HERPES ZOSTER mRNA VACCINE, PREPARATION METHOD THEREFOR, AND USE THEREOF

Abstract

This invention belongs to the field of mRNA vaccine technology, and particularly relates to a shingles mRNA vaccine, its preparation method, and its application. The shingles mRNA vaccine provided by this invention contains RNA encoding the varicella-zoster virus gE glycoprotein or a variant thereof. The vaccine can prevent shingles infection and its complications.

Description

Technical Field

[0001] This disclosure belongs to the field of mRNA vaccine technology, specifically relating to a herpes zoster mRNA vaccine, its preparation method, and its application. Prior Technology

[0002] Shingles is an infectious skin disease caused by the reactivation of the varicella-zoster virus (VZV), which has been dormant in the dorsal root ganglia of the spinal cord or cranial nerve ganglia for a long time. Shingles is a common dermatological condition, often accompanied by neuropathic pain in addition to skin lesions. It is more common in older adults, those with suppressed or deficient immune systems, and is more prevalent in spring and autumn. The incidence rate increases significantly with age.

[0003] After a person recovers from chickenpox, varicella-zoster virus (VZV) is not completely eradicated. Instead, it remains latent in the cranial ganglia, dorsal root ganglia, and autonomic ganglia throughout the nerve axis, persisting throughout life. Following chickenpox infection with VZV, the body produces specific antibodies against VZV and T-cell-mediated cellular immunity (such as CD4+ / CD8+ / memory T cells). These two immune mechanisms play a crucial role in maintaining latent VZV infection and preventing shingles. With age or the occurrence of external or internal factors that suppress the body's immunity, VZV can spontaneously reactivate, triggering herpes zoster (HZ).

[0004] Common triggering factors for shingles include age (such as old age), cellular immune deficiency, genetic susceptibility, trauma, systemic diseases (such as diabetes, kidney disease, etc.), excessive mental stress, fatigue, etc. Unlike chickenpox in children, shingles in adults (elderly) is more likely to cause sequelae, the most common of which is postherpetic neuralgia (PHN), which can cause pain for 3 to 12 months after shingles has healed.

[0005] Shingles and postherpetic neuralgia are both common and frequently occurring diseases. Chronic pain caused by shingles (postherpetic neuralgia) and other complications, commonly known as "shingles," "herpes zoster," etc., severely impact patients' quality of life. The elderly and those with weakened immune systems are frequently affected by these complications. Due to the unclear pain mechanism, postherpetic neuralgia remains one of the most difficult-to-treat pain conditions.

[0006] Shingles has two notable characteristics: a high rate of transmission and significant suffering for sufferers. Data from European and American surveys show that the annual incidence of shingles is generally 2-6 per 1,000 people. The incidence increases with age. Statistical surveys show that the incidence rate in the 10-49 age group is approximately 4 per 1,000, while the incidence rate in the over 75 age group is as high as 14 per 1,000. Furthermore, women are slightly more likely to contract shingles than men. Currently, the global incidence of shingles is on the rise. Surveys from 1994 to 2018 show that the annual incidence rate of shingles is increasing by 3.1% annually, with a particularly significant increase in the 20-49 age group.

[0007] China has not included shingles in the category of Class A and B notifiable infectious diseases, and there are relatively few related epidemiological studies on the entire population. Statistics show that approximately 99.5% of adults aged 50 and above in China harbor the VZV virus, with about 1.56 million new cases annually. The average annual incidence rate of shingles in the 50-60 age group in China is 2.66‰, while the average annual incidence rate in the 80+ age group is as high as 8.55‰. The incidence of postherpetic neuralgia (PHN) also increases with age; studies show that the incidence rate of PHN among elderly shingles patients in China is 18.8%, reaching 31.7% in those over 75 years of age.

[0008] Vaccines are the most effective way to prevent shingles. The main technological approaches involved in shingles vaccine development include live attenuated vaccines, recombinant protein vaccines, adenovirus vector vaccines, and mRNA vaccines.

[0009] Globally, there are currently only four vaccines available for the prevention of shingles: Merck's live attenuated vaccine Zostavax® (discontinued), GlaxoSmithKline's (GSK) recombinant vaccine Shingrix®, SK Chemicals' SkyZoster® (sold only in South Korea), and the recently launched live attenuated vaccine from China's BEHC Biotechnology. Merck's Zostavax® was the world's first approved shingles vaccine, launched in the US and Europe in 2006. However, due to its low protective efficacy (approximately 70% protection against shingles), it was unsuitable for people with immunosuppression or immune system disorders, severely limiting its application, and production was discontinued in 2018. GlaxoSmithKline's (GSK) recombinant protein vaccine, Shingrix®, was launched in the US in 2017, in Europe in 2018, and applied for marketing approval in China in 2019. Global sales of this vaccine reached $2.4 billion in 2021 and $3.2 billion in 2022, consistently ranking among the top ten best-selling vaccines globally for several years. However, as a protein subunit vaccine, the use of GSK's special adjuvant makes it expensive and difficult to increase production capacity. More importantly, it has significant side effects, with a significantly higher incidence of adverse reactions compared to live attenuated vaccines.

[0010] mRNA vaccines represent the third generation of vaccine technology, following traditional vaccines and protein subunit vaccines. After entering human cells via a specific delivery system, mRNA vaccines utilize the body's own cells to translate mRNA into proteins. These proteins are expressed as antigens specific to the virus, recognized as foreign antigens by antigen-presenting cells (APCs). This drives the maturation of dendritic cells (DCs), which in turn activate B cells and T cells to produce a strong immune response, triggering both humoral and cellular immune responses. mRNA vaccines break through the traditional immune activation model by innovatively utilizing the body's own cells to produce antigens, thereby activating dual-specific immunity, forming immune memory, and providing more durable specific immunity. The greatest advantage of mRNA vaccines is that once the antigen gene sequence of the pathogen is known, mRNA vaccines can be developed quickly. The rapid design and construction of mRNA vaccine technology, its high responsiveness to viral mutations, and its efficient, universal, total synthetic production platform, along with its ease of standardization, result in short production cycles and relatively simple processes, enabling rapid mass production of mRNA vaccines.

[0011] Compared with traditional vaccines, shingles mRNA vaccines have the following advantages: 1) They are non-infectious and non-integrative reagents, eliminating the risk of infection or insertional mutations; 2) mRNA vaccines activate specific immunity in the body by expressing antigens, resulting in more durable and effective specific immunity; 3) mRNA vaccines can be stably delivered into cells for efficient intracellular expression; 4) mRNA vaccine production can be subject to rigorous quality control.

[0012] gE is the main target protein in shingles vaccine development and is one of the most abundant glycoproteins in VZV, playing a crucial role in viral replication and viral transmission between ganglion cells. As a highly glycosylated type I membrane protein, gE can be transported between the endoplasmic reticulum (ER), the trans-Golgi network (TGN), and endosomes.

[0013] Based on the above problems, in order to further reduce the risk of shingles in people with weakened immune systems, there is an urgent need to provide a novel mRNA vaccine to prevent VZV, which can significantly enhance humoral and cellular immunity after vaccination. Summary of the Invention

[0014] This invention provides a shingles mRNA vaccine that can safely guide the body's cellular mechanisms to produce virtually any protein of interest, from natural proteins to antibodies and other entirely novel proteins that may have preventative activity both inside and outside cells. The shingles mRNA vaccine of this disclosure can be used to elicit a balanced immune response against VZV, encompassing both cellular and humoral immunity, without the many risks associated with attenuated virus vaccination.

[0015] RNA (e.g., mRNA) vaccines are available in a variety of situations depending on the prevalence of infection or the degree or level of unmet medical need. RNA (e.g., mRNA) vaccines can be used to prevent VZV of various genotypes, strains, and isolates. The advantage of RNA (e.g., mRNA) vaccines lies in their ability to produce significantly higher antibody titers and earlier responses compared to commercially available antiviral treatments. While not wishing to be bound by theory, it is believed that, like mRNA polynucleotides, RNA vaccines are better designed to produce appropriate protein conformations through translation when the RNA vaccine is assigned to natural cellular mechanisms. Unlike conventional vaccines manufactured in vitro and capable of triggering adverse cellular responses, RNA (e.g., mRNA) vaccines are delivered to cellular systems in a more natural manner.

[0016] Based on the important structure and biological function of the VZV gE protein, this invention innovatively designed a series of mRNA vaccine candidate antigens and compared their immunogenicity with existing mRNA vaccines (e.g., antigen YK-VZV-007, see CN108472309A; and the marketed recombinant subunit vaccine Shingrix®). Several shingles mRNA candidate vaccines with novel antigen structures and superior immunogenicity were successfully screened, which provides a foundation for the successful development of shingles mRNA vaccines.

[0017] Based on wild-type VZV gE glycoprotein, this application combines ribonucleic acid encoding multiple VZV gE glycoprotein variants through specific methods (including sequence truncation, site mutation, and / or sequence deletion), and provides novel mRNA vaccines for the prevention of VZV. Experiments have shown that vaccination can significantly enhance humoral and cellular immunity, including: increasing the content of IgG antibodies against VZV gE protein, increasing the number of immune cells (including CD4+ and CD8+ that secrete IFN-γ+ and / or IL-2+), and promoting the secretion of cytokines (including IFN-γ+ and IL-2+) by immune cells in a herpes zoster mRNA vaccine.

[0018] The mRNA vaccines provided herein may include at least one VZV glycoprotein RNA polynucleotide provided in the appended sequence listing, or fragments, homologs (e.g., having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity), or variants or derivatives thereof.

[0019] In some implementations, the antigen encodes a VZV gE polypeptide.

[0020] In some embodiments, the VZV gE polypeptide (full length) contains 1 to 623 amino acids (e.g., SEQ ID NO: 3, 51, 55, 171, 135, 139, 143, 147, 19, 23, 151, 27, 31, 35, 39, 43, 47, 163, 167).

[0021] In some embodiments, the VZV gE peptide is a variant. In some embodiments, the VZV gE variant is a truncated peptide lacking the anchor domain (ER-retained domain).

[0022] In some embodiments, the truncated VZV gE polypeptide contains 1 to 539 amino acids (e.g., SEQ ID NO: 7).

[0023] In some embodiments, the truncated VZV gE polypeptide contains 1 to 573 amino acids (e.g., SEQ ID NO: 15, 59, 63, 67, 71, 75, 79, 83, 87, 91).

[0024] In some embodiments, the truncated VZV gE polypeptide contains 1 to 568 amino acids (e.g., SEQ ID NO: 11).

[0025] In some embodiments, the truncated VZV gE polypeptide contains 1 to 587 amino acids (e.g., SEQ ID NO: 95, 99, 103, 107, 111, 115, 119, 123, 127, 131).

[0026] In some embodiments, the truncated VZV gE polypeptide contains 1 to 601 amino acids (e.g., SEQ ID NO: 155, 159).

[0027] In some embodiments, the VZV gE variant is a full-length or truncated polypeptide. This also includes mutations in one or more motifs associated with targeting the Golgi apparatus or trans-Golgi network (TGN), resulting in a reduction in the VZV gE polypeptide targeting or localizing to the Golgi apparatus or TGN. In particular, the inventors have unexpectedly discovered that the motifs associated with gE protein localization to the Golgi apparatus or trans-Golgi network include the "A568Y569R570V571" motif (specifically, its mutated antigenic sequence is such as YK-VZV-011 (SEQ ID NO:35), especially the A568D and / or Y569K mutations).

[0028] Furthermore, in some embodiments, the VZV gE variant may have a Y582A / G mutation, or a Y569K / A mutation, or a combination of Y582G and Y569A mutations. Other mutation types also include phosphorylated acidic motif mutations such as those at the S593EST596DT598 (SEQ ID NO:182) site.

[0029] In some embodiments, the variant VZV gE polypeptide is a full-length or truncated polypeptide. This also includes mutations in one or more motifs Y582AGL585 (SEQ ID NO: 185) associated with VZV gE internalization or endocytosis, resulting in reduced endocytosis of the VZV gE polypeptide.

[0030] In some implementations, the VZV gE variant is a full-length polypeptide with a Y569K mutation (SEQ ID NO: 27, 31, 35, 39, 43, 47, 143, 147).

[0031] In some implementations, the VZV gE variant is a full-length polypeptide with the Y582A mutation (SEQ ID NO: 23, 27, 31, 43, 47, 135, 139, 171).

[0032] In some implementations, the VZV gE variant is a full-length polypeptide (SEQ ID NO: 27, 31, 43, 47) with Y582A and Y569K mutations.

[0033] In some implementations, the VZV gE variant is a full-length polypeptide having the sequence A593EA595A596DA598 (SEQ ID NO:183).

[0034] In some embodiments, the VZV gE variant is a full-length or truncated polypeptide having the sequence A593EA595A596DA598 (SEQ ID NO:183) and having a Y582G mutation, or a Y569K mutation, or a combination of Y582G and Y569K mutations.

[0035] In some implementations, the VZV gE variant contains one or more site mutations selected from the group consisting of: A568D, Y569K, Y569A, R570E, V571K, Y582A, S593A, S595A, T596A, and T598A; preferably A568D, Y569K, R570E, and V571K.

[0036] In some implementations, the site mutation is any one of the following combinations: 1)A568D;Y569K;R570E;V571K;(YK-VZV-023, YK-VZV-011) 2)A568D;Y569A;R570E;V571K;(YK-VZV-024) 3)Y569K;R570E;V571K;(YK-VZV-025) 4)A568D;Y569K;R570E;V571K;Y582A;(YK-VZV-030、YK-VZV-013) 5)A568D;Y569K;R570E;V571K;Y582G;(YK-VZV-031、YK-VZV-038) 6)A568D;Y582A;(YK-VZV-032) 7)Y569K;Y582A;(YK-VZV-033、YK-VZV-009) 8)R570E;Y582A;(YK-VZV-034) 9)V571K;Y582A;(YK-VZV-035) 10)S593A;S595A;T596A;T598A;(YK-VZV-016、YK-VZV-044) 11)Y582A;S593A;S595A;T596A;T598A;(YK-VZV-037) 12)A568D;Y569K;R570E;V571K;Y582G;S593A;S595A;T596A;T598A;(YK-VZV-039) 13)A568D;Y569K;R570E;V571K;Y582A;S593A;S595A;T596A;T598A;(YK-VZV-014) 14)Y582G;S593A;S595A;T596A;T598A;(YK-VZV-040) 15)Y569K;Y582A;S593A;S595A;T596A;T598A;(YK-VZV-010) 16)A568D;Y569K;R570E;V571K;S593A;S595A;T596A;T598A;(YK-VZV-012) 17)Y582G;(YK-VZV-029) 18)A568D;(YK-VZV-018) 19)Y569K;(YK-VZV-020) 20)R570E;(YK-VZV-021) 21)V571K;(YK-VZV-022) 22)Y582A; (YK-VZV-028, YK-VZV-036) any one of them

[0037] In some implementations, the VZV gE variant further includes a sequence deletion, wherein the sequence deletion is selected from any one or more of the following group: 1) A568, 2)Y569RVDKSPYNQS579、 3)Y569RVDKSPYNQSMYYAGLPV587.

[0038] The VZV gE antigen disclosed herein has a variety of mutation combinations, including gE antigen C-terminal amino acid truncation, key amino acid deletion or substitution, which are further illustrated below through specific examples.

[0039] The present invention also provides a method for preparing the composition, comprising: Provide a template for transcribing the RNA of the VZV; Transcription is performed using the template under conditions suitable for transcribing the RNA. In some embodiments, the preparation method includes the following steps: The DNA sequence of the VZV gE antigen was synthesized and then homologously recombinated into the PVAX1 vector; plastids were obtained after transformation culture of Escherichia coli; Linearized plasmids were obtained by enzymatic digestion of plasmids; Using T7 RNA polymerase with linearized plastids as templates, NTP raw materials were added, and after co-transcription and capping, RNA was obtained, preferably mRNA.

[0040] In some preferred embodiments, the purification method includes one or a combination of the following: lithium chloride precipitation, affinity chromatography, ultrafiltration with fluid exchange, and cellulose chromatography.

[0041] In some embodiments, the preparation method of the composition includes: synthesizing a DNA sequence based on the antigen gene and inserting it into a plastid DNA construct; the plastid DNA is cut by a DNA restriction endonuclease to become a linear template; under the catalysis of T7 RNA polymerase, using the linearized plastid as a template, key raw materials such as NTPs and cap analogs are added to transcribe and synthesize mRNA and modify it by adding a cap at the 5' end; the modified mRNA is then purified by methods such as lithium chloride precipitation and affinity chromatography to remove impurities such as contaminants, enzymes, and free nucleotides.

[0042] In a third aspect, the composition of the present invention is in the form of a vaccine, namely a shingles vaccine, which, in addition to the composition, also contains a pharmaceutically acceptable carrier.

[0043] In some preferred embodiments, the pharmaceutically acceptable carrier comprises a lipid mixture, preferably lipid nanoparticles (LNPs).

[0044] In some preferred embodiments, the lipid nanoparticles comprise, for example, cationic lipids, neutral lipids, structural lipids, and polymer-conjugated lipids.

[0045] Fourthly, this application also provides a method for preparing the vaccine composition, comprising mixing the RNA of the VZV with the pharmaceutically acceptable carrier, for example, to encapsulate at least a portion of the RNA within lipid nanoparticles. In some embodiments, the preparation method includes the steps of: mixing RNA, preferably mRNA, with lipid nanoparticles, encapsulating it within the lipid nanoparticles, and removing unencapsulated components by purification.

[0046] In some more specific embodiments, the preparation method includes the following specific steps: the mRNA is formulated in the lipid nanoparticles (LNPs), that is, the purified mRNA and lipid mixture are mixed in a microfluidic wafer and self-assembled to form lipid nanoparticles, in which the mRNA is encapsulated inside the liposomes; the lipid nanoparticle solution is dialyzed or filtered to remove unencapsulated mRNA, non-aqueous solvents and bacteria; the filtered lipid nanoparticle solution is stored and packaged into sterile vials to complete the preparation and production of the mRNA vaccine.

[0047] This application is the first to discover: This application, based on wild-type VZV gE glycoprotein, combines several ribonucleic acids encoding VZV gE glycoprotein variants through specific methods (including sequence truncation, site mutation, and / or sequence deletion), providing a novel mRNA vaccine for VZV prevention. Experiments have demonstrated that vaccination significantly enhances humoral and cellular immunity, including: increasing the level of IgG antibodies against VZV gE protein, increasing the number of immune cells (including CD4+ and CD8+ secreting IFN-γ+ and / or IL-2+), and promoting the secretion of cytokines (including IFN-γ+ and IL-2+) by immune cells in a herpes zoster mRNA vaccine. Specifically, this application includes the following findings and results: 1. By performing Western spectroscopy on 43 designed VZV gE antigen variants... Blot analysis showed that all 39 antigen sequences exhibited significant protein expression, including YK-VZV-001, YK-VZV-003, YK-VZV-009, YK-VZV-010, YK-VZV-011, YK-VZV-012, YK-VZV-013, YK-VZV-014, YK-VZV-015, YK-VZV-016, YK-VZV-017, YK-VZV-018, YK-VZV-019, YK-VZV-020, YK-VZV-021, YK-VZV-022, YK-VZV-023, YK-VZV-024, YK-VZV-025, YK-VZV-026, and YK-V ZV-027, YK-VZV-028, YK-VZV-029, YK-VZV-030, YK-VZV-031, YK-VZV-032, YK-VZV-033, YK-VZV-034, YK-VZV-035, YK-VZV-036, YK-VZV-037, YK-VZV-038, YK-VZV-039, YK-VZV-040, YK-VZV-044, as well as YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4) can be used as effective candidate antigens for the next step of immunogenicity screening and evaluation. 2. Based on the above 39 sequences, the following 14 variants were extracted using the gE-specific antibody IgG titer results on day 42: YK-VZV-009, YK-VZV-011, YK-VZV-013, YK-VZV-014, YK-VZV-010, YK-VZV-012, YK-VZV-018, and YK-VZV-020. YK-VZV-030, YK-VZV-031, YK-VZV-038, YK-VZV-021, YK-VZV-024, YK-VZV-028 and four control sequences YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4). The above sequences were 3.3 to 5.3 times larger than the Shingrix® positive control and 1.8 to 2.8 times larger than the YK-VZV-007 (Comparative Example 4) sequence. Their efficacy was superior to Shingrix®, YK-VZV-007 (Comparative Example 4), YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), and YK-VZV-045 (Comparative Example 3). 3. The results of measuring the proportion of CD4+ T and CD8+ T cells secreting IFN-γ and IL-2 in the spleen of mice showed that... ① Based on the percentage of CD4+ T cells, the following 9 sequences were selected: YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, YK-VZV-012, YK-VZV-018, YK-VZV-028, YK-VZV-038, and YK-VZV-031. The combined percentage of IFN-γ+ CD4+ T cells and IL-2+ CD4+ T cells was more than twice that of the Shingrix® positive control, reaching up to seven times; and approximately 1.8 to 5.3 times that of YK-VZV-007 (comparative example 4). The proportion of IFN-γ+ CD4+ T cells reached 1.00~2.00%, which is more than 3 times that of the Shingrix® positive control vaccine, reaching a maximum of 6.7 times; and about 2.2~4.4 times that of YK-VZV-007 (comparative example 4). The percentage of IL-2+ CD4+ T cells both exceeded 1%, and was more than 3.7 times that of the Shingrix® positive control vaccine and more than 2.2 times that of YK-VZV-007; ②Furthermore, based on the percentage of CD8+ T cells, five sequences were identified: YK-VZV-010, YK-VZV-013, YK-VZV-020, YK-VZV-018, and YK-VZV-011. The combined percentage of IFN-γ+ CD8+ T cells and IL-2+ CD8+ T cells was 4 to 7 times higher than that of the Shingrix® vaccine, and approximately 3 to 5 times higher than that of YK-VZV-007 (comparative example 4). The proportion of IFN-γ+ CD8+ T cells was optimal, all above 5.0%, which is 4.5 to 7.0 times that of the Shingrix® positive control vaccine and about 2.5 to 4.5 times that of YK-VZV-007; The proportion of IL-2+ CD8+ T cells was optimal, reaching 0.3-0.5%, which is more than 2.5-4.0 times that of the Shingrix® positive control vaccine and about 1.5-3.0 times that of YK-VZV-007; And all of them were significantly higher than the comparative examples (YK-VZV-004, YK-VZV-006, YK-VZV-045, YK-VZV-007). 4. To verify the above results, based on the test results on day 42, the titer of VZV-binding-gE antibody IgG in the serum of immunized mice on day 56 was further measured and verified. The results showed that on day 56 after mice were immunized with YK-VZV-009, YK-VZV-010, YK-VZV-011, YK-VZV-013, YK-VZV-020, YK-VZV-014, YK-VZV-012, YK-VZV-018, YK-VZV-021, YK-VZV-024, YK-VZV-028, YK-VZV-030, YK-VZV-031, and YK-VZV-038 vaccines, the gE-specific antibody IgG titers of the above mRNA vaccines were all superior to those of the Shingrix® positive control, and were approximately 1.8 to 5.0 times higher than those of the Shingrix® vaccine. Among them, the antibody GMT of YK-VZV-011, YK-VZV-013, YK-VZV-020, YK-VZV-018, and YK-VZV-010 reached over 650×10⁴, which is more than 4.0 to 5.0 times that of the Shingrix® vaccine and more than twice that of YK-VZV-007 (Comparative Example 4). Furthermore, all of them were significantly superior to YK-VZV-004 (Comparative Example 1) and YK-VZV-045 (Comparative Example 3). 5. Five optimal antigen sequences (YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, and YK-VZV-018) were selected based on the combined results of IgG and multi-parameter flow cytometry. These sequences were further validated using the ELISpot method, and the results are as follows: ① The amount of IFN-γ secreted by T cells stimulated by the mRNA vaccine was above 500 SFU, with the highest reaching nearly 600 SFU, which is about 16 to 19 times that of the Shingrix® positive control and 2.5 to 3.0 times that of control 4 (YK-VZV-007); and significantly better than the cytokines secreted by the mRNA vaccines corresponding to control 1 (YK-VZV-004), control 2 (YK-VZV-006) or control 3 (YK-VZV-045). Among them, the mRNA vaccine prepared with the YK-VZV-010 sequence reached a maximum of 598.8 SFU, which is 18.7 times that of the Shingrix® positive control and nearly 3 times that of the YK-VZV-007 control. The IFN-γ secretion levels from high to low were YK-VZV-010, YK-VZV-011, YK-VZV-018, YK-VZV-020, and YK-VZV-013, with no significant differences between groups, and all groups showed good and significant immune effects. ② The amount of IL-2 secreted by T cells stimulated by the mRNA vaccine was above 400-600 SFU, which was 10-16 times that of the Shingrix® positive control and 2.0-3.0 times that of the YK-VZV-007 control; it was also significantly better than the cytokines secreted by the mRNA vaccines corresponding to Comparative Example 1 (YK-VZV-004), Comparative Example 2 (YK-VZV-006), or Comparative Example 3 (YK-VZV-045). Among them, the mRNA vaccine prepared with the YK-VZV-010 sequence reached a maximum of 614.5 SFU, which is 16.0 times that of the Shingrix® positive control and more than 3 times that of the YK-VZV-007 control. The IL-2 secretion levels from high to low were YK-VZV-010, YK-VZV-011, YK-VZV-018, YK-VZV-013, and YK-VZV-020, with no significant differences between groups, and all groups showed good and significant immune effects. 6. In addition, the antigen localization results of the above 5 sequences show that they are localized in the Golgi apparatus, cell membrane, or cytoplasm. Simple Explanation of the Diagram

[0048] Figure 1: Major functional domains of VZV gE protein and a series of deletion mutants; Figure 2: Expression of YK-VZV-001~YK-VZV-045 antigens; Figure 3: Cellular localization of VZV gE antigen in YK-VZV-010, YK-VZV-011, and YK-VZV-013; Figure 4: Cellular localization of VZV gE antigen in YK-VZV-018 and YK-VZV-020. Green represents gE antigen, yellow and red represent GM130 and TGN46 respectively, white arrows represent cell membranes, and orange arrows represent Golgi apparatus. Implementation

[0049] The present invention will be further illustrated below through embodiments. It should be understood that the embodiments of the present invention are merely provided for illustrative purposes and are not intended to limit the present invention. Simple improvements to the present invention based on the technical solutions of the present invention are all within the protection scope of the present invention.

[0050] In this document, the term "selected from" means any combination of one, two, three or more of the listed objects or elements.

[0051] It should be understood that the term "a compound" as used herein may include the compound, its N-oxide, its solvate, its pharmaceutically acceptable salt, its stereoisomer, and mixtures thereof.

[0052] Antigen Sequence Design: An antigen is a protein capable of inducing an immune response (e.g., causing the immune system to produce antibodies against the antigen). In this document, the term "antigen" is used to encompass both immunogenic proteins and immunogenic fragments (that induce or are capable of inducing) an immune response to varicella-zoster virus (e.g., VZV), unless otherwise stated. It should be understood that the term "protein" encompasses peptides, and the term "antigen" encompasses antigen fragments. Table 1 provides exemplary sequences of VZV antigens of the compositions of this disclosure and RNA encoding said VZV antigens.

[0053] Nucleic acid: Nucleic acid comprises polymers of nucleotides (nucleotide monomers). The compositions disclosed herein comprise RNA having an open reading frame (ORF) encoding a VZV antigen. In some embodiments, the RNA is messenger RNA (mRNA). In some embodiments, the RNA (e.g., mRNA) further comprises a 5′ UTR, a 3′ UTR, a poly(A) tail, and / or a 5′ cap analogue.

[0054] Messenger RNA (mRNA): any RNA that encodes (at least one) protein (a naturally occurring, non-natural, or modified amino acid polymer) and can be translated in vitro, in vivo, in situ, or ex vivo to produce a protein-encoding RNA. Those skilled in the art will understand that, unless otherwise stated, the nucleic acid sequences described herein may be listed as "T" in a representative DNA sequence, but where said sequence represents RNA (e.g., mRNA), "T" will replace "U". Therefore, any DNA disclosed and identified herein by a specific sequence identification number also discloses a corresponding RNA (e.g., mRNA) sequence complementary to the DNA, wherein each "T" in the DNA sequence is replaced by "U".

[0055] An open reading frame (ORF) is a continuous sequence of DNA or RNA that begins with a start codon (e.g., methionine (ATG)) and ends with a stop codon (e.g., TAA, TAG, or TGA, or UAA, UAG). ORFs typically encode proteins. It should be understood that the sequences disclosed herein may also contain additional elements, such as 5′ and 3′ UTRs.

[0056] Variant RNA: An antigenic variant or other polypeptide variant is a molecule whose amino acid sequence differs from the wild-type, native, or reference sequence. Compared to the native or reference sequence, the antigen / polypeptide variant may have substitutions, deletions, and / or insertions at certain positions within the amino acid sequence. Typically, the variant shares at least 50% identity with the wild-type, native, or reference sequence. In some embodiments, the variant shares at least 80% or at least 90% identity with the wild-type, native, or reference sequence.

[0057] In some embodiments, the composition comprises RNA or RNA ORF containing the nucleotide sequence of any of the sequences provided herein (see, for example, sequence listings and Table 1), or containing at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotide sequence of any of the sequences provided herein.

[0058] The term "identity" refers to the relationship between sequences of two or more polypeptides (e.g., antigens) or polynucleotides (nucleic acids), as determined by sequence comparison. Identity also refers to the degree of sequence relevance between or among sequences, as determined by the number of matches between two or more amino acid residues or nucleic acid residue strings. Identity measures the percentage of identity matches between the smaller of two or more sequences with vacancy alignments (if any), processed by a specific mathematical model or computer program (e.g., an "algorithm"). The identity of related antigens or nucleic acids can be readily calculated using known methods. "Identity percentage (%)" when applied to polypeptide or polynucleotide sequences is defined as the percentage of residues in the candidate amino acid or nucleic acid sequence that are identical to residues in the amino acid or nucleic acid sequence of a second sequence after sequence alignment and the introduction of vacancy (if necessary) to achieve the maximum identity percentage. Methods and computer programs used for alignment are well known in the art. It should be understood that identity depends on the calculation of the identity percentage, but the value of identity may differ due to vacancy and penalty introduced in the calculation. Typically, a variant of a specific polynucleotide or polypeptide (e.g., an antigen) has at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, but less than 100% sequence identity with the specific reference polynucleotide or polypeptide, as determined by sequence alignment procedures and parameters known to those of ordinary skill in the art described herein and to which this invention pertains. Such tools for alignment include those in BLAST suites (Stephen F. Altsch et al. (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402).

[0059] Therefore, polynucleotides encoding peptides or polypeptides containing substitutions, insertions, and / or additions or deletions relative to a reference sequence, particularly the antigen sequence disclosed herein, are all included within the scope of this disclosure. Amino residues located at the carboxyl and amino terminal regions of the amino acid sequence of a peptide or protein may optionally be deleted to provide a truncated sequence. Depending on the structure and purpose of the sequence, the gE protein possesses several important domains related to its primary function (Figure 1). The gE protein possesses several important domains related to its primary function (Figure 3). (1) The TM transmembrane domain, composed of amino acids at positions 539-559; (2) A568YRV571: mediates the transport of gE between the endoplasmic reticulum (ER), the trans-Golgi network (TGN), and the endosome; (3) Y582AGL585: mediates the transport of gE between the endoplasmic reticulum (ER), the trans-Golgi network (TGN), and the endosome; (4) S593ES595T596DT598: an important glycosylation site; mediates the transport of gE between the endoplasmic reticulum (ER), the trans-Golgi network (TGN), and the endosome. In some embodiments, important structural sites can be removed and replaced with appropriate residues to alter antigen transport and expression, thereby enhancing the immunogenicity of the antigen. Such sequences can be readily identified by those skilled in the art to which this invention pertains. It should also be understood that some of the sequences provided herein contain sequence tags or terminal peptide sequences (e.g., at the N-terminus or C-terminus) that may be missing prior to, for example, the preparation of RNA (e.g., mRNA) vaccines.

[0060] As will be recognized by those skilled in the art to which this invention pertains, protein fragments, functional protein domains, and homologous proteins are also considered to be within the scope of the target varicella-zoster virus antigen. For example, any protein fragment of a reference protein (meaning a polypeptide sequence that is at least one amino acid residue shorter than the reference antigen sequence but otherwise identical) is provided herein, provided that the fragment is immunogenic and confers a protective immune response against varicella-zoster virus. In addition to variants that are identical to but truncated from the reference protein, in some embodiments, as shown in any sequence provided or referenced herein, the antigen includes mutations at sites 2, 3, 4, 5, 6, 7, 8, 9, 10, or more. The length of the antigen / antigenic polypeptide can range from about 4, 6, or 8 amino acids to the full-length protein.

[0061] VZV Antigen Variants: This invention includes variant VZV antigenic peptides. In some embodiments, the variant VZV antigenic peptide is a variant VZV gE peptide. The variant VZV gE peptide is designed to avoid ER / Horgitschlia retention of the peptide, resulting in increased surface expression of the antigen. In some embodiments, the variant gE peptide is truncated to remove the ER-retained portion or the cytoplasmic tail portion of the peptide. In some embodiments, the variant VZV gE peptide is mutated to reduce the localization of the VZV peptide to ER / Horgitschlia / TGN. This modification inhibits ER capture and thus accelerates transport to the cell membrane. Therefore, in some embodiments, the VZV glycoprotein is a variant gE peptide. VZV gE has a target sequence for TGN at its C-terminus and is transported from ER to TGN in infected and gE-transfected cells. Most gE in TGN appears to be retrieved from the plasma membrane via endocytosis and transferred from the endosome to the TGN, then recycled back to the plasma membrane. gE accumulates in the TGN along with other VZV proteins (e.g., envelope proteins) associated with the production of intact enveloped VZV viral particles. Therefore, mutations that reduce TGN localization and endocytosis facilitate the transport of gE to the cell membrane. The variant VZV gE polypeptide can be any truncated polypeptide lacking an anchor domain (ER-retained domain). For example, the variant VZV gE polypeptide can be a truncated VZV gE polypeptide containing at least amino acids 1 to 124, such as truncated VZV gE polypeptides containing amino acids 1 to 124, 1 to 140, 1 to 160, 1 to 200, 1 to 250, 1 to 300, 1 to 350, 1 to 360, 1 to 400, 1 to 450, 1 to 500, 1 to 511, 1 to 550, and 1 to 561, as well as polypeptide fragments having fragment sizes within the referenced size range. In some embodiments, the variant VZV gE polypeptide is a truncated polypeptide lacking a carboxyl-terminal tail domain. Therefore, in some embodiments, the truncated VZV gE polypeptide comprises amino acids 1 to 573 of SEQ ID NO: 59. In some embodiments, the variant VZV gE polypeptide has at least one mutation in one or more motifs associated with ER retention, wherein the mutation in one or more motifs results in reduced retention of the VZV gE polypeptide in the ER and / or Gauzynes. In some embodiments, the variant VZV gE polypeptide has at least one mutation in one or more phosphorylated acidic motifs. For example, the variant VZV gE polypeptide may be a full-length VZV gE polypeptide having a Y582G mutation, a Y569K mutation, or both a Y582G mutation and a Y569K mutation. Alternatively, the variant VZV gE polypeptide may be an antigenic fragment comprising, for example, amino acids 1 to 573 of VZV gE and having a Y569K mutation. Alternatively, the variant VZV gE polypeptide may be an antigenic fragment having a mutation in an acidic phosphorylated motif (such as an SSTT motif).For example, the variant VZV gE polypeptide can be an antigenic fragment having the AEAADA sequence (SEQ ID NO: 183).

[0062] Naturally occurring eukaryotic mRNA molecules, in addition to other structural features such as a 5′-cap structure or a 3′-poly(A) tail, may contain stabilizing elements, including but not limited to untranslated regions (UTRs) at their 5′ end (5′UTR) and / or at their 3′ end (3′UTR). Both the 5′UTR and 3′UTR are typically elements transcribed from genomic DNA and are pre-mature mRNAs. Characteristic structural features of mature mRNA (e.g., a 5′-cap and a 3′-poly(A) tail) are usually added to the transcribed (pre-mature) mRNA during mRNA processing.

[0063] In some embodiments, the composition comprises an RNA polynucleotide having an open reading frame encoding at least one antigenic polypeptide having at least one modification, at least one 5′ terminal cap, and formulated within lipid nanoparticles. The 5′-capping of the polynucleotide can be performed simultaneously during in vitro transcription using a chemical RNA cap analog, according to the manufacturer's protocol, to produce a 5′-guanosine cap structure. In some cases, the 5′-capping of the modified RNA can also be performed post-transcriptionally using a vaccinia virus capping enzyme to produce a "cap" structure. Cap 1 can be produced using a vaccinia virus capping enzyme and a 2′-O methyltransferase to produce: m7G(5′)ppp(5′)G-2′-O-methyl. Cap 2 can be produced from Cap 1 by 2′-O-methylation of the 5′-last nucleotide using a 2′-O methyltransferase. Cap 3 can be produced from Cap 2 by 2′-O-methylation of the 5′-last nucleotide using a 2′-O methyltransferase. The enzymes can be derived from recombinant sources. The 3′-poly(A) tail is typically an adenine nucleotide appended to the 3′ end of the transcribed mRNA. In some cases, it can contain up to about 400 adenine nucleotides. In some embodiments, the length of the 3′-poly(A) tail may be an essential factor for the stability of the individual mRNA.

[0064] Chemical Modification: In some embodiments, the compositions of this disclosure comprise RNA having an open reading frame encoding a VZV antigen, wherein the nucleic acid comprises nucleotides and / or nucleosides that may be standard (unmodified) or modified as known in the art. In some embodiments, the nucleotides and nucleosides of this disclosure comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides may be naturally occurring modified nucleotides and nucleosides or non-naturally occurring modified nucleotides and nucleosides. Such modifications may include those modifications at the sugar, backbone, or nucleobase moieties of the nucleotides and / or nucleosides as recognized in the art.

[0065] In some embodiments, the naturally occurring modified nucleotides or nucleosides disclosed herein are nucleotides or nucleosides generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleosides can be found, in particular, in the widely recognized MODOMICS database.

[0066] In some embodiments, the non-naturally occurring modified nucleotides or nucleosides of this disclosure are nucleotides or nucleosides generally known or recognized in the art. Non-limiting examples of such non-naturally occurring modified nucleotides and nucleosides can be found in particular in the published U.S. applications PCT / US2012 / 058519; PCT / US2013 / 075177; PCT / US2014 / 058897; PCT / US2014 / 058891; PCT / US2014 / 070413; PCT / US2015 / 36773; PCT / US2015 / 36759; PCT / US2015 / 36771; or PCT / IB2017 / 051367, all of which are incorporated herein by reference.

[0067] Therefore, the nucleic acids (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids) disclosed herein may comprise standard nucleotides and nucleosides, naturally occurring nucleotides and nucleosides, non-naturally occurring nucleotides and nucleosides, or any combination thereof.

[0068] In some embodiments, the nucleic acids of this disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids) comprise multiple (more than one) different types of standard and / or modified nucleotides and nucleosides. In some embodiments, specific regions of the nucleic acid contain one, two, or more (optionally different) types of standard and / or modified nucleotides and nucleosides.

[0069] In some implementations, modified RNA nucleic acids (e.g., modified mRNA nucleic acids) introduced into cells or organisms exhibit reduced degradation in cells or organisms, relative to unmodified nucleic acids containing standard nucleotides and nucleosides.

[0070] In some implementations, modified RNA nucleic acids (e.g., modified mRNA nucleic acids) introduced into cells or organisms may exhibit reduced immunogenicity in cells or organisms, relative to unmodified nucleic acids containing standard nucleotides and nucleosides.

[0071] In some implementations, nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) contain non-naturally modified nucleotides introduced during or after nucleic acid synthesis to achieve a desired function or property. Modifications can be present at internucleotide links, purine or pyrimidine bases, or sugars. Modifications can be introduced chemically or using polymerases at the ends of the chain or anywhere else in the chain. Any region of the nucleic acid can be chemically modified.

[0072] This disclosure provides modified nucleosides and nucleotides of nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids). "Nucleoside" refers to a compound containing a sugar molecule (e.g., pentose or ribose) or a derivative thereof combined with an organic base (e.g., purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase"). "Nucleotide" refers to a nucleoside comprising a phosphate group. Modified nucleotides can be synthesized by any useful method, such as chemical, enzymatic, or recombinant methods, to comprise one or more modified or non-natural nucleosides. Nucleic acids may contain one or more regions of linked nucleosides. Such regions may have variable backbone bonds. The bonds may be standard phosphodiester bonds, in which case the nucleic acid will contain the nucleotide region.

[0073] Modified nucleotide base pairings encompass not only standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides containing non-standard or modified bases, wherein the arrangement of hydrogen bond donors and acceptors allows hydrogen bonding between non-standard bases and standard bases or between two complementary non-standard base structures, such as in nucleic acids having at least one chemical modification. An example of such non-standard base pairings is the base pairing between modified nucleotides inosine and adenine, cytosine, or uracil. Any combination of base / sugar or linker may be incorporated into the nucleic acids of this disclosure.

[0074] In some embodiments, the modified nucleotides in the nucleic acid (e.g., RNA nucleic acid, such as mRNA nucleic acid) comprise 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, the modified nucleotides in the nucleic acid (e.g., RNA nucleic acid, such as mRNA nucleic acid) comprise 5-methoxymethyluridine, 5-methylthiouridine, 1-methoxymethylpseudouridine, 5-methylcytidine, and / or 5-methoxycytidine. In some embodiments, the polynucleotide comprises at least two (e.g., 2, 3, 4, or more) combinations of any of the modified nucleotides mentioned above, including but not limited to chemical modifications.

[0075] In some embodiments, the mRNA disclosed herein contains 1-methyl-pseudouridine (m1ψ) substitution at one or all uridine positions of the nucleic acid.

[0076] In some embodiments, the mRNA disclosed herein comprises 1-methyl-pseudouridine (m1ψ) substitution at one or more or all uridine positions in the nucleic acid and 5-methylcytidine substitution at one or more or all cytidine positions in the nucleic acid.

[0077] In some embodiments, the mRNA disclosed herein contains pseudouridine (ψ) substitutions at one or all uridine sites in the nucleic acid.

[0078] In some implementations, for a specific modification, the mRNA is uniformly modified (e.g., completely modified, modified throughout the entire sequence). For example, nucleic acids can be uniformly modified with 1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, nucleic acids can be uniformly modified for any type of nucleoside residue present in the sequence by substitution with modified residues (e.g., those explained above).

[0079] The nucleic acid may contain from about 1% to about 100% modified nucleotides (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any or more of A, G, U, or C) or any intercalary percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10%). (up to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It should be understood that the presence of unmodified A, G, U, or C accounts for any remaining percentage.

[0080] The mRNA may contain at least 1% and at most 100% of modified nucleotides or any intercalary percentage, such as at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, or at least 90% of modified nucleotides. For example, the nucleic acid may contain modified pyrimidines, such as modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracil in the nucleic acid is replaced by modified uracil (e.g., 5-substituted uracil). The modified uracil may be replaced by a compound having a single unique structure or by multiple compounds having different structures (e.g., 2, 3, 4, or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosine in the nucleic acid is replaced by modified cytosine (e.g., 5-substituted cytosine). The modified cytosine may be replaced by a compound having a single unique structure, or by multiple compounds having different structures (e.g., 2, 3, 4, or more unique structures).

[0081] Untranslated Region (UTR): The mRNA disclosed herein may contain one or more regions or portions that act as or are used as untranslated regions. When the mRNA is designed to encode at least one target antigen, the nucleic acid may contain one or more of these untranslated regions (UTRs). The wild-type untranslated region of the nucleic acid is transcribed but not translated. In mRNA, the 5′UTR begins at the transcription start site and continues to the start codon, but does not include the start codon; while the 3′UTR begins immediately after the stop codon and continues to the transcription termination signal. Increasing evidence suggests the regulatory role of UTRs in the stability and translation of nucleic acid molecules. Regulatory features of UTRs may be incorporated into the polynucleotides of this disclosure to particularly enhance molecular stability. Specific features may also be incorporated to ensure controlled downregulation of the transcript in cases where the transcript is misdirected to an undesirable organ site. Various 5′UTR and 3′UTR sequences are known and available in the art.

[0082] In some embodiments of this disclosure, the 5′UTR is a heterologous UTR, i.e., a UTR found in nature that is associated with a different ORF. In another embodiment, the 5′UTR is a synthetic UTR, i.e., one that does not occur in nature. Synthetic UTRs include UTRs that have been mutated to improve their properties, such as UTRs that increase gene expression, as well as completely synthetic UTRs. Exemplary 5′UTRs include Xenopus xenograft or human α-globulin or β-globulin (8278063; 9012219), human cytochrome b-245a polypeptide and hydroxysteroid (17b) dehydrogenase, and tobacco etch virus (US8278063, 9012219).

[0083] In some embodiments, the 5′UTR of this disclosure contains a sequence selected from SEQ ID NO:173~174.

[0084] In some preferred embodiments, the 5′UTR of this disclosure comprises a sequence selected from SEQ ID NO:174.

[0085] The 3′UTR is the region of mRNA directly downstream (3′) of the stop codon (the codon that signals the termination of translation in mRNA transcripts). The 3′UTR does not encode proteins (it is non-coding). Natural or wild-type 3′UTRs are known to contain segments containing adenosine (A) and uridine (U). These AU-rich imprints are particularly prevalent in genes with high turnover rates.

[0086] The introduction, removal, or modification of AU-rich elements (AREs) in the 3′UTR can be used to modulate the stability of nucleic acids (e.g., RNA) disclosed herein. When engineering a specific nucleic acid, one or more copies of AREs can be introduced to make the nucleic acid of this disclosure less stable, thereby reducing translation and decreasing the production of the resulting protein. Similarly, AREs can be identified and removed or mutated to increase intracellular stability, thereby increasing the translation and production of the resulting protein.

[0087] 3′UTRs can be heterologous or synthetic. Regarding 3′UTRs, globulin UTRs (including Xenopus β-globulin UTRs and human β-globulin UTRs) are known in the art (8278063, 9012219, US20110086907). By selectively colonizing two consecutive human β-globulin 3′UTRs end-to-end, modified β-globulin-encoding nucleic acids (e.g., mRNAs) with enhanced stability in several cell types have been developed, and these are well known in the art (US2012 / 0195936, WO2014 / 071963).

[0088] In some embodiments, the 3′UTR of this disclosure contains a sequence selected from SEQ ID NO:175.

[0089] Those skilled in the art will understand that heterologous or synthetic 5′UTRs can be used with any desired 3′UTR sequence. For example, a heterologous 5′UTR can be used with a synthetic 3′UTR or a heterologous 3′UTR.

[0090] It should be understood that any UTR from any gene can be incorporated into a region of nucleic acid. Furthermore, multiple wild-type UTRs of any known gene can be utilized. Artificial UTRs that provide variants that are not wild-type regions are also within the scope of this disclosure. These UTRs, or portions thereof, can be positioned in the same orientation as in the transcript from which they are selected, or can be altered in orientation or position. Thus, 5′ or 3′ UTRs can be inverted, shortened, lengthened, or prepared together with one or more other 5′ or 3′ UTRs. As used herein, the term "altered" when referring to a UTR sequence means that the UTR has been altered in some way relative to a reference sequence. For example, a 3′ or 5′ UTR can be altered relative to a wild-type or native UTR by changes in orientation or position as taught above, or by changes including additional nucleotides, deletions of nucleotides, exchanges of nucleotides, or transpositions. Any of these alterations that produce an "altered" UTR (whether 3′ or 5′) comprises a variant UTR.

[0091] RNA in vitro transcription: cDNA encoding the polynucleotides described herein can be transcribed using an in vitro transcription (IVT) system. In some embodiments, the RNA transcript is produced in an in vitro transcription reaction using a non-amplified linearized DNA template to produce RNA transcript. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by circular plasmid DNA digestion. In some embodiments, cells, such as bacterial cells, such as *E. coli*, or DH-1 cells, are transfected with the plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA, and then the plasmid DNA is isolated and purified. In some embodiments, the DNA template includes an RNA polymerase promoter, such as the T7 promoter located at the 5′ of the target gene and operatively linked thereto.

[0092] In some implementations, the in vitro transcription template encodes a 5′ untranslated (UTR) region containing an open reading frame, and also encodes a 3′ UTR and a poly(A) tail. The specific nucleic acid sequence composition and length of the in vitro transcription template will depend on the mRNA encoded by the template.

[0093] The "5′ untranslated region" (UTR) refers to the region of mRNA that does not encode a polypeptide, located directly upstream (i.e., 5′) of the start codon (i.e., the first codon of the mRNA transcript translated by ribosomes). When an RNA transcript is produced, the 5′ UTR may contain a promoter sequence. Such promoter sequences are known in the art. It should be understood that such promoter sequences will not be present in the vaccines disclosed herein.

[0094] The "3′ untranslated region" (UTR) refers to the region of mRNA that does not encode a polypeptide, located directly downstream (i.e., 3′) of the stop codon (i.e., the codon of the mRNA transcript that sends the translation termination signal).

[0095] An "open reading frame" is a continuous segment of DNA that begins with a start codon (e.g., methionine (ATG)) and ends with a stop codon (e.g., TAA, TAG, or TGA) and encodes a polypeptide.

[0096] A poly(A) tail is a region of mRNA located downstream, for example, directly downstream (i.e., 3′), of a 3′ UTR containing multiple consecutive adenosine monophosphates (ATPs). The poly(A) tail can contain 10 to 300 ATPs. For example, a poly(A) tail can contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 ATPs. In some embodiments, the poly(A) tail contains 50 to 250 ATPs. In relevant biological environments (e.g., in cells, in vivo), the poly(A) tail serves to protect mRNA from enzymatic degradation, for example, in the cytoplasm, and to facilitate transcription termination, and / or mRNA export from the nucleus and translation.

[0097] In some implementations, the nucleic acid comprises 200 to 3,000 nucleotides. For example, the nucleic acid may comprise 200 to 500, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 3000, 1500 to 3000, or 2000 to 3000 nucleotides.

[0098] In vitro transcription systems typically contain transcription buffer, nucleotide triphosphates (NTPs), RNase inhibitors, inorganic pyrophosphates, and polymerases.

[0099] The NTP may be manufactured in-house, selected from a supplier, or synthesized as described herein. The NTP may be selected from, but is not limited to, those NTPs described herein, including natural and non-natural (modified) NTPs.

[0100] Any number of RNA polymerases or variants may be used in the methods of this disclosure. The polymerase may be selected from, but is not limited to, bacteriophage RNA polymerases, such as T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, and / or mutant polymerases, such as, but not limited to, polymerases capable of incorporating modified nucleic acids and / or modified nucleotides (including chemically modified nucleic acids and / or nucleotides). Some embodiments exclude the use of DNases.

[0101] In some implementations, RNA transcripts can be capped via enzymatic capping or co-transcriptional capping. In some implementations, the RNA contains a 5′ end cap, such as 7mG(5′)ppp(5′)NlmpNp.

[0102] Purification of mRNA: The purification of nucleic acids described herein may include, but is not limited to, nucleic acid purification, quality assurance, and quality control. Purification may be carried out by methods known in the art, such as, but not limited to, lithium chloride precipitation, beads (Beckman & Co., Microter Genomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probes (Vedbaek, Denmark), or HPLC-based purification methods, such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reversed-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). The term "purified" when used with respect to nucleic acids, such as "purified nucleic acid," refers to nucleic acids isolated from at least one contaminant. A "contaminant" is any substance that makes another substance unsuitable, impure, or inferior. Thus, purified nucleic acids (e.g., DNA and RNA) exist in a form or environment different from their natural occurrence or in a form or environment different from their existence prior to the treatment or purification method.

[0103] Quality assurance and / or quality control checks may be performed using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC.

[0104] Quantification: In some embodiments, nucleic acids can be quantified using methods such as, but not limited to, ultraviolet-visible spectroscopy (UV / Vis). A non-limiting example of a UV / Vis spectrometer is a spectrometer (ThermoFisher, Waltham, MA). The quantified nucleic acids can be analyzed to determine whether the nucleic acids are of appropriate size and to check that the nucleic acids have not been degraded. Degradation of nucleic acids can be checked by methods such as, but not limited to, agarose gel electrophoresis; HPLC-based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reversed-phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC); liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE), and capillary gel electrophoresis (CGE).

[0105] Lipid nanoparticles (LNPs): In some embodiments, the RNA (e.g., mRNA) of this disclosure is formulated in lipid nanoparticles (LNPs). Lipid nanoparticles typically contain ionizable cationic lipids, non-cationic lipids, sterols and PEG lipid components, and the target nucleic acid cargo. The lipid nanoparticles disclosed herein can be produced using components, compositions, and methods commonly known in the art, see, for example, CN116535381B, TW202340136A, CN116178193B, CN116178193B, CN115784921B, CN115745820B, CN115677518B, CN114957027B, CN114044741B, CN116854754A, CN116785265A, CN116789764A, CN116396178A, CN116375592A, CN116082275A, all of which are incorporated herein by reference in their entirety.

[0106] In this paper, the term "cationic lipid" refers to lipids that carry a positive charge at a selected pH. Cationic liposomes readily bind to negatively charged nucleic acids, that is, through electrostatic interaction with the negatively charged phosphate groups present in nucleic acids, forming lipid nanoparticles (LNPs). LNPs are currently one of the mainstream delivery carriers.

[0107] In this paper, the term "neutral lipid" refers to lipids that are uncharged at a selected pH or exist in a zwitterionic form and play an auxiliary role. These neutral lipids may modulate the fluidity of nanoparticles to form lipid bilayers and improve efficiency by promoting lipid phase transitions, and may also affect the specificity of target organs.

[0108] In this document, "structural lipids" refers to lipids that enhance the stability of nanoparticles by filling the gaps between lipids. Structural lipids may be selected from, but are not limited to, the group consisting of: cholesterol, non-steroidal, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol, corticosteroids, and mixtures thereof. In some embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and corticosteroids (such as prednisolone, dexamethasone, prednisone, and hydrocortisone) or any combination thereof.

[0109] In some embodiments, the molar ratio of the cationic lipid to the structural lipid is about 1:1 to 5:1, for example, about 1.0:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, or 2.0:1.

[0110] In some embodiments, the molar ratio of the cationic lipid to the neutral lipid is about (1 to 10):1, for example, about 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1 or 10:1.

[0111] In some embodiments, the molar ratio of the cationic lipid to the structural lipid is about (1 to 5):1, for example, about 1:1, 2:1, 3:1, 4:1 or 5:1.

[0112] In some embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25~65):(5~25):(25~45):(0.5~5). For example, in some embodiments, the cationic lipid is 25 parts, 30 parts, 35 parts, 40 parts, 45 parts, 50 parts, 55 parts, 60 parts, or 65 parts in proportion (relative molar number); the neutral lipid is 5 parts, 10 parts, 15 parts, 20 parts, or 25 parts; the structural lipid is 25 parts, 30 parts, 35 parts, 40 parts, or 45 parts; and the polymer-conjugated lipid is 0.5 parts, 1 part, 1.5 parts, 2 parts, 2.5 parts, 3.0 parts, 3.5 parts, 4.0 parts, 4.5 parts, or 5.0 parts.

[0113] In some embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (49-50):10:(38.5-39.5):1. For example, in some embodiments, by proportion (relative molar number), the cationic lipid is 49 or 50 parts, the neutral lipid is 10 parts, the structural lipid is 38.5, 39.0, or 39.5 parts, and the polymer-conjugated lipid is 1 part; for example, 50:10:38.5:1.5 or 49:10:39.5:1.5.

[0114] In this document, the term "polymer conjugated lipid" refers to a polyethylene glycol (PEG) modified lipid. Hydrophilic PEG stabilizes LNPs, modulates nanoparticle size by restricting lipid fusion, and increases the half-life of nanoparticles by reducing non-specific interactions with macrophages. In some embodiments, the polymer conjugated lipid is selected from one or more of the following: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol. The molecular weight of the PEG-modified PEG is typically 350–5000 Da. For example, the polymer conjugated lipid is selected from one or more of the following: distearate phosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristylglycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000), and methoxy polyethylene glycol bis(tetradecyl)acetamide (ALC-0159).

[0115] In one embodiment of the composition / carrier disclosed herein, the polymeric conjugated lipid is DMG-PEG2000.

[0116] In one embodiment of the composition / carrier disclosed herein, the carrier comprises neutral lipids, structural lipids, and polymer-conjugated lipids, wherein the molar ratio of the cationic lipids, the neutral lipids, the structural lipids, and the polymer-conjugated lipids is (25~65):(5~25):(25~45):(0.5~5), for example (45~55):(9~11):(34~43):(0.5~2.5).

[0117] In one embodiment of the composition / carrier disclosed herein, the carrier comprises neutral lipids, structural lipids, and polymer-conjugated lipids, wherein the molar ratio of the cationic lipids, the neutral lipids, the structural lipids, and the polymer-conjugated lipids is 50:10:38.5:1.5.

[0118] In this document, the term "alkyl" refers to a branched and straight-chain saturated aliphatic monovalent hydrocarbon group having a specified number of carbon atoms. The term "alkylene" in this disclosure refers to a branched and straight-chain saturated aliphatic divalent hydrocarbon group having a specified number of carbon atoms. Cn~m refers to a group having n to m carbon atoms. For example, C2~5 alkylene includes C2 alkylene, C3 alkylene, C4 alkylene, and C5 alkylene. C2~8 alkylene includes C2 alkylene, C3 alkylene, C4 alkylene, C5 alkylene, C6 alkylene, C7 alkylene, and C8 alkylene. C1~6 alkylene includes C1 alkylene, C2 alkylene, C3 alkylene, C4 alkylene, C5 alkylene, and C6 alkylene. C1~3 alkylene includes C1 alkylene, C2 alkylene, and C3 alkylene. C6-15 straight-chain alkyl groups include straight-chain alkyl groups having 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 carbon atoms. C12-25 branched-chain alkyl groups include branched-chain alkyl groups having 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 carbon atoms. The alkyl group (or alkylene group) may be unsubstituted or substituted, wherein at least one hydrogen atom is replaced by another chemical group.

[0119] In this document, a "therapeutic effective amount" is the amount of a therapeutic agent that improves a disease or symptom when administered to a patient. A "preventive effective amount" is the amount of a preventive agent that prevents a disease or symptom when administered to a subject. The amount of a therapeutic agent constituting a "therapeutic effective amount" or the amount of a preventive agent constituting a "preventive effective amount" varies depending on the therapeutic agent / preventive agent, the disease state and its severity, the age and weight of the patient / subject to be treated / prevented, etc. Those skilled in the art to which this invention pertains can conventionally determine the therapeutic effective amount and the preventive effective amount based on their knowledge and this disclosure.

[0120] In this document, the composition can be used to induce a protective immune response against VZV in subjects with this need, wherein the protective immune response includes, for example, the production of neutralizing antibodies. In some embodiments, the subject is immunocompromised. The subject is 10 years of age or older, for example, 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 years of age.

[0121] The vaccines disclosed herein are typically formulated in lipid nanoparticles. In some embodiments, the lipid nanoparticles comprise at least one ionizable cationic lipid, at least one non-cationic lipid, at least one sterol, and / or at least one polyethylene glycol (PEG) modified lipid.

[0122] In some preferred embodiments, the lipid nanoparticles include cationic lipids, neutral lipids, structural lipids, and polymer-conjugated lipids.

[0123] In some preferred embodiments, the cationic lipid is a compound of formula I, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G1 is a C1-6 alkylene; G2 is a C2-8 alkylene; G3 is a C1-3 alkylene; L1 is a C6-15 straight-chain alkyl; and L2 is a C12-25 branched-chain alkyl. For example, YK-009 of formula II (see patent CN114044741B). Formula I Formula II

[0124] In some preferred embodiments, the cationic lipid is a compound of formula II, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein: G1 is a C2-8 alkylene group; G2 is a C2-8 alkylene group; L1 is -C(O)O- or -OC(O)-; L2 is -C(O)O- or -OC(O)-; R1 is a C6-25 straight-chain or branched alkyl group; R2 is a C6-25 straight-chain or branched alkyl group; G3 is HO(CH2)2- or HO(CH2)3-; G4 is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-. For example, YK-401 of formula II-I and YK-402 of formula II-II (see patent CN115784921B). Formula II Formula II-I Formula II-II

[0125] In some preferred embodiments, the cationic lipid is a compound of formula III, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein: G1 is a C1-6 alkylene; G2 is a C2-8 alkylene; R1 is a C6-20 straight-chain or branched alkyl; R2 is a C12-25 branched alkyl; and G3 is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2)-, (HO(CH2)2)2N(CH2)2)-, CH3O(CH2)2N(CH3)(CH2)2), (CH3)2N(CH2)3SC(O)O(CH2)2)-, (CH3)2N(CH2)3SC(O))-, CH3NH(CH2)2N(CH3)(CH2)2) or CH3CH2NH(CH2)2-. For example, YK-201 with the structure of Formula III-I and YK-202 with the structure of Formula III-II (see patent CN115677518B). Formula III Formula III-I Formula III-II

[0126] In some preferred embodiments, the cationic lipid is a compound of formula IV, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G1 is a C1-8 alkylene; G2 is a C2-8 alkylene; R1 is a C6-25 straight-chain or branched alkyl; R2 is a C12-25 straight-chain or branched alkyl; and G3 is: HO(CH2)2N(R3)CH2CH(OH)CH2-, wherein R3 is -CH3, -CH2CH3, or -CH2CH2OH. For example, YK-305 of formula IV-I and YK-310 of formula IV-II (see patent CN115745820B). Formula IV Formula IV-I Formula IV-II

[0127] In some preferred embodiments, the cationic lipid is a compound of formula V, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G1 and G2 are each independently unsubstituted C6-C10 alkylene; G3 is unsubstituted C1-C12 alkylene; R1 and R2 are each independently C6-C24 alkyl or C6-C24 alkenyl; R3 is OR5, N, -C(=O)OR4, -OC(=O)R4, or –NR5C(=O)R4; R4 is C1-C12 hydrocarbon; and R5 is H or C1-C6 hydrocarbon; for example, ALC0315 of formula VI (see patent CN108368028B); Equation V can be found in (CN 108368028 B, ALC0315). Style VI

[0128] In some preferred embodiments, the cationic lipid is a compound of formula VI, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein R4 is selected from -(-(CH2)nQ and -(CH2)nCHQR; Q is selected from the group consisting of: -OR, -OH, -O(CH2)nN(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O) -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), -N(R)S(O)2R8 and heterocycles; n is 1, 2 or 3; for example, SM102 of the VI-I structure (see patent CN110520409A). Formula VI can be found in (CN 110520409A, SM102) Formula VI-I

[0129] In some preferred embodiments, the cationic lipid is a compound of formula VII, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer. See Formula VII (CN 102625696 B, DLIN-MC3-DMA).

[0130] In some more preferred embodiments, the cationic lipids include YK-009, YK-401, YK-305, ALC0315, SM102, and DLIN-MC3-DMA.

[0131] In some preferred embodiments, the molar ratio of the cationic lipid to the neutral lipid is 1:(1~10):1.

[0132] In some preferred embodiments, the molar ratio of the cationic lipid to the structural lipid is (1~5):1.

[0133] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer conjugated lipid is (25~75):(5~25):(15~65):(0.5~10).

[0134] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer conjugated lipid is (35~49):(7.5~15):(35~55):(1~5), for example, 49:10:43.5:1.5.

[0135] In some preferred embodiments, the neutral lipids include one or more of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterols and their derivatives.

[0136] In some more preferred embodiments, the neutral lipid is selected from one or more of the following: 1,2-dilinoleyl-sn-glycerol-3-phosphate choline (DLPC), 1,2-dimyristyl-sn-glycerol-3-phosphate choline (DMPC), 1,2-dilinoleyl-sn-glycerol-3-phosphate choline (DOPC), 1,2-dispalmitoyl-sn-glycerol-3-phosphate choline (DPPC), 1,2-distearateyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-diundecanoyl-sn-glycerol-3-phosphate choline (DUPC), 1-palmitoyl-2-oleyl-sn-glycerol-3-phosphate choline (POPC), 1,2-di-O-octadecenyl-sn-glycerol-3-phosphate choline (18:0 Diether 1,2-Olecaprylyl-2-cholesterolylhemisuccinyl-sn-glycerol-3-phosphate choline (OChemsPC), 1-hexadecyl-sn-glycerol-3-phosphate choline (C16 Lyso PC), 1,2-dilininyl-sn-glycerol-3-phosphate choline, 1,2-diarachidonicyl-sn-glycerol-3-phosphate choline, 1,2-bis(docosahexaenoenyl)-sn-glycerol-3-acid choline, 1,2-diolecaprylyl-sn-glycerol-3-phosphate ethanolamine (DOPE), 1,2-diphydanyl-sn-glycerol-3-phosphate ethanolamine (ME 16) .0PE), 1,2-distearate-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinolinyl-sn-glycerol-3-phosphate ethanolamine, 1,2-diarachidonicyl-sn-glycerol-3-phosphate ethanolamine, 1,2-bis(docosahexaenoyl)-sn-glycerol-3-phosphate ethanolamine, 1,2-dioleyl-sn-glycerol-3-phosphate-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyl oleyl Phosphatidylethanolamine (POPE), distearyl-phosphatidylethanolamine (DSPE), dipalmitinylphosphatidylethanolamine (DPPE), dimyristylphosphatidylethanolamine (DMPE), 1-stearyl-2-oleyl-stearylethanolamine (SOPE), 1-stearyl-2-oleyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmityloleylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), and mixtures thereof.

[0137] In some more preferred embodiments, the neutral lipid is DOPE and / or DSPC.

[0138] In some preferred embodiments, the structural lipid is selected from one or more of the following: cholesterol, non-steroidal alcohols, sitosterol, ergosterol, campesterol, stigmasterol, brassosterol, tomatine, ursolic acid, α-tocopherol, and corticosteroids.

[0139] In some more preferred embodiments, the structural lipid is cholesterol.

[0140] In some preferred embodiments, the polymeric conjugated lipid is selected from one or more of the following: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol.

[0141] In some more preferred embodiments, the polymeric conjugated lipid is selected from one or more of the following: distearate phospholipid ethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristyl glycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000), and methoxy polyethylene glycol bis(tetradecyl acetylamine) (ALC-0159).

[0142] Pharmaceutical formulations: This document provides compositions (e.g., pharmaceutical compositions), methods, kits, and reagents for the prevention or treatment of varicella-zoster virus, such as in humans and other mammals. The compositions provided herein can be used as therapeutic or preventative agents. They can be used in pharmaceuticals for the prevention and / or treatment of shingles.

[0143] In some implementations, a shingles vaccine containing RNA as described herein may be administered to a subject (e.g., a mammalian subject, such as a human subject), and the RNA polynucleotide may be translated in vivo to produce an antigenic polypeptide (antigen).

[0144] The “effective amount” of a composition (e.g., containing RNA) is based at least in part on the target tissue, target cell type, administration method, physical characteristics of the RNA (e.g., length, nucleotide composition, and / or degree of nucleoside modification), other components of the vaccine, and other determinants such as the subject’s age, weight, height, sex, and general health status. Typically, an effective amount of the composition provides an induced or enhanced immune response that varies with antigen production in the subject’s cells. In some embodiments, an effective amount of a composition containing an RNA polynucleotide with at least one chemical modification is more effective than a composition containing a corresponding unmodified polynucleotide encoding the same antigen or peptide antigen. Increased antigen production can be demonstrated by increased cell transfection (the percentage of cells transfected with an RNA vaccine), increased protein translation and / or expression from the polynucleotide, reduced nucleic acid degradation (e.g., as by an increased duration of protein translation from the modified polynucleotide), or alterations in the host cell’s antigen-specific immune response.

[0145] The term "pharmaceutical composition" refers to a combination of an active agent and an inert or active carrier, making the composition particularly suitable for in vivo or in vitro diagnostic or therapeutic use. A "pharmaceuticalally acceptable carrier" is one that does not cause undesirable physiological effects upon or during administration to a subject. The carrier in a pharmaceutical composition must also be "acceptable" in the sense that it is compatible with and stabilizes the active ingredient. One or more solubilizers may be used as pharmaceutical carriers for delivering the active agent.

[0146] In some embodiments, the compositions according to this disclosure (comprising polynucleotides and polypeptides encoded therein) can be used to treat or prevent herpes zoster. The compositions can be administered prophylactically or therapeutically to healthy individuals as part of an active immunization program, or early in the course of infection during the incubation period or during active infection following symptom onset. In some embodiments, the amount of RNA provided to cells, tissues, or subjects can be an amount effective for immunoprophylaxis.

[0147] In some embodiments, the composition may be administered via intramuscular injection.

[0148] Depending on the prevalence of infection or the extent or level of unmet medical needs, the composition can be used in a variety of settings. As a non-limiting example, RNA vaccines can be used to treat and / or prevent a variety of infectious diseases. RNA vaccines have superior properties because they produce much higher antibody titers, better neutralizing immunity, produce more durable immune responses, and / or generate responses earlier than commercially available vaccines.

[0149] This document provides pharmaceutical compositions comprising RNA and / or complexes, optionally combined with one or more pharmaceutically acceptable excipients. In addition to conventional excipients (e.g., any and all solvents, dispersion media, diluents or other liquid media, dispersing or suspending agents, surfactants, isotonic agents, thickeners or emulsifiers, preservatives), excipients may also include (but are not limited to) lipids, liposomes, lipid nanoparticles, polymers, lipid complexes, core-shell nanoparticles, peptides, proteins, RNA-transfected cells (e.g., for transplantation into a subject), hyaluronidase, nanoparticle mimics, and combinations thereof.

[0150] The RNA can be formulated or administered alone, or in combination with one or more other components. For example, the immune composition may contain other components, including but not limited to adjuvants.

[0151] The relative amounts of the active ingredient, pharmaceutically acceptable excipients, and / or any additional ingredients in the pharmaceutical compositions according to this disclosure will vary depending on the identity, body type, and / or condition of the subject being treated and, more particularly, on the route of administration of the composition. For example, the composition may contain between 0.1% and 100%, such as between 0.5% and 50%, between 1% and 30%, between 5% and 80%, and at least 80% (w / w) of the active ingredient.

[0152] In some implementations, one or more excipients are used to formulate RNA to increase mRNA stability, increase cell transfection efficiency and protein translation efficiency, and alter the biodistribution of mRNA to target specific tissues or cell types.

[0153] Administration / Prescription: This document provides immune compositions (e.g., RNA vaccines), methods, kits, and reagents for the prevention of varicella-zoster virus infection in humans and other mammals. The immune compositions can be used as therapeutic or prophylactic agents. In some embodiments, the immune compositions are used to provide prophylactic protection against shingles.

[0154] The object can be any mammal, including non-human primates and human objects.

[0155] In some embodiments, an immune composition (e.g., an mRNA vaccine) is administered in an effective amount to a subject (e.g., a mammalian subject, such as a human subject) to induce an antigen-specific immune response. RNA encoding the VZV gE antigen is expressed and translated in vivo to produce the antigen, which then stimulates the subject's immune response.

[0156] Prophylactic protection against shingles can be achieved after administration of the immunizing composition disclosed herein (e.g., an mRNA vaccine). The immunizing composition may be administered once, twice, three times, four times, or more, but it is possible that a single administration of the vaccine is sufficient (optionally followed by a single booster).

[0157] In this disclosure, methods are provided for inducing an immune response against varicella-zoster virus antigens (or multiple antigens) in a subject. In some embodiments, the method includes administering to the subject an immune composition comprising RNA (e.g., mRNA) having an open reading frame encoding the VZV gE glycoprotein, thereby inducing an immune response in the subject specifically against the varicella-zoster virus antigen, wherein the anti-antigen antibody titer in the subject increases after vaccination relative to the anti-antigen antibody titer in a subject vaccinated with a conventional vaccine (such as GSK's recombinant subunit vaccine). An "anti-antigen antibody" is a serum antibody that specifically binds to an antigen.

[0158] An effective preventive dose is a dose that is clinically acceptable in preventing viral infection. In some embodiments, the effective dose is the dose listed in the vaccine's instructions for use or packaging insert. As used herein, a conventional vaccine refers to a vaccine other than the mRNA vaccine disclosed herein. For example, conventional vaccines include (but are not limited to) live microbial vaccines, inactivated microbial vaccines, subunit vaccines, protein antigen vaccines, DNA vaccines, virus-like particle (VLP) vaccines, etc. In exemplary embodiments, a conventional vaccine is a vaccine that has been approved by a regulatory authority and / or registered with a national drug regulatory agency (such as the U.S. Food and Drug Administration (FDA) or the European Medicines Agency (EMA)).

[0159] In other aspects of this disclosure, a method for inducing an immune response against varicella-zoster virus in a subject is provided. The method includes administering to the subject an immune composition (e.g., an RNA vaccine) comprising an RNA polynucleotide containing an open reading frame encoding a VZV gE antigen, thereby inducing a varicella-zoster virus-specific immune response in the subject.

[0160] In other embodiments, the immune response is assessed by measuring proteins (antibody titers) in the subject. In still other embodiments, the ability of serum or antibodies from the immunized subject to neutralize viral uptake or reduce varicella-zoster virus conversion of human B lymphocytes is tested. In yet other embodiments, the ability to promote a robust T-cell response is measured using techniques recognized in the art.

[0161] This article also provides a method for inducing an immune response against varicella-zoster virus in a subject by administering RNA having an open reading frame encoding a first antigen, wherein the RNA does not include stabilizing elements and wherein the adjuvant is not co-formulated or co-administered with the vaccine.

[0162] Immunological compositions (e.g., RNA vaccines) can be administered via any route that produces a therapeutically effective outcome. These routes include (but are not limited to) intradermal, intramuscular, or subcutaneous administration. This disclosure provides methods for administering RNA vaccines to subjects in need. The exact amount required will vary depending on the subject's species, age and general condition, disease severity, the specific composition, its administration method, its mode of activity, etc. RNA is typically formulated in dose units for ease of administration and uniformity of dosage. However, it should be understood that the total daily dose of RNA may be determined by the attending physician within reasonable medical judgment. The specific therapeutic, prophylactic, or appropriate imaging dose level for any particular patient will depend on a variety of factors, including the condition being treated and its severity; the activity of the specific compound used; the specific composition used; the patient's age, weight, general health condition, sex, and diet; the timing, route of administration, and the rate of excretion of the specific compound used; the duration of treatment; drugs used in combination with or concurrently with the specific compound used; and similar factors well known in the medical field.

[0163] The effective amount of RNA provided herein can be as low as 5 μg, for example, administered as a single dose or two 2.5 μg doses. In some embodiments, the effective amount is a total dose from 5 μg to 200 μg. For example, the effective amount can be a total dose of 5 μg, 10 μg, 20 μg, 25 μg, 30 μg, 35 μg, 40 μg, 45 μg, 50 μg, 55 μg, 60 μg, 65 μg, 70 μg, 75 μg, 80 μg, 85 μg, 90 μg, 95 μg, 100 μg, 110 μg, 120 μg, 130 μg, 140 μg, 150 μg, 160 μg, 170 μg, 180 μg, 190 μg, or 200 μg. In some embodiments, the effective amount is a total dose from 5 μg to 200 μg. In some embodiments, the effective amount is a total dose of 10 μg. In some embodiments, the effective amount is a total dose of 20 μg. In some embodiments, the effective amount is a total dose of 75 μg. In some embodiments, the effective amount is a total dose of 150 μg. In some embodiments, the effective amount is a total dose of 200 μg.

[0164] Vaccine efficacy Some aspects of this disclosure provide formulations of immune compositions (e.g., RNA vaccines) wherein RNA is formulated in an effective amount to generate an antigen-specific immune response in a subject (e.g., to generate antibodies specific to varicella-zoster virus antigens). "Effective amount" is the dose of RNA that effectively generates an antigen-specific immune response. Methods for inducing an antigen-specific immune response in a subject are also provided herein.

[0165] As used herein, an immune response to the vaccine or LNP of this disclosure is a humoral and / or cellular immune response in a subject to (one or more) varicella-zoster virus proteins present in the vaccine. For the purposes of this disclosure, "humoral" immune responses refer to immune responses mediated by antibody molecules, including, for example, secretory (IgA) or IgG molecules, while "cellular" immune responses are immune responses mediated by T lymphocytes (e.g., CD4+ helper cells and / or CD8+ T cells (e.g., CTLs)) and / or other leukocytes. An important aspect of cellular immunity includes antigen-specific responses induced by cytolytic T cells (CTLs). CTLs are specific for peptide antigens presented and expressed on the cell surface, which are associated with proteins encoded by the major histocompatibility complex (MHC). CTLs help induce and promote the lysis of cells that have been infected with intracellular microbes or by other microbes. Another aspect of cellular immunity includes antigen-specific responses induced by helper T cells. Helper T cells help stimulate function and concentrate the activity of nonspecific effector cells on cells that display peptide antigens associated with MHC molecules on their surfaces. Cellular immune responses also result in the production of cytokines (e.g., IFN-γ, IL-2, TNF-β), chemokines, and other such molecules produced by activated T cells and / or other leukocytes.

[0166] In some embodiments, antigen-specific immune responses are characterized by measuring the titer of anti-varicella-zoster virus antigen antibodies generated in subjects treated with an immunizing composition as provided herein. Antibody titer is a measurement of the amount of antibody (e.g., an antibody specific to a particular antigen (e.g., anti-VZV gE glycoprotein) or an epitope of an antigen) within the subject. Antibody titers are typically expressed as the reciprocal of the maximum dilution that provides a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay used to determine antibody titers.

[0167] In some embodiments, antibody titers are used to assess whether a subject has been infected or to determine whether immunization is required. In some embodiments, antibody titers are used to determine the strength of an autoimmune response, to determine whether booster immunization is needed, to determine the effectiveness of a previous vaccine, and to identify any recent or prior infections. According to this disclosure, antibody titers can be used to determine the strength of an immune response induced in a subject by an immunizing composition (e.g., an RNA vaccine).

[0168] In some implementations, the anti-VZV gE antigen antibody titer generated in the subjects is at least 1 log higher than that in the control (unvaccinated subjects). For example, the anti-VZV gE antigen antibody titer generated in the subjects may be at least 1.5, at least 2, at least 2.5, at least 3 log, at least 3.5 log, or at least 4 log higher than that in the control. In some implementations, the anti-VZV gE antigen antibody titer generated in the subjects is 1, 1.5, 2, 2.5, or 3 log higher than that in the control. In some implementations, the anti-VZV gE antigen antibody titer generated in the subjects is 1 to 4 log higher than that in the control. For example, the anti-VZV gE antigen antibody titer generated in the subjects may be 1 to 1.5, 1 to 2, 1 to 2.5, 1 to 3, 1.5 to 2, 1.5 to 2.5, 1.5 to 3, 2 to 2.5, 2 to 3, or 2.5 to 4 log higher than that in the control.

[0169] In some implementations, the anti-VZV gE antigen antibody titer generated in the subjects is at least 2-fold higher than that of the control (received with the conventional vaccine GSK Shingrix®). For example, the anti-VZV gE antigen antibody titer generated in the subjects may be at least 1-fold, at least 1.5-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, or at least 3.5-fold higher than that of the control GSK.

[0170] In some embodiments, the control is the anti-varicella-zoster virus antigen-antibody titer generated in subjects who have not received an immunization composition (e.g., an RNA vaccine). In some embodiments, the control is the anti-varicella-zoster virus antigen-antibody titer generated in subjects who have received the recombinant subunit vaccine Shingrix®.

[0171] In some embodiments, the effectiveness of the immune composition (e.g., an RNA vaccine) is measured in a rodent model. For example, the immune composition may be administered to a rodent model, and the induction of neutralizing antibody titers in the rodent model may be determined. Viral challenge studies may also be used to evaluate the efficacy of the vaccine of this disclosure. For example, the immune composition may be administered to a rodent model, the rodent model may be challenged with a virus, and the survival and / or immune response (e.g., T cell response (e.g., cytokine response)) of the rodent model may be determined.

[0172] The present invention also relates to the following embodiments: 1. An immunogenic composition comprising ribonucleic acid (RNA) of varicella-zoster virus (VZV), said RNA encoding wild-type VZV gE glycoprotein or a variant thereof; The sequence of the wild-type VZV gE glycoprotein is SEQ ID NO:3. 2. The composition of embodiment 1, wherein the VZV gE glycoprotein variant comprises one or more of the following mutations relative to the wild-type VZV gE glycoprotein: sequence truncation, site mutation, and sequence deletion. 3. The composition as described in embodiment 1 or 2, wherein the sequence truncation includes the absence of a carboxyl-terminal tail domain. 4. The composition according to any one of embodiments 1 to 3, wherein the sequence truncation is selected from any one of the group consisting of: 1) Truncate amino acids 540-623 at the C-terminus of the gE protein; that is, retain amino acids 1-539 of the VZV gE protein; 2) Truncate amino acids 569-623 at the C-terminus of the gE protein; that is, retain amino acids 1-568 of the VZV gE protein; 3) Truncate amino acids 574-623 at the C-terminus of the gE protein; that is, retain amino acids 1-573 of the VZV gE protein; 4) Truncate amino acids 588-623 at the C-terminus of the gE protein; that is, retain amino acids 1-587 of the VZV gE protein; 5) Truncate amino acids 602-623 at the C-terminus of the gE protein; that is, retain amino acids 1-601 of the VZV gE protein. 5. The composition of any one of embodiments 2 to 4, wherein the VZV gE glycoprotein variant comprises a site mutation selected from: mutations in motifs associated with gE protein ER retention and endocytosis, and / or at least one site mutation in at least one motif associated with the Golgi apparatus or the anti-Golgi network, and at least one site mutation in a phosphorylated acidic motif at the C-terminus of gE; The motifs related to gE protein ER retention and endocytosis include the "Y582A583G584L585" motif (mutations in the Y582A583G584L585 can prevent gE protein endocytosis and reduce the localization of gE antigen to the trans-Horgosin network, such as the mutation site Y582A, YK-VZV-013 (SEQ ID NO:43)). The motifs associated with the location of gE protein in the Golgi apparatus or the anti-Golgi network include the "A568Y569R570V571" motif (e.g., the "A568Y569R570V571" motif, with a specific mutant antigen sequence such as YK-VZV-011 (SEQ ID NO:35); The C-terminal phosphorylated acidic motif of gE includes the motif "S593E594S595T596D597T598" (e.g., the "S593E594S595T596D597T598" motif is mutated to "A593E594A595A596D597A598" motif), which can reduce the localization of gE antigen to the trans-high-glucose network. The specific mutated antigen sequence is as follows: YK-VZV-010 (SEQ ID NO:31). 6. The composition of any one of embodiments 2 to 5, wherein the VZV gE glycoprotein variant comprises a site mutation selected from the group consisting of: A568D, Y569K, Y569A, R570E, V571K, Y582A, S593A, S595A, T596A, and T598A; for example, selected from A568D, Y569K, R570E, and V571K; for example, selected from A568D and Y569K. 7. The composition of any one of embodiments 2 to 6, wherein the variant of the VZV gE glycoprotein comprises a site mutation selected from: 1)A568D;Y569K;R570E;V571K; (YK-VZV-023, YK-VZV-011) 2)A568D;Y569A;R570E;V571K;(YK-VZV-024) 3)Y569K;R570E;V571K;(YK-VZV-025) 4)A568D;Y569K;R570E;V571K;Y582A;(YK-VZV-030, YK-VZV-013) 5)A568D;Y569K;R570E;V571K;Y582G;(YK-VZV-031, YK-VZV-038) 6)A568D;Y582A;(YK-VZV-032) 7)Y569K;Y582A;(YK-VZV-033, YK-VZV-009) 8)R570E;Y582A;(YK-VZV-034) 9)V571K;Y582A;(YK-VZV-035) 10)S593A;S595A;T596A;T598A;(YK-VZV-016, YK-VZV-044) 11)Y582A;S593A;S595A;T596A;T598A;(YK-VZV-037) 12)A568D;Y569K;R570E;V571K;Y582G;S593A;S595A;T596A;T598A;(YK-VZV-039) 13)A568D;Y569K;R570E;V571K;Y582A;S593A;S595A;T596A;T598A;(YK-VZV-014) 14)Y582G;S593A;S595A;T596A;T598A;(YK-VZV-040) 15)Y569K;Y582A;S593A;S595A;T596A;T598A;(YK-VZV-010) 16)A568D;Y569K;R570E;V571K;S593A;S595A;T596A;T598A;(YK-VZV-012) 17)Y582G;(YK-VZV-029) 18)A568D;(YK-VZV-018) 19)Y569K;(YK-VZV-020) 20)R570E;(YK-VZV-021) 21)V571K; and (YK-VZV-022) 22) Y582A; (YK-VZV-028, YK-VZV-036). 8. The composition as described in any one of embodiments 2 to 7, wherein the variant of the VZV gE glycoprotein comprises a site mutation selected from: 1)A568D;Y569K;R570E;V571K;(YK-VZV-011) 2)A568D;Y569A;R570E;V571K;(YK-VZV-024) 4)A568D;Y569K;R570E;V571K;Y582A;(YK-VZV-030, YK-VZV-013) 5)A568D;Y569K;R570E;V571K;Y582G;(YK-VZV-031, YK-VZV-038) 7)Y569K;Y582A;(YK-VZV-009) 13)A568D;Y569K;R570E;V571K;Y582A;S593A;S595A;T596A;T598A;(YK-VZV-014); 15)Y569K;Y582A;S593A;S595A;T596A;T598A;(YK-VZV-010) 16)A568D;Y569K;R570E;V571K;S593A;S595A;T596A;T598A;(YK-VZV-012) 18)A568D;(YK-VZV-018) 19)Y569K;(YK-VZV-020) 20)R570E;(YK-VZV-021) and 22)Y582A(YK-VZV-028). 9. The composition as described in any of embodiments 8, wherein the variant of the VZV gE glycoprotein comprises a sequence deletion selected from the following: 1) A568; 2) Y569RVDKSPYNQS579; and 3)Y569RVDKSPYNQSMYYAGLPV587. 10. The combination as described in any one of embodiments 1 to 9, wherein the variant of the VZV gE glycoprotein comprises a combination of site mutations, sequence truncations, and sequence deletions selected from the following: Name Sequence truncation Location mutation Sequence missing YK-VZV-018 gE(1-573) A568D No sequence deletion YK-VZV-020 gE(1-573) Y569K No sequence deletion YK-VZV-021 gE(1-573) R570E No sequence deletion YK-VZV-024 gE(1-573) A568D; Y569A; R570E; V571K No sequence deletion YK-VZV-028 gE(1-587) Y582A -Y569RVDKSPYNQS579- YK-VZV-030 gE(1-587) A568D; Y569K; R570E; V571K; Y582A No sequence deletion YK-VZV-031 gE(1-587) A568D; Y569K; R570E; V571K; Y582G No sequence deletion YK-VZV-038 Unordered truncation A568D; Y569K; R570E; V571K; Y582G No sequence deletion YK-VZV-009 Unordered truncation Y569K; Y582A No sequence deletion YK-VZV-010 Unordered truncation Y569K; Y582A; S593A; S595A; T596A; T598A No sequence deletion YK-VZV-011 Unordered truncation A568D; Y569K; R570E; V571K No sequence deletion YK-VZV-012 Unordered truncation A568D;Y569K;R570E; V571K;S593A; S595A; T596A; T598A No sequence deletion YK-VZV-013 Unordered truncation A568D;Y569K;R570E; V571K;Y582A No sequence deletion YK-VZV-014 Unordered truncation A568D;Y569K;R570E; V571K; Y582A;S593A; S595A; T596A; T598A No sequence deletion . 11. The composition according to any one of embodiments 1 to 10, wherein the variant of the VZV gE glycoprotein comprises a combination selected from site mutations, sequence truncations, and / or sequence deletions; name Sequence truncation Site mutation Sequence missing YK-VZV-018 gE(1-573) A568D No sequence deletion YK-VZV-020 gE(1-573) Y569K No sequence deletion YK-VZV-010 Unordered truncation Y569K; Y582A; S593A; S595A; T596A; T598A No sequence deletion YK-VZV-011 Unordered truncation A568D; Y569K; R570E; V571K No sequence deletion YK-VZV-013 Unordered truncation A568D;Y569K;R570E; V571K;Y582A No sequence deletion . 12. The composition according to any one of embodiments 1 to 11, wherein the variant of the VZV gE glycoprotein comprises a sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with the sequence of SEQ ID NO: 27, 31, 35, 39, 43, 47, 63, 71, 75, 87, 103, 111, 115, or 143. 13. The composition of any one of embodiments 1 to 12, wherein the variant of the VZV gE glycoprotein comprises SEQ ID NO: 31, 35, 43, 63 or 71. 14. The composition according to any one of embodiments 1 to 13, wherein the VZV RNA has an open reading frame (ORF) encoding the VZV gE glycoprotein or a variant thereof, the sequence of the open reading frame having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 26, 30, 34, 38, 42, 46, 62, 70, 74, 86, 102, 110, 114, or 142. 15. The composition of embodiment 14, wherein the sequence of the open reading frame is SEQ ID NO: 30, 34, 42, 62 or 70. 16. The composition of any one of embodiments 1 to 15, wherein the RNA of the VZV further comprises a 5′ untranslated region (UTR). 17. The composition of embodiment 16, wherein the 5' utr has a sequence as shown in SEQ ID NO: 173, 174, 175, 176 or 177. 18. The composition of embodiment 17, wherein the 5' utr has a sequence as shown in SEQ ID NO:174. 19. The composition of any one of embodiments 1 to 18, wherein the RNA of the VZV further comprises a 3′ untranslated region (UTR). 20. The composition of embodiment 19, wherein the 3' utr has a sequence as shown in SEQ ID NO: 178, 179, 180 or 181. 21. The composition of embodiment 20, wherein the 3' utr has a sequence as shown in SEQ ID NO:178. 22. The composition of any one of embodiments 1 to 21, wherein the RNA of the VZV further comprises a poly(A) tail. 23. The composition as described in embodiment 22, wherein the Ploy(A) tail has a length of 50 to 150 nucleotides. 24. The composition of any one of embodiments 1 to 23, wherein the VZV RNA further comprises a 5′ cap. 25. The composition as described in embodiment 24, wherein the 5′ end cap is 7mG(5′)ppp(5′)NlmpNp. 26. The composition of any one of embodiments 14 to 25, wherein the sequence of the open reading frames is codon-optimized. 27. The composition of embodiment 26, wherein the sequence of the open reading frame comprises at least one base modification. 28. The composition of embodiment 27, wherein the base modification is selected from one or more of the following: pseudouridine, N1-methylpseuuridine, N1-ethylpseuuridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseuuridine, 2-thio-1-methylpseuuridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuuridine, 2-thio-dihydrouridine, 2-thio-pseuuridine, 4-methoxy-2-thio-pseuuridine, 4-methoxy-pseuuridine, 4-thio-1-methylpseuuridine, 4-thio-pseuuridine, 5-aza-uridine, dihydropseuuridine, 5-methoxyuridine, and 2′-O-methyluridine. 29. The composition of embodiment 28, wherein the base modification is to replace uracil with pseudouridine and / or N1-methylpseudouridine. 30. The composition as described in embodiments 27, 28, or 29, wherein the base modification is 1% to 100% base modification, for example, 1% base modification, 2% base modification, 3% base modification, 4% base modification, 5% base modification, 6% base modification, 7% base modification, 8% base modification, 9% base modification, 10% base modification, 15% base modification, 20% base modification, 25% base modification, 30% base modification, 35% base modification, 40% base modification, 45% base modification, 50% base modification, 55% base modification, 60% base modification, 65% base modification, 70% base modification, 75% base modification, 80% base modification, 85% base modification, 90% base modification, 95% base modification, and 100% base modification; and a range with any of the above values ​​as endpoints. 31. The composition of any one of embodiments 1 to 30, wherein the sequence of the VZV RNA has at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 28, 32, 36, 40, 44, 48, 64, 72, 76, 88, 104, 112, 116, or 144. 32. The composition of embodiment 31, wherein the RNA of the VZV has a sequence as shown in SEQ ID NO: 32, 36, 44, 64 or 72. 33. The composition according to any one of embodiments 1 to 32, wherein the RNA of the VZV is mRNA. 34. The composition according to any one of embodiments 1 to 33, wherein the RNA encoding the VZV gE glycoprotein comprises an RNA sequence corresponding to a DNA sequence having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 25, 29, 33, 37, 41, 45, 61, 69, 73, 85, 101, 109, 113, or 141. 35. The composition of embodiment 34, wherein the RNA encoding the VZV gE glycoprotein has an RNA sequence corresponding to the DNA sequence shown in SEQ ID NO: 29, 33, 41, 61 or 69. 36. A method for preparing a composition as described in any one of embodiments 1 to 35, comprising: Provide a template for transcribing the RNA of the VZV; Transcription is performed using the template under conditions suitable for transcribing the RNA. 37. The method according to embodiment 36 further includes purification steps selected from: lithium chloride precipitation, affinity chromatography, ultrafiltration with fluid exchange, and cellulose chromatography. 38. The composition according to any one of embodiments 1 to 35 is a vaccine and further comprises a pharmaceutically acceptable carrier. 39. The composition of embodiment 38, wherein the carrier comprises a lipid mixture, such as lipid nanoparticles (LNP). 40. The composition as described in embodiment 38 or 39, wherein the vaccine is an mRNA vaccine. 41. The composition of embodiment 39 or 40, wherein the lipid mixture is lipid nanoparticles (LNPs), the lipid nanoparticles comprising, for example, cationic lipids, neutral lipids, structural lipids and polymer-conjugated lipids. 42. The composition of embodiment 41, wherein the cationic lipid is a compound of formula I, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G1 is a C1-6 alkylene; G2 is a C2-8 alkylene; G3 is a C1-3 alkylene; L1 is a C6-15 straight-chain alkyl; L2 is a C12-25 branched-chain alkyl; for example, the cationic lipid is YK-009 of formula II. Formula I Formula II. 43. The composition of embodiment 41, wherein the cationic lipid is a compound of formula II, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein: G1 is a C2-8 alkylene group; G2 is a C2-8 alkylene group; L1 is -C(O)O- or -OC(O)-; L2 is -C(O)O- or -OC(O)-; R1 is a C6-25 straight-chain or branched alkyl group; R2 is a C6-25 straight-chain or branched alkyl group; G3 is HO(CH2)2- or HO(CH2)3-; G4 is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-; for example, the cationic lipid is YK-401 of formula II-I or YK-402 of formula II-II. Formula II Formula II-I Formula II-II. 44. The composition of embodiment 41 above, wherein the cationic lipid is a compound of formula III, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein: G1 is a C1-6 alkylene; G2 is a C2-8 alkylene; R1 is a C6-20 straight-chain or branched alkyl; R2 is a C12-25 branched alkyl; and G3 is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2 -,(HO(CH2)2)2N(CH2)2-,CH3O(CH2)2N(CH3)(CH2)2-,(CH3)2N(CH2)3SC(O)O(CH2)2-,(CH3)2N(CH2)3SC(O)-,CH3NH(CH2)2N(CH3)(CH2)2- or CH3CH2NH(CH2)2-; for example, YK-201 with formula III-I structure, YK-202 with formula III-II structure. Formula III Formula III-I Formula III-II. 45. The composition of embodiment 41 above, wherein the cationic lipid is a compound of formula IV, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G1 is a C1-8 alkylene; G2 is a C2-8 alkylene; R1 is a C6-25 straight-chain or branched alkyl; R2 is a C12-25 straight-chain or branched alkyl; G3 is: HO(CH2)2N(R3)CH2CH(OH)CH2-, wherein R3 is -CH3 or -CH2CH3 or -CH2CH2OH; for example, YK-305 of formula IV-I, YK-310 of formula IV-II. Formula IV Formula IV-I Formula IV-II. 46. ​​The composition of embodiment 41 above, wherein the cationic lipid is a compound of formula V, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein G1 and G2 are each independently unsubstituted C6-C10 alkylene; G3 is unsubstituted C1-C12 alkylene; R1 and R2 are each independently C6-C24 alkyl or C6-C24 alkenyl; R3 is OR5, N, -C(=O)OR4, -OC(=O)R4, or –NR5C(=O)R4; R4 is C1-C12 hydrocarbon; and R5 is H or C1-C6 hydrocarbon; for example, ALC0315 of formula VI; Formula V Formula VI. 47. The composition of embodiment 41 above, wherein the cationic lipid is a compound of formula VI, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer, wherein R4 is selected from -(CH2)nQ and -(CH2)nCHQR; Q is selected from the group consisting of: -OR, -OH, -O(CH2)nN(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O) -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), -N(R)S(O)2R8 and heterocyclic rings; n is 1, 2 or 3; for example, SM102 of formula VI-I. Style VI Formula VI-I. 48. The composition as described in embodiment 41 above, wherein the cationic lipid is a compound of formula VII, or its N-oxide, solvate, pharmaceutically acceptable salt, or stereoisomer. Equation VII. 49. The composition of embodiment 41, wherein the cationic lipid is selected from YK-009, YK-401, YK-305, ALC0315, SM102 and DLIN-MC3-DMA. 50. The composition of any one of embodiments 41 to 49, wherein the molar ratio of the cationic lipid to the neutral lipid is (1 to 10):1. 51. The composition according to any one of embodiments 41 to 50, wherein the molar ratio of the cationic lipid to the structural lipid is (1 to 5):1. 52. The composition according to any one of embodiments 41 to 51, wherein the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer conjugated lipid is (25~65):(5~25):(25~45):(0.5~5). 53. The composition of embodiment 52, wherein the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer conjugated lipid is (49-50):10:(38.5-39.5):1.5, for example 50:10:38.5:1.5 or 49:10:39.5:1.5. 54. The composition according to any one of embodiments 41 to 53, wherein the neutral lipid is selected from phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterols, derivatives thereof, and any combination thereof. 55. The composition according to any one of embodiments 41 to 54, wherein the neutral lipid is selected from: 1,2-dilinoleyl-sn-glycerol-3-phosphate choline (DLPC), 1,2-dimyristyl-sn-glycerol-3-phosphate choline (DMPC), 1,2-dioleyl-sn-glycerol-3-phosphate choline (DOPC), 1,2-dipalmitoyl-sn-glycerol-3-phosphate choline (DPPC), 1,2-distearateyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-diundecanoyl-sn-glycerol-3-phosphate choline (DUPC), 1-palmitoyl-2-oleyl-sn-glycerol-3-phosphate choline (POPC), 1,2-di-O-octadecenyl-sn-glycerol-3-phosphate choline (18:0 Diether) 1,2-Olecaprylyl-2-cholesterolylhemisuccinyl-sn-glycerol-3-phosphate choline (OChemsPC), 1-hexadecyl-sn-glycerol-3-phosphate choline (C16 Lyso PC), 1,2-dilininyl-sn-glycerol-3-phosphate choline, 1,2-diarachidonicyl-sn-glycerol-3-phosphate choline, 1,2-bis(docosahexaenoenyl)-sn-glycerol-3-acid choline, 1,2-diolecaprylyl-sn-glycerol-3-phosphate ethanolamine (DOPE), 1,2-diphydanyl-sn-glycerol-3-phosphate ethanolamine (ME 16) .0PE), 1,2-distearate-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinolinyl-sn-glycerol-3-phosphate ethanolamine, 1,2-diarachidonicyl-sn-glycerol-3-phosphate ethanolamine, 1,2-bis(docosahexaenoyl)-sn-glycerol-3-phosphate ethanolamine, 1,2-dioleyl-sn-glycerol-3-phosphate-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyl oleyl Phosphatidylethanolamine (POPE), distearyl-phosphatidylethanolamine (DSPE), dipalmitinylphosphatidylethanolamine (DPPE), dimyristylphosphatidylethanolamine (DMPE), 1-stearyl-2-oleyl-stearylethanolamine (SOPE), 1-stearyl-2-oleyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmityloleylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), and mixtures thereof. 56. The composition of any one of embodiments 41 to 55, wherein the neutral lipid is DOPE and / or DSPC. 57. The composition of any one of embodiments 41 to 56, wherein the structural lipid is selected from: sterols, cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassosterol, tomatine, ursolic acid, α-tocopherol, corticosteroids, and any combination thereof. 58. The composition of embodiment 57, wherein the structural lipid comprises cholesterol, for example, cholesterol. 59. The composition of any one of embodiments 41 to 56, wherein the polymeric conjugated lipid is selected from: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and any combination thereof. 60. The composition of embodiment 59, wherein the polymeric conjugated lipid is selected from: distearate phospholipid ethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristyl glycerin-3-methoxy polyethylene glycol 2000 (DMG-PEG2000), methoxy polyethylene glycol bis(tetradecyl acetamide) (ALC-0159), and any combination thereof. 61. The composition according to any one of embodiments 38 to 60, wherein the effective dose of the VZV RNA is 25 μg to 200 μg; preferably 50 μg to 100 μg. 62. The composition of any one of embodiments 38 to 60, wherein the vaccine is an injectable preparation, such as a liquid preparation or a lyophilized preparation. 63. A method for preparing a composition as described in any one of embodiments 38 to 60, comprising: mixing the RNA of the VZV with the pharmaceutically acceptable carrier, for example, to encapsulate at least a portion of the RNA within lipid nanoparticles. 64. The method of embodiment 63 further includes a purification step, such as dialysis and / or filtration, to remove unencapsulated components. 65. The method of embodiment 64, wherein the uncoated component is selected from: uncoated RNA, non-aqueous solvents, and bacteria. 66. Use of the composition of any one of embodiments 1 to 62 in the preparation of a medicament for inducing a protective immune response against VZV in a subject, said protective immune response including, for example, the production of neutralizing antibodies. 66a. The composition of any one of embodiments 1 to 62, for inducing a protective immune response against VZV in a subject in which such a need exists, wherein the protective immune response includes, for example, the production of neutralizing antibodies. 66b. A method for inducing a protective immune response against VZV in a subject in need, comprising administering to the subject the composition of any one of embodiments 1 to 62, wherein the protective immune response comprises, for example, the generation of neutralizing antibodies. 67. The use, composition, or method according to embodiments 66, 66a, or 66b, wherein the subject is immunocompromised. 68. The use, composition, or method according to embodiments 66, 66a, 66b, or 67, wherein the subject is 10 years of age or older, such as 50, 60, 70, 80 years of age or older. 69. The use, composition, or method as described in any one of embodiments 66 to 68, wherein the protective immune response further includes a cellular immune response. 70. The use, composition, or method as described in any one of embodiments 66 to 69, wherein the induction of a protective immune response is for the prevention of VZV infection. 71. The use, composition, or method as described in any one of embodiments 66 to 69, wherein the induction of a protective immune response is for the prevention of VZV-related pain.

[0173] Example 1: VZV gE mutant antigen design. gE, a highly glycosylated type I membrane protein, can be transported between the endoplasmic reticulum (ER), trans-Golgi network (TGN), and endosomes. The gE protein has several important domains related to its main function. (1) The TM transfer domain is composed of amino acids at positions 539-559; (2) A568YRV571 motif: mediates the transport of gE between the endoplasmic reticulum (ER), trans-Golgi network (TGN), and endoplasm; (3) Y582AGL585 motif: mediates the transport of gE between the endoplasmic reticulum (ER), trans-Golgi network (TGN), and endoplasm; (4) S593ES595T596DT598 motif: an important glycosylation site; mediates the transport of gE between the endoplasmic reticulum (ER), the trans-Golgi network (TGN), and the endoplasm. The intracellular carboxyl terminus of gE plays a decisive role in its intracellular transport. Based on the important structural domains and functions of the gE protein, a series of mRNA antigens targeting mutations in key structural and functional domains of gE and mutations in different truncated forms were designed (as shown in Figure 1). Using the wild-type gE gene sequence of VZV virus (reference NCBI virus strain sequence number QXN54923.1) as a reference, a series of 43 different gE variant mRNA sequences were designed: Table 1 summarizes the mRNAs encoding variant gE antigens with different C-terminal sequences. In the table, YK-VZV-004, YK-VZV-006, YK-VZV-045, and YK-VZV-007 correspond to the mutations or combinations of mutations in the published patents (US11643441B1, CN114081943A, US20230233671A1, and CN108472309A), respectively. Table 1. Herpes zoster mRNA vaccine antigens SEQ ID NO: name Sequence truncation: (Truncate to) Site mutation Sequence missing 7 YK-VZV-002 gE(1-539) Wild-type WT (wild-type) / 11 YK-VZV-003 gE(1-568) WT / 59 YK-VZV-017 gE(1-573) WT / 15 YK-VZV-004 Y569A (Comparative Example 1) / 63 YK-VZV-018 A568D / 67 YK-VZV-019 A568 71 YK-VZV-020 Y569K / 75 YK-VZV-021 R570E / 79 YK-VZV-022 V571K / 83 YK-VZV-023 A568D; Y569K; R570E; V571K / 87 YK-VZV-024 A568D; Y569A; R570E; V571K / 91 YK-VZV-025 Y569K; R570E; V571K -A568- 95 YK-VZV-026 gE(1-587) WT 99 YK-VZV-027 Y569RVDKSPYNQS579 103 YK-VZV-028 Y582A Y569RVDKSPYNQS579 107 YK-VZV-029 Y582G Y569RVDKSPYNQS579 111 YK-VZV-030 A568D; Y569K;R570E; V571K; Y582A / 115 YK-VZV-031 A568D; Y569K;R570E; V571K; Y582G / 119 YK-VZV-032 A568D; Y582A / 123 YK-VZV-033 Y569K;Y582A / 127 YK-VZV-034 R570E;Y582A / 131 YK-VZV-035 V571K; Y582A / 171 YK-VZV-045 gE(1-623) full length Y582A (Comparative Example 3) / 3 YK-VZV-001 WT full length / 51 YK-VZV-015 Y569RVDKSPYNQS579 55 YK-VZV-016 S593A; S595A; T596A; T598A; Y569RVDKSPYNQS579 135 YK-VZV-036 Y582A Y569RVDKSPYNQS579 139 YK-VZV-037 Y582A; S593A; S595A; T596A; T598A Y569RVDKSPYNQS579 <所使用的术语“ 143 YK-VZV-038 A568D; Y569K;R570E; V571K; Y582G / 147 YK-VZV-039 A568D; Y569K; R570E; V571K; Y582G; S593A; S595A; T596A; T598A / 19 YK-VZV-006 Y569A; S593A; S595A; T596A; T598A (Comparative Example 2) / twenty three YK-VZV-007 Y582A; S593A; S595A; T596A; T598A (Comparative Example 4) / 151 YK-VZV-040 Y582G; S593A; S595A; T596A; T598A / 27 YK-VZV-009 Y569K; Y582A / 31 YK-VZV-010 Y569K; Y582A; S593A; S595A; T596A; T598A / 35 YK-VZV-011 A568D; Y569K; R570E; V571K / 39 YK-VZV-012 A568D;Y569K;R570E; V571K;S593A; S595A; T596A; T598A / 43 YK-VZV-013 A568D;Y569K;R570E; V571K;Y582A / 47 YK-VZV-014 A568D;Y569K;R570E; V571K; Y582A;S593A; S595A; T596A; T598A / 163 YK-VZV-043 / Y569RVDKSPYNQSMYYAGLPV587 167 YK-VZV-044 S593A; S595A; T596A; T598A Y569RVDKSPYNQSMYYAGLPV587 155 YK-VZV-041 gE(1-601) / Y569RVDKSPYNQSMYYAGLPV587 159 YK-VZV-042 / Y569RVDKSPYNQSMYYAGLPV587

[0174] Example 2: Preparation of VZV gE antigen mRNA vaccine. Transcription template linearization plastid preparation. All antigen gene fragments were artificially synthesized by Genscript Biotech Co., Ltd. and selected and colonized into the pVAX vector (purchased from Thermo Fisher Scientific Co., Ltd.) to obtain successfully constructed circular plastids. Template preparation involved linearizing plastids with BsaI restriction endonuclease (purchased from Shanghai Beyotime Biotechnology Co., Ltd.). The digestion system included supercoiled plastids containing the target gene corresponding to Example 1, 10×Digestion Buffer, BsaI restriction endonuclease, and RNase-free ddH2O. The digestion reaction was carried out at 37 ℃ for 3 h. The digestion system is shown in Table 2. Table 2 Enzyme digestion reaction system Components Dosage pDNA 1~2 μg 10×Digestion Buffer 5.0 μl BsaI (10 U / μl) 1.0 μl RNase-free ddH2O Up to 50 μl After the enzyme digestion reaction was completed, the linearized product was recovered using a DNA product purification kit (purchased from Yisheng Biotechnology Co., Ltd.), the product concentration was determined using a micro-ultraviolet spectrophotometer (Denovix), and the length and state of the linearized plastid template were detected by agarose gel electrophoresis. The preparation of mRNA stock solution involves in vitro co-transcriptional capping, a process of assembling modified or natural triphosphate nucleotides (NTPs) according to the template base sequence to prepare mRNA polynucleotides. Adding Clean Cap allows for one-step transcription to generate mRNA containing the Cap1 structure. The standard reaction process consists of the following systems (all purchased from Suzhou Nearshore Protein Technology Co., Ltd.): Table 3. In vitro co-transcriptional capping reaction system Components Dosage template cDNA 1.0 μg 10×Transcription Buffer 2.0 μl NTP (100 mM each) 2.0 μl each Cap1-GAG (100 mM) 2.0 μl RNase Inhibitor 0.5 μl T7 RNA polymerase 2.0 μl RNase-free ddH2O Up to 20 μl Incubate at 37°C for 2 hours After transcription was completed, 1 μl of DNase I (2 U / μl) was added, mixed well, and incubated at 37 ℃ for 20 min to remove template DNA. The transcription product was then purified by lithium chloride precipitation. 1) Add 30 μl of RNase-free H2O and 7.5 M lithium chloride (final lithium chloride concentration is 2.8 M) to 20 μl of the reaction mixture. 2) After mixing thoroughly, incubate at -20 ℃ for 2 h, centrifuge at 12000 rpm for 15 min, and discard the supernatant. Add 500 μl of 70% ethanol to wash the RNA precipitate; centrifuge at 12000 rpm for 5 min, repeat this step once, and collect the precipitate. 3) Air dry, add 100 μl of enzyme-free water to dissolve the mRNA precipitate, and store the purified RNA solution at -80℃. Measure the concentration and integrity of the mRNA. Preparation of mRNA-LNP (mRNA vaccine): Accurately weigh 20 mg of cationic lipids, DSPC, cholesterol, and DMG-PEG2000, dissolve them in anhydrous ethanol, and prepare a solution with a concentration of 10 mg / ml. Prepare a carrier mixture solution according to a molar ratio of 49:10:39.5:1.5 as the organic phase for later use. VZV mRNA was dissolved in 50 mM pH 4.0 citrate buffer and diluted to a 0.15 mg / ml solution for use as the aqueous phase. Using a BD 3 ml syringe, 2 ml of the organic phase was drawn, and using a BD 10 ml syringe, 7 ml of the aqueous phase was drawn. The left pump held the organic phase, and the right pump held the aqueous phase. The LNP intermediate solution was prepared in a microfluidic device. The preparation volume was 9.0 ml; the organic phase flow rate was 5.0 ml / min; the aqueous phase flow rate was 15 ml / min; and the LNP intermediate solution was collected. The LNP intermediate solution was diluted with 9 times its volume of PBS solution and concentrated by ultrafiltration on a small-scale ultrafiltration device with an ultrafiltration membrane pore size of 50 KD. When the concentration was about 10 ml, it was diluted with 4 times its volume of PBS solution and concentrated on the ultrafiltration device. Ultrafiltration was stopped when the final concentrated volume was less than 5 ml.

[0175] Example 3: Western Blot Detection of Herpes Zoster mRNA Vaccine Antigen Expression. To verify whether the designed antigen mRNA sequence can be expressed in cells and the efficiency of expression of different antigen sequences, the mRNA sequence was first transfected into cells, and Western Blot was used to detect the expression of antigen mRNA in cells. Table 4. Main Experimental Materials and Their Sources Material Name source 293T cells Purchased from ATCC Series of mRNA vaccines Preparation in Example 2 RIPA pyrolysis fluid Thermo Fisher BCA reagent kit Thermo Fisher Primary antibody (Anti-VZV gE protein antibody, mouse mAb) Abcam Secondary antibody (Goat Anti-Mouse IgG) Acro Experimental Procedure: Cell Culture and Transfection: 293T cells were seeded into 12-well plates at a rate of 2.5 × 10⁵ cells / well. The required volume of mRNA formulation for 500 ng mRNA was calculated, and the corresponding volume of mRNA formulation sample was directly added to the cells and mixed thoroughly. Experimental group: A mixture of protein samples obtained from cell lysis after transfection with the series of mRNA vaccines prepared in Example 2; Negative control NC: RIPA lysis buffer; Positive control PC:gE purified protein; Internal control protein loading control: Glyceraldehyde-3-phosphate dehydrogenase (GAPDH); Protein sample preparation: ① Sixteen hours after transfection, remove cells from the incubator. Use a pipette to repeatedly pipette until all cells are detached from the bottom of the dish. Transfer the cells to a 1.5 ml centrifuge tube and centrifuge at 1500 rpm for 3 min at 25 ℃. ② Discard the supernatant, add 1 ml of PBS, and resuspend the cells by pipetting; centrifuge at 1500 rpm for 3 min. ③ Repeat the above step twice. ④ Add 50 μl of RIPA lysis buffer to each cell tube (add 0.5 μl of 100× protein inhibitor to the RIPA lysis buffer before use), and incubate on ice for 30 min, vortexing the sample for 30 s every 5 min. ⑤ Pre-cool the centrifuge. After complete cell lysis, centrifuge the sample at 12000 rpm for 10 min at 4 ℃. Transfer the supernatant to a new 1.5 ml centrifuge tube to obtain the protein sample to be tested. Development as well as analysis: Quantitative detection of protein sample concentration was performed using BCA kit, 200 μl of BCA working fluid was added, 10 μl of sample to be tested; Aspirate 3 μg of sample (9 μl) for dotting, marker how to 4 μl, and electrophoresis at 200V for 30 min, respectively. Transfer membranes Using a dry transfer instrument, the glue was removed and a transfer membrane “sandwich” was made, covered with a negative plate, 21V, 23V, and 25V for 1, 4, 2 min, respectively; Primary antibody incubation: 1 h at room temperature. Antibody preparation (1:2000-fold dilution): 7.5 μl of antibody was aspirated and 15 ml of the primary antibody (Anti-VZV gE protein antibody, mouse mAb) dilution was added. Wash film: wash solution using 1×TBST buffer solution, 5 min / time, 3 times. Secondary antibody incubation: 1 h at room temperature. Antibody preparation (1:1000-fold dilution): Aspirate 30 μl of antibody and add 30 ml of secondary antibody (Goat Anti-Mouse IgG) dilution. Wash film: The wash solution was washed using 1×TBST buffer solution diluted in distilled water for 5 min / time for 3 times. Color development: 1 ml each of the developer and fixer solution was mixed 1:1, added dropwise to the film for color development, and photographed. Intrinsic reference protein GAPDH: The relative intensity is consistent, indicating the same amount of sample loading between different samples, on which basis the strength of expression between different samples is compared. Negative control NC: only the internal reference part with the corresponding band, no corresponding band in the target protein region, meeting the negative control requirements; In the case of reasonable anion settings and clear bands, to determine whether the experimental sample is expressed, and the relative expression is high or low, the results of the protein sample mixture obtained after lysis treatment of the series mRNA vaccine prepared in Example 2 are shown in Figure 2 of this instruction manual.

[0176] Example 4: Balb / c Mice Immunization Experimental Material Animals: Balb / c mice, female, 6~8 weeks; Subjects: 1) an mRNA vaccine corresponding to an expressed antigen in Example 3; 2) an LNP sample (an mRNA-free LNP sample prepared in Example 2); Grouping: Randomization according to body weight, 5 mice per group; Animal immunization: Mice were immunized on day 0 and day 28 with either the solvent or the test substance (liquid mRNA vaccine prepared in Example 2) via intramuscular injection into the gastrocnemius muscle. The volume and dosage are shown in the table below. Table 5. Immunization regimen for mice Group Animal numbers immunity Blood collection time execution time vaccine under test Inoculation dose (µg / animal) Inoculation volume (μl / animal) way frequency 1 5 solvent 0 100 Intramuscular injection (gastrocnemius muscle) Day 0, 28 Blood samples were taken from the orbital vein on days 42 and 56. Spleen removed on day 56 2 5 YK-VZV-001 10 100 3 5 YK-VZV-003 10 100 4 5 YK-VZV-004 10 100 5 5 YK-VZV-006 10 100 6 5 YK-VZV-007 10 100 7 5 YK-VZV-009 10 100 8 5 YK-VZV-010 10 100 9 5 YK-VZV-011 10 100 10 5 YK-VZV-012 10 100 11 5 YK-VZV-013 10 100 12 5 YK-VZV-014 10 100 13 5 YK-VZV-015 10 100 14 5 YK-VZV-016 10 100 15 5 YK-VZV-017 10 100 16 5 YK-VZV-018 10 100 17 5 YK-VZV-019 10 100 18 5 YK-VZV-020 10 100 19 5 YK-VZV-021 10 100 20 5 YK-VZV-022 10 100 twenty one 5 YK-VZV-023 10 100 twenty two 5 YK-VZV-024 10 100 Table 5 (continued) Group Animal numbers immunity Blood collection time execution time vaccine under test Inoculation dose (µg / animal) Inoculation volume (μl / animal) way frequency twenty three 5 YK-VZV-025 10 100 Intramuscular injection (gastrocnemius muscle) Day 0, 28 twenty three Blood samples were taken from the orbital vein on days 42 and 56. Spleen removed on day 56 twenty four 5 YK-VZV-026 10 100 25 5 YK-VZV-027 10 100 26 5 YK-VZV-028 10 100 27 5 YK-VZV-029 10 100 28 5 YK-VZV-030 10 100 29 5 YK-VZV-031 10 100 30 5 YK-VZV-032 10 100 31 5 YK-VZV-033 10 100 32 5 YK-VZV-034 10 100 33 5 YK-VZV-035 10 100 34 5 YK-VZV-036 10 100 35 5 YK-VZV-037 10 100 36 5 YK-VZV-038 10 100 37 5 YK-VZV-039 10 100 38 5 YK-VZV-040 10 100 39 5 YK-VZV-044 10 100 40 5 YK-VZV-045 10 100 41 5 LNP 10 100 42 5 Shingrix® 10 100 Sample collection and pretreatment: Approximately 0.2 ml of blood was collected from the orbital venous plexus of each animal. The serum was separated (centrifuged at 4000 rpm / min for 10 min at 4 ℃) and stored in a 4 ℃ refrigerator for further processing. Health monitoring should be conducted twice daily (once in the morning and once in the afternoon), including but not limited to death, onset of illness, respiration, secretions, feces, and food and water intake. According to the IACUC protocol, any mouse that loses more than 20% of its body weight during the experiment (based on the body weight on day 0 before infection and on the body weight on the day of infection after infection), or / and shows signs of imminent death, will be euthanized and recorded as a dead animal in the results. Example 5: Enzyme-linked immunosorbent assay (ELISA) for detecting the titer of gE protein-specific IgG antibody in Balb / c mouse serum. Main experimental materials and sources: Varicella-zoster virus (VZV) IgG (human) titer ELISA kit (gE protein) was purchased from Beijing Baipusai Biotechnology Co., Ltd. The kit contained 1× washing buffer, positive control working solution, negative control working solution, dilution buffer, HRP-Goat anti-Mouse IgG, Substrate Solution, Stop Solution, and an ELISA plate. Experimental Step 1) Preparation of working solutions: Prepare 1×washing buffer: Take 50 ml of 10×washing buffer, dilute with ultrapure water or deionized water and bring the volume to 500 ml. Prepare positive control working solution and negative control working solution. 2) Sample pretreatment: Blood samples obtained on day 42 and day 56 from Example 4. 3) Antibody titer detection: The test sample, positive control PC and negative control NC were diluted with Dilution buffer from 1:100 to 1:102400. 4) Numbering: Number the diluted samples according to the wells of the ELISA plate. Set up PC working solution and NC working solution for each experiment. 5) Sample addition: Add 100 μl of diluted sample, positive control working solution, and negative control working solution to the corresponding wells. Shake to mix and incubate at 37 °C for 1.0 h. 6) Washing: Discard the liquid in the wells, blot dry the microplate, wash with 1× washing buffer (300 μl / well for 30 s), blot, wash a total of 3 times, and blot dry. 7) Add HRP enzyme label: Dilute HRP-Goat anti-Mouse IgG 1000 times with Dilution buffer, add 100 μl to each well, and incubate at 37 ℃ for 1.0 h. 8) Wash the plate: Repeat step 6 to wash the plate 3 times. 9) Color development: Add 100 μl of Substrate Solution to each well and incubate at 37 °C in the dark for 20 min. 10) Termination: Add 50 μl of Stop Solution to each well and shake the microplate until well mixed. 11) Reading: Use an ELISA reader to measure the absorbance of each well at wavelengths of OD450 nm and OD630 nm, with 630 nm as the background. Read the values ​​within 3 minutes after termination. 12) Interpretation of test results: Antibody positive determination: OD450nm-OD630nm ≥ 0.1.

[0177] Example 6: Multiparameter Flow Cytometry (FCM) Detection of the Proportion of CD4+ T Cells and CD8+ T Cells Secreting IFN-γ and IL-2 in the Spleen of Balb / c Mice. The role of immune checkpoint inhibitors is to prevent T cell exhaustion. Immune cell function is assessed by detecting cytokine production in tumor samples. In the event of inflammation or host immune defense, T cells and NK cells respond by producing interferon-gamma (IFN-γ). Multiparameter flow cytometry (FCM) was used to quantitatively analyze IFN-γ-producing CD8+ or CD4+ T cells in the mouse spleen. Interferon-gamma (IFN-γ) is a soluble dimeric cytokine and the only member of the type II interferon family. It is primarily secreted by natural killer (NK) cells and natural killer T cells (NKT) and plays a role in innate immunity; in antigen-specific immunity, it is secreted by CD4 Th1 and CD8 cytotoxic T cells. IFN-γ or type II interferon plays an important role in innate and adaptive immunity against viral, certain bacterial, and protozoan infections. IFN-γ is an important macrophage activator and an inducer of type II major histocompatibility complex (MHC II) expression. Interleukin-2 (IL-2) is a cytokine belonging to the chemokine family. It is a cytokine with multiple cell origins (mainly produced by activated T cells) and multi-directional functions (mainly promoting lymphocyte growth, proliferation, and differentiation); it plays an important role in the body's immune response and antiviral infection, and can stimulate the proliferation of T cells that have been activated by specific antigens or mitogenic factors; it can activate T cells and promote cytokine production; it can stimulate NK cell proliferation, enhance NK killing activity and produce cytokines, induce the production of lymphokine-activated killer cells (LAK); promote B cell proliferation and antibody secretion; and activate macrophages. Detection method: FCM (multi-parameter flow cytometry). Test sample: Spleen harvested on day 56 of the immunized mouse model in Example 5. Objective: To determine the proportions of CD4+ T cells and CD8+ T cells secreting IFN-γ and IL-2 in the spleen of mice. Testing indicators: CD4+(IFN-γ+): The total number of CD4+ T cells that produce IFN-γ; CD4+ (IL-2+): The total number of CD4+ T cells that produce IL-2; CD4+(IFN-γ+IL-2+): The number of CD4+ T cells that simultaneously produce IFN-γ and IL-2; CD4+ (IFN-γ+ or IL-2+): The number of all CD4+ T cells that produce IFN-γ or IL-2; CD8+(IFN-γ+): The total number of CD8+ T cells that produce IFN-γ; CD8+ (IL-2+): The total number of CD8+ T cells that produce IL-2; CD8+(IFN-γ+IL-2+): The number of CD8+ T cells that simultaneously produce IFN-γ and IL-2; CD8+ (IFN-γ+ or IL-2+): The number of all CD8+ T cells that produce IFN-γ or IL-2. Table 6. Main sources of reagents for experimental materials and sample testing reagents name Manufacturer Fetal bovine serum (FBS) ExCell Bio RPMI 1640 medium GIBCO Penicillin-streptomycin mixture GIBCO Phosphate-buffered saline (PBS) Biotopped 10x RBC Lysis Buffer (M μlti-species) Thermo Fisher Zombie Violet™ Fixable Viability Kit Biolegend Protein Transport Inhibitor (Brefeldin A Solution) Biolegend Fixation and Permeabilization Solution BD Perm / Wash Buffer BD Ionomycin / PMA Sigma PerCP / Cyanine5.5 anti-mouse CD3 Biolegend FITC anti-mouse CD4 Biolegend Alexa Fluor® 700 anti-mouse CD8a Biolegend APC anti-mouse IFN-γ Biolegend PE anti-mouse IL-2 Biolegend Cell Staining Buffer Biolegend Prepare the reagents according to the required amount for the experiment. All reagents are prepared in volume ratios. FBS inactivation: Place the FBS stored at -20 ℃ at 4 ℃ to melt, place it in a 56 ℃ water bath for 30 min to inactivate, filter it through a 0.22 μm filter, and store it at 2~8 ℃. It has a shelf life of 14 days. Preparation of 1 × RBC Lysis Buffer: Dilute 10 × RBC Lysis Buffer (Mμlti-species) with sterile water to make 1 × RBC Lysis Buffer, mix well and set aside. Prepare a complete culture medium containing 1% antibiotics: The complete culture medium is prepared according to the ratio of RPMI-1640:inactivated FBS = 9:1. The complete culture medium containing 1% penicillin and streptomycin should be prepared according to a ratio of 99:1 (complete culture medium: penicillin / streptomycin mixture). After mixing, store at 2–8 °C for 14 days. Equilibrate to room temperature before use. PMA / Ionomycin positive stimulant working solution: Add 400 μl of PMA working solution and 80 μl of ionomycin (ION) to 19.520 ml of complete culture medium containing 1% penicillin and antibiotics to prepare the positive stimulant working solution. Prepare and use immediately. The final concentration of PMA is 1 μg / ml, and the final concentration of ionomycin (ION) is 2 μg / ml. Negative control: Complete culture medium containing 1% penicillin and antibiotics. Prepare the working solution for the peptide: Protein Transport Inhibitor working solution, dilute the stock solution 50 times with complete culture medium containing 1% penicillin and antibiotics. Live / Dead working solution: Dilute Zombie Violet™ Fixable Viability solution 1000 times with 1×PBS. Surface staining antibody: Taking the amount needed for one well as an example, prepare the surface staining antibody according to the proportions in the table below, and mix thoroughly by pipetting. Store at 2°C~8°C protected from light for later use. Table 7 Preparation of Surface Staining Antibodies Antibody name antibody volume / well Cell Staining Buffer PerCP / Cyanine5.5 anti-mouse CD3 2 μl / test 45.2 μl FITC anti-mouse CD4 2 μl / test Alexa Fluor® 700 anti-mouse CD8a 0.8 μl / test 1× Perm / Wash Buffer: Dilute 10× Perm / Wash Buffer 10 times with ultrapure water. Intracellular staining antibody: Taking the amount needed to prepare one well as an example, prepare the intracellular staining antibody according to the proportions in the table below, and mix thoroughly by pipetting. Store temporarily at 2°C ~ 8°C protected from light for later use. Table 8. Preparation of Intracellular Staining Antibodies Antibody name antibody volume / well 1×Perm / Wash Buffer APC anti-mouse IFN-γ 2 μl / test 44 μl PE anti-mouse IL-2 2 μl / test Preparation of cryopreservation solution: Prepare according to FBS∶DMSO = 9∶1, and use immediately after preparation. Procedure for isolating mouse spleen cells: 1) Place a cell filter in a 6-well plate containing 4 ml of complete culture medium with 1% penicillin-dextrose antibiotics. Place the spleen separately on the cell filter. Using the plunger of a syringe, gently crush or grind the spleen on the cell filter. Filter the resulting cell suspension through the cell filter into a 15 ml centrifuge tube. Add 1-2 ml of complete culture medium with 1% penicillin-dextrose antibiotics to wash the 6-well plate. Filter the resulting liquid into a 15 ml centrifuge tube. Centrifuge at 20 ºC, 500 g for 5 min. Discard the supernatant. 2) Resuspend the cells in 2 ml of 1×RBC Lysis Buffer and lyse for 5 ± 1 min. Centrifuge at 20 ºC, 500 g for 5 min. Discard the supernatant. Wash the cells with 5 ml of complete culture medium containing 1% penicillin and antibiotics, and centrifuge at 20 ºC, 500 g for 5 min. Discard the supernatant. 3) Resuspend the cells in 10 ml of complete culture medium containing 1% penicillin and antibiotics. After mixing, immediately transfer 100 μl of the cell suspension to an EP tube. Then transfer 10 μl of the cell suspension and 10 μl of fluorescence staining solution to the EP tube. After mixing, transfer 10 μl of the mixture to a fluorescence counter to count the total number of viable cells and the cell viability. 4) Centrifuge the cells in a 15 ml centrifuge tube at 20 ºC and 400 g for 5 min. Discard the supernatant and resuspend the cells in fresh complete culture medium containing 1% penicillin and antibiotics. Adjust the viable cell concentration of each sample to 1×107 cells / ml. 5) After the samples are plated, the remaining cells are centrifuged at 20ºC and 400 g for 5 min. The cell concentration is adjusted to (1-2)×107 cells / ml using cryopreservation solution. The cells are aliquoted into pre-labeled cryopreservation tubes at 1 ml / tube and placed in a programmed cooling box. The tubes are then frozen at -70ºC or below. After 12-24 hours, the cells are transferred to a liquid nitrogen tank for long-term storage. Stimulation of mouse spleen cells 1) Stimulation of mouse spleen cells was performed in 96-well U-shaped plates, with the experimental date marked on the plate. 2) Set up positive control wells, negative control wells, and peptide wells according to the experimental requirements. Add 100 μl of negative control to each negative control well, add 100 μl of positive stimulus working solution to each positive control well, add 100 μl of peptide working solution to each peptide well, and then add 100 μl of cell suspension to each positive control well, negative control well, and peptide well. 3) Place the 96-well plate in a 37 ºC, 5% CO2 incubator for 2 h ± 5 min to stimulate. Then add 10 μl of Protein Transport Inhibitor working solution per well, mix well, and continue to place the plate in a 37 ºC, 5% CO2 incubator for 18 h ± 10 min to stimulate. Finally, remove the round-bottom 96-well plate for flow cytometry staining. 4) Note: The experimental procedures in this section must be performed in a biosafety cabinet, and all reagents must be sterile. Cell staining 1) Washing the stimulated sample: After removing the round-bottom 96-well plate, centrifuge at 500 g, 4 ºC for 5 min and discard the supernatant. Add 200 μl of PBS to each well, resuspend and mix, centrifuge at 500 g, 4 ºC for 5 min and discard the supernatant. 2) Live / Dead staining: Add 50 μl of the prepared Live / Dead working solution to each well, resuspend and mix well, and stain at 2 ºC ~ 8 ºC in the dark for 30 min. After staining, add 150 μl of PBS to each well, centrifuge at 500 g, 4 ºC for 5 min, and discard the supernatant. 3) Surface staining: Add 50 μl of surface staining antibody to each well, resuspend and mix well, and stain at 2 ºC ~ 8 ºC in the dark for 30 min. Add Cell Staining Buffer at 150 μl / well to stop staining, centrifuge at 500 g, 4 ºC for 5 min, and discard the supernatant. 4) Cell fixation and permeabilization: Add 100 μl of Fixation and Permeabilization Solution to each well, resuspend and mix well, and incubate at 4 ºC in the dark for 20 min. Terminate by adding 1×Perm / Wash Buffer to each well, centrifuge at 500 g, 4 ºC for 5 min, and discard the supernatant. 5) Intracellular staining: Add 50 μl of intracellular staining antibody to each well, resuspend and mix well, and incubate at 4 ºC in the dark for 50 min. Add 1×Perm / Wash Buffer at 150 μl / well to stop staining, centrifuge at 500 g, 4 ºC for 5 min, and discard the supernatant. Add 1×Perm / Wash Buffer at 200 μl / well, resuspend and mix well, centrifuge at 500 g, 4 ºC for 5 min, and discard the supernatant. 6) Filtration: Add 200 μl of Cell Staining Buffer to each well, resuspend and mix well. Filter the cell suspension through a 300-mesh nylon mesh into new wells. Example of sample numbering: "01-P-1", where "01" is the sample number, "P" represents a positive well, and the final "1" represents the well number. Instrument used for testing: Flow cytometer (Cytoflex); Instrument acquisition parameters: The acquisition flow rate is set to high speed, and the number of cells recorded is 100,000 cells collected under the lymphocyte phylum. Data processing and analysis: Circle CD3+ cells, then circle CD4+ cells and CD8+ cells separately. From CD4+ cells, circle the CD4+(IFN-γ+) subset and CD4+(IL-2+) subset; from CD8+ cells, circle the CD8+(IFN-γ+) subset and CD8+(IL-2+) subset. Data calculation formula: All values ​​in this test are statistically expressed as a percentage; valid value = mean value of peptide wells - mean value of negative wells. All values ​​are rounded to one decimal place.

[0178] Example 7: Detection of IFN-γ and IL-2 Cytokines Secreted by Balb / c Mouse Spleen Cells using Enzyme-Linked Immunospot Assay (ELISPOT). ELISPOT is a more sensitive detection method in cellular immunology research, capable of detecting antibody-secreting cells (ASCs) and cytokine-secreting cells at the single-cell level. It has higher sensitivity than ELISA and limiting dilution methods, detecting one cell secreting the protein from 200,000-300,000 cells. Furthermore, this method can perform functional detection on live cells after antigen stimulation, exhibiting high specificity, high reliability, and ease of operation. It has been widely used in the detection of CK-secreting cells or the assay of ASCs, and has gained widespread application in the immunology community both domestically and internationally. Lymphocytes locally produce cytokines after antigen stimulation, and these cytokines are captured by specific monoclonal antibodies (pre-coated) on the PVDF membrane at the bottom of the ELISPOT plate. After cell removal, the captured cytokines bind to biotin-labeled monoclonal antibodies, and subsequently to avidin labeled with alkaline phosphatase or wasabi peroxidase. Following substrate addition and color development, purple or reddish-brown spots appear on the PVDF membrane, indicating cytokine production by the cells. These spots are then automatically counted and analyzed using an ELISPOT Reader. The spleen organs were harvested from the mouse model of Example 6, and the levels of IFN-γ and IL-2 secreted by spleen cells after stimulation by the peptide library were detected on day 56 post-immunization. Sample processing: Procedure for isolating and cryopreserving mouse spleen cells. Elispot method: Detect the levels of IFN-γ and IL-2 in the supernatant of spleen cells after stimulation with a peptide library. Main Reagents Table 9 Sample Detection Reagents name source mouse spleen cells Myrade FBS ExCellBio RPMI-1640 medium GIBCO DMSO Sigma Phosphate-buffered saline (1×PBS) Biotopped Phosphate-buffered saline (20×PBS) Solarbio Phlorizol 12-Myristate 13-Acetate (PMA) Sigma Ionicin (ION) Sigma Penicillin-streptomycin mixture Gibco ELISpot Plus: Mouse IFN-γ (HRP) MabTech ELISpot Plus: Mouse IL-2 (HRP) MabTech Preparation of test solution 1) FBS inactivation: Place the FBS stored at -20 ºC to thaw at 4 ºC, place it in a 56 ºC water bath for 30 min to inactivate, filter it through a 0.22 μm filter, and store it at 2~8 ºC for 30 days. 2) Preparation of PMA working solution: Add 1 ml of DMSO to the PMA reagent bottle to dissolve the PMA powder, then transfer it to a 15 ml centrifuge tube. Rinse the PMA reagent bottle with 1 ml of DMSO, combine the rinsing solution with the 15 ml centrifuge tube, add 8 ml of DMSO to the 15 ml centrifuge tube, mix well, and prepare a PMA working solution with a concentration of 100 μg / ml. Store at -20 ºC protected from light. 3) Preparation of ION working solution: Add 2 ml of DMSO to the ION reagent bottle to dissolve the PMA powder, then transfer it to a 15 ml centrifuge tube. Rinse the PMA reagent bottle with 1 ml of DMSO, repeating the rinsing step twice (3 times in total, 1 ml each time). Combine the rinsing solutions into a 15 ml centrifuge tube, then add 5 ml of DMSO to the 15 ml centrifuge tube, mix well, and prepare an ION working solution with a concentration of 1 mg / ml. Store at -20 ºC. 4) Prepare complete culture medium containing 1% penicillin and streptomycin: Prepare complete culture medium according to RPMI-1640:inactivated FBS = 9:1, and prepare complete culture medium containing 1% penicillin and streptomycin according to complete culture medium:penicillin-streptomycin mixture = 99:1. Mix well and store at 2-8 ºC. Shelf life is 14 days. Equilibrate to room temperature before use. 5) Preparation of positive stimulus working solution: Add 400 μl of PMA working solution and 80 μl of ionomycin (ION) to 19.520 ml of complete culture medium to prepare the positive stimulus working solution. Prepare and use immediately. The final concentration of PMA is 2 μg / ml, and the final concentration of ION is 4 μg / ml. 6) Preparation of polypeptide working solution: ① Preparation of gE peptide library solution Add 100 μl of DMSO to each tube of lyophilized powder to dissolve it, resulting in a peptide concentration of 1 mg / ml / peptide per tube. Add 900 μl of PBS to the dissolved peptide solution to adjust the gE peptide library concentration to 100 μg / ml / peptide. ② Prepare gE working solution The working solution was prepared by mixing gE peptide library solution and complete culture medium containing 1% penicillin antibiotics at a ratio of 1:50, and the concentration of gE working solution after mixing was 2 μg / ml / peptide. Negative control: The negative control is a complete culture medium containing 1% penicillin and antibiotics. 7) Prepare 1×PBS solution: Prepare according to 20×PBS: pure water = 1:19, store at room temperature, and use immediately after preparation. 8) Prepare PBS containing FBS: Prepare PBS (Biotopped) : inactivated FBS at a ratio of 200 : 1, and use immediately. 9) Antibody preparation: ① Preparation of R4-6A2-biotin: R4-6A2-biotin ∶ PBS containing FBS = 1 ∶ 1000, prepare fresh and use immediately. ② Preparation of 5H4-biotin: 5H4-biotin ∶ PBS containing FBS = 1 ∶ 1000, prepare fresh and use immediately. Experimental Step 1) Take the spleen organ from the mouse model of Example 6, and detect the content of IFN-γ and IL-2 secreted by spleen cells after stimulation by peptide library on day 56 after immunization, as well as the CD4 and CD8 T cells that produce IFN-γ and IL-2. 2) Sample for testing: Spleen removed on day 56, sample frozen at -80 ºC. Resuscitation of mouse spleen cells 1) Preparation: Before cell resuscitation, adjust the temperature of the constant temperature water bath to 37 ºC and preheat the complete culture medium containing 1% double antibiotics to 37 ºC. 2) Sampling: The sample administrator removes the frozen mouse spleen cells from the liquid nitrogen container and places them into a box containing liquid nitrogen for transfer. The cryovials are then removed from the box, sprayed with 75% alcohol, and then placed in the cell culture room transfer window. 3) Thawing: The verification personnel immediately removed the cryopreserved tubes from the transfer window and placed them in a 37 ºC constant temperature water bath for rapid thawing. After the cells were fully thawed, they were aseptically transferred to 15 ml centrifuge tubes containing 9 ml of complete culture medium with 1% penicillin and antibiotics. 4) Rinse: Add 1 ml of complete culture medium containing 1% double antibiotics to the cryovial, rinse the cryovial, and then transfer the rinsing solution back to a 15 ml centrifuge tube. 5) Centrifugation: 400 g, 18-20 ºC, centrifuge for 10 min. 6) Counting: Discard the supernatant, resuspend the cells in 10 ml of complete culture medium containing 1% penicillin and antibiotics, mix well, and immediately take 100 μl of the cell suspension into an EP tube. Then immediately take 10 μl of the 100 μl cell suspension and add it to an EP tube containing 10 μl of fluorescence staining solution. Mix well and take 10 μl for fluorescence counting. Count the total number of viable cells and the cell viability (if the viability is less than 50%, repeat the fluorescence counting once, and take the second count result as the standard). 7) Centrifuge again: Centrifuge the remaining cells in a 15 ml centrifuge tube at 400 g, 18-20 ºC for 5 min. 8) Resuspension: Discard the supernatant and resuspend the cells in complete culture medium containing 1% penicillin and antibiotics, adjusting the viable cell concentration to A0: 4×106 cells / ml and A1: 4×105 cells / ml. Stimulation of mouse spleen cells 1) Washing: Take IFN-γ and IL-2 well plates, add 200 μl / well of PBS (all PBS used in the entire experiment is sterile) and wash 4 times. 2) Blocking: Discard the PBS in the wells, blot the plate (remove as much residual liquid as possible from the wells), add 200 μl of complete culture medium containing 1% penicillin and antibiotics per well, and incubate at room temperature for at least 30 min (record the exact time as it is). 3) Plate preparation: Discard the complete culture medium containing 1% penicillin and antibiotics in the well plate, and tap the plate (remove as much residual liquid as possible from the wells); add 100 μl of positive stimulant working solution to each positive well; add 100 μl of negative control to each negative well; add 100 μl of peptide working solution to each peptide well; and add only 200 μl of negative control to each blank well, which contains no cells. 4) Add cells: Add A0 cell suspension at 100 μl / well to negative wells and polypeptide wells, and add A1 cell suspension at 100 μl / well to positive wells. 5) Incubation: Use aluminum foil to wrap the plates and place them in a 37℃, 5% CO2 incubator for 21 h ± 30 min for stimulation. Note: The experiments in this section must be performed in a biosafety cabinet, and all reagents must be sterile. Cytokine detection 1) Washing: The next day, empty the original liquid in the well plate, tap the plate (remove as much residual liquid as possible from the well), add 200 μl of PBS per well, and wash 5 times. 2) Add secondary antibody: Discard the PBS in the wells and plate (remove as much residual liquid as possible from the wells). IFN-γ: Add 100 μl of R4-6A2-biotin working solution to each well. IL-2: Add 100 μl of 5H4-biotin working solution to each well. Incubate at room temperature for 2 h ± 5 min. 3) Washing: Empty the original liquid from the well plate, tap the plate (to remove as much residual liquid as possible from the wells), add 200 μl of PBS per well, and wash 5 times. 4) Add triple antibody: Add 100 μl of Streptavidin-HRP working solution to each well. After incubating at room temperature for 1 h ± 2 min, empty the liquid from the plate, tap the plate (remove as much residual liquid as possible from the wells), add 200 μl of PBS to each well, and wash 5 times. 5) Washing: Empty the original liquid from the well plate, tap the plate (to remove as much residual liquid as possible from the wells), add 200 μl of PBS per well, and wash 5 times. 6) Color development: Add 100 μl of TMB substrate solution restored to room temperature to each well. After developing at room temperature for 15 ± 1 min, empty the liquid from the well plate, rinse the well plate with pure water to stop the color development, and remove the bottom plate of the well plate and rinse the bottom surface of the well plate. 7) Reading: Take photos and read the values ​​at room temperature, away from light, until the well plate is completely dry. Camera parameters: Shutter (Exposure): 400; Gain: 25. Counting parameters: IFN-γ-Mouse-Mab / IL-2-Mouse-MabT: Size: 30; Intensity (optical density threshold): 30; TNTC: 80%.

[0179] Example 8: Distribution of VZV gE antigen in African green monkey kidney cells (Vero) Vero cells are cell lineages used in cell cultures. The "Vero" lineage was isolated from kidney epithelial cells extracted from African green monkeys. Vero cells were transfected with different variant gE antigens we constructed (YK-VZV-010, YK-VZV-011, YK-VZV-013, YK-VZV-018, YK-VZV-020). Transfected cells were stained with antibodies for gE antigen labeling and Golgi-labeled GM130 / TGN46 antibody, and antigen localization was observed using confocal microscopy. The results are shown in Figures 3 and 4. Reagent and Consumables Preparation Table 10: Sample Testing Reagents and Consumables name source µ-Slide 8 Well Light-Proof Incubation Box ibidi Anti-VZV gE protein antibody abcam 488 donkey anti-mouse secondary antibody Yisheng Biotechnology Co., Ltd. Anti-fluorescence quenching mounting solution (containing DAPI) Biyuntian Biotechnology Co., Ltd. Phosphate-buffered saline (1×PBS) Biyuntian Biotechnology Co., Ltd. Phosphate-buffered saline (20×PBS) Biyuntian Biotechnology Co., Ltd. Immunostaining permeabilization solution (Triton X-100) Biyuntian Biotechnology Co., Ltd. 4% paraformaldehyde fixative Biyuntian Biotechnology Co., Ltd. QuickBlock™ Immunostaining Primary Antibody Diluent Biyuntian Biotechnology Co., Ltd. QuickBlock™ Immunostaining Blocking Solution Biyuntian Biotechnology Co., Ltd. QuickBlock™ Immunofluorescence Staining Secondary Antibody Diluent Biyuntian Biotechnology Co., Ltd. 647-conj μgated GOLGA2 / GM130 antibody proteintech CoraLite® 594-conjμgated TGN46 antibody proteintech Experimental Step 1) Cell Seeding: Vero cells (purchased from Beyotime Biotechnology Co., Ltd.) were seeded in confocal dishes. The number of seeded cells was recorded when the cell seeding density reached approximately 30% under a microscope. The cells were then cultured overnight. 2) Transfection: Transfect the overexpression stock solution (50 ng / well) and incubate for 48 h. 3) Washing: Remove the confocal dish, remove the culture medium directly, and add PBS to wash 1-3 times. Be careful not to shake it vigorously during washing. 4) Fixation: Add 200 μl of 4% paraformaldehyde solution to fix the cells, let them stand at room temperature for 15 min, wash 3 times with 1xPBS, and let them stand at room temperature for 5 min each time. 5) Permeability: Add 200 μl of 0.3% Tritonx-100 (diluted with 1×PBS) and punch holes for 10 min. Wash with 1×PBS 3 times, and let stand at room temperature for 5 min each time. 6) Blocking: Add 200 μl of immunostaining blocking solution and incubate at room temperature for 2 h. 7) Primary antibody conjugation: Add 100 μl of primary antibody diluted with antibody dilution buffer. The specific antibodies and dilution ratios are as follows: VZV gE antibody dilution ratio 1:100; 647-conjμgated GOLGA2 / GM130 antibody dilution ratio 1:100; CoraLite®594-conjμgated TGN46 antibody dilution ratio 1:100. Incubate overnight at 4°C in the dark, and remove the primary antibody (which can be recycled). 8) Primary antibody washing: Wash 3 times with 1×PBS, 5 min each time; wash away unbound primary antibody. 9) Secondary antibody incubation: Add 200 μl of fluorescent secondary antibody diluted with antibody dilution buffer. The antibody dilution ratio is 1:300. Incubate at room temperature in the dark for 1.5 h. 10) Secondary antibody washing: Wash 3 times with 1×PBS for 5 min each time to remove unbound secondary antibody and avoid non-specific staining. 11) Nucleus staining and mounting: Remove the frame, add one drop of DAPI stain stock solution to each well, cover and store at 4 degrees Celsius away from light. 12) Take X-rays using a confocal microscope. The settings of this invention are compared as follows: LNP: Blank LNP without mRNA vaccine; Shingrix®: Shingrix® is a recombinant protein subunit vaccine manufactured and marketed by GlaxoSmithKline. It is the extracellular region of the VZV gE protein, with amino acids 1-539 and no mutations.

[0180] Comparative Example 1: Based on the herpes zoster mRNA vaccine antigen sequence reported in the literature (Morgan A, et al. 2020) and Moderna patent (US11643441B1), the antigen developed in that patent was found to be gE(1-573aa) Y569A. Based on this, this project designed YK-VZV-004 (SEQ ID NO:15), which maintains the same mutation site and truncated length as the herpes zoster mRNA vaccine antigen sequence gE(1-573aa) Y569A reported in Moderna patent (US11643441B1). YK-VZV-004:gE(1-573aa) Y569A was used as one of the positive controls for antigen screening. The immunogenicity of the vaccine was evaluated together with the newly designed mutation and mutation combination sequences of this invention. Specific results are shown in the examples.

[0181] Comparative Example 2: Based on the herpes zoster mRNA vaccine antigen sequence reported in patent (CN114081943A), it was found that the full-length VZV gE polypeptide developed in this patent contains a combination of mutations (Y569A, S593A, S595A, T596A, T598A). Based on this, this project designed YK-VZV-006 (SEQ ID NO:19), which maintains the same combination of mutation sites (Y569A, S593A, S595A, T596A, T598A) as SEQ ID No.2 mentioned in patent (CN114081943A). YK-VZV-006:gE(1-623aa), (Y569A,S593A,S595A,T596A,T598A) were also used as one of the controls for antigen screening in this invention. Together with the newly designed mutation and mutation combination sequences of this invention, the immunogenicity of the vaccine was evaluated. The specific results are shown in the examples.

[0182] Comparative Example 3: Based on the herpes zoster mRNA vaccine antigen sequence reported in US20230233671A1, it was found that the patent discloses a mutant VZV gE protein Y582A. Based on this, this project designed YK-VZV-045 (SEQ ID NO: 171), which maintains the same mutation site combination Y582A as the mRNA vaccine antigen sequence mentioned in US20230233671A1. YK-VZV-045 was also used as one of the controls for antigen screening in this invention, and together with the newly designed mutant and mutant combination sequences of this invention, the immunogenicity of the vaccine was evaluated. Specific results are shown in the examples.

[0183] Comparative Example 4: Based on the herpes zoster mRNA vaccine antigen sequence reported in CN108472309A, it was found that the patent discloses a mutant VZV gE protein Y582A. Based on this, this project designed YK-VZV-007 (SEQ ID NO:23), which maintains the same mutation site combination Y582A; S593A; S595A; T596A; T598A as the mRNA vaccine antigen sequence mentioned in CN108472309A. YK-VZV-007 was also used as one of the controls for antigen screening in this invention, and the immunogenicity of the vaccine was evaluated together with the newly designed mutant and mutant combination sequences of this invention. Specific results are shown in the examples.

[0184] Results Summary and Analysis: In vitro expression results of VZV gE antigen variants: Western blot analysis of 43 VZV gE antigen variants (Figure 2) showed that the expression level of YK-VZV-002 antigen protein was extremely low or almost non-existent; the expression results of YK-VZV-041, YK-VZV-042, and YK-VZV-043 antigen proteins were negative, indicating no expression; therefore, the above four sequences could not be used as candidate antigens for herpes zoster mRNA vaccines and were therefore excluded. Other antigen variants all showed significant protein expression, with the expressed proteins ranging from approximately 63 kDa to 75 kDa, consistent with the theoretical antigen design. They can serve as effective candidate antigens for further immunogenicity screening and evaluation. The Western blot results above show that YK-VZV-001, YK-VZV-003, YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-007 (Comparative Example 4), YK-VZV-009, YK-VZV-010, YK-VZV-011, YK-VZV-012, and YK-VZV-003 are all related to the above-mentioned Western blot experiments. V-013, YK-VZV-014, YK-VZV-015, YK-VZV-016, YK-VZV-017, YK-VZV-018, YK-VZ V-019, YK-VZV-020, YK-VZV-021, YK-VZV-022, YK-VZV-023, YK-VZV-024, YK-VZV The 39 antigen sequences YK-VZV-025, YK-VZV-026, YK-VZV-027, YK-VZV-028, YK-VZV-029, YK-VZV-030, YK-VZV-031, YK-VZV-032, YK-VZV-033, YK-VZV-034, YK-VZV-035, YK-VZV-036, YK-VZV-037, YK-VZV-038, YK-VZV-039, YK-VZV-040, YK-VZV-044, and YK-VZV-045 (Comparative Example 3) all showed significant protein expression and can be used as effective candidate antigens for further immunogenicity screening and evaluation. Therefore, the gE-specific antibody IgG titer was detected against the above antigens.

[0185] Results of gE protein-specific IgG antibody titers in Balb / c mouse serum (D42) using VZV gE antigen variant: As shown in Example 5, the gE protein-specific IgG antibody titers in mouse serum on day 42 post-immunization were detected by ELISA. The results are shown in Table 11 below. Table 11. VZV gE protein-specific IgG antibody titers in mouse serum (day 42) test substance Antibody GMT (×10⁴) Test antibody GMT / Shingrix® antibody GMT (times) Test antibody GMT / YK-VZV-007 antibody GMT (times) YK-VZV-009 1000 5.3 2.8 YK-VZV-010 1000 5.3 2.8 YK-VZV-013 1000 5.3 2.8 YK-VZV-014 1000 5.3 2.8 YK-VZV-011 950 5.0 2.6 YK-VZV-012 944 5.0 2.6 YK-VZV-018 870 4.6 2.4 YK-VZV-020 800 4.2 2.2 YK-VZV-030 662 3.5 1.8 YK-VZV-031 659 3.5 1.8 YK-VZV-038 654 3.4 1.8 YK-VZV-021 650 3.4 1.8 YK-VZV-024 640 3.4 1.8 YK-VZV-028 630 3.3 1.8 YK-VZV-003 560 2.9 1.6 YK-VZV-001 540 2.8 1.5 YK-VZV-016 530 2.8 1.5 YK-VZV-015 520 2.7 1.4 YK-VZV-017 510 2.7 1.4 YK-VZV-023 190 1.0 0.5 YK-VZV-022 163 0.9 0.5 YK-VZV-026 163 0.9 0.5 YK-VZV-027 163 0.9 0.5 YK-VZV-033 163 0.9 0.5 YK-VZV-037 163 0.9 0.5 YK-VZV-039 163 0.9 0.5 YK-VZV-044 163 0.9 0.5 YK-VZV-040 162 0.9 0.5 YK-VZV-032 160 0.8 0.4 YK-VZV-034 154 0.8 0.4 YK-VZV-025 151 0.8 0.4 YK-VZV-035 150 0.8 0.4 YK-VZV-036 136 0.7 0.4 YK-VZV-029 102 0.5 0.3 LNP 0 0.0 0.0 Shingrix® 190 1.0 0.5 YK-VZV-004 (Comparative Example 1) 400 2.1 1.1 YK-VZV-006 (Comparative Example 2) 360 1.9 1.0 YK-VZV-045 (Comparative Example 3) 352 1.9 1.0 YK-VZV-007 (Comparative Example 4) 360 1.9 1.0 The results showed that, based on the gE-specific antibody IgG titer on day 42, the titer of the Shingrix® positive control was 190 × 10⁴. Among these, the following variants showed superior efficacy compared to Shingrix®: YK-VZV-009, YK-VZV-011, YK-VZV-013, YK-VZV-014, YK-VZV-010, YK-VZV-012, YK-VZV-018, YK-VZV-020, YK-VZV-030, YK-VZV-031, and YK... YK-VZV-038, YK-VZV-021, YK-VZV-024, YK-VZV-028, YK-VZV-003, YK-VZV-001, YK-VZV-016, YK-VZV-015, YK-VZV-017, and YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4) were 2.7 to 5.3 times more effective than the Shingrix® positive control. Using the Shingrix® positive control as a standard, and based on the fact that the gE-specific antibody IgG titer was 1.8 to 2.8 times better than the YK-VZV-007 sequence (Comparative Example 4), the following 14 variants were further extracted, including: YK-VZV-009, YK-VZV-011, YK-VZV-013, YK-VZV-014, YK-VZV-010, YK-VZV-012, YK-VZV-0 18. YK-VZV-020, YK-VZV-030, YK-VZV-031, YK-VZV-038, YK-VZV-021, YK-VZV-024, YK-VZV-028 and four control sequences YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4) were subjected to subsequent testing.

[0186] Cellular Immunotherapy Results (FCM) of VZV gE Antigen Variant: Cellular immunity, especially T-cell immunity, plays a crucial role in VZV infection. Studies have shown that cell-mediated immune effects are an important indicator for evaluating the efficacy of shingles vaccines. To further evaluate the specific cellular immune response induced in mice immunized with the aforementioned antigen mutant mRNA, Example 6 used FCM to detect the specific CD4+ T cell and CD8+ T cell immune responses induced in mice immunized with VZV gE antigen mRNA. Using the Shingrix® positive control as a standard, and based on the fact that the gE-specific antibody IgG titer effect was also superior to the YK-VZV-007 sequence, the following 14 variants were further extracted, including: YK-VZV-009, YK-VZV-011, YK-VZV-013, YK-VZV-014, YK-VZV-010, YK-VZV-012, YK-VZV-018, YK-VZV-020, YK-VZV-030, YK-V The spleens of mice immunized with ZV-031, YK-VZV-038, YK-VZV-021, YK-VZV-024, YK-VZV-028, and four control sequences, including YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4), were measured on day 56. The proportions of CD4+ T cells and CD8+ T cells secreting IFN-γ and IL-2 in the mouse spleen were determined according to the detection method in Example 6.

[0187] [1)]CD4+ T cells CD4+ T cell immune response plays a crucial role in VZV infection recovery and vaccine immunization, and is one of the most important indicators for evaluating vaccine efficacy. Spleens were harvested from immunized mice on day 56, and the proportion of CD4+ T cells secreting IFN-γ and IL-2 in the spleen was measured. The specific results are shown in the table below. Table 12 Summary of CD4+ T cell detection results test substance CD4+(IFN-γ+) CD4+ (IL-2+) CD4+ (IFN-γ+ or IL-2+) CD4+(IFN-γ+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD4+ (IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD4+ (IFN-γ+ or IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 2.00% 6.7 4.4 3.70% 12.3 7.4 4.20% 7.0 5.3 YK-VZV-013 1.70% 5.7 3.8 1.30% 4.3 2.6 1.90% 3.2 2.4 YK-VZV-011 1.60% 5.3 3.6 1.20% 4.0 2.4 1.60% 2.7 2.0 YK-VZV-020 1.60% 5.3 3.6 2.50% 8.3 5.0 3.10% 5.2 3.9 YK-VZV-012 1.40% 4.7 3.1 1.20% 4.0 2.4 1.70% 2.8 2.1 YK-VZV-018 1.20% 4.0 2.7 1.10% 3.7 2.2 1.40% 2.3 1.8 YK-VZV-028 1.20% 4.0 2.7 1.30% 4.3 2.6 1.70% 2.8 2.1 YK-VZV-014 1.10% 3.7 2.4 0.80% 2.7 1.6 1.10% 1.8 1.4 YK-VZV-038 1.10% 3.7 2.4 1.40% 4.7 2.8 1.90% 3.2 2.4 YK-VZV-031 1.00% 3.3 2.2 1.40% 4.7 2.8 1.70% 2.8 2.1 YK-VZV-021 0.90% 3.0 2.0 1.10% 3.7 2.2 1.50% 2.5 1.9 YK-VZV-009 0.80% 2.7 1.8 1.10% 3.7 2.2 1.40% 2.3 1.8 YK-VZV-024 0.70% [[ID=I4]] 2.3 1.6 0.60% 2.0 1.2 0.90% 1.5 1.1 YK-VZV-030 0.60% 2.0 1.3 0.80% 2.7 1.6 1.10% 1.8 1.4 LNP 0.10% [[ID=I64]] 0.3 0.2 0.10% 0.3 0.2 0.20% 0.3 0.3 Shingrix® 0.30% 1.0 0.7 0.30% 1.0 0.6 0.60% 1.0 0.8 YK-VZV-004 (Comparative Example 1) 0.55% 1.8 1.2 Note: There seems to be a minor error in the reference notation in the original text. I've assumed the "I4" and "I64" in the translation are just typos and should be the same as the original numbers. If this is not the case, please clarify. 0.55% 1.8 1.1 0.95% 1.6 1.2 YK-VZV-045 (Comparative Example 3) 0.50% 1.7 1.1 0.30% 1.0 0.6 0.50% 0.8 0.6 YK-VZV-007 (Comparative Example 4) 0.45% 1.5 1.0 0.50% 1.7 1.0 0.80% 1.3 1.0 Note: Shingrix® is a GSK recombinant protein vaccine. ① The total percentage of IFN-γ+ CD4+ T cells and IL-2+ CD4+ T cells A) Based on the above results, the tested mRNA vaccines YK-VZV-010, YK-VZV-020, YK-VZV-013, YK-VZV-038, YK-VZV-012, YK-VZV-028, YK-VZV-031, YK-VZV-011, YK-VZV-021, YK-VZV-018, and YK-VZV-009 (11 in total) were screened. The combined percentage of IFN-γ+ CD4+ T cells and IL-2+ CD4+ T cells secreted by these vaccines was more than twice that of the Shingrix® positive control vaccine, reaching a maximum of seven times; and 1.8 to 5.3 times that of YK-VZV-007 (Comparative Example 4). Furthermore, they were significantly superior to YK-VZV-004 (Comparative Example 1) and YK-VZV-045 (Comparative Example 3). Among them, the total percentage of IFN-γ+ CD4+ T cells and IL-2+ CD4+ T cells secreted by the YK-VZV-010, YK-VZV-020, YK-VZV-013, YK-VZV-011, and YK-VZV-018 mRNA vaccines was 7.0, 5.2, 3.2, 2.7, and 2.3 times that of the Shingrix® positive control vaccine; and 5.3, 3.9, 2.4, 2.0, and 1.8 times that of YK-VZV-007 (comparative example 4), all significantly higher than that of YK-VZV-004 (comparative example 1) and YK-VZV-045 (comparative example 3). The specific information is shown in the table below: Table 13. Total IFN-γ+ CD4+ T cells and IL-2+ CD4+ T cells induced by mRNA vaccine -1 test substance CD4+ (IFN-γ+ or IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 4.20% 7.0 5.3 YK-VZV-020 3.10% 5.2 3.9 YK-VZV-013 1.90% 3.2 2.4 YK-VZV-038 1.90% 3.2 2.4 YK-VZV-012 1.70% 2.8 2.1 YK-VZV-028 1.70% 2.8 2.1 YK-VZV-031 1.70% 2.8 2.1 YK-VZV-011 1.60% 2.7 2.0 YK-VZV-021 1.50% 2.5 1.9 YK-VZV-018 1.40% 2.3 1.8 YK-VZV-009 1.40% 2.3 1.8 LNP 0.20% 0.3 0.3 Shingrix® 0.60% 1.0 0.8 YK-VZV-004 (Comparative Example 1) 0.95% 1.6 1.2 YK-VZV-045 (Comparative Example 3) 0.50% 0.8 0.6 YK-VZV-007 (Comparative Example 4) 0.80% 1.3 1.0 B) The total percentage of IFN-γ+ CD4+ T cells and IL-2+ CD4+ T cells secreted by the test drugs YK-VZV-014, YK-VZV-030, and YK-VZV-024 mRNA vaccines was less than twice that of the Shingrix® positive control vaccine and less than 1.5 times that of control sample 4 (YK-VZV-007), and was therefore excluded. The specific results are shown in the table below: Table 14. Total IFN-γ+ CD4+ T cells and IL-2+ CD4+ T cells induced by mRNA vaccine -2 test substance CD4+ (IFN-γ+ or IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-014 1.10% 1.8 1.4 YK-VZV-030 1.10% 1.8 1.4 YK-VZV-024 0.90% 1.5 1.1 LNP 0.20% 0.3 0.3 Shingrix® 0.60% 1.0 0.8 YK-VZV-004 (Comparative Example 1) 0.95% 1.6 1.2 YK-VZV-045 (Comparative Example 3) 0.50% 0.8 0.6 YK-VZV-007 (Comparative Example 4) 0.80% 1.3 1.0 ② Percentage of IFN-γ+ CD4+ T cells A) The tested mRNA vaccines YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, YK-VZV-012, YK-VZV-018, YK-VZV-028, YK-VZV-014, YK-VZV-038, and YK-VZV-031 showed the best proportion of IFN-γ+ CD4+ T cells, ranging from 1.00% to 2.00%, which was significantly higher than the control vaccines (YK-VZV-004, YK-VZV-045, and YK-VZV-007). This was more than 3 times that of the Shingrix® positive control vaccine, reaching a maximum of 6.7 times; and approximately 2.2 to 4.4 times that of control vaccine 4 (YK-VZV-007). Among them, the proportion of IFN-γ+ CD4+ T cells secreted by the mRNA vaccines corresponding to YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, and YK-VZV-018 was 6.7, 5.7, 5.3, 5.3, and 4.0 times that of the Shingrix® positive control vaccine; and 4.4, 3.8, 3.6, 3.6, and 2.7 times that of control sample 4 (YK-VZV-007), and all were significantly higher than those of control sample 1 (YK-VZV-004) and control sample 3 (YK-VZV-045). The specific results are shown in the table below: Table 15. mRNA vaccine induces IFN-γ+ CD4+ T cells -1 test substance CD4+ IFN-γ+ Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 2.00% 6.7 4.4 YK-VZV-013 1.70% 5.7 3.8 YK-VZV-011 1.60% 5.3 3.6 YK-VZV-020 1.60% 5.3 3.6 YK-VZV-012 1.40% 4.7 3.1 YK-VZV-018 1.20% 4.0 2.7 YK-VZV-028 1.20% 4.0 2.7 YK-VZV-014 1.10% 3.7 2.4 YK-VZV-038 1.10% 3.7 2.4 YK-VZV-031 1.00% 3.3 2.2 LNP 0.10% 0.3 0.2 Shingrix® 0.30% 1.0 0.7 YK-VZV-004 (Comparative Example 1) 0.55% 1.8 1.2 YK-VZV-045 (Comparative Example 3) 0.50% 1.7 1.1 YK-VZV-007 (Comparative Example 4) 0.45% 1.5 1.0 B) Because the IFN-γ+ CD4+ T cells secreted by the test mRNA vaccines YK-VZV-021, YK-VZV-009, YK-VZV-024, and YK-VZV-030 were less than 1.0%, significantly lower than the optimal and better mRNA vaccine secretion cell ratio (1.0~2.0%), only 2~3 times that of the Shingrix® positive control vaccine, and about 1~2 times that of control 4 (YK-VZV-007); therefore, YK-VZV-021, YK-VZV-009, YK-VZV-024, and YK-VZV-030 were removed from the candidate sequences. The specific results are shown in the table below: Table 16. mRNA vaccine induces IFN-γ+ CD4+ T cells -2 test substance CD4+ IFN-γ+ Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-021 0.90% 3.0 2.0 YK-VZV-009 0.80% 2.7 1.8 YK-VZV-024 0.70% 2.3 1.6 YK-VZV-030 0.60% 2.0 1.3 LNP 0.10% 0.3 0.2 Shingrix® 0.30% 1.0 0.7 YK-VZV-004 (Comparative Example 1) 0.55% 1.8 1.2 YK-VZV-045 (Comparative Example 3) 0.50% 1.7 1.1 YK-VZV-007 (Comparative Example 4) 0.45% 1.5 1.0 ③ IL-2+ CD4+ T cells A) Screening for the mRNA vaccines secreted by the test substances YK-VZV-010, YK-VZV-020, YK-VZV-038, YK-VZV-031, YK-VZV-013, YK-VZV-028, YK-VZV-011, YK-VZV-012, YK-VZV-018, YK-VZV-021, and YK-VZV-009. The T-cell percentage was optimal, reaching 1.10-3.70%, significantly higher than the comparative mRNA vaccines (YK-VZV-004, YK-VZV-045, and YK-VZV-007), more than 3.7 times that of the Shingrix® positive control vaccine, more than 2.2 times that of YK-VZV-007, and significantly better than comparative sample 1 (YK-VZV-004) and comparative sample 3 (YK-VZV-045). Among them, the proportion of IL-2+ CD4+ T cells secreted by the YK-VZV-010, YK-VZV-020, YK-VZV-013, YK-VZV-011, and YK-VZV-018 mRNA vaccines was 12.3, 8.3, 4.3, 4.0, and 3.7 times that of the Shingrix® positive control vaccine, respectively; and 7.4, 5.0, 2.6, 2.4, and 2.2 times that of YK-VZV-007 (comparative example 4), respectively. At the same time, they were all significantly higher than those of YK-VZV-004 (comparative example 1) and YK-VZV-045 (comparative example 3). The specific results are shown in the table below: Table 17. mRNA vaccine induces IL-2+CD4+ T cells -1 test substance CD4+IL-2+ Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 3.70% 12.3 7.4 YK-VZV-020 2.50% 8.3 5.0 YK-VZV-038 1.40% 4.7 2.8 YK-VZV-031 1.40% 4.7 2.8 YK-VZV-013 1.30% 4.3 2.6 YK-VZV-028 1.30% 4.3 2.6 YK-VZV-011 1.20% 4.0 2.4 YK-VZV-012 1.20% 4.0 2.4 YK-VZV-018 1.10% 3.7 2.2 YK-VZV-021 1.10% 3.7 2.2 YK-VZV-009 1.10% 3.7 2.2 LNP 0.10% 0.3 0.2 Shingrix® 0.30% 1.0 0.6 YK-VZV-004 (Comparative Example 1) 0.55% 1.8 1.1 YK-VZV-045 (Comparative Example 3) 0.30% 1.0 0.6 YK-VZV-007 (Comparative Example 4) 0.50% 1.7 1.0 B) Because the proportion of IL-2+ CD4+ T cells secreted by the test mRNA vaccines YK-VZV-014, YK-VZV-030, and YK-VZV-024 was less than 1.0%, significantly lower than the proportion of cells secreted by the optimal and better mRNA vaccines (greater than 1.0%), less than 3 times that of the Shingrix® positive control vaccine, and less than 2 times that of YK-VZV-007 (comparative example 4), YK-VZV-014, YK-VZV-030, and YK-VZV-024 were removed from the candidate sequences. The specific results are shown in the table below: Table 18. mRNA vaccine induces IL-2+ CD4+ T cells -2 test substance CD4+IL-2+ Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-014 0.80% 2.7 1.6 YK-VZV-030 0.80% 2.7 1.6 YK-VZV-024 0.60% 2.0 1.2 LNP 0.10% 0.3 0.2 Shingrix® 0.30% 1.0 0.6 YK-VZV-004 (Comparative Example 1) 0.55% 1.8 1.1 YK-VZV-045 (Comparative Example 3) 0.30% 1.0 0.6 YK-VZV-007 (Comparative Example 4) 0.50% 1.7 1.0 ④ Conclusion A) The percentage of immune cells in the spleen of mice after immunizing them with the selected mRNA vaccine: The combined percentage of IFN-γ+ CD4+ T cells and IL-2+ CD4+ T cells was more than twice that of the Shingrix® positive control, reaching up to seven times; and 1.8 to 5.3 times that of YK-VZV-007 (comparative example 4). The proportion of IFN-γ+ CD4+ T cells reached 1.00~2.00%, which is more than 3 times that of the Shingrix® positive control vaccine, reaching a maximum of 6.7 times; and 2.2~4.4 times that of control 4 (YK-VZV-007); The percentage of IL-2+ and CD4+ T cells both exceeded 1%, and was more than 3.7 times that of the Shingrix® positive control vaccine and more than 2.2 times that of YK-VZV-007; the information is as follows: Table 19. mRNA vaccine induces the production of CD4+ T cells with IFN-γ or IL-2+. test substance CD4+(IFN-γ+) CD4+ (IL-2+) CD4+ (IFN-γ+ or IL-2+) CD4+(IFN-γ+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD4+ (IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD4+ (IFN-γ+ or IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 2.00% 6.7 4.4 3.70% 12.3 7.4 4.20% 7.0 5.3 YK-VZV-013 1.70% 5.7 3.8 1.30% 4.3 2.6 1.90% 3.2 2.4 YK-VZV-011 1.60% 5.3 3.6 1.20% 4.0 2.4 1.60% 2.7 2.0 YK-VZV-020 1.60% 5.3 3.6 2.50% 8.3 5.0 3.10% 5.2 3.9 YK-VZV-012 1.40% 4.7 3.1 1.20% 4.0 2.4 1.70% 2.8 2.1 YK-VZV-018 1.20% 4.0 2.7 1.10% 3.7 2.2 1.40% 2.3 1.8 YK-VZV-028 1.20% 4.0 2.7 1.30% 4.3 2.6 1.70% 2.8 2.1 YK-VZV-038 1.10% 3.7 2.4 1.40% 4.7 2.8 1.90% 3.2 2.4 YK-VZV-031 1.00% 3.3 2.2 1.40% 4.7 2.8 1.70% 2.8 2.1 LNP 0.10% 0.3 0.2 0.10% 0.3 0.2 0.20% 0.3 0.3 Shingrix® 0.30% 1.0 0.7 0.30% 1.0 0.6 0.60% 1.0 0.8 YK-VZV-004 (Comparative Example 1) 0.55% 1.8 1.2 0.55% 1.8 1.1 0.95% 1.6 1.2 YK-VZV-045 (Comparative Example 3) 0.50% 1.7 1.1 0.30% 1.0 0.6 0.50% 0.8 0.6 YK-VZV-007 (Comparative Example 4) 0.45% 1.5 1.0 0.50% 1.7 1.0 0.80% 1.3 1.0 In the above sequence, YK-VZV-010 induces CD4+ IFN-γ+ T cells and CD4+ IL+ T cells to account for more than 2% of spleen cells, which is about 6 to 12 times that of Shingrix® positive control vaccine, and has the best immune effect. B) The removed sequence is secreted by the mRNA vaccine: The combined percentage of IFN-γ+ CD4+ T cells and IL-2+ CD4+ T cells was less than twice that of the Shingrix® positive control vaccine and less than 1.5 times that of control 4 (YK-VZV-007). The mRNA vaccine secreted less than 1.0% of IFN-γ+ CD4+ T cells, which is only 2 to 3 times that of the Shingrix® positive control vaccine and about 1 to 2 times that of the control vaccine YK-VZV-007. or The percentage of IL-2+ CD4+ T cells was less than 1.0%, which is less than three times that of the Shingrix® positive control vaccine and less than twice that of YK-VZV-007 (comparative example 4); the information is as follows: Table 20. mRNA vaccine induces the production of CD4+ T cells with IFN-γ or IL-2+. test substance CD4+(IFN-γ+) CD4+ (IL-2+) CD4+ (IFN-γ+ or IL-2+) CD4+(IFN-γ+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD4+ (IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD4+ (IFN-γ+ or IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-014 1.10% 3.7 2.4 0.80% 2.7 1.6 1.10% 1.8 1.4 YK-VZV-021 0.90% 3.0 2.0 1.10% 3.7 2.2 1.50% 2.5 1.9 YK-VZV-009 0.80% 2.7 1.8 1.10% 3.7 2.2 1.40% 2.3 1.8 YK-VZV-024 0.70% 2.3 1.6 0.60% 2.0 1.2 0.90% 1.5 1.1 YK-VZV-030 0.60% 2.0 1.3 0.80% 2.7 1.6 1.10% 1.8 1.4 LNP 0.10% 0.3 0.2 0.10% 0.3 0.2 0.20% 0.3 0.3 Shingrix® 0.30% 1.0 0.7 0.30% 1.0 0.6 0.60% 1.0 0.8 YK-VZV-004 (Comparative Example 1) 0.55% 1.8 1.2 0.55% 1.8 1.1 0.95% 1.6 1.2 YK-VZV-045 (Comparative Example 3) 0.50% 1.7 1.1 0.30% 1.0 0.6 0.50% 0.8 0.6 YK-VZV-007 (Comparative Example 4) 0.45% 1.5 1.0 0.50% 1.7 1.0 0.80% 1.3 1.0 The proportion of CD4+ T cells induced by the above-mentioned mRNA vaccines to produce IFN-γ or IL-2 in spleen cells was less than 1%, and the total proportion of IFN-γ+ CD4+ T cells and IL-2+ CD4+ T cells produced was less than 2.0 times that of Shingrix®, resulting in poor immune enhancement. Compared with the sequences in Part A above, these sequences are not suitable as candidate sequences for shingles vaccines. In summary, the mRNA vaccines containing the test substances YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, YK-VZV-012, YK-VZV-018, YK-VZV-028, YK-VZV-038, and YK-VZV-031 showed excellent efficacy in inducing IFN-γ+ CD4+ T cells and IL-2+ CD4+ T cells. Therefore, the above sequences, along with YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4), were used for subsequent CD8+ T cell immunoassays.

[0188] [2)]CD8+ T cells Based on the results of CD4+ T cell assays, the test substances YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, YK-VZV-012, YK-VZV-018, YK-VZV-028, YK-VZV-038, YK-VZV-031, and YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4) were measured to determine the number of CD8+ T cells induced to produce IL-2 / IFN-γ. The specific results are shown in the table below: Table 21 Summary of CD8+ T cell detection results test substance CD8+ IFN-γ+ CD8+ IL-2+ CD8+ (IFN-γ+ or IL-2+) CD8+ (IFN-γ+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD8+ (IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD8+ (IFN-γ+ or IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 8.10% 7.36 4.26 0.50% 4.17 2.78 7.90% 7.18 4.94 YK-VZV-013 6.90% 6.27 3.63 0.40% 3.33 2.22 7.10% 6.45 4.44 YK-VZV-020 5.60% 5.09 2.95 0.30% 2.50 1.67 5.60% 5.09 3.50 YK-VZV-018 5.20% 4.73 2.74 0.40% 3.33 2.22 5.20% 4.73 3.25 YK-VZV-011 5.00% 4.55 2.63 0.40% 3.33 2.22 5.10% 4.64 3.19 YK-VZV-012 4.20% 3.82 2.21 0.10% 0.83 0.56 4.20% 3.82 2.63 YK-VZV-028 3.10% 2.82 1.63 0.40% 3.33 2.22 3.10% 2.82 1.94 YK-VZV-038 2.40% 2.18 1.26 0.20% 1.67 1.11 2.30% 2.09 1.44 YK-VZV-031 1.80% 1.64 0.95 0.10% 0.83 0.56 1.90% 1.73 1.19 LNP 0.00% - - 0.00% - - 0.00% - - Shingrix® 1.10% 1.00 0.58 0.12% 1.00 0.67 1.10% 1.00 0.69 YK-VZV-004 (Comparative Example 1) 2.80% 2.55 1.47 0.21% 1.75 1.17 2.70% 2.45 1.69 YK-VZV-006 (Comparative Example 2) 1.90% 1.73 1.00 0.20% 1.67 1.11 1.50% 1.36 0.94 YK-VZV-045 (Comparative Example 3) 1.50% 1.36 0.79 0.16% 1.33 0.89 1.40% 1.27 0.88 YK-VZV-007 (Comparative Example 4) 1.90% 1.73 1.00 0.18% 1.50 1.00 1.60% 1.45 1.00 Note: Shingrix® is a GSK recombinant protein vaccine. ① Total number of IFN-γ+ CD8+ T cells and IL-2+ CD8+ T cells A) Based on the above results, the total percentage of IFN-γ+ CD8+ T cells and IL-2+ CD8+ T cells induced by the screened test drugs YK-VZV-010, YK-VZV-013, YK-VZV-020, YK-VZV-018, and YK-VZV-011 mRNA vaccines is 4 to 7 times higher than that of the Shingrix® positive control vaccine, and about 3 to 5 times that of YK-VZV-007 (comparative example 4). Specific results are shown in the table below: Table 22 Total IFN-γ+ CD8+ T cells and IL-2+ CD8+ T cells induced by mRNA vaccine -1 test substance CD8+ (IFN-γ+ or IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 7.90% 7.18 4.94 YK-VZV-013 7.10% 6.45 4.44 YK-VZV-020 5.60% 5.09 3.50 YK-VZV-018 5.20% 4.73 3.25 YK-VZV-011 5.10% 4.64 3.19 LNP 0.00% - - Shingrix® 1.10% 1.00 0.69 YK-VZV-004 (Comparative Example 1) 2.70% 2.45 1.69 YK-VZV-006 (Comparative Example 2) 1.50% 1.36 0.94 YK-VZV-045 (Comparative Example 3) 1.40% 1.27 0.88 YK-VZV-007 (Comparative Example 4) 1.60% 1.45 1.00 B) The total percentage of IFN-γ+ CD8+ T cells and IL-2+ CD8+ T cells secreted by the test drugs YK-VZV-012, YK-VZV-028, YK-VZV-038, and YK-VZV-031 mRNA vaccines was less than 4 times that of the Shingrix® positive control vaccine, and less than 3 times that of YK-VZV-007 (comparative example 4). Specific results are shown in the table below: Table 23 Total IFN-γ+ CD8+ T cells and IL-2+ CD8+ T cells induced by mRNA vaccine -2 test substance CD8+ (IFN-γ+ or IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-012 4.20% 3.82 2.63 YK-VZV-028 3.10% 2.82 1.94 YK-VZV-038 2.30% 2.09 1.44 YK-VZV-031 1.90% 1.73 1.19 LNP 0.00% - - Shingrix® 1.10% 1.00 0.69 YK-VZV-004 (Comparative Example 1) 2.70% 2.45 1.69 YK-VZV-006 (Comparative Example 2) 1.50% 1.36 0.94 YK-VZV-045 (Comparative Example 3) 1.40% 1.27 0.88 YK-VZV-007 (Comparative Example 4) 1.60% 1.45 1.00 ② IFN-γ+ CD8+ T cells A) The tested mRNA vaccines YK-VZV-010, YK-VZV-013, YK-VZV-020, YK-VZV-018, and YK-VZV-011 showed the best proportion of IFN-γ+ CD8+ T cells, all above 5.0%, with YK-VZV-010 reaching the highest at 8.10%, significantly higher than control samples 1-4 (YK-VZV-004, YK-VZV-006, YK-VZV-045, and YK-VZV-007). These five sequences were 4.5-7.0 times higher than the Shingrix® positive control vaccine and approximately 2.5-4.5 times higher than YK-VZV-007. Specific results are shown in the table below: Table 24. mRNA vaccine induces IFN-γ+ CD8+ T cells-1 test substance CD8+ (IFN-γ+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 8.10% 7.36 4.26 YK-VZV-013 6.90% 6.27 3.63 YK-VZV-020 5.60% 5.09 2.95 YK-VZV-018 5.20% 4.73 2.74 YK-VZV-011 5.00% 4.55 2.63 LNP 0.00% - - Shingrix® 1.10% 1.00 0.58 YK-VZV-004 (Comparative Example 1) 2.80% 2.55 1.47 YK-VZV-006 (Comparative Example 2) 1.90% 1.73 1.00 YK-VZV-045 (Comparative Example 3) 1.50% 1.36 0.79 YK-VZV-007 (Comparative Example 4) 1.90% 1.73 1.00 B) The IFN-γ+ CD8+ T cell proportion secreted by the test products YK-VZV-012, YK-VZV-028, YK-VZV-038, and YK-VZV-031 mRNA vaccines was less than 5%, significantly lower than the optimal mRNA vaccine secretion cell proportion (5.00~8.10%), only less than 4.0 times that of the Shingrix® positive control vaccine, and about 1 to 2 times that of YK-VZV-007. Therefore, they were excluded. The specific results are shown in the table below: Table 25. mRNA vaccine induces IFN-γ+ CD8+ T cells -2 test substance CD8+ (IFN-γ+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-012 4.20% 3.82 2.21 YK-VZV-028 3.10% 2.82 1.63 YK-VZV-038 2.40% 2.18 1.26 YK-VZV-031 1.80% 1.64 0.95 LNP 0.00% - - Shingrix® 1.10% 1.00 0.58 YK-VZV-004 (Comparative Example 1) 2.80% 2.55 1.47 YK-VZV-006 (Comparative Example 2) 1.90% 1.73 1.00 YK-VZV-045 (Comparative Example 3) 1.50% 1.36 0.79 YK-VZV-007 (Comparative Example 4) 1.90% 1.73 1.00 ③ IL-2+ CD8+ T cells A) The tested mRNA vaccines YK-VZV-010, YK-VZV-013, YK-VZV-018, YK-VZV-011, YK-VZV-028, and YK-VZV-020 showed the best proportion of IL-2+ CD8+ T cells secreted, reaching 0.3-0.5%, which was significantly higher than the control groups (YK-VZV-004, YK-VZV-006, YK-VZV-045, and YK-VZV-007). This was 2.5-4.0 times higher than the Shingrix® positive control vaccine and approximately 1.5-3.0 times higher than YK-VZV-007. Specific results are shown in the table below: Table 26. mRNA vaccine induces IL-2+ CD8+ T cells-1 test substance CD8+ (IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 0.50% 4.17 2.78 YK-VZV-013 0.40% 3.33 2.22 YK-VZV-018 0.40% 3.33 2.22 YK-VZV-011 0.40% 3.33 2.22 YK-VZV-028 0.40% 3.33 2.22 YK-VZV-020 0.30% 2.50 1.67 LNP 0.00% - - Shingrix® 0.12% 1.00 0.67 YK-VZV-004 (Comparative Example 1) 0.21% 1.75 1.17 YK-VZV-006 (Comparative Example 2) 0.20% 1.67 1.11 YK-VZV-045 (Comparative Example 3) 0.16% 1.33 0.89 YK-VZV-007 (Comparative Example 4) 0.18% 1.50 1.00 B) The test products YK-VZV-038, YK-VZV-012, and YK-VZV-031 mRNA vaccines secreted IL-2+ CD8+ T cells at a rate of less than 0.2%. Their efficacy was not significantly different from or even worse than that of the Shingrix® positive control vaccine and YK-VZV-007, only about 0.8 to 1.6 times that of the Shingrix® positive control vaccine and about 0.5 to 1.0 times that of YK-VZV-007. Therefore, they were excluded. The specific results are shown in the table below: Table 27. mRNA vaccine induces IL-2+ CD8+ T cells -2 test substance CD8+ (IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-038 0.20% 1.67 1.11 YK-VZV-012 0.10% 0.83 0.56 YK-VZV-031 0.10% 0.83 0.56 LNP 0.00% - - Shingrix® 0.12% 1.00 0.67 YK-VZV-004 (Comparative Example 1) 0.21% 1.75 1.17 YK-VZV-006 (Comparative Example 2) 0.20% 1.67 1.11 YK-VZV-045 (Comparative Example 3) 0.16% 1.33 0.89 YK-VZV-007 (Comparative Example 4) 0.18% 1.50 1.00 ④ Conclusion: Based on the results ①~③ above, the percentage of immune cells in the spleen of mice induced by candidate vaccines was selected as follows: A) The total percentage of IFN-γ+ CD8+ T cells and IL-2+ CD8+ T cells is 4 to 7 times higher than that of the Shingrix® vaccine, and about 3 to 5 times higher than that of YK-VZV-007 (comparative example 4); The proportion of IFN-γ+ CD8+ T cells was optimal, all above 5.0%, which is 4.5 to 7.0 times that of the Shingrix® positive control vaccine and about 2.5 to 4.5 times that of YK-VZV-007; The proportion of IL-2+ CD8+ T cells was optimal, reaching 0.3-0.5%, which is more than 2.5-4.0 times that of the Shingrix® positive control vaccine and about 1.5-3.0 times that of YK-VZV-007; And all of them were significantly higher than the control samples (YK-VZV-004, YK-VZV-006, YK-VZV-045, YK-VZV-007), as shown in the following message: Table 28. mRNA vaccine-induced production of IFN-γ or IL-2+ CD8+ T cells -1 test substance CD8+ IFN-γ+ CD8+ IL-2+ CD8+ (IFN-γ+ or IL-2+) CD8+ (IFN-γ+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD8+ (IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD8+ (IFN-γ+ or IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 8.10% 7.36 4.26 0.50% 4.17 2.78 7.90% 7.18 4.94 YK-VZV-013 6.90% 6.27 3.63 0.40% 3.33 2.22 7.10% 6.45 4.44 YK-VZV-020 5.60% 5.09 2.95 0.30% 2.50 1.67 5.60% 5.09 3.50 YK-VZV-018 5.20% 4.73 2.74 0.40% 3.33 2.22 5.20% 4.73 3.25 YK-VZV-011 5.00% 4.55 2.63 0.40% 3.33 2.22 5.10% 4.64 3.19 LNP 0.00% - - 0.00% - - 0.00% - - Shingrix® 1.10% 1.00 0.58 0.12% 1.00 0.67 1.10% 1.00 0.69 YK-VZV-004 (Comparative Example 1) 2.80% 2.55 1.47 0.21% 1.75 1.17 2.70% 2.45 1.69 YK-VZV-006 (Comparative Example 2) 1.90% 1.73 1.00 0.20% 1.67 1.11 1.50% 1.36 0.94 YK-VZV-045 (Comparative Example 3) 1.50% 1.36 0.79 0.16% 1.33 0.89 1.40% 1.27 0.88 YK-VZV-007 (Comparative Example 4) 1.90% 1.73 1.00 0.18% 1.50 1.00 1.60% 1.45 1.00 B) Percentage of immune cells in the spleen of mice induced by the eliminated test drug vaccine: The combined percentage of IFN-γ+ CD8+ T cells and IL-2+ CD8+ T cells was less than four times that of the Shingrix® vaccine and less than three times that of YK-VZV-007 (comparative example 4). Alternatively, the proportion of IFN-γ+ CD8+ T cells was less than 5%, significantly lower than the optimal proportion of secretory cells for mRNA vaccines (5.20~8.10%), less than 4.0 times that of the Shingrix® positive control vaccine, and about 1 to 2 times that of YK-VZV-007; Alternatively, if the proportion of IL-2+ CD8+ T cells is less than 0.2%, its efficacy is not significantly different from or even worse than that of Shingrix® positive control vaccine and YK-VZV-007, being only about 0.8 to 1.6 times that of Shingrix® positive control vaccine and about 0.5 to 1.0 times that of YK-VZV-007, therefore it is excluded; The message is as follows: Table 29. mRNA vaccine-induced production of IFN-γ or IL-2+ CD8+ T cells -2 test substance CD8+ IFN-γ+ CD8+ IL-2+ CD8+ (IFN-γ+ or IL-2+) CD8+ (IFN-γ+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD8+ (IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) CD8+ (IFN-γ+ or IL-2+) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-012 4.20% 3.82 2.21 0.10% 0.83 0.56 4.20% 3.82 2.63 YK-VZV-028 3.10% 2.82 1.63 0.40% 3.33 2.22 3.10% 2.82 1.94 YK-VZV-038 2.40% 2.18 1.26 0.20% 1.67 1.11 2.30% 2.09 1.44 YK-VZV-031 1.80% 1.64 0.95 0.10% 0.83 0.56 1.90% 1.73 1.19 LNP 0.00% - - 0.00% - - 0.00% - - Shingrix® 1.10% 1.00 0.58 0.12% 1.00 0.67 1.10% 1.00 0.69 YK-VZV-004 (Comparative Example 1) 2.80% 2.55 1.47 0.21% 1.75 1.17 2.70% 2.45 1.69 YK-VZV-006 (Comparative Example 2) 1.90% 1.73 1.00 0.20% 1.67 1.11 1.50% 1.36 0.94 YK-VZV-045 (Comparative Example 3) 1.50% 1.36 0.79 0.16% 1.33 0.89 1.40% 1.27 0.88 YK-VZV-007 (Comparative Example 4) 1.90% 1.73 1.00 0.18% 1.50 1.00 1.60% 1.45 1.00 The YK-VZV-012 and YK-VZV-031 mRNA vaccines induced a lower proportion of IL-2+ CD8+ T cells compared to the Shingrix® vaccine and YK-VZV-007 (Comparative Example 4), and were therefore excluded. The YK-VZV-028 and YK-VZV-038 mRNA vaccines induce only about twice the proportion of IFN-γ+ CD8+ T cells and the total proportion of IFN-γ+ and IL-2+ CD8+ T cells compared to the Shingrix® vaccine, which is significantly lower than the sequence designed in part A above (more than seven times lower). Therefore, their immune efficacy is poor and they are not suitable as candidate sequences for shingles vaccines. Therefore, based on the above results, the sequences with significant advantages in overall immunization effect include: YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, and YK-VZV-018, which have excellent immunization effects and are significantly better than other sequences, among which YK-VZV-010 has the best effect.

[0189] Results of gE protein-specific IgG antibody titers in Balb / c mouse serum of VZV gE antigen variants (D56). To verify the consistency between the above partial IgG antibody titers and partial VZV gE antigen variant cellular immunoassay results, the following partial test substances (including YK-VZV-009, YK-VZV-010, YK-VZV-011, YK-VZV-013, YK-VZV-020, YK-VZV-014, YK-VZV-012, YK-VZV-018, YK-VZV-021, YK-VZV-024, YK-V ZV-028, YK-VZV-030, YK-VZV-031, YK-VZV-038, YK-VZV-004 (Comparative Example 1), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4) were used to measure serum samples from immunized mice on day 56. The titer of VZV-binding-gE antibody IgG in the serum was detected according to the method described in Example 5. The results are shown in the table below. Table 30 Serum titers of VZV-binding-gE antibody IgG (day 56) test substance Antibody GMT (×10⁴) Test antibody GMT compared to Shingrix® antibody GMT Compared with the GMT of the test antibody YK-VZV-007, the GMT of the test antibody GMT is... YK-VZV-010 750 5.00 2.68 YK-VZV-011 710 4.73 2.54 YK-VZV-018 698 4.65 2.49 YK-VZV-020 690 4.60 2.46 YK-VZV-013 669 4.46 2.39 YK-VZV-031 480 3.20 1.71 YK-VZV-030 454 3.03 1.62 YK-VZV-038 445 2.97 1.59 YK-VZV-009 420 2.80 1.50 YK-VZV-014 410 2.73 1.46 YK-VZV-012 405 2.70 1.45 YK-VZV-021 373 2.49 1.33 YK-VZV-028 357 2.38 1.28 YK-VZV-024 274 1.83 0.98 LNP 0 0.00 0.00 Shingrix® 150 1.00 0.54 YK-VZV-004 (Comparative Example 1) 330 2.20 1.18 YK-VZV-045 (Comparative Example 3) 170 1.13 0.61 YK-VZV-007 (Comparative Example 4) 280 1.87 1.00 Based on the above results, at day 56, the gE-specific antibody IgG titers of the aforementioned mRNA vaccines were all superior to the Shingrix® positive control, approximately 1.8 to 5.0 times higher. The antibody GMT distribution ranged from 270 to 750 × 10⁴. Specifically, the antibody GMT of YK-VZV-010, YK-VZV-011, YK-VZV-018, YK-VZV-020, and YK-VZV-013 reached over 650 × 10⁴, which is more than 4.0 to 5.0 times higher than the Shingrix® vaccine and more than twice that of YK-VZV-007 (Comparative Example 4). Furthermore, all were significantly superior to YK-VZV-004 (Comparative Example 1) and YK-VZV-045 (Comparative Example 3). Based on the above IgG antibody titers and CD4+ T cell and CD8+ T cell detection results, the five antigens YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, and YK-VZV-018 showed the best cellular immunization effects and were therefore selected as candidate antigens for further detection and analysis using the ELISpot method.

[0190] VZV gE antigen variant cellular immune factor results (ELISOPT). ELISOPT is the gold standard for screening and evaluating the antigen-specific T-cell immune efficacy of candidate vaccines. It can be used to distinguish different subsets of activated T cells by cytokines, such as T helper (Th) type 1 cells (producing IFN-γ, IL-2, IL-6, IL-12, IL-21 and TNF-α cytokines), Th2 (producing IL-4, IL-5, IL-10 and IL-13 cytokines) and Th17 (producing IL-17 cytokine) cells. Five optimal antigen sequences (YK-VZV-010, YK-VZV-013, YK-VZV-011, YK-VZV-020, and YK-VZV-018) were selected based on the combined results of IgG and cytokine detection. These, along with Comparative Example 1 (YK-VZV-004), Comparative Example 2 (YK-VZV-006), Comparative Example 3 (YK-VZV-045), and Comparative Example 4 (YK-VZV-007), and using LNP and Shingrix® as controls, were further detected using the ELISpot method. The results are as follows: 1) The amount of IFN-γ cytokine secreted by T cells stimulated by the mRNA vaccine was above 500 SFU, with the highest reaching nearly 600 SFU, which is about 16 to 19 times that of the Shingrix® positive control and 2.5 to 3.0 times that of control 4 (YK-VZV-007); and significantly better than the cytokines secreted by the mRNA vaccines corresponding to control 1 (YK-VZV-004), control 2 (YK-VZV-006) or control 3 (YK-VZV-045). Among them, the mRNA vaccine prepared with the YK-VZV-010 sequence reached a maximum of 598.8 SFU, which is 18.7 times that of the Shingrix® positive control and nearly 3 times that of the YK-VZV-007 control. The IFN-γ secretion levels from high to low were YK-VZV-010, YK-VZV-018, YK-VZV-011, YK-VZV-020, and YK-VZV-013, with no significant differences between groups, and all groups showed good and significant immune effects. Table 31. mRNA vaccine induces IFN-γ secretion from spleen cells. test substance IFN-γ+(SFU) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 598.8 18.71 2.99 YK-VZV-018 565 17.66 2.82 YK-VZV-011 561.7 17.55 2.80 YK-VZV-020 522.4 16.33 2.61 YK-VZV-013 511.0 15.97 2.55 LNP 1.2 0.04 0.01 Shingrix® 32.0 1.00 0.16 YK-VZV-004 (Comparative Example 1) 280.3 8.76 1.40 YK-VZV-006 (Comparative Example 2) 220.3 6.88 1.10 YK-VZV-045 (Comparative Example 3) 200.1 6.25 1.00 YK-VZV-007 (Comparative Example 4) 200.3 6.26 1.00 2) The amount of IL-2 secreted by T cells stimulated by the mRNA vaccine was above 400-600 SFU, which was 10-16 times that of the Shingrix® positive control and 2.0-3.0 times that of the YK-VZV-007 control; it was also significantly better than the cytokines secreted by the mRNA vaccines corresponding to Comparative Example 1 (YK-VZV-004), Comparative Example 2 (YK-VZV-006), or Comparative Example 3 (YK-VZV-045). Among them, the mRNA vaccine prepared with the YK-VZV-010 sequence reached a maximum of 614.5 SFU, which is 16.00 times that of the Shingrix® positive control and more than 3 times that of the YK-VZV-007 control. The IL-2 secretion levels from high to low were YK-VZV-010, YK-VZV-011, YK-VZV-018, YK-VZV-013, and YK-VZV-020, with no significant differences between groups, and all groups showed good and significant immune effects. Table 32. mRNA vaccine induces IL-2+ secretion from spleen cells. test substance IL-2+ (SFU) Compared to Shingrix® (times) Compared to YK-VZV-007 (times) YK-VZV-010 614.5 16.00 3.07 YK-VZV-011 490.3 12.77 2.45 YK-VZV-018 452.3 11.78 2.26 YK-VZV-013 441.6 11.50 2.20 YK-VZV-020 418.9 10.91 2.09 LNP 16.1 0.42 0.08 Shingrix® 38.4 1.00 0.19 YK-VZV-004 (Comparative Example 1) 274.7 7.15 1.37 YK-VZV-006 (Comparative Example 2) 230.3 6.00 1.15 YK-VZV-045 (Comparative Example 3) 205.3 5.35 1.02 YK-VZV-007 (Comparative Example 4) 200.4 5.22 1.00

[0191] VZV gE antigen variant cellular localization results: 1) C-terminal truncation and the "A568Y569R570V571" motif mutation reduced the localization of gE antigen to the trans-Gorgistrite network. The "A568Y569R570V571" motif (SEQ ID NO:184) is a transport motif that targets the gE peptide to the trans-homogeneous network. YK-VZV-018 (SEQ ID NO:63) and YK-VZV-020 (SEQ ID NO:71) are truncated peptides encoding the terminal 50 amino acids (retaining 1-573 amino acids) with a deleted C-terminal region, and mutations at any site in the A568Y569R570V571 sequence (e.g., mutations at A568D and Y569K sites). Results in Example 8 showed that both the YK-VZV-018 and YK-VZV-020 variants resulted in reduced localization of the gE peptide to the trans-homogeneous network and enhanced cell membrane expression. 2) Any combination of mutant motifs "A568Y569R570V571" or "Y582A583G584L585" reduces the localization of gE antigen into the trans-Gyrgiform network. YK-VZV-011 (SEQ ID NO:35) and YK-VZV-013 (SEQ ID NO:43) encode the full-length gE polypeptide and contain mutations at various sites of the "A568Y569R570V571" motif (SEQ ID NO:184). In addition, the "Y582A583G584L585" endocytosis motif (SEQ ID NO:185) of YK-VZV-013 is also mutated (e.g., Y582A). The results of Example 8 show that gE antigen is expressed on the cell membrane in any combination of "A568Y569R570V571" or "Y582A583G584L585" mutated motifs. 3) Full-length gE variants with the "A593E594A595A596D597A598" mutation motif, Y569K, and Y582A mutations are reduced in localization to the trans-homogeneous network. YK-VZV-010 (SEQ ID NO:31) encodes a full-length gE polypeptide, with the A593E594A595A596D597A598 (SEQ ID NO:183) sequence replacing the "S593E594S595T596D597T598" motif (SEQ ID NO:182). YK-VZV-010 replaces the Ser / Thr-rich "SSTT" acidic cluster with an Ala-rich sequence. Furthermore, the YK-VZV-010 mRNA vaccine also possesses Y569K and Y582 mutations. Results in Example 8 showed enhanced cell membrane expression of the YK-VZV-010 gE polypeptide. Each of the above variants has the modification of reducing the localization of the gE protein into the trans-Gyrtisteine ​​network and enhancing its transport to the serous membrane. Table 33 Antigen localization results of different VZV antigen sequences on Vero cells mutation site Antigen sequence SEQ ID NO Express Cell localization gE full length; Y569K; Y582A; S593A; S595A; T596A; T598A YK-VZV-010 31 +++ Display of Golgi apparatus and cell membrane localization gE (full length); A568D; Y569K; R570E; V571K YK-VZV-011 35 ++ Displaying Golgi body localization and cell membrane localization gE (full length); A568D; Y569K; R570E; V571K; Y582A YK-VZV-013 43 ++ Display of Golgi apparatus and cytoplasmic localization and cell membrane gE(1-573aa);A568D YK-VZV-018 63 +++ Display of the Golgi apparatus, cytoplasmic localization, and cell membrane. gE(1-573aa); Y569K YK-VZV-020 71 +++ Display of Golgi apparatus and cytoplasmic localization and cell membrane In summary, this invention, by designing 43 antigen sequences encoding VZV gE protein variants, screened out several sequences with superior efficacy, including several antigen sequences that are at least superior to the vaccines Shingrix® and YK-VZV-004 (Comparative Example 1), YK-VZV-006 (Comparative Example 2), YK-VZV-045 (Comparative Example 3), and YK-VZV-007 (Comparative Example 4). Such results are surprising. Among these sequences, the mutation combinations YK-VZV-010 (gE full length; Y569K; Y582A; S593A; S595A; T596A; T598A), YK-VZV-011 (gE full length; A568D; Y569K; R570E; V571K), YK-VZV-013 (gE full length; A568D; Y569K; R570E; V571K; Y582A), YK-VZV-018 (gE 1-573aa, A568D), and YK-VZV-020 (gE 1-573aa, Y569K) are preferred. The table below shows the complete sequence information and their numbers for this application. Taking the antigen sequence of YK-VZV-001 as an example, SEQ NO ID: 2 and 3 are the nucleic acid sequence ("ORF-NT") and amino acid sequence ("ORF-AA") of the open reading frame of antigen YK-VZV-001, respectively; SEQ NO ID: 1 and 4 are the DNA sequence ("DNA") and mRNA sequence ("mRNA") of antigen YK-VZV-001, respectively. Table 34 Sequence List Messages SEQ NO ID: name sequence type 1 YK-VZV-001-DNA DNA 2 YK-VZV-001- ORF-NT ORF-NT 3 YK-VZV-001- ORF-AA ORF-AA 4 YK-VZV-001- mRNA mRNA 5 YK-VZV-002- DNA DNA 6 YK-VZV-002- ORF-NT ORF-NT 7 YK-VZV-002-ORF-AA ORF-AA 8 UN-VZV-002 mRNA mRNA 9 UN-VZV-003-DNA DNA 10 YK-VZV-003-ORF-NT ORF-NT 11 YK-VZV-003-ORF-AA ORF-AA 12 UN-VZV-003 mRNA mRNA 13 UN-VZV-004-DNA DNA 14 YK-VZV-004-ORF-NT ORF-NT 15 YK-VZV-004-ORF-AA ORF-AA 16 YK-VZV-004-mRNA mRNA 17 YK-VZV-006-DNA DNA 18 YK-VZV-006-ORF-NT ORF-NT 19 YK-VZV-006-ORF-AA ORF-AA 20 YK-VZV-006-mRNA mRNA 21 UN-VZV-007-DNA DNA 22 YK-VZV-007-ORF-NT ORF-NT 23 YK-VZV-007-ORF-AA ORF-AA 24 UN-VZV-007 mRNA mRNA 25 UN-VZV-009-DNA DNA 26 YK-VZV-009-ORF-NT ORF-NT 27 YK-VZV-009-ORF-AA ORF-AA 28 UN-VZV-009 mRNA mRNA 29 YK-VZV-010-DNA DNA 30 YK-VZV-010-ORF-NT ORF-NT 31 YK-VZV-010-ORF-AA ORF-AA 32 UN-VZV-010-mRNA mRNA 33 YK-VZV-011-DNA DNA 34 YK-VZV-011-ORF-NT ORF-NT 35 YK-VZV-011-ORF-AA ORF-AA 36 UN-VZV-011 mRNA mRNA 37 YK-VZV-012-DNA DNA 38 YK-VZV-012-ORF-NT ORF-NT 39 YK-VZV-012-ORF-AA ORF-AA 40 UN-VZV-012 mRNA mRNA 41 UN-VZV-013-DNA DNA 42 YK-VZV-013-ORF-NT ORF-NT 43 YK-VZV-013-ORF-AA ORF-AA 44 UN-VZV-013 mRNA mRNA 45 UN-VZV-014-DNA DNA 46 YK-VZV-014-ORF-NT ORF-NT 47 YK-VZV-014-ORF-AA ORF-AA 48 UN-VZV-014 mRNA mRNA 49 UN-VZV-015-DNA DNA 50 YK-VZV-015-ORF-NT ORF-NT 51 YK-VZV-015-ORF-AA ORF-AA 52 UN-VZV-015 mRNA mRNA 53 UN-VZV-016-DNA DNA 54 YK-VZV-016-ORF-NT ORF-NT 55 YK-VZV-016-ORF-AA ORF-AA 56 UN-VZV-016 mRNA mRNA 57 UN-VZV-017-DNA DNA 58 YK-VZV-017-ORF-NT ORF-NT 59 YK-VZV-017-ORF-AA ORF-AA 60 UN-VZV-017 mRNA mRNA 61 UN-VZV-018-DNA DNA 62 YK-VZV-018-ORF-NT ORF-NT 63 YK-VZV-018-ORF-AA ORF-AA 64 UN-VZV-018 mRNA mRNA 65 UN-VZV-019-DNA DNA 66 YK-VZV-019-ORF-NT ORF-NT 67 YK-VZV-019-ORF-AA ORF-AA 68 UN-VZV-019 mRNA mRNA 69 YK-VZV-020-DNA DNA 70 YK-VZV-020-ORF-NT ORF-NT 71 YK-VZV-020-ORF-AA ORF-AA 72 UN-VZV-020-mRNA mRNA 73 UN-VZV-021-DNA DNA 74 YK-VZV-021-ORF-NT ORF-NT 75 YK-VZV-021-ORF-AA ORF-AA 76 UN-VZV-021 mRNA mRNA 77 UN-VZV-022-DNA DNA 78 YK-VZV-022-ORF-NT ORF-NT 79 YK-VZV-022-ORF-AA ORF-AA 80 UN-VZV-022 mRNA mRNA 81 YK-VZV-023-DNA DNA 82 YK-VZV-023-ORF-NT ORF-NT 83 YK-VZV-023-ORF-AA ORF-AA 84 UN-VZV-023 mRNA mRNA 85 UN-VZV-024-DNA DNA 86 YK-VZV-024-ORF-NT ORF-NT 87 YK-VZV-024-ORF-AA ORF-AA 88 UN-VZV-024 mRNA mRNA 89 YK-VZV-025-DNA DNA 90 YK-VZV-025-ORF-NT ORF-NT 91 YK-VZV-025-ORF-AA ORF-AA 92 UN-VZV-025 mRNA mRNA 93 UN-VZV-026-DNA DNA 94 YK-VZV-026-ORF-NT ORF-NT 95 YK-VZV-026-ORF-AA ORF-AA 96 UN-VZV-026 mRNA mRNA 97 UN-VZV-027-DNA DNA 98 YK-VZV-027-ORF-NT ORF-NT 99 YK-VZV-027-ORF-AA ORF-AA 100 UN-VZV-027 mRNA mRNA 101 UN-VZV-028-DNA DNA 102 YK-VZV-028-ORF-NT ORF-NT 103 YK-VZV-028-ORF-AA ORF-AA 104 UN-VZV-028 mRNA mRNA 105 UN-VZV-029-DNA DNA 106 YK-VZV-029-ORF-NT ORF-NT 107 YK-VZV-029-ORF-AA ORF-AA 108 UN-VZV-029 mRNA mRNA 109 UN-VZV-030-DNA DNA 110 YK-VZV-030-ORF-NT ORF-NT 111 YK-VZV-030-ORF-AA ORF-AA 112 UN-VZV-030-mRNA mRNA 113 UN-VZV-031-DNA DNA 114 YK-VZV-031-ORF-NT ORF-NT 115 YK-VZV-031-ORF-AA ORF-AA 116 UN-VZV-031 mRNA mRNA 117 YK-VZV-032-DNA DNA 118 YK-VZV-032-ORF-NT ORF-NT 119 YK-VZV-032-ORF-AA ORF-AA 120 UN-VZV-032 mRNA mRNA 121 UN-VZV-033-DNA DNA 122 YK-VZV-033-ORF-NT ORF-NT 123 YK-VZV-033-ORF-AA ORF-AA 124 UN-VZV-033 mRNA mRNA 125 UN-VZV-034-DNA DNA 126 YK-VZV-034-ORF-NT ORF-NT 127 YK-VZV-034-ORF-AA ORF-AA 128 UN-VZV-034-mRNA mRNA 129 UN-VZV-035-DNA DNA 130 YK-VZV-035-ORF-NT ORF-NT 131 YK-VZV-035-ORF-AA ORF-AA 132 UN-VZV-035 mRNA mRNA 133 UN-VZV-036-DNA DNA 134 YK-VZV-036-ORF-NT ORF-NT 135 YK-VZV-036-ORF-AA ORF-AA 136 UN-VZV-036 mRNA mRNA 137 UN-VZV-037-DNA DNA 138 YK-VZV-037-ORF-NT ORF-NT 139 YK-VZV-037-ORF-AA ORF-AA 140 UN-VZV-037 mRNA mRNA 141 UN-VZV-038-DNA DNA 142 YK-VZV-038-ORF-NT ORF-NT 143 YK-VZV-038-ORF-AA ORF-AA 144 UN-VZV-038-mRNA mRNA 145 UN-VZV-039-DNA DNA 146 YK-VZV-039-ORF-NT ORF-NT 147 YK-VZV-039-ORF-AA ORF-AA 148 UN-VZV-039 mRNA mRNA 149 YK-VZV-040-DNA DNA 150 YK-VZV-040-ORF-NT ORF-NT 151 YK-VZV-040-ORF-AA ORF-AA 152 UN-VZV-040-mRNA mRNA 153 UN-VZV-041-DNA DNA 154 YK-VZV-041-ORF-NT ORF-NT 155 YK-VZV-041-ORF-AA ORF-AA 156 UN-VZV-041 mRNA mRNA 157 YK-VZV-042-DNA DNA 158 YK-VZV-042-ORF-NT ORF-NT 159 YK-VZV-042-ORF-AA ORF-AA 160 YK-VZV-042-mRNA mRNA 161 YK-VZV-043-DNA DNA 162 YK-VZV-043-ORF-NT ORF-NT 163 YK-VZV-043-ORF-AA ORF-AA 164 YK-VZV-043-mRNA mRNA 165 YK-VZV-044-DNA DNA 166 YK-VZV-044-ORF-NT ORF-NT 167 YK-VZV-044-ORF-AA ORF-AA 168 YK-VZV-044-mRNA mRNA 169 YK-VZV-045-DNA DNA 170 YK-VZV-045-ORF-NT ORF-NT 171 YK-VZV-045-ORF-AA ORF-AA 172 YK-VZV-045-mRNA mRNA 173 5' UTR Artificial synthesis 174 5' UTR C3 (complement component 3) 175 5' UTR Artificial synthesis 176 5' UTR Artificial synthesis 177 5' UTR Artificial synthesis 178 3' UTR Homo sapiens hemoglobin β-globin gene 1 (TA) 179 3' UTR Homo sapiens hemoglobin β-globin gene 180 3' UTR PCBP4 gene 181 3' UTR CYBA_1.5x 182 S593ES595T596DT598 sequence amino acid sequence 183 A593EA595A596DA598 motif amino acid sequence 184 A568YRV571 genomic sequence amino acid sequence 185 Y582AGL585 sequence amino acid sequence

[0192] SEQ ID NO: 1 YK-VZV-001-DNA SEQ ID NO: 2 YK-VZV-001-ORF-NT SEQ ID NO: 3 YK-VZV-001- ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDKSPYNQSMYYAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 4 YK-VZV-001-mRNA SEQ ID NO: 29 YK-VZV-010 DNA SEQ ID NO: 30 YK-VZV-010-ORF-NT SEQ ID NO: 31 YK-VZV-010-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAKRVDKSPYNQSMYAAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 32 YK-VZV-010-mRNA SEQ ID NO: 33 YK-VZV-011 DNA SEQ ID NO: 34 YK-VZV-011-ORF-NT SEQ ID NO: 35 YK-VZV-011-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYYAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 36 YK-VZV-011- mRNA SEQ ID NO: 41 YK-VZV-013-DNA SEQ ID NO: 42 YK-VZV-013- ORF-NT SEQ ID NO: 43 YK-VZV-013-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYAAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 44 YK-VZV-013- mRNA SEQ ID NO: 61 YK-VZV-018-DNA SEQ ID NO: 62 YK-VZV-018- ORF-NT SEQ ID NO: 63 YK-VZV-018- ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDYRVDK SEQ ID NO: 64 YK-VZV-018- mRNA SEQ ID NO: 69 YK-VZV-020-DNA SEQ ID NO: 70 YK-VZV-020-ORF-NT SEQ ID NO: 71 YK-VZV-020- ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAKRVDK SEQ ID NO: 72 YK-VZV-020-mRNA SEQ ID NO: 73 YK-VZV-021 DNA SEQ ID NO: 74 YK-VZV-021-ORF-NT SEQ ID NO: 75 YK-VZV-021-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYEVDK SEQ ID NO: 76 YK-VZV-021-mRNA SEQ ID NO: 77 YK-VZV-022 DNA SEQ ID NO: 78 YK-VZV-022-ORF-NT SEQ ID NO: 79 YK-VZV-022-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRKDK SEQ ID NO: 80 YK-VZV-022-mRNA SEQ ID NO: 81 YK-VZV-023-DNA SEQ ID NO: 82 YK-VZV-023-ORF-NT SEQ ID NO: 83 YK-VZV-023-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDK SEQ ID NO: 84 YK-VZV-023-mRNA SEQ ID NO: 85 YK-VZV-024-DNA SEQ ID NO: 86 YK-VZV-024-ORF-NT SEQ ID NO: 87 YK-VZV-024-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDAEKDK SEQ ID NO: 88 YK-VZV-024-mRNA SEQ ID NO: 89 YK-VZV-025 DNA SEQ ID NO: 90 YK-VZV-025-ORF-NT SEQ ID NO: 91 YK-VZV-025-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKKEKDK SEQ ID NO: 92 YK-VZV-025-mRNA SEQ ID NO: 93 YK-VZV-026-DNA SEQ ID NO: 94 YK-VZV-026-ORF-NT SEQ ID NO: 95 YK-VZV-026-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDKSPYNQSMYYAGLPV SEQ ID NO: 96 YK-VZV-026-mRNA SEQ ID NO: 97 YK-VZV-027-DNA SEQ ID NO: 98 YK-VZV-027-ORF-NT SEQ ID NO: 99 YK-VZV-027-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYYAGLPV SEQ ID NO: 100 YK-VZV-027-mRNA SEQ ID NO: 101 YK-VZV-028-DNA SEQ ID NO: 102 YK-VZV-028-ORF-NT SEQ ID NO: 103 YK-VZV-028-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYAAGLPV SEQ ID NO: 104 YK-VZV-028-mRNA SEQ ID NO: 105 YK-VZV-029-DNA SEQ ID NO: 106 YK-VZV-029-ORF-NT SEQ ID NO: 107 YK-VZV-029-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYGAGLPV SEQ ID NO: 108 YK-VZV-029-mRNA SEQ ID NO: 109 YK-VZV-030-DNA SEQ ID NO: 110 YK-VZV-030-ORF-NT SEQ ID NO: 111 YK-VZV-030-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYAAGLPV SEQ ID NO: 112 YK-VZV-030-mRNA SEQ ID NO: 113 YK-VZV-031-DNA SEQ ID NO: 114 YK-VZV-031-ORF-NT SEQ ID NO: 115 YK-VZV-031-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYGAGLPV SEQ ID NO: 116 YK-VZV-031-mRNA SEQ ID NO: 117 YK-VZV-032-DNA SEQ ID NO: 118 YK-VZV-032-ORF-NT SEQ ID NO: 119 YK-VZV-032-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDYRVDKSPYNQSMYAAGLPV SEQ ID NO: 120 YK-VZV-032-mRNA SEQ ID NO: 121 YK-VZV-033-DNA SEQ ID NO: 122 YK-VZV-033-ORF-NT SEQ ID NO: 123 YK-VZV-033-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAKRVDKSPYNQSMYAAGLPV SEQ ID NO: 124 YK-VZV-033-mRNA SEQ ID NO: 125 YK-VZV-034-DNA SEQ ID NO: 126 YK-VZV-034-ORF-NT SEQ ID NO: 127 YK-VZV-034-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYEVDKSPYNQSMYAAGLPV SEQ ID NO: 128 YK-VZV-034-mRNA SEQ ID NO: 129 YK-VZV-035-DNA SEQ ID NO: 130 YK-VZV-035-ORF-NT SEQ ID NO: 131 YK-VZV-035-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRKDKSPYNQSMYAAGLPV SEQ ID NO: 132 YK-VZV-035-mRNA SEQ ID NO: 133 YK-VZV-036-DNA SEQ ID NO: 134 YK-VZV-036-ORF-NT SEQ ID NO: 135 YK-VZV-036-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYAAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 136 YK-VZV-036-mRNA SEQ ID NO: 137 YK-VZV-037-DNA SEQ ID NO: 138 YK-VZV-037-ORF-NT SEQ ID NO: 139 YK-VZV-037-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAMYAAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 140 YK-VZV-037-mRNA SEQ ID NO: 141 YK-VZV-038-DNA SEQ ID NO: 142 YK-VZV-038-ORF-NT SEQ ID NO: 143 YK-VZV-038-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYGAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 144 YK-VZV-038-mRNA SEQ ID NO: 145 YK-VZV-039-DNA SEQ ID NO: 146 YK-VZV-039-ORF-NT SEQ ID NO: 147 YK-VZV-039-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKDKEKDKSPYNQSMYGAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 148 YK-VZV-039-mRNA SEQ ID NO: 149 YK-VZV-040-DNA SEQ ID NO: 150 YK-VZV-040-ORF-NT SEQ ID NO: 151 YK-VZV-040-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDKSPYNQSMYGAGLPVDDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 152 YK-VZV-040-mRNA SEQ ID NO: 153 YK-VZV-041-DNA SEQ ID NO: 154 YK-VZV-041-ORF-NT SEQ ID NO: 155 YK-VZV-041-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKADDFEDSESTDTEEE SEQ ID NO: 156 YK-VZV-041-mRNA SEQ ID NO: 157 YK-VZV-042-DNA SEQ ID NO: 158 YK-VZV-042-ORF-NT SEQ ID NO: 159 YK-VZV-042-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKADDFEDAEAADAEEE SEQ ID NO: 160 YK-VZV-042-mRNA SEQ ID NO: 161 YK-VZV-043-DNA SEQ ID NO: 162 YK-VZV-043-ORF-NT SEQ ID NO: 163 YK-VZV-043-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKADDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 164 YK-VZV-043-mRNA SEQ ID NO: 165 YK-VZV-044-DNA SEQ ID NO: 166 YK-VZV-044-ORF-NT SEQ ID NO: 167 YK-VZV-044-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKADDFEDAEAADAEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 168 YK-VZV-044-mRNA SEQ ID NO: 169 YK-VZV-045-DNA SEQ ID NO: 170 YK-VZV-045-ORF-NT SEQ ID NO: 171 YK-VZV-045-ORF-AA MGTVNKPVVGVLMGFGIITGTLRITNPVRASVLRYDDFHIDEDKLDTNSVYEPYYHSDHAESSWVNRGESSRKAYDHNSPYIWPRNDYDGFLENAHEHHGVYNQGRGIDSGERLMQPTQMSAQEDLGDDTGIHVIPTLNGDDRHKIVNVDQRQYGDVFKGDLNPKPQGQRLIEVSVEENHPFTLRAPIQRIYGVRYTETWSFLPSLTCTGDAAPAIQHICLKHTTCFQDVVVDVDCAENTKEDQLAEISYRFQGKKEADQPWIVVNTSTLFDELELDPPEIEPGVLKVLRTEKQYLGVYIWNMRGSDGTSTYATFLVTWKGDEKTRNPTPAVTPQPRGAEFHMWNYHSHVFSVGDTFSLAMHLQYKIHEAPFDLLLEWLYVPIDPTCQPMRLYSTCLYHPNAPQCLSHMNSGCTFTSPHLAQRVASTVYQNCEHADNYTAYCLGISHMEPSFGLILHDGGTTLKFVDTPESLSGLYVFVVYFNGHVEAVAYTVVSTVDHFVNAIEERGFPPTAGQPPATTKPKEITPVNPGTSPLLRYAAWTGGLAAVVLLCLVIFLICTAKRMRVKAYRVDKSPYNQSMYAAGLPVDDFEDSESTDTEEEFGNAIGGSHGGSSYTVYIDKTR SEQ ID NO: 172 YK-VZV-045-mRNA SEQ ID NO: 173 5′ UTR 5′AGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC3′ SEQ ID NO: 174 5′ UTR 5′AGACTCCTCCCCATCCTCTCCCTCTGTCCCTCTGTCCCTCTGACCCTGCACTGTCCCAGCACCGCCACC3′ SEQ ID NO: 175 5′ UTR 5′AGCATTCTGTGGTCTGATCATCCTGTGGTTTCGTCGCCGCCATCCTCGTCGCGACACGCTGTTTTCGGTTCTCGGCCCGACGAGCCATCGCCATCCTACAGC3′ SEQ ID NO: 176 5′ UTR 5′AGCACTCGCGCTGCCATCACTCTTCCGCCGTCTTCGCCGCCATCCTCGGCGCGACTCGCTTCTTTCGGTTCTACCAGGTAGAGTCCGCCGCCATCCTCCACC3′ SEQ ID NO: 177 5′ UTR 5′AGCTTGTCTCGCTCCGGGGAACGCTCGGAAACTCCCGGCCGCCGCCACCCGCGTCTGTTCTGTTACACAAGGGAAGAAAAGCCGCTGCCGCACTCCGAGTGT3′ SEQ ID NO: 178 3′ UTR 5′gctggagcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcacccgtacccccgtggtctttgaataaagtctgagtgggcggc3′ SEQ ID NO: 179 3′ UTR 5′GCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC3′ SEQ ID NO: 180 3′ UTR 5′TTCTGGACTTCTGGACTTCTGGACTTCTGGACTTCTGGACTTCTGGACTTCTGGACTTCTGGACTTCTGGACTTCTGGACTTCTGGAC3′ SEQ ID NO: 181 3′ UTR 5′CCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGCAGCGAAGCCGGGACCTCGCCCCGGACCTGCCCTCCCGCCAGGTGCACCCACCTGCAATAAATGC3′ SEQ ID NO: 182 S593ES595T596DT598 SEQ ID NO: 183A593EA595A596DA598 SEQ ID NO: 184 A568YRV571 SEQ ID NO: 185 Y582AGL585 SEQ ID NO: 186 Y569RVDKSPYNQS579 SEQ ID NO: 187 Y569RVDKSPYNQSMYAGLPV587 SEQ ID NO: 188 SSTT SEQ ID NO: 189 The sequence of FIG. 1 AYRVYAGLSSTT SEQ ID NO: 190 The sequence of FIG. 1 YAGLSSTT SEQ ID NO: 191 The sequence of FIG. 1 AYRVYAGL

[0193] TW202602905A_114113533_SEQL.xml

Claims

1. An immunogenic composition comprising ribonucleic acid (RNA) of varicella-zoster virus (VZV), said RNA encoding a variant of wild-type VZV gE glycoprotein; wherein the sequence of said wild-type VZV gE glycoprotein is SEQ ID NO: 3; wherein said variant of said wild-type VZV gE glycoprotein is selected from the following variants: YK-VZV-020, YK-VZV-030, YK-VZV-031, YK-VZV-009, YK-VZV-010, YK-VZV-011, YK-VZV-012, YK-VZV-013 and YK-VZV-014, the reference sequence of said variant is SEQ ID NO: 3; 2. The immunogenic composition of claim 1, wherein the variant of the wild-type VZV gE glycoprotein is selected from the following variants: YK-VZV-020, YK-VZV-010, YK-VZV-011, and YK-VZV-013, the reference sequence of which is SEQ ID NO: 3; or, the amino acid sequence of the variant of the wild-type VZV gE glycoprotein is as shown in SEQ ID NO: 27, 31, 35, 39, 43, 47, 71, 111, or 115; or, the VZV RNA further comprises a 5′ untranslated region (UTR); or, the VZV RNA further comprises a 3′ untranslated region (UTR); or, the VZV RNA further comprises a poly(A) tail; or, the VZV RNA further comprises a 5′ cap; or, the sequence of the VZV RNA is as shown in SEQ ID NO:

3. SEQ ID NO: 28, 32, 36, 40, 44, 48, 72, 112 or 116; or, the RNA of the VZV is mRNA; or, the DNA sequence corresponding to the RNA encoding the variant of the wild-type VZV gE glycoprotein is as shown in SEQ ID NO: 25, 29, 33, 37, 41, 45, 69, 109 or 113.

3. The immunogenic composition of claim 2, wherein the sequence of the 5' utr is as shown in SEQ ID NO: 173, 174, 175, 176 or 177; or, the sequence of the 3' utr is as shown in SEQ ID NO: 178, 179, 180 or 181; or, the Ploy(A) tail has a length of 50 to 150 nucleotides; or, the 5' cap is 7mG(5')ppp(5')NlmpNp.

4. The immunogenic composition of claim 1, wherein the VZV RNA has an open reading frame (ORF) encoding a variant of the wild-type VZV gE glycoprotein, the sequence of which is shown in SEQ ID NO: 26, 30, 34, 38, 42, 46, 70, 110 or 114.

5. The immunogenic composition as claimed in claim 4, wherein the sequence of the open reading frame is codon-optimized.

6. The immunogenic composition of claim 5, wherein the sequence of the open reading frame comprises at least one base modification.

7. The immunogenic composition of claim 6, wherein the base modification is selected from one or more of the following: pseudouridine, N1-methylpseuuridine, N1-ethylpseuuridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseuuridine, 2-thio-1-methylpseuuridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuuridine, 2-thio-dihydrouridine, 2-thio-pseuuridine, 4-methoxy-2-thio-pseuuridine, 4-methoxy-pseuuridine, 4-thio-1-methylpseuuridine, 4-thio-pseuuridine, 5-aza-uridine, dihydropseuuridine, 5-methoxyuridine, and 2′-O-methyluridine.

8. The immunogenic composition as claimed in claim 6, wherein the base modification is 1 to 100% base modification.

9. The immunogenic composition as claimed in claim 8, wherein the base modification is 100% base modification.

10. A method for preparing an immunogenic composition as described in any one of claims 1 to 9, comprising: A template is provided that can transcribe the RNA of the VZV; under conditions suitable for transcribing the RNA, transcription is performed using the template.

11. The method of claim 10, further comprising a purification step selected from: lithium chloride precipitation, affinity chromatography, ultrafiltration with fluid exchange, and cellulose chromatography.

12. The immunogenic composition as claimed in claim 1, which is a vaccine, further comprising a pharmaceutically acceptable carrier.

13. The immunogenic composition of claim 12, wherein the pharmaceutically acceptable carrier comprises a lipid mixture.

14. The immunogenic composition as claimed in claim 13, wherein the lipid mixture is lipid nanoparticles (LNP).

15. The immunogenic composition of any one of claims 13 to 14, wherein the vaccine is an mRNA vaccine.

16. The immunogenic composition of claim 14, wherein the lipid nanoparticles comprise cationic lipids, neutral lipids, structural lipids, and polymer-conjugated lipids.

17. The immunogenic composition of claim 16, wherein the cationic lipid is selected from YK-009, YK-401, YK-305, ALC0315, SM102 and DLIN-MC3-DMA; or, the molar ratio of the cationic lipid to the neutral lipid is (1-10):1; or, the molar ratio of the cationic lipid to the structural lipid is (1-5):1; or, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid and the polymer conjugated lipid is (25-75):(5-25):(15-65):(0.5-10); or, the neutral lipid is selected from phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, derivatives thereof and any combination thereof.Alternatively, the neutral lipid is selected from: 1,2-dilinoleyl-sn-glycerol-3-phosphate choline (DLPC), 1,2-dimyristyl-sn-glycerol-3-phosphate choline (DMPC), 1,2-dioleyl-sn-glycerol-3-phosphate choline (DOPC), 1,2-dipalmityl-sn-glycerol-3-phosphate choline (DPPC), 1,2-distearateyl-sn-glycerol-3-phosphate choline (DSPC), 1,2-diundecylyl-sn-glycerol-3-phosphate choline (DUPC), 1-palmityl-2-oleyl-sn-glycerol-3-phosphate choline (POPC), 1,2-di-O-octadecenyl-sn-glycerol-3-phosphate choline (18:0Diether) PC), 1-oleyl-2-cholesterolylhemisuccinyl-sn-glycerol-3-phosphate choline (OChemsPC), 1-hexadecyl-sn-glycerol-3-phosphate choline (C16 Lyso PC), 1-,2-dilininyl-sn-glycerol-3-phosphate choline, 1,2-diarachidonicyl-sn-glycerol-3-phosphate choline, 1,2-bis(docosahexaenoenyl)-sn-glycerol-3-acid choline, 1,2-dioleyl-sn-glycerol-3-phosphate ethanolamine (DOPE), 1,2-diphydanyl-sn-glycerol-3-phosphate ethanolamine (4ME 16:0 PE), 1,2-distearyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilinoleyl-sn-glycerol-3-phosphate ethanolamine, 1,2-dilininyl-sn-glycerol-3-phosphate ethanolamine, 1,2-diarachidonicyl-sn-glycerol-3-phosphate ethanolamine, 1,2-bis(docosahexaenoyl)-sn-glycerol-3-phosphate ethanolamine, 1,2-dioleyl-sn-glycerol-3-phosphate-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleylphosphatidylglycerol Phytoethanolamine (POPE), distearyl-phosphatidyl-ethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristylphosphatidylethanolamine (DMPE), 1-stearyl-2-oleyl-stearylethanolamine (SOPE), 1-stearyl-2-oleyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylinosine, phosphatidic acid, palmityloleylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE), and mixtures thereof; Alternatively, the neutral lipid is DOPE and / or DSPC; or, the structural lipid is selected from: sterols, cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol, corticosteroids, and any combination thereof.Alternatively, the polymeric conjugated lipid is selected from: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and any combination thereof.

18. The immunogenic composition of claim 17, wherein the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymeric conjugated lipid is (35-49):(7.5-15):(35-55):(1-5); or, the structural lipid comprises cholesterol; or, the polymeric conjugated lipid is selected from: distearate phospholipid ethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristyl glycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000), methoxy polyethylene glycol bis(tetradecyl acetamide) (ALC-0159), and any combination thereof.

19. The immunogenic composition of claim 18, wherein the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymeric conjugated lipid is 49:10:43.5:1.5; or, the structural lipid is cholesterol.

20. The immunogenic composition as claimed in claim 12, wherein the effective dose of the VZV RNA is 25 μg to 200 μg; or, the vaccine is an injectable preparation.

21. The immunogenic composition as claimed in claim 20, wherein the effective dose of the VZV RNA is 50 μg to 100 μg; or, the vaccine is a liquid formulation or a lyophilized formulation.

22. A method for preparing an immunogenic composition as described in any one of claims 12 to 21, comprising: The RNA of the VZV is mixed with the pharmaceutically acceptable carrier.

23. The method of claim 22, wherein the method includes encapsulating at least a portion of the RNA inside lipid nanoparticles.

24. Use of an immunogenic composition as claimed in any one of claims 1 to 9, 12 to 21 in the preparation of a medicament for inducing a protective immune response against VZV in a subject.

25. The use as described in claim 24, wherein the protective immune response includes the production of neutralizing antibodies.

Images