimed in claim 1 or 2, wherein the RNAi agent contains a targeting group.
7. The RNAi agent of claim 6, wherein the targeting group is attached to the 5' end of the sense strand.
8. The RNAi agent of claim 6, wherein the targeting group comprises a desialyl glycoprotein receptor ligand.
9. The RNAi agent of claim 8, wherein the desialyl glycoprotein receptor ligand comprises an N-acetylglucosamine trimer.
10. An RNAi agent as claimed in claim 6, wherein the targeting group comprises the following structures: , , , , , , , , , , 11. The RNAi agent of claim 10, wherein the targeting group comprises the following chemical structure: .
12. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence (5'→3') usGfsuUfaAfacaugCfcUfaAfaCfgCfsu (SEQ ID NO: 960), wherein: a, c, g, and u are 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; and s is a thiophosphate bond.
13. The RNAi agent of claim 12, wherein the sense string comprises the sequence (5'→3') agcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1279), wherein: a, c, g, and u are 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; and s is a thiophosphate bond; wherein, depending on the situation, one or two inverse abase-free deoxyribose residues (invAb) and / or one, two, three, or four thiophosphate nucleoside bonds are present on the sense bond; and wherein, depending on the situation, the ligands connected to the 5' end of the sense bond are targeting ligands containing N-acetylglucosamine.
14. The RNAi agent of claim 1, wherein the antisense strand of the RNAi agent contains the sequence (5'→3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgusu (SEQ ID NO: 913), wherein: a, c, g, and u are 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; and s is a thiophosphate bond.
15. The RNAi agent of claim 14, wherein the sense string comprises the sequence (5'→3') cguuuaGfGfCfauguuuaacausu (SEQ ID NO: 1276), wherein: a, c, g, and u are 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; and s is a thiophosphate bond; wherein, depending on the situation, one or two inverse abase-free deoxyribose residues (invAb) and / or one, two, three, or four thiophosphate nucleoside bonds are present on the sense bond; and wherein, depending on the situation, the ligands connected to the 5' end of the sense bond are targeting ligands containing N-acetylglucosamine.
16. The RNAi agent of claim 1, wherein the antisense strand of the RNAi agent contains the sequence (5'→3') usGfsusUfaAfaCfaUfgCfcUfaAfaCfgcusu (SEQ ID NO: 958), wherein: a, c, g, and u are 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; and s is a thiophosphate bond.
17. The RNAi agent of claim 16, wherein the sense string comprises the sequence (5'→3') gcguuuaGfGfCfauguuuaacausu (SEQ ID NO: 1277), wherein: a, c, g, and u are 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; and s is a thiophosphate bond; wherein, depending on the situation, one or two inverse abase-free deoxyribose residues (invAb) and / or one, two, three, or four thiophosphate nucleoside bonds are present on the sense bond; and wherein, depending on the situation, the ligands connected to the 5' end of the sense bond are targeting ligands containing N-acetylglucosamine.
18. The RNAi agent of claim 1, wherein the antisense strand of the RNAi agent contains the sequence (5'→3') usGfsuUfaAfaCfaUfgCfcUfaAfaCfgsCfsg (SEQ ID NO: 959), wherein: a, c, g, and u are 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; and s is a thiophosphate bond.
19. The RNAi agent of claim 18, wherein the sense string comprises the sequence (5'→3') cgcguuuaGfGfCfauguuuaaca (SEQ ID NO: 1278), wherein: a, c, g, and u are 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, and 2'-O-methyluridine, respectively; Af, Cf, Gf, and Uf are 2'-fluoroadenosine, 2'-fluorocytidine, 2'-fluoroguanosine, and 2'-fluorouridine, respectively; and s is a thiophosphate bond; wherein, depending on the situation, one or two inverse abase-free deoxyribose residues (invAb) and / or one, two, three, or four thiophosphate nucleoside bonds are present on the sense bond; and wherein, depending on the situation, the ligands connected to the 5' end of the sense bond are targeting ligands containing N-acetylglucosamine.
20. A composition comprising an RNAi agent as claimed in any one of claims 1 to 19.
21. The composition of claim 20, formulated for administration to an individual.
22. The composition of claim 20 or 21, wherein the composition is formulated for administration by subcutaneous injection.
23. The composition of claim 20 or 21, wherein the individual has a homozygous PiZZ genotype or a heterozygous PiZ / + genotype.
24. The composition of claim 21, wherein the individual has chronic hepatitis, cirrhosis, hepatocellular carcinoma, elevated transaminases, cholestasis, fibrosis, or fulminant hepatic failure.
25. Use of an RNA interference (RNAi) agent as claimed in any one of claims 1 to 19 or a composition as claimed in any one of claims 20 to 24, for the preparation of a pharmaceutical product that inhibits the expression of the α-1 antitrypsin (AAT) gene.
26. The use as claimed in claim 25, wherein the pharmaceutical product is used for the prevention or treatment of α-1 antitrypsin deficiency (AATD).
27. The use as claimed in claim 25, wherein the pharmaceutical product is used for the prevention or treatment of conditions or diseases caused by α-1 antitrypsin deficiency (AATD).
28. As requested in item 27, wherein the condition or disease is liver disease.
29. As claimed in claim 28, wherein the liver disease is chronic hepatitis, cirrhosis, hepatocellular carcinoma, elevated transaminases, cholestasis, fibrosis, or fulminant hepatic failure.
Citation Information
Patent Citations
RNA interference mediated inhibition of alpha-1 antitrypsin (AAT) gene expression using short interfering nucleic acid (siNA)
US20050137153A1
Serpina1 sirnas: compositions of matter and methods of treatment
WO2012178033A2