A drug combination comprising a TDG inhibitor and an immune checkpoint inhibitor and its uses

Abstract

This invention relates to a pharmaceutical combination comprising a TDG inhibitor and an immune checkpoint inhibitor, and its use therein. Specifically, this invention provides a pharmaceutical combination comprising a safe and effective amount of a TDG inhibitor and a safe and effective amount of an immune checkpoint inhibitor; this invention also provides the use of said pharmaceutical combination in the prevention, mitigation, and / or treatment of diseases related to TP53 gene mutations.

Description

Technical Field

[0001] This invention relates to the pharmaceutical field, and more specifically to a drug combination comprising a TDG inhibitor and an immune checkpoint inhibitor. Prior Technology

[0002] Human thymine DNA glycosylase (TDG) is a multifunctional protein belonging to the uracil DNA glycosylase (UDG) superfamily, involved in multiple processes such as DNA mismatch repair, DNA demethylation, and transcriptional regulation. However, the mechanism of action of TDG in tumor progression remains largely unknown, resulting in a lack of effective targeted cancer treatment strategies in clinical practice.

[0003] Previous studies have revealed the potential of TDG targeting in various p53-deficient (TP53 gene mutation) tumors due to its crucial role in gene transcription regulation. Mechanistically, TDG and p53 work synergistically to promote the transcription of the RNA helicase DHX9, thereby regulating intracellular double-stranded RNA (dsRNA) levels. Specifically, inhibiting TDG in p53-deficient tumor cells leads to DHX9 downregulation, which in turn triggers the abnormal accumulation of dsRNA generated by short interspersed nuclear elements (SINEs). This process triggers an antiviral response through the RIG-I / MDA5-MAVS pathway, thereby inhibiting tumor growth and enhancing anti-tumor immune responses. However, a safe and effective small-molecule inhibitor targeting TDG is currently lacking.

[0004] Therefore, there is an urgent need in this field to develop a safe and effective small molecule inhibitor compound targeting TDG to provide a new strategy for the treatment of p53-deficient tumors. Summary of the Invention

[0005] To address the aforementioned issues, the applicant designed a small molecule compound 1 that can covalently bind to the cysteine ​​residue at position 276 of TDG, providing a new strategy for the treatment of p53-deficient tumors.

[0006] In a first aspect of the present invention, a pharmaceutical combination is provided, the pharmaceutical combination comprising: A. Safe and effective doses of TDG inhibitors; and B. Safe and effective doses of immune checkpoint inhibitors; The immune checkpoint inhibitor is selected from the group consisting of PD-1 inhibitors, PD-L1 inhibitors, CTLA-4 inhibitors, or combinations thereof.

[0007] In another preferred embodiment, the drug combination is a single dosage form; preferably, the single dosage form is an oral dosage form or an injectable dosage form.

[0008] In another preferred embodiment, the oral dosage form is selected from the group consisting of tablets, capsules, granules, and oral liquid preparations.

[0009] In another preferred embodiment, in the drug combination, the TDG inhibitor and the immune checkpoint inhibitor are administered via the same route, such as oral or intravenous administration.

[0010] In another preferred embodiment, the drug combination comprises individual dosage forms; preferably, the TDG inhibitor is an oral dosage form and the immune checkpoint inhibitor is an injectable dosage form.

[0011] In another preferred embodiment, in the drug combination, the TDG inhibitor and the immune checkpoint inhibitor are administered via different routes, for example, the TDG inhibitor is administered orally and the immune checkpoint inhibitor is administered intravenously.

[0012] In a preferred embodiment, the TDG inhibitor is a compound represented by Formula I, or a deuterated product, stereoisomer, tautomer thereof, or a pharmaceutically acceptable salt thereof: I R1 is selected from the following group: OH, H, halogen, cyano, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C2-C6 alkoxy, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 3-12 member heterocycle, substituted or unsubstituted 5-12 member heteroaromatic ring, substituted or unsubstituted -O-3-12 member heterocycle, substituted or unsubstituted -C1-C6 alkyl-phenyl, substituted or unsubstituted -O-phenyl, substituted or unsubstituted The substituted C1-C4 alkyl-C(O)-, substituted or unsubstituted C1-C4 alkyl-S(O)2-, substituted or unsubstituted C1-C6 alkyl-NH-, (substituted or unsubstituted C1-C6 alkyl)2-N-, -O(CH2)sR10, or -S(CH2)sR10; s is 0, 1, 2, or 3; R10 is selected from the group consisting of: H, substituted or unsubstituted C3-8 carbon rings, substituted or unsubstituted 3-8 member heterocycles, substituted or unsubstituted C6-C10 aryl groups, and substituted or unsubstituted 5-12 member heteroaromatic rings; R2 is independently selected from the following group: H, halogen, substituted or unsubstituted C1-C6 alkyl; R3 is selected from the group consisting of: H, halogen, cyano, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C6 alkoxy, substituted or unsubstituted C3-C12 cycloalkyl, or (C1-C6 alkyl)C(O)R8, (C1-C6 alkyl)C(O)NHR8, (C1-C6 alkyl)C(O)N(substituted or unsubstituted C1-C6 alkyl)R8, (C1-C6 alkyl)C(O)OR8; wherein R8 is selected from the group consisting of: H, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C6-C10 aryl, -(OCH2CH2)m-substituted or unsubstituted C1-C6 alkyl, or substituted or unsubstituted groups selected from the group consisting of: -(CH2)mNHC(O)(CH2)nR13, -(CH2)CHR9NHC(O)(CH2) R12 is selected from the group consisting of: substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted C6-C10 carbide ring, substituted or unsubstituted 3-12 member heterocyclic ring, and substituted or unsubstituted 5-12 member heteroaromatic ring; R13 is selected from the group consisting of: substituted or unsubstituted C3-C10 carbide ring; m and n are each independently 0, 1, 2 or 3; R4 is selected from the following group: H, halogen, cyano, substituted or unsubstituted C1-C6 alkoxy, substituted or unsubstituted C1-C6 amino, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-12 member heterocycle, substituted or unsubstituted 5-12 member heteroaromatic ring, substituted or unsubstituted -O-5-12 member heteroaromatic ring; Alternatively, R3 and R4, together with the carbon atom attached to them, form a structure selected from the group consisting of: substituted or unsubstituted C6-C10 aromatic rings, substituted or unsubstituted 5-10 member aromatic heterocycles, substituted or unsubstituted C3-C8 carbon rings, or substituted or unsubstituted 3-10 member heterocycles; R5 and R6 are each independently selected from the group consisting of: H, substituted or unsubstituted C1-C6 alkyl groups, substituted or unsubstituted C6-C10 aromatic rings, substituted or unsubstituted 5-10 member aromatic heterocycles, substituted or unsubstituted C3-C8 carbon rings, or substituted or unsubstituted 3-10 member heterocycles; or R5 and R6, together with the carbon atoms attached thereto, form substituted or unsubstituted 3-12 member carbon rings. R6' is selected from the following group: H, substituted or unsubstituted C1-C6 alkyl groups; or R6 and R6' together form =CH2; X is selected from O or S; Z is selected from O, S, or NR14; wherein R14 is H or a C1-C4 alkyl group; R7 is selected from the following group: H, substituted or unsubstituted C1-C12 alkyl groups, or C(O)R11, C(O)OR11, -CH2OC(O)OR11, -S(O)2NHR11; The R11 is selected from the group consisting of: H, substituted or unsubstituted C1-C16 alkyl, substituted or unsubstituted C6-C10 aryl, -(OCH2CH2)m-substituted or unsubstituted C1-C6 alkyl, and substituted or unsubstituted 5-8 member heterocyclic groups; Unless otherwise specified, in the above formulas, the heteroaromatic ring, heteroaryl, heterocycle, or heterocyclic group contains one, two, or three heteroatoms selected from N, S, or O; the aromatic ring, aryl, heteroaromatic ring, or heteroaryl group can be a monocyclic or fused ring; the carbocyclic, cycloalkyl, heterocyclic, or heterocyclic group can be a monocyclic, fused, bridged, or spirocyclic ring; the carbocyclic, heterocyclic, or heterocyclic group can be saturated or partially unsaturated, but does not possess aromaticity.

[0013] The substitution refers to the replacement of the hydrogen atom on the corresponding group by one or more substituents selected from the group consisting of: deuterium, halogen, hydroxyl, carboxyl, mercapto, benzyl, C2-C12 alkoxycarbonyl, C1-C6 aldehyde, (C1-C6 alkyl)3Si, amino, C1-C6 amide, nitro, cyano, unsubstituted or halogenated C1-C6 alkyl, C2-C10 alkenyl, C1-C6 alkoxy, C3-C6 cycloalkyl, C1-C6 alkyl-amino, C1-C 12-alkylaminocarbonyl, unsubstituted or halogenated C2-C10 acetyl, unsubstituted or halogenated C1-C4 alkyl-S(O)2-, unsubstituted or substituted C1-C4 alkyl-OC(O)NH-, unsubstituted or halogenated C1-C4 alkyl-SO-, unsubstituted or substituted C1-C4 alkyl-5-7-membered heterocycle, or phenyl (which may have 1-5 substituents selected from halogen, C1-C4 alkyl, C1-C4 alkoxy).

[0014] In a preferred embodiment, the compound has the structure shown in Formula III: III The definitions of R1, R2, R3 and XR7 are as described in request item 2.

[0015] In a preferred embodiment, R1 is selected from the group consisting of: halogens, substituted or unsubstituted C1-C6 alkoxy groups, substituted or unsubstituted C6-C10 aryl groups, substituted or unsubstituted 3-12 member heterocycles, substituted or unsubstituted 5-12 member heteroaromatic rings, substituted or unsubstituted -O-3-12 member heterocycles, substituted or unsubstituted C1-C4 alkyl-S(O)2-, substituted or unsubstituted C1-C6 alkyl-NH-, (substituted or unsubstituted C1-C6 alkyl)2-N-, and -O(CH2)sR10.

[0016] In a preferred embodiment, the R3 is selected from the group consisting of: H, halogens, substituted or unsubstituted C1-C6 alkyl groups, substituted or unsubstituted C3-C8 cycloalkyl groups, and substituted or unsubstituted phenyl groups.

[0017] In a preferred embodiment, the PD-1 inhibitor is selected from the group consisting of: Retifanlimab, Pucotenlimab, Cadonilimab, Serplulimab, Nivolumab / Relatlimab, Zimberelimab, Penpulimab, Dostarlimab-gxly, Prolgolimab, Tislelizumab, Camrelizumab, Sintilimab, Toripalimab, Cemiplimab-RWLC, Pembrolizumab, Nivolumab, and Balstilimab. (batielimab), Finotonlimab, Iparomlimab, Ivonescimab, entronsubab, or combinations thereof; The PD-L1 inhibitors mentioned are selected from the following group: Benmelstobart, Socazolimab, Adebrelimab, Sugemalimab, Envafolimab, Durvalumab, Avelumab, Atezolizumab, Tagitanlimab, or combinations thereof; The CTLA-4 inhibitors are selected from the following group: Tremelimumab, Ipilimumab, Cadonilimab, Erfonrilimab, Gotistobart, Pembrolizumab / Quavonlimab, Prolgolimab / nurulimab, Quavonlimab, Tuvonralimab / Iparomlimab, Volrustomig, or combinations thereof.

[0018] In a preferred embodiment, the drug combination further includes a pharmaceutically acceptable carrier.

[0019] In a preferred embodiment, the mass ratio of the TDG inhibitor to the immune checkpoint inhibitor is 1-1000:1000-1; Preferably, the mass ratio of the TDG inhibitor to the immune checkpoint inhibitor is 1-10:10-1.

[0020] In another preferred embodiment, the mass ratio of the TDG inhibitor to the immune checkpoint inhibitor in the drug combination is 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1, 150:1, 200:1, 250:1, 300:1, 350:1, 400:1, 450:1, 500:1, 550:1, 600:1, 650:1, 700:1, 750:1, 800:1, 850:1, 900:1, 950:1, or 1000:1.

[0021] In another preferred embodiment, the mass ratio of the TDG inhibitor to the immune checkpoint inhibitor in the drug combination is 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:80, 1:90, 1:100, 1:150, 1:200, 1:250, 1:300, 1:350, 1:400, 1:450, 1:500, 1:550, 1:600, 1:650, 1:700, 1:750, 1:800, 1:850, 1:900, 1:950, or 1:1000.

[0022] A second aspect of the present invention provides a medicine kit, the medicine kit comprising: (A) Safe and effective doses of TDG inhibitors; (B) Safe and effective doses of immune checkpoint inhibitors; and (C) Instruction manual.

[0023] A third aspect of the present invention provides the use of a pharmaceutical combination as described in the first aspect of the present invention, or a medicament as described in the second aspect of the present invention, said pharmaceutical combination or medicament for preparing a medicament for treating diseases related to TP53 gene mutations; Preferably, the disease associated with TP53 gene mutation is a tumor containing TP53 gene mutation; More preferably, the tumor containing the TP53 gene mutation is selected from the group consisting of: lung cancer, liver cancer, skin cancer, bladder cancer, breast cancer, colon cancer, esophageal cancer, acute myeloid leukemia, or a combination thereof.

[0024] In another preferred embodiment, the TP53 gene mutation is selected from the group consisting of: TP53 missense mutation, TP53 gene deletion, TP53 frameshift mutation, TP53 splice site mutation, TP53 truncation mutation, or a combination thereof.

[0025] In another preferred embodiment, the drug combination or kit is used to inhibit the binding of TDG to genomic DNA.

[0026] In a preferred embodiment, the drug combination or kit is used to inhibit the activity of TDG.

[0027] In another preferred embodiment, the drug combination or kit is used to inhibit the binding of TDG to dsDNA.

[0028] In another preferred embodiment, the drug combination or kit is used in combination with TDG.

[0029] In a preferred embodiment, the drug combination or kit is used to reduce the level of DHX9 in p53 mutant tumor cells, or the drug combination or kit is used to increase the level of dsRNA in p53 mutant tumor cells.

[0030] In another preferred embodiment, the pharmaceutical composition is used to inhibit the growth of p53 mutant tumor cells.

[0031] A fourth aspect of the present invention provides the use of a TDG inhibitor for the preparation of: (a) A covalent ligand that selectively binds to cysteine ​​residue 276 (Cys276) in a target protein; and / or (b) Use in pharmaceutical compositions for the prevention, mitigation and / or treatment of diseases associated with TP53 gene mutations.

[0032] In another preferred embodiment, the TDG inhibitor is used to inhibit the binding of TDG to genomic DNA.

[0033] In another preferred embodiment, the TDG inhibitor is used to inhibit the activity of TDG.

[0034] In another preferred embodiment, the TDG inhibitor is used to inhibit the binding of TDG to dsDNA.

[0035] In another preferred embodiment, the TDG inhibitor is used to improve the thermal stability of the TDG protein.

[0036] In another preferred embodiment, the TDG inhibitor is used to bind to TDG.

[0037] In another preferred embodiment, the TDG inhibitor is used to inhibit the expression of DHX9 protein in KP cells.

[0038] In another preferred embodiment, the TDG inhibitor is used to promote the accumulation of dsRNA in the cytoplasm.

[0039] In another preferred embodiment, the TDG inhibitor is used to reduce the level of DHX9 in TP53 mutant tumor cells, or the TDG inhibitor is used to increase the level of dsRNA in TP53 mutant tumor cells.

[0040] In another preferred embodiment, the TDG inhibitor is a compound of formula I.

[0041] A fifth aspect of the present invention provides a method for designing a TDG inhibitor, comprising the steps of: (a) A candidate molecule is provided that can bind to Cys276 in the TDG protein; (b) Determine the TDG binding capacity of the candidate molecules.

[0042] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Simple Explanation of the Diagram

[0043] Figure 1 shows the inhibition curve of compound 1 on TDG activity. Figure 2 shows the inhibition curve of compound 1 on the binding of TDG to double-stranded DNA. Figure 3 shows the binding constant Kd of compound 1 with TDG. Figure 4 shows the binding constant Kd of compound 1 with three other glycosylation enzymes in the same family. Figure 5 shows the inhibitory effect of compound 1 on the activity of enzymes targeting 23 epigenetic sites. Figure 6 shows that compound 1 is covalently bonded to TDG. Figure 7 shows the eutectic of compound 1 and TDG. Figure 8 shows the effect of compound 1 on the thermal stability of TDG protein at the cellular level. Figure 9 shows the effect of compound 1 on the binding of TDG to genomic DNA. Figure 10 shows the effect of compound 1 on DHX9 protein expression in KP cells (Trp53 knockout mouse lung cancer cells). Figure 11 shows the effect of compound 1 on dsRNA levels in KP cells (Trp53 knockout mouse lung cancer cells). Figure 12 shows the effect of compound 1 on dsRNA levels in p53 mutant and wild-type tumor cells. Figure 13 shows the IC50 inhibitory effect of compound 1 on the in vitro proliferation of p53 mutant and wild-type tumor cell lines. Figure 14 shows the inhibitory effects of compound 1 on p53 mutant and wild-type tumor cell lines. Figure 15 shows the inhibitory effect of compound 1 on subcutaneous tumor growth in immunodeficient mice with p53 mutant and wild-type tumor cell lines. Figure 16 shows the experiment of compound 1 in combination with anti-CTLA-4 antibody in p53-deficient homologous mouse models KP, 4T1, and MC38. Figure 17 shows the mechanism of action of compound 1 on p53 mutant tumors. Implementation

[0044] Through long-term and in-depth research and extensive screening, the applicant has developed for the first time a small molecule inhibitor that inhibits the function of TDG by covalently modifying the cysteine ​​residue at position 276. The applicant further investigated the role of this inhibitor in tumors associated with TP53 gene mutations. Based on this, the applicant has completed this invention. [the term]

[0045] In this invention, the halogen is F, Cl, Br or I.

[0046] In this invention, unless otherwise specified, the terms used have their general meanings known to those skilled in the art. In this invention, unless otherwise specified, all chemical formulas are intended to cover any possible optical or geometric isomers (e.g., R-type, S-type, or racemic, or cis-trans isomers of alkenes, etc.).

[0047] In this invention, the term "C1-C6 alkyl" refers to a straight-chain or branched alkyl group having 1 to 6 carbon atoms, and includes, without limitation, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, and hexyl; preferably ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, and tert-butyl.

[0048] In this invention, the term "C1-C6 alkoxy" refers to a straight-chain or branched alkoxy group having 1 to 6 carbon atoms, and includes, without limitation, methoxy, ethoxy, propoxy, isopropoxy, and butoxy.

[0049] In this invention, the term C1-C6 amino group refers to “C1-C6 alkyl-NH-” and “(C1-C6 alkyl)2N-”, or similar structures.

[0050] In this invention, the term "C2-C6 alkenyl" refers to a straight-chain or branched alkenyl group having 2 to 6 carbon atoms and containing a double bond, and includes, without limitation, vinyl, propenyl, butenyl, isobutenyl, pentenyl, and hexenyl groups.

[0051] In this invention, the term "C2-C6 ynyl" refers to a straight-chain or branched ynyl group having 2 to 6 carbon atoms and containing a triple bond, and includes, without limitation, ethynyl, propynyl, butynyl, isobutynyl, pentylyl, and hexynyl.

[0052] In this invention, the term "C3-C10 cycloalkyl" refers to a cyclic alkyl group having 3 to 10 carbon atoms on a ring, and non-limitingly includes cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and cyclodecyl, etc. The terms "C3-C8 cycloalkyl", "C3-C7 cycloalkyl", and "C3-C6 cycloalkyl" have similar meanings.

[0053] In this invention, the term "C1-C12 alkoxycarbonyl" refers to an alkoxycarbonyl group having 1 to 12 carbon atoms on an alkyl chain, and includes, without limitation, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, isopropoxycarbonyl, tert-butoxycarbonyl, benzyloxycarbonyl, etc.

[0054] In this invention, the term "C1-C12 alkylaminocarbonyl" refers to an alkylaminocarbonyl group having 1 to 12 carbon atoms on an alkyl chain, and includes, without limitation, methylaminocarbonyl, ethylaminocarbonyl, propylaminocarbonyl, isopropylaminocarbonyl, tert-butylaminocarbonyl, benzylaminocarbonyl, dimethylaminocarbonyl, etc.

[0055] In this invention, the terms "aromatic ring" and "aryl" have the same meaning, and preferably "aryl" refers to "C6-C12 aryl" or "C6-C10 aryl". The term "C6-C12 aryl" refers to an aromatic cyclic group with 6 to 12 carbon atoms that does not contain heteroatoms on the ring, such as phenyl or naphthyl. The term "C6-C10 aryl" has a similar meaning.

[0056] In this invention, the terms "aromatic heterocycle," "heteroaromatic ring," or "heteroaryl" have the same meaning, referring to a heteroaromatic group containing one or more heteroatoms. Heteroatoms referred to herein include oxygen, sulfur, and nitrogen. Examples include furanyl, thiophene, pyridinyl, pyrazolyl, pyrroleyl, N-alkylpyrroleyl, pyrimidinyl, pyridine, imidazolyl, tetrazolyl, etc. The heteroaryl ring may be fused to an aryl, heterocyclic, or cycloalkyl ring, wherein the ring connected to the parent structure is the heteroaryl ring. The heteroaryl group may be optionally substituted or unsubstituted.

[0057] In this invention, the term "3-12 member heterocyclic group" refers to a saturated or unsaturated 3-12 member heterocyclic group containing 1 to 3 heteroatoms selected from oxygen, sulfur, and nitrogen, such as dioxanepentyl. The term "3-7 member heterocyclic group" has a similar meaning.

[0058] In this invention, the term "substitution" refers to the substitution of one or more hydrogen atoms on a specific group by a specific substituent. The specific substituent is either the substituent described accordingly above or the substituent appearing in the various embodiments. Unless otherwise specified, a substituted group may have a substituent selected from a specific group at any substituted site of that group, and the substituents may be the same or different at each position. Cyclic substituents, such as heterocyclic alkyl groups, may be attached to another ring, such as a cycloalkyl group, thereby forming a spirobicyclic system, for example, where the two rings share a common carbon atom. Those skilled in the art will understand that the combinations of substituents contemplated in this invention are those that are stable or chemically feasible. The substituents are, for example (but not limited to): C1-8 alkyl, C2-8 alkenyl, C2-8 alkynyl, C3-8 cycloalkyl, 3- to 12-membered heterocyclic, aryl, heteroaryl, halogen, hydroxyl, carboxyl (-COOH), C1-8 aldehyde, C2-10 acetyl, C2-10 ester, C1-C12 alkoxycarbonyl, amino, alkoxy, C1-10 sulfonylurea, etc.

[0059] As used herein, a “drug combination” can be a combination of two or more active ingredients; it can also be a combination of drug compositions prepared from various active ingredients individually, such as a combination of tablets and injections, a combination of capsules and injections, a combination of tablets and tablets, or a combination of tablets and capsules; or it can be a drug composition prepared by combining various active drugs.

[0060] The term "active ingredient" or "active drug" in the context of pharmaceutical combinations according to the invention refers to the TDG inhibitor and / or immune checkpoint inhibitor according to the invention.

[0061] "Drug combination therapy," "combination therapy," "combination treatment," "combination medication," or "combination therapy" refers to drug treatment achieved by combining or mixing more than one active ingredient. For example, the combination of TDG inhibitors and immune checkpoint inhibitors used in this article, where their respective symptoms and manifestations constitute combination therapy. "Combination" administration means that two drugs (such as TDG inhibitors and immune checkpoint inhibitors used in this article) are administered in any manner in which the pharmacological effects of both drugs are simultaneously manifested in the patient. Therefore, combination administration does not require the use of a single drug composition, the same dosage form, or even the same route of administration for the two drugs, or the simultaneous administration of the two drugs. The two drugs can be administered simultaneously, sequentially, or alternately. The two drugs can also be formulated into a single pharmaceutically acceptable composition. Non-limiting examples of such single compositions are oral compositions or oral dosage forms.

[0062] "Pharmaceutical acceptable" means safe and non-toxic, preferably for internal use, and more preferably for human use. [Active Ingredients——] [TDG] [Inhibitor]

[0063] As used herein, “TDG inhibitor” refers to a compound of formula (I) and also includes its stereoisomers, its optical isomers, its pharmaceutically acceptable salts, its crystal forms, its isotopic derivatives, its prodrugs, its metabolites, its solvates or hydrates thereof.

[0064] Unless otherwise specified, the structural formulas described in this invention are intended to include all stereoisomers (such as cis-trans isomers, enantiomers, diastereomers, and conformational isomers): R and S configurations containing an asymmetric center, (Z) and (E) isomers of double bonds, cis-trans isomers of cycloalkanes, etc. Therefore, any single stereochemical isomer of the compounds of this invention, or a mixture of its enantiomers, diastereomers, or conformational isomers, is within the scope of this invention.

[0065] The compounds of this invention may contain cis-trans isomers, one or more chiral carbon atoms, and thus can produce cis-trans isomers, chiral isomers, enantiomers, diastereomers, and other combinations of stereoisomers. Cis-trans isomerism refers to the diastereomeric phenomenon in which different functional groups in a compound molecule are arranged differently in space due to a restrictive factor that limits free rotation. This restrictive factor is generally caused by non-rotating functional groups in the structure of organic compounds, such as C=C double bonds, C=N double bonds, C=S double bonds, N=N double bonds, heterocycles, or cycloalkanes. Organic molecules containing such isomers, such as alkenes, azo compounds, and cycloalkanes, are considered cis-trans isomers. Cis refers to the same ligands being in adjacent positions, generally denoted by "cis" or "cis-"; trans refers to the same ligands being in diagonal positions, generally denoted by "trans" or "trans-". Each chiral carbon atom can be defined as (R)- or (S)- based on stereochemistry. This invention aims to include all possible isomers, their racemic and optically pure forms. The compounds of this invention can be prepared using racemic, cis-trans, chiral, diastereomer, or enantiomers as starting materials or intermediates. Optically active isomers can be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, such as crystallization and chiral chromatography.

[0066] Conventional techniques for preparing / separating individual optical isomers (i.e., cis-trans isomers and chiral isomers) include chiral synthesis from suitable cis-trans precursors or optically pure precursors, or resolution of racemates (or racemates of salts or derivatives) using, for example, chiral high-performance liquid chromatography.

[0067] To design the synthesis of a specific stereoisomer of the compound of this invention, it can be prepared asymmetrically or derivatized with a chiral auxiliary. The resulting stereo mixture is then separated, and the chiral auxiliary is removed to obtain pure cis-trans monomers, chiral monomers, or mixed stereoisomers. If the molecule contains a cis-trans isomer center, it can be purified by column chromatography (normal-phase silicone column or reverse-phase high-performance liquid chromatography) to obtain pure cis or trans products. Alternatively, if the molecule contains a basic functional group, such as an amino acid, or an acidic functional group, such as a carboxyl group, it can be formed with a suitable optically active acid or base to form a diastereomer salt, which is then separated by conventional methods such as separation crystallization or chromatography to obtain pure enantiomers.

[0068] This invention also includes isotopically labeled compounds (i.e., isotopic derivatives), equivalent to the original compounds disclosed herein. However, it is common practice for one or more atoms to be substituted with atoms of different atomic weights or mass numbers. Examples of isotopes in the isotopic derivatives of this invention include hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, and chlorine isotopes, such as 2H, 3H, 13C, 11C, 14C, 15N, 18O, 17O, 31P, 32P, 35S, 18F, and 36Cl, respectively. Isotopic derivatives of the compounds of this invention are all within the scope of protection of this invention. In this document, 3H-labeled and 14C-labeled compounds are useful in drug and subject tissue distribution experiments. Tritium (i.e., 3H) and carbon-14 (i.e., 14C)-labeled compounds are relatively easy to prepare and detect, and are the preferred isotopes. Furthermore, heavier isotope substitutions, such as deuterium (2H), are preferred in certain therapies due to their excellent metabolic stability, which can be advantageous in some cases, such as increasing half-life or reducing dosage in vivo. Isotope-labeled compounds can be prepared using general methods by replacing non-isotopic reagents with readily available isotope-labeling reagents, according to the schemes disclosed in the examples.

[0069] As used herein, the term "pharmaceutically acceptable salt" includes pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

[0070] "Pharmaceutically acceptable acid addition salts" refer to salts formed with inorganic or organic acids that retain the bioavailability of the free base without other side effects. Inorganic acid salts include, but are not limited to, hydrochlorides, hydrobroms, sulfates, nitrates, and phosphates; organic acid salts include, but are not limited to, formates, acetates, 2,2-dichloroacetate, trifluoroacetate, propionates, hexanoates, octanoates, decanoates, undecenoates, glycolates, gluconates, lactates, sebates, adipates, glutarate, malonates, oxalates, maleates, succinates, fumarates, tartrates, citrates, palmitates, stearates, oleates, cinnamates, laurates, malates, glutamates, pyroglutamates, aspartates, benzoates, methanesulfonates, benzenesulfonates, p-toluenesulfonates, alginates, ascorbic acid salts, salicylates, 4-aminosalicylates, and naphthalenedisulfonates. These salts can be prepared using methods known in this field.

[0071] "Pharmaceutically acceptable base addition salts" refer to salts formed with inorganic or organic bases that retain the bioavailability of the free acid without other side effects. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum salts. Preferred inorganic salts are ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, the following: primary amines, secondary amines, and tertiary amines; substituted amines, including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, triethanolamine, dimethylethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, choline, betaine, ethylenediamine, glucosamine, methylglucosamine, theobromine, purine, piperidine, piperidine, N-ethylpiperidine, polyamine resins, etc. Preferred organic bases include isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. These salts can be prepared by methods known in the art.

[0072] Metabolites of the compound represented by formula (I) and its pharmaceutically acceptable salts, as well as prodrugs that can be converted in vivo into the compound represented by formula (I) and its pharmaceutically acceptable salts, are also included within the scope of protection of this invention.

[0073] As used herein, the term "solvent" refers to a complex of a compound of formula (I) coordinated with a solvent molecule in a specific ratio.

[0074] As used herein, the term "hydrate" refers to a complex of the compound represented by formula (I) coordinated with water molecules in a specific ratio.

[0075] As described herein, the compounds of the present invention can be substituted with any number of substituents or functional groups to broaden their scope. Generally, the term "substitution" refers to replacing a hydrogen radical with a substituent of a specified structure. When multiple positions in a particular structure are substituted by multiple specific substituents, each substituent position can be the same or different. The term "substitution" as used herein includes all permissible organic group substitutions. In a broad sense, permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic organic groups. As described herein, heteroatomic nitrogen may be supplemented with a hydrogen substituent or any permissible organic group described above to complete its valence state. Furthermore, the present invention is not intended to limit permissible substituted organic groups in any way. The present invention considers the combination of substituents and variable groups to be beneficial in the treatment of diseases in the form of stable compounds. The term "stable" here means having a stable compound that, when tested for a sufficiently long time, maintains sufficient integrity of the compound structure, preferably remaining effective for a sufficiently long time, and is used herein for the aforementioned purposes. [Active Ingredient – ​​Immune Checkpoint Inhibitor]

[0076] Immune checkpoint inhibitors are a class of anti-tumor drugs that work by inhibiting immune checkpoints in the immune system. By blocking the function of immune checkpoints, they enable immune cells to reactivate and kill tumor cells. The immune checkpoint inhibitors discussed in this article include, but are not limited to, PD-1 inhibitors, PD-L1 inhibitors, CTLA-4 inhibitors, or combinations thereof.

[0077] In a preferred embodiment, the PD-1 inhibitors include, but are not limited to: Retifanlimab, Pucotenlimab, Cadonilimab, Serplulimab, Nivolumab / Relatlimab, Zimberelimab, Penpulimab, Dostarlimab-gxly, Prolgolimab, Tislelizumab, Camrelizumab, Sintilimab, Toripalimab, Cemiplimab-RWLC, Pembrolizumab, Nivolumab, and Balstilimab. (batielimab), Finotonlimab, Iparomlimab, Ivonescimab, entronsubab, or combinations thereof; In a preferred embodiment, the PD-L1 inhibitor includes, but is not limited to: Benmelstobart, Socazolimab, Adebrelimab, Sugemalimab, Envafolimab, Durvalumab, Avelumab, Atezolizumab, Tagitanlimab, or combinations thereof; In a preferred embodiment, the CTLA-4 inhibitor includes, but is not limited to: Tremelimumab, Ipilimumab, Cadonilimab, Erfonrilimab, Gotistobart, Pembrolizumab / Quavonlimab, Prolgolimab / nurulimab, Quavonlimab, Tuvonralimab / Iparomlimab, Volrustomig, or combinations thereof. [application]

[0078] Since the TDG inhibitor of the present invention can selectively bind to cysteine ​​residue 276 (Cys276) in the target protein, the drug combination of the present invention, including the TDG inhibitor and the immune checkpoint inhibitor, can be used to prevent and / or treat (stabilize, alleviate or cure) diseases containing TP53 gene mutations.

[0079] In this application, the term "pharmaceutical composition" refers to a formulation comprising the pharmaceutical composition of the present invention (i.e., a pharmaceutical composition comprising a TDG inhibitor and an immune checkpoint inhibitor) and a medium generally accepted in the art for delivering a bioactive compound to a mammal (e.g., a human). This medium includes pharmaceutically acceptable carriers. The purpose of the pharmaceutical composition is to facilitate administration to the organism, thereby facilitating the absorption of the active ingredient and the exertion of its bioactivity.

[0080] The pharmaceutical compositions of the present invention comprise TDG inhibitors and immune checkpoint inhibitors within a safe and effective range, as well as pharmaceutically acceptable excipients or carriers. "Safe and effective range" refers to an amount of the compound sufficient to significantly improve the condition without causing serious side effects.

[0081] "Pharmaceutically acceptable carrier" refers to one or more compatible solid or liquid fillers or gel substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with and with the TDG inhibitors and immune checkpoint inhibitors of the present invention without significantly reducing the efficacy of the compounds. Examples of pharmaceutically acceptable carrier components include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (such as Tween®), wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0082] The administration method of the TDG inhibitor, immune checkpoint inhibitor, or pharmaceutical composition of the present invention is not particularly limited. Representative administration methods include, but are not limited to, oral administration and parenteral administration (intravenous, intramuscular, or subcutaneous).

[0083] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In these solid dosage forms, the active compound is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following components: (a) fillers or compatibilizers, such as starch, lactose, sucrose, glucose, mannitol, and silica; (b) binders, such as hydroxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and gum arabic; (c) humectants, such as glycerin; (d) disintegrants, such as agar, calcium carbonate, potato starch or cassava starch, alginate, certain complex silicates, and sodium carbonate; (e) slowing agents, such as paraffin; (f) absorption accelerators, such as quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glyceryl monostearate; (h) adsorbents, such as kaolin; and (i) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium dodecyl sulfate, or mixtures thereof. Buffers may also be included in the dosage forms of capsules, tablets, and pills.

[0084] Solid dosage forms such as tablets, sugar pills, capsules, pellets, and granules can be prepared using coatings and shells, such as casings and other materials known in the art. They may contain opacifying agents, and the release of the active compound or compound in such compositions can be delayed in a portion of the digestive tract. Examples of encapsulating components that can be used are polymeric substances and waxes. If necessary, the active compound may also be formed into microcapsules with one or more of the excipients described above.

[0085] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, or tinctures. In addition to the active compound, liquid dosage forms may contain inert diluents conventionally used in the art, such as water or other solvents, solubilizers and emulsifiers, e.g., ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butanediol, dimethylformamide, and oils, particularly cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil, and sesame oil, or mixtures of these substances.

[0086] In addition to these inert diluents, the composition may also contain auxiliaries such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents and fragrances.

[0087] In addition to the active ingredient, the suspension may contain suspending agents, such as ethoxylated isooctadecyl alcohol, polyoxyethylene sorbitol and dehydrated sorbitol esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these substances.

[0088] Compositions for parenteral injection may comprise physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions, or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents, or excipients include water, ethanol, polyols, and suitable mixtures thereof.

[0089] Dosage forms for topical administration include ointments, powders, patches, sprays, and inhalers. The active ingredient is mixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants that may be necessary.

[0090] The drug combination of the present invention can also be administered in combination with other pharmaceutically acceptable compounds.

[0091] When administered in combination, the pharmaceutical composition further comprises one or more (two, three, four, or more) other pharmaceutically acceptable compounds. One or more (two, three, four, or more) of these other pharmaceutically acceptable compounds may be used simultaneously, separately, or sequentially with the pharmaceutical composition of the present invention for the prevention and / or treatment of diseases containing TP53 gene mutations.

[0092] When using the pharmaceutical composition, a safe and effective amount of the pharmaceutical composition of the present invention is administered to the mammal (such as a human) requiring treatment. The dosage at the time of administration is the pharmaceutically considered effective dose. For a person weighing 60 kg, the daily dose is typically 1-2000 mg, preferably 20-500 mg. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of the skills of a skilled physician. [The main advantages of this invention:] 1. Compound 1 of the present invention exhibits potent therapeutic effects in p53-deficient tumors, especially when used in combination with immune checkpoint inhibitors, showing excellent synergistic effects. 2. Compound 1 of the present invention can specifically modify the cysteine ​​residue at position 276 of TDG. 3. Compound 1 of the present invention can effectively inhibit the DNA binding ability of TDG.

[0093] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0094] As used in this article, the terms “p53 defective,” “p53 mutant,” “TP53 gene mutation,” and “Trp53 knockout” are synonymous. [Example] [1] [Compound] [1] [Preparation]

[0095] Step 1: Synthesis of 4-hydroxy-2-methoxy-5-methylbenzaldehyde (b) 5-Methoxy-2-methylphenol(a) (10 g, 72.38 mmol, 1 equivalent) was dissolved in dichloromethane (500 mL), and then dichloro(methoxy)methane (16.6 g, 144.76 mmol, 12.80 mL, 2 equivalents) and titanium tetrachloride (34.3 g, 180.95 mmol, 2.5 equivalents) were added in a single batch at -78 °C. The temperature was then gradually increased to 25 °C, and the mixture was stirred for 16 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 4:1) showed that the starting material was completely consumed. Water (200 mL) was added to the reaction mixture, and extraction was performed with ethyl acetate (200 mL * 3). The organic layers were combined, dried over magnesium sulfate, and concentrated under reduced pressure. The residue was purified by recrystallization from tetrahydrofuran / dichloromethane (1:3, 40 mL). Compound b (6.1 g, 36.71 mmol, yield 50.72%) was obtained as a dark red solid. 1H NMR spectrum (400MHz, deuterated DMSO) δ: 10.64 (broad singlet, 1H), 10.11 (singlet, 1H), 7.44 (singlet, 1H), 6.53 (singlet, 1H), 3.82 (singlet, 3H), 2.07 (singlet, 3H).

[0096] Step 2: Synthesis of 4-(allyloxy)-2-methoxy-5-methylbenzaldehyde (c) Compound b (5.0 g, 30.09 mmol, 1 equivalent) was dissolved in dimethylformamide (75 mL), and potassium carbonate (12.5 g, 90.27 mmol, 3 equivalent) and 3-bromopropene (4.73 g, 39.12 mmol, 1.3 equivalent) were added. The mixture was then stirred at 25 °C for 3 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 4:1) showed that the reaction was complete. The reaction solution was filtered through diatomaceous earth, and the filtrate was concentrated to obtain the residue. The residue was then analyzed by silica gel rapid chromatography (ISCO®; 80 g SepaFlash® silica gel rapid column, eluent 0–10% ethyl acetate / petroleum ether gradient, flow rate 65 mL / min, petroleum ether:ethyl acetate = 3:1, Rf = 0.4, product). Compound c (5.3 g, 25.70 mmol, yield 85.41%) was obtained as a white solid. 1H NMR spectrum (400MHz, deuterated chloroform): 10.30 (single peak, 1H), 7.64 (doublet, J=0.61 Hz, 1H), 6.40 (single peak, 1H), 6.09 (multiplet, 1H), 5.48 (multiplet, 1H), 5.36 (multiplet, 1H), 4.65 (triplet doublet, J=1.53, 5.01 Hz, 2H), 3.91 (single peak, 3H), 2.19 (single peak, 3H).

[0097] Step 3: Synthesis of 4-(4-(allyloxy)-2-methoxy-5-methylphenyl)-3-oxabicyclo[3.1.0]hexane-2-one (d) First, (Z)-ethyl 2-(phenylsulfinyl)cyclopropane-1-carboxylic acid ester (c-1) was prepared according to a previously reported method (Chawner, SJ, et al. Divergent Synthesis of Cyclopropane-Containing Lead-Like Compounds, Fragments and Building Blocks through a Cobalt Catalyzed Cyclopropanation of Phenyl Vinyl Sulfide. European J Org Chem 2017, 5015-5024). Compound c-1 (8.09 g, 33.94 mmol, 1 equivalent) was dissolved in tetrahydrofuran (210 mL), and isopropyl magnesium chloride (2 M, 25.46 mL, 1.5 equivalent) was added at -78 °C, followed by stirring at -78 °C for 1 hour. Compound c (7.0 g, 33.94 mmol, 1.0 equivalent) was dissolved in a mixed solution of toluene (20 mL) and tetrahydrofuran (10 mL), added to the reaction system, and stirred at 0 °C for 3 hours. Thin-layer chromatography (petroleum ether: ethyl acetate = 3:1) showed that the reaction was complete. The reaction was quenched with 200 mL of water and ammonium chloride aqueous solution, and extracted with ethyl acetate (200 mL * 3). The organic layers were combined, dried over sodium sulfate, filtered, and concentrated to obtain the residue. The residue was purified by rapid silica gel chromatography (ISCO®; 220 g SepaFlash® rapid silica gel column, eluent gradient of 0–10 and 15% ethyl acetate / petroleum ether, flow rate 30 mL / min, petroleum ether:ethyl acetate = 3:1, Rf = 0.55, product: PMA). A colorless oily compound d (4.8 g, 16.80 mmol, yield 49.49%) was obtained. 1H NMR spectrum (400 MHz, deuterated chloroform): δ: 6.96–7.08 (multiplet, 1H), 6.47 (singlet, 1H), 6.00–6.18 (multiplet, 1H), 5.84 (doublet, J = 4.62 Hz, 0.24H), 5.51 (singlet, 0.7H), 5.46 (quartet, J = 1.65, 17.28 Hz, 1H), 5.27–5.36 (multiplet, 1H), 4.59 (triplet, J = 1.68, 5.01 Hz, 1H). Hz, 2H), 3.82-3.90 (multiple peaks, 3H), 2.61-2.72 (multiple peaks, 0.2H), 2.12-2.30 (multiple peaks, 4.8H), 1.20-1.40 (multiple peaks, 1H), 0.96-1.10 (multiple peaks, 1H), 0.80-0.90 (multiple peaks, 0.28H). Liquid chromatography-mass spectrometry: (ESI) m / z = 275.2(M+1)+, retention time = 0.87 min.

[0098] Step 4: Synthesis of 4-(4-hydroxy-2-methoxy-5-methylphenyl)-3-oxabicyclo[3.1.0]hexane-2-one (Compound 1) Compound d (3.8 g, 13.85 mmol, 1 equivalent) was dissolved in tetrahydrofuran (100 mL), and palladium acetate (933 mg, 4.16 mmol, 0.3 equivalent) and triphenylphosphine (4.36 g, 16.62 mmol, 1.2 equivalent) were added. The mixture was then stirred at 25 °C for 20 hours. Thin-layer chromatography (petroleum ether:ethyl acetate = 1:1) showed that the reaction was complete. The mixture was combined with two other batches (230 mg and 500 mg scales, respectively) and post-processed. The solvent was removed to obtain the residue. The residue was purified by silica gel rapid chromatography (ISCO®; 80+40 g SepaFlash® silica gel rapid column, eluent 0–30% ethyl acetate / petroleum ether gradient, flow rate 60 mL / min, petroleum ether:ethyl acetate = 1:1, Rf = 0.45, product, PMA). Fractions of the desired product were combined and concentrated. The residue was prepared with methyl tert-butyl ether: petroleum ether (1:1, 10 mL) to obtain compound 1 (990 mg, 4.23 mmol, yield 25.64%), which was a grayish-white solid. 1H NMR spectrum (400MHz, deuterated DMSO): δ: 9.19-9.67 (multiplet, 1H), 6.82-6.98 (multiplet, 1H), 6.44-6.54 (multiplet, 1H), 5.73 (doublet, J=4.65 Hz, 0.2H), 5.39 (singlet, 0.8H), 3.64-3.79 (multiplet, 3H), 2.12-2.28 (multiplet, 2H), 1.98-2.11 (multiplet, 3H), 1.29 (doublet, triplet, J=4.46, 8.16 Hz, 0.8H), 1.00-1.10 (multiplet, 0.2H), 0.96 (quartet, J=4.28 Hz, 0.8H), 0.71 (broad doublet, J=3.30 Hz, 0.2H). Liquid chromatography-mass spectrometry: (ESI) m / z = 235.1(M+1)+, retention time = 0.749 min. [Example] [2] [Compound] [1] [right] [TDG] [Inhibition of activity]

[0099] The experiment used 50 nM TDG recombinant human protein, 30 nM FAM and biotin to co-label double-stranded DNA receptors containing G / U mismatch, and the reaction was carried out in a specific buffer environment.

[0100] The specific buffer solution consists of 20 mM HEPES, pH 7.5, 0.2 mM EDTA, 2.5 mM MgCl2, 0.1 M NaCl, and 0.05% BSA, with the final reaction volume controlled at 20 μL.

[0101] The G / U mismatched double-stranded DNA acceptor described above is made of 5'-FAM-TAA [U]GTGAATGGAGCTG AAAT-biotin-3' and 5'-TTTCAGCTCCATTCAC [G]TTA-3' was prepared by annealing and pairing two oligonucleotides.

[0102] In the experiment, compound 1 was serially diluted into 384-well plates using Bravo and Mosquito HTS automated equipment, followed by the addition of prepared TDG protein and G / U acceptor solution using a Multidrop Combi device.

[0103] After incubation at room temperature for 30 minutes, 10 μL of streptavidin magnetic beads were added to the assay plate to bind biotin-labeled G / U acceptors, and incubation continued at room temperature for 1 hour. Then, 30 μL of 400 mM NaOH was added, and incubation at room temperature for 30 minutes to terminate the reaction. This cleaved the double-stranded DNA backbone and TDG protein excised the apurinol pyrimidine sites (AP sites) resulting from G / U mismatches, forming different oligonucleotides. The multi-well plate was placed on a magnetic rack, and the unreacted oligonucleotides with fluorophores and biotin labels were adsorbed and precipitated by the magnetic rack. Subsequently, 40 μL of the supernatant was transferred to a black 384-well plate, and the fluorescence signal at 485 nm / 535 nm was detected using an Envision multi-plate reader.

[0104] The percentage of enzyme activity of compound 1 at each concentration was calculated using fluorescence signals. The DMSO control was set at 100%, and the control without TDG protein was set at 0%. The IC50 of the inhibition of TDG enzyme activity by compound 1 was fitted using a four-parameter logic (4PL) curve (Figure 1).

[0105] Experimental results showed that compound 1 inhibited TDG enzyme activity by IC50 = 0.17 μM, indicating that compound 1 of this application has excellent inhibitory effect on TDG activity. [Example] [3] [Compound] [1] [right] [TDG] [and double chains] [DNA] [Prisoned] [Inhibition of binding]

[0106] The inhibitory effect of compound 1 on the binding of TDG to double-stranded DNA receptors was evaluated using homogeneous time-resolved fluorescence (HTRF).

[0107] Compound 1 was initially diluted 3-fold to obtain 10 different concentrations, with replicates in each well. The solutions were serially diluted 40-fold to obtain 10 different final concentrations in a 384-well plate. Then, 500 nmol was transferred to the 384-well plate using an Echo 550 for later use. Subsequently, 1.5 μL / well of epigenetic binding domain dilution buffer (Catalog No.: 62DLBDDF, Cisbio) was added sequentially, followed by 4 μL of His-labeled TDG protein (5-fold final concentration, 40 nM), diluted with epigenetic binding domain dilution buffer, 4 μL of Biotin-labeled double-stranded DNA conjugate (Forward: TCGGATGTTGTGGGTCAGUGCATGATAGTGTA-Biotin, Reverse: TACACTATCATGC GCTGACCCACAACATCCGA, 40 nM), diluted with epigenetic binding domain dilution buffer, and 5 μL of streptavidin-XL665 conjugate (4-fold final concentration, 5 nM), diluted with epigenetic binding domain detection buffer (Catalog No.: 610SAXLA, Cisbio). Dilute 62DB1FDG (Cisbio) and 5 μL of 4-fold final concentration of histidine-tagged monoclonal antibody-Eu conjugate (MAb Anti-6HIS-Eu cryptate Gold, catalog number: 61HI2KLA, Cisbio), to a final concentration of 0.1 μg / mL, using epigenetic binding domain detection buffer. Incubate overnight at 4°C, then detect HTRF signals using an Envision multi-mode microplate reader equipped with an HTRF function module.

[0108] The inhibition rate of compound 1 at each concentration was calculated using HTRF signals, and the IC50 was fitted using a four-parameter logic (4PL) curve (Figure 2).

[0109] Experimental results showed that compound 1 inhibited the binding of TDG and double-stranded DNA receptors by IC50 = 0.36 μM, indicating that compound 1 can effectively inhibit the binding of TDG and double-stranded DNA receptors. [Example] [4] [Compound] [1] [and] [TDG] [The binding constant of the bond] [Kd]

[0110] The binding constant Kd of compound 1 with TDG and three other glycosylation enzymes in the same family was tested using microscale thermophoresis (MST). The three other glycosylation enzymes in the same family are uracil DNA glycosylation enzyme 2 (UNG2), depurine depyrimidine endonuclease 1 (APE1), and endonuclease VIII-like protein 1 (NEIL1).

[0111] After labeling TDG, UNG2, APE1, and NEIL1 with the His tag using RED-tris-NTA dye, the labeled proteins were mixed with different concentrations of Compound 1 in PBS buffer containing 0.05% Tween 20, and then loaded into capillary tubes. Changes in thermal surge signal were detected using a Monolith NT.115 analyzer. The results were used to calculate Kd using MO. Affinity Analysis V2.3 software.

[0112] The fitting calculation showed that the binding constant Kd of compound 1 with TDG was 0.69 μM (Figure 3), indicating that compound 1 can bind to TDG; however, the binding constant Kd of compound 1 with UNG2, APE1 and NEIL1 was greater than 100 μM, indicating that compound 1 does not bind to UNG2, APE1 and NEIL1 (Figure 4).

[0113] In summary, compound 1 exhibits excellent selectivity and can specifically bind to TDG. [Example] [5] [Compound] [1] [right] [twenty three] [Inhibition of enzyme activity at individual epigenetic target sites]

[0114] In this embodiment, the experimental concentration of compound 1 was 1 μM.

[0115] EZH2, SET7, NSD2, DOT1L, G9a, MLL1, and SETDB1 are histone lysine methyltransferases; GCN5, PCAF, and P300 are histone acetylated transferases; BRD2(D1,D2), BRD4(D1,D2), and BRD9 are bromine-containing domain proteins; HDAC1 and HDAC6 are histone deacetylases; DNMT1 is a DNA cytosine methyltransferase; EP300 is a bromine-containing domain protein of P300; SMYD2 is a protein lysine methyltransferase; LSD1 is a histone lysine demethylase; METTL3 is an RNA adenosine methyltransferase; PARP1 and PARP7 are poly(ADP-ribose) polymerases.

[0116] The enzyme activity inhibition experiment of TDG is shown in Example 2.

[0117] The enzyme activity inhibition assays for EZH2 and SET7 were isotope detection assays, using [3H]-SAH and peptides as substrates to detect changes in the isotope 3H.

[0118] The enzyme activity inhibition assays of GCN5, PCAF, and P300 were performed using isotope detection assays. [3H]-Ac-CoA and peptides were used as substrates to detect changes in the isotope 3H.

[0119] The enzyme activity inhibition assays of BRD2(D1,D2), BRD4(D1,D2) and BRD9 were used as HTRF detection assays, with peptides as the acceptors, to detect changes in HTRF signals.

[0120] The enzyme activity inhibition assay for HDAC1 and HDAC6 was used as a fluorescence detection assay. Acetylated peptides were used as the acceptor, and the product could be hydrolyzed by trypsin. Changes in fluorescence signal were detected.

[0121] The enzyme activity inhibition assays of NSD2, DOT1L, and DNMT1 were performed using isotope detection assays. [3H]-SAH and polypeptide / recombinant nucleosomes were used as substrates to detect changes in the isotope 3H.

[0122] The enzyme activity inhibition assays of G9a, EP300, SMYD2, MLL1, SETDB1, LSD1, PARP1, and PARP7 were performed using an AlphaLISA assay kit to detect the formation of the products.

[0123] The enzyme activity inhibition assay of METTL3 is an isotope detection assay, using [3H]-SAH and RNA as substrates to detect changes in the isotope 3H.

[0124] All experimental results were converted into enzyme activity inhibition rate.

[0125] Experimental results showed that compound 1 could significantly inhibit the activity of TDG, but could not inhibit the activity of the other 22 epigenetic target enzymes (Figure 5), indicating that compound 1 has excellent selectivity. [Example] [6] [Compound] [1] [and] [TDG] [The way of combining]

[0126] The binding mechanism of compound 1 to TDG was deduced using Intact MS technology. 5 μM of the TDG catalytic domain (covering the amino acid sequence aa111-308) was mixed with 25 μM of compound 1 at a molar ratio of 1:5 in 40 μL of Intact MS buffer. This buffer contained 20 mM HEPES, pH 7.5, 300 mM NaCl, and 1 mM DTT.

[0127] The mixed solution was incubated at room temperature for 1 hour. After incubation, to quench any possible covalent bonding reaction, 0.8 μL of 10% formic acid was rapidly added to the solution. Simultaneously, a TDG catalytic region sample without compound 1 was prepared as a negative control. Waters Q-TOF LC-MS was used to analyze the treated samples to accurately detect the MS changes of TDG protein before and after the addition of compound 1.

[0128] Experimental results show that after treatment with compound 1, the molecular weight of the TDG catalytic domain increased by 234, which is exactly the molecular weight of compound 1, indicating that compound 1 and TDG are covalently bonded (Figure 6). [Example] [7] [Compound] [1] [and] [TDG] [eutectic]

[0129] SUMO (Small ubiquitin-like modifier) ​​modification is an important natural modification of TDG. Studies have shown that 20-50% of TDG in cells are SUMO modified, and SUMO modification plays an important role in the cellular localization and functional regulation of TDG.

[0130] Expression and purification of SUMO-1-TDG catalytic region protein: Vectors containing the SUMO-1 and TDG target genes (covering amino acid sequences aa112-339) were simultaneously transformed into BL21(DE3) competent cells for expression via co-transformation. After purification by Ni-NTA affinity chromatography, the MBP tag was cleaved by TEV protease treatment. Unmodified TDG protein was then removed by Mono S anion exchange column. Uncleaved SUMO-1-TDG-MBP protein was separated by heparin affinity chromatography. Finally, the protein purity was further improved by Superdex 75 molecular sieve to obtain the target protein SUMO-1-TDG suitable for crystal screening.

[0131] Cocrystallization of Compound 1 with SUMO-1-TDG: A 30 mg / mL SUMO-1-TDG catalytic region was mixed with an equal volume of a stock solution containing 0.1 M Tris, pH 8.5, 25% PEG3350, and 0.2 M MgCl2, and equilibrated with 100 μL of the stock solution at 293 K. After three days of incubation, plate-like crystals were observed.

[0132] Subsequently, a DMSO solution of compound 1 with a final concentration of 10 mM was added to the crystallization droplets, and the solution was soaked for 12 hours. Next, the crystals were immersed in a mother liquor containing 30% (v / v) glycerol as a protective agent, followed by rapid freezing in liquid nitrogen for X-ray diffraction analysis.

[0133] The cocrystallization experiment showed that compound 1 bound to the vicinity of the 276th cysteine ​​residue (Cys276) of the TDG protein and covalently modified the 276th cysteine ​​residue of the TDG protein (Figure 7). [Example] [8] [Compound] [1] [right] [TDG] [Protein and cellular levels] [TDG] [Effect on protein thermal stability]

[0134] The effects of compound 1 on the thermal stability of TDG protein at the cellular level were tested using TSA (Thermal Shift Assay) and CETSA (Cellular Thermal Shift Assay) techniques.

[0135] The TSA experiment was performed on a PikoReal 96 Real-Time PCR system using a melting point curve program, with temperature increases of 0.2 °C within a temperature range of 25–70 °C. Based on the obtained positive derivative d(RFU) / dT curve, the change in the melting point (Tm) of TDG protein after treatment with compound 1 was estimated using the PikoReal 96 Real-Time PCR system software.

[0136] Experimental results showed that after treatment with compound 1, the melting point (Tm) of TDG protein increased by 9.25℃, indicating that the thermal stability of TDG protein was significantly improved (Figure 8a).

[0137] Cellular target binding assays for compound 1 were performed using a CETSA assay, as follows: NCI-H1299 cells were transfected with pCDNA4-Flag-TDG and cultured overnight. Afterward, the cells were treated with 10 μM compound 1 at 37°C for 2 hours. Cells were then lysed, and the cell supernatant was treated at ten different temperatures (35–55°C) for 3 minutes each, followed by centrifugation. Subsequently, Western blotting (WB) analysis of the cell supernatant using the Flag antibody was performed to assess changes in the thermostability of intracellular TDG before and after compound 1 treatment.

[0138] Furthermore, after treatment with compound 1, the melting point (Tm) of TDG protein at the cellular level increased by approximately 10°C, indicating a significant improvement in the thermal stability of TDG protein at the cellular level (Figure 8b).

[0139] In summary, compound 1 can bind to the intracellular TDG target and enhance its thermal stability. [Example] [9] [Compound] [1] [right] [TDG] [With Genome] [DNA] [The effect of combination]

[0140] The effect of compound 1 on the binding of TDG to genomic DNA was tested using chromatin immunoprecipitation-sequencing (ChIP-seq).

[0141] NCI-H1299 cells overexpressing Flag-TDG were treated with 5 μM compound 1 for 48 hours, then cross-linked with 1% formaldehyde for 10 minutes at room temperature, followed by quenching with 0.125 M glycine. The genomic DNA was then sonicated using a COVARIS S220 to break it into fragments of approximately 300 bp. In the immunoprecipitation (IP) step, one-tenth of the supernatant was incubated overnight at 4 °C with the Flag antibody, followed by immunoprecipitation using Protein G magnetic beads. The chromatin (ChIP DNA) obtained from the immunoprecipitation was eluted in TE buffer. Subsequently, end repair, A-tailing, adapter ligation, library amplification, sequencing, and data analysis were performed.

[0142] Experimental results showed that TDG mainly bound to the promoter region of genomic DNA, accounting for 60% (Figure 9a). Furthermore, after treatment with compound 1, the peak signal intensity of TDG binding was significantly reduced, indicating that compound 1 can inhibit the binding of TDG to genomic DNA (Figure 9b). [Example]

[10] [Compound] [1] [right] [KP] [cell] [(, Trp53 , ] [Knockout mouse lung cancer cells] [)] [middle] [DHX9] [Effects on protein expression]

[0143] DHX9 is an RNA helicase. Its reduction leads to the accumulation of double-stranded RNA (dsRNA) in the cytoplasm, thereby triggering an antiviral response, which in turn inhibits tumor growth and enhances the anti-tumor immune response.

[0144] The effect of compound 1 on DHX9 protein expression in KP cells (Trp53 knockout mouse lung cancer cells, i.e., lung cancer cells mimicking TP53 deficiency) was tested using Western blotting (WB).

[0145] KP cell construction: KrasG12D mutant, Trp53 conditional knockout mice were obtained through breeding. Detailed experimental procedures can be found in DuPage M, et al. Conditional mouse lung cancer models using adenoviral or lentiviral delivery of Cre recombinase. Nat Protoc. 2009;4(7):1064-72. The sgRNA sequences used to knock out Trp53 in the experiment were: mTrp53_sg-1: AGTGAAGCCCTCCGAGTGTC; mTrp53_sg-2: GACCCTGTCACCGAGACCCC. After 3-4 weeks of nasal instillation of Ad-Cre to induce tumor development in mice, tumor nodules were collected from the lung tissue of KrasG12D mutant, Trp53 knockout mice, and KP cells were cultured.

[0146] KP cells were treated with different concentrations of compound 1: 0.625, 1.25, and 2.5 μM. Cells were harvested 4 days after compound 1 treatment, and the effect of compound 1 on DHX9 protein levels was tested using Western blotting (WB).

[0147] Western blot results showed that the DHX9 protein level in KP cells decreased significantly after treatment with compound 1 (Figure 10), indicating that compound 1 can inhibit the expression of DHX9 protein in KP cells, suggesting that compound 1 can promote the accumulation of dsRNA in the cytoplasm. [Example]

[11] [Compound] [1] [right] [KP] [cell] [(, Trp53 , ] [Knockout mouse lung cancer cells] [)] [Middle Dual Chain] [RNA (dsRNA)] [Impact]

[0148] The effect of compound 1 on double-stranded RNA (dsRNA) in KP cells (Trp53 knockout mouse lung cancer cells) was tested using immunofluorescence (IF).

[0149] The KP cells used in this example are the same as those in Example 10, all being Trp53 knockout mouse lung cancer cells. Adherent KP cells were treated with 1.25 μM compound 1 for 4 days, and after fixation, permeabilization, and blocking, they were sequentially treated with J2 antibody (an antibody that specifically recognizes dsRNA), fluorescent secondary antibody CyTM3, and DAPI, and then photographed under a fluorescence microscope.

[0150] Immunofluorescence assays showed that, compared to the control group, the level of dsRNA in the cytoplasm of KP cells treated with compound 1 was increased (Figure 11), indicating that compound 1 can increase the level of dsRNA in KP cells.

[0151] The results in this embodiment are consistent with the conclusion in Example 10 that the DHX9 protein level decreased significantly, indicating that the increase in dsRNA level was caused by the decrease in DHX9 protein level. In other words, compound 1 can promote the accumulation of dsRNA in the cytoplasm by inhibiting DHX9 protein in KP cells. [Example]

[12] [Compound] [1] [right] [p53] [Mutants and] [p53] [Wild-type tumor cells] [dsRNA] [Impact]

[0152] The KP cells used in this example are the same as those in Example 10, all of which are Trp53 knockout mouse lung cancer cells; 4T1 cells are Trp53-deficient mouse breast cancer cells; Hep3B is TP53-deficient human liver cancer cells; HCI-H1299 is TP53-deficient human lung cancer cells; and A549 is TP53 wild-type human lung cancer cells.

[0153] The effect of compound 1 on dsRNA in p53 mutant and wild-type tumor cells was tested using immunofluorescence (IF). The experimental procedure was the same as in Example 10, and images were taken and quantified using the PE Operatta high-content cell imaging system.

[0154] The experimental results showed that the dsRNA level was significantly increased in p53 knockout or missing tumor cells (i.e., p53 mutant tumor cells) treated with compound 1, and the change in dsRNA level in cells was correlated with the compound dose (Figure 12a). However, compound 1 did not have a significant effect on the dsRNA level in p53 wild-type tumor cells (Figure 12b), indicating that the effect of compound 1 on DHX9 protein level and dsRNA level only specifically acts on TP53 mutant tumor cells. [Example]

[13] [Compound] [1] [right] [, TP53 , ] [Inhibition of proliferation of mutant and wild-type tumor cells]

[0155] Compound 1 inhibits the proliferation of TP53 mutant and wild-type tumor cells. In this example, both the TP53 mutant and wild-type tumor cells used are human tumor cells.

[0156] Tumor cells were seeded in 384-well plates and treated with DMSO or a specified concentration of Compound 1 (0.04–30 μM). After 6 days of incubation, chemiluminescence intensity was measured using a CellTiter-Glo chemiluminescence detection kit (Promega). The curves were fitted using GraphPad Prism software, and the IC50 values ​​were calculated.

[0157] The results showed that compound 1 significantly inhibited the in vitro proliferation of p53 mutant tumor cell lines, but had a weaker inhibitory effect on the in vitro proliferation of p53 wild-type tumor cell lines (Figure 13). This indicates that the effect of compound 1 on tumor cell proliferation is specifically applied to TP53 mutant tumor cells, which is consistent with the conclusion in Example 12. [Example]

[14] [Compound] [1] [right] [p53] [Inhibition of subcutaneous tumor growth in immunodeficient mice using mutant and wild-type tumor cell lines.]

[0158] The tumor cells used in this embodiment are: MDA-MB-436 (TP53 mutant human breast cancer cells), SKM-1 (TP53 mutant human AML cells), NCI-H1299 (TP53-deficient human lung cancer cells), CAL27 (TP53 mutant human tongue squamous cell carcinoma cells), NCI-H446 (TP53 mutant human lung cancer cells), RKO (TP53 wild-type human colon cancer cells), A498 (TP53 wild-type human renal cell carcinoma cells), A549 (TP53 wild-type human lung cancer cells), NCI-H2228 (TP53 wild-type human lung cancer cells), and HCT116 (TP53 wild-type human colon cancer cells).

[0159] In this embodiment, the MDA-MB-436 and CAL27 models used NCG immunodeficient mice, the SKM-1 and A498 models used CB17-SCID immunodeficient mice, and the NCI-H1299, NCI-H446, RKO, A549, NCI-H2228, and HCT116 models used BALB / c nude immunodeficient mice.

[0160] The tumor cells described above were inoculated into the right thigh of immunodeficient mice. Drug administration began when the tumor size reached 50-150 mm³ (the timing of drug administration varied slightly depending on the model). Compound 1 was administered at a dose of 50 mpk (50 mg / kg) via oral gavage once daily. Tumor size and mouse weight were recorded 2-3 times per week. Mice in the control group were sacrificed when the tumor volume approached 2000 mm³, ending the experiment.

[0161] Tumor proliferation inhibition rate calculation: Tumor proliferation inhibition rate = (1-(Tt-T0) / (Ct-C0))*100, where Tt and T0 are the average tumor volumes of the treatment group at the end and start of administration points, respectively, and Ct and C0 are the average tumor volumes of the blank control group at the end and start of administration points, respectively.

[0162] The results showed that compound 1 had a significant inhibitory effect on the growth of p53 mutant tumors, but a weaker inhibitory effect on the growth of p53 wild-type tumors (Figure 14). This indicates that the effect of compound 1 on tumor cell proliferation only specifically acts on TP53 mutant tumor cells, which is consistent with the conclusions in Examples 11 and 12.

[0163] Furthermore, in mouse models inoculated with NCI-H1299, SKM-1, and MDA-MB-436 tumor cells, compound 1 showed a significant inhibitory effect on tumor growth, and the changes in tumor volume and mouse body weight are shown in Figure 15. [Example]

[15] [Compound] [1] [exist] [p53] [On the defective homologous mouse model] [anti-CTLA-4] [Antibody combination experiment.]

[0164] The tumor cells used in this embodiment are: KP (Trp53 knockout mouse lung cancer cells), 4T1 (Trp53-deficient mouse breast cancer cells), and MC38 (Trp53-mutant mouse colon cancer cells).

[0165] In this embodiment, the KP and MC38 models used C57BL / 6 fully immunized mice, and the 4T1 model used BALB / c fully immunized mice.

[0166] The aforementioned tumor cells were inoculated into the right thigh of fully immunized mice to construct a p53-deficient homologous mouse model (KP, 4T1, MC38). After inoculation, mice were randomly assigned to groups. Compound 1 was administered on day 3 at a dose of 5 mpk via oral gavage once daily. Anti-CTLA-4 antibody was administered on day 6 at a dose of 10 mpk via intraperitoneal injection once every 3 days for a total of 3-4 administrations. Tumor size and mouse weight were recorded 3 times per week. Mice in the control group were sacrificed when the tumor reached approximately 2000 mm³, ending the experiment.

[0167] The results showed that, compared with compound 1 alone or anti-CTLA-4 antibody alone, the combination of compound 1 and anti-CTLA-4 antibody significantly reduced tumor volume in the three p53-deficient homologous mouse models, indicating that the combination of compound 1 and anti-CTLA-4 antibody showed excellent synergistic effects in the three p53-deficient homologous mouse models (Figure 16).

[0168] In summary, compound 1 specifically inhibits the expression of the DHX9 gene in p53-deficient tumor cells by inhibiting TDG, thereby regulating dsRNA levels and activating the body's anti-tumor innate immunity. Furthermore, the activated anti-tumor innate immunity can inhibit tumor cell growth in vitro and in vivo, and can also be used in combination with immunotherapies such as anti-CTLA-4 antibodies to further inhibit tumor growth (Figure 17).

[0169] All references to this invention are incorporated herein by reference as if each reference were individually incorporated herein by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0170] (none)

Claims

1. A drug combination, characterized in that the drug combination comprises: A. Safe and effective doses of TDG inhibitors; B. A safe and effective amount of an immune checkpoint inhibitor; wherein the immune checkpoint inhibitor is selected from the group consisting of: PD-1 inhibitors, PD-L1 inhibitors, CTLA-4 inhibitors, or combinations thereof; the TDG inhibitor is a compound represented by Formula I below, or a pharmaceutically acceptable salt thereof: I R1 is selected from the group consisting of: OH, H, halogen, cyano, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C2-C6 alkoxy, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 3-12 member heterocycles, substituted or unsubstituted 5-12 member heteroaromatic rings, substituted or unsubstituted -O-3-12 member heterocycles, substituted or unsubstituted -C1-C6 alkyl-phenyl, substituted or unsubstituted -O-phenyl, substituted or unsubstituted The C1-C4 alkyl-C(O)-, substituted or unsubstituted C1-C4 alkyl-S(O)2-, substituted or unsubstituted C1-C6 alkyl-NH-, (substituted or unsubstituted C1-C6 alkyl)2-N-, -O(CH2)sR10, or -S(CH2)sR10; s is 0, 1, 2, or 3; R10 is selected from the group consisting of: H, substituted or unsubstituted C3-8 carbon rings, substituted or unsubstituted 3-8 member heterocycles, substituted or unsubstituted C6-C10 aryl groups, and substituted or unsubstituted 5-12 member heteroaromatic rings; R2 is independently selected from the group consisting of: H, halogens, and substituted or unsubstituted C1-C6 alkyl groups; R3 is selected from the group consisting of: H, halogen, cyano, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C1-C6 alkoxy, substituted or unsubstituted C3-C12 cycloalkyl, or (C1-C6 alkyl)C(O)R8, (C1-C6 alkyl)C(O)NHR8, (C1-C6 alkyl)C(O)N(substituted or unsubstituted C1-C6 alkyl)R8, (C1-C6 alkyl)C(O)OR8; wherein R8 is selected from the group consisting of: H, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C6-C10 aryl, -(OCH2CH2)m-substituted or unsubstituted C1-C6 alkyl, or substituted or unsubstituted [other groups]. The following groups are selected from: -(CH2)mNHC(O)(CH2)nR13, -(CH2)CHR9NHC(O)(CH2)nR13, CHR9(CH2)NHC(O)(CH2)nR13; wherein R9 is selected from: H, -COOH, -CONHR12, -CONHCH2R12, -CONH(CH2CH2O)m(CH2)nCOOH, substituted or unsubstituted C1-C6 alkoxy, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted C3-C10 carbocyclic ring, substituted or unsubstituted 3-12 member heterocyclic ring, substituted or unsubstituted 5-12 member heteroaromatic ring;R12 is selected from the group consisting of: substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted 5-12 member heteroaromatic rings; R13 is selected from the group consisting of: substituted or unsubstituted C3-C10 carbocyclic rings; m and n are each independently 0, 1, 2 or 3; R4 is selected from the group consisting of: H, halogen, cyano, substituted or unsubstituted C1-C6 alkoxy, substituted or unsubstituted C1-C6 amino, substituted or unsubstituted C6-C10 aryl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted 3-12 member heterocyclic rings, substituted or unsubstituted 5-12 member heteroaromatic rings, substituted or unsubstituted -O-5-12 member heteroaromatic rings; Alternatively, R3 and R4, together with the carbon atom attached thereto, form a structure selected from the group consisting of: substituted or unsubstituted C6-C10 aromatic rings, substituted or unsubstituted 5-10 member aromatic heterocycles, substituted or unsubstituted C3-C8 carbon rings, or substituted or unsubstituted 3-10 member heterocycles; R5 and R6 are each independently selected from the group consisting of: H, substituted or unsubstituted C1-C6 alkyl groups, substituted or unsubstituted C6-C10 aromatic rings, substituted or unsubstituted 5-10 member aromatic heterocycles, substituted or unsubstituted C3-C8 carbon rings, or substituted or unsubstituted 3-10 member heterocycles; or R5 and R6, together with the carbon atom attached thereto, form a substituted or unsubstituted 3-12 member carbon ring; R6' is selected from the group consisting of: H, substituted or unsubstituted C1-C6 alkyl groups; or R6 and R6' together constitute =CH2; X is selected from O or S; Z is selected from O, S, or NR14; wherein R14 is H or C1-C4 alkyl; R7 is selected from the following group: H, substituted or unsubstituted C1-C12 alkyl, or C(O)R11, C(O)OR11, -CH2OC(O)OR11, -S(O)2NHR11; wherein R11 is selected from the following group: H, substituted or unsubstituted C1-C16 alkyl, substituted or unsubstituted C6-C10 aryl, -(OCH2CH2)m-substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted 5-8 member heterocyclic group; Unless otherwise specified, in the above formulas, the heteroaromatic ring, heteroaryl, heterocycle, or heterocyclic group contains one, two, or three heteroatoms selected from N, S, or O; the aromatic ring, aryl, heteroaromatic ring, or heteroaryl group can be a monocyclic or fused ring; the carbocyclic ring, cycloalkyl, heterocycle, or heterocyclic group can be a monocyclic, fused, bridged, or spirocyclic ring; the carbocyclic, heterocycle, or heterocyclic group can be saturated or partially unsaturated, but does not possess aromaticity.The substitution refers to the replacement of the hydrogen atom on the corresponding group by one or more substituents selected from the group consisting of: deuterium, halogen, hydroxyl, carboxyl, mercapto, benzyl, C2-C12 alkoxycarbonyl, C1-C6 aldehyde, (C1-C6 alkyl)3Si, amino, C1-C6 amide, nitro, cyano, unsubstituted or halogenated C1-C6 alkyl, C2-C10 alkenyl, C1-C6 alkoxy, C3-C6 cycloalkyl, C1-C6 alkyl-amino, C1-C 12-alkylaminocarbonyl, unsubstituted or halogenated C2-C10 acetylated group, unsubstituted or halogenated C1-C4 alkyl-S(O)2-, unsubstituted or substituted C1-C4 alkyl-OC(O)NH-, unsubstituted or halogenated C1-C4 alkyl-SO-, unsubstituted or substituted C1-C4 alkyl-5-7-membered heterocycle, or phenyl (which may have 1-5 substituents selected from halogen, C1-C4 alkyl, and C1-C4 alkoxy groups).

2. The pharmaceutical combination as claimed in claim 1, characterized in that the compound has a structure as shown in formula III: III where, The definitions of R1, R2, R3, and XR7 are as described in Request 1.

3. The pharmaceutical composition as claimed in claim 1, characterized in that the R1 is selected from the group consisting of: halogens, substituted or unsubstituted C1-C6 alkoxy groups, substituted or unsubstituted C6-C10 aryl groups, substituted or unsubstituted 3-12 member heterocycles, substituted or unsubstituted 5-12 member heteroaromatic rings, substituted or unsubstituted -O-3-12 member heterocycles, substituted or unsubstituted C1-C4 alkyl-S(O)2-, substituted or unsubstituted C1-C6 alkyl-NH-, (substituted or unsubstituted C1-C6 alkyl)2-N-, and -O(CH2)sR10.

4. The pharmaceutical combination as claimed in claim 1, characterized in that the R3 is selected from the group consisting of: H, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C3-C8 cycloalkyl, and substituted or unsubstituted phenyl.

5. The pharmaceutical combination as claimed in claim 1, characterized in that the compound is...

6. The drug combination as claimed in claim 1, characterized in that the PD-1 inhibitor is selected from the group consisting of: Retifanlimab, Pucotenlimab, Cadonilimab, Serplulimab, Nivolumab / Relatlimab, Zimberelimab, Penpulimab, Dostarlimab-gxly, Prolgolimab, Tislelizumab, Camrelizumab, Sintilimab, Toripalimab, Cemiplimab-RWLC, Pembrolizumab, Nivolumab, Balstilimab The PD-L1 inhibitors are selected from the following groups: Benmelstobart, Socazolimab, Adebrelimab, Sugemalimab, Envafolimab, Durvalumab, Avelumab, Atezolizumab, Tagitanlimab, or combinations thereof; The PD-L1 inhibitors are selected from the following groups: Tremelimumab, Ipilimumab, Cadonilimab. (Caducnimab), Erfonrilimab, Gotistobart, Pembrolizumab / Quavonlimab, Prolgolimab / nurulimab, Quavonlimab, Tuvonralimab / Iparomlimab, Volrustomig, or combinations thereof.

7. The pharmaceutical combination as claimed in claim 1, characterized in that the pharmaceutical combination further comprises a pharmaceutically acceptable carrier.

8. The drug combination as claimed in claim 1, characterized in that the mass ratio of the TDG inhibitor to the immune checkpoint inhibitor is 1-1000:1000-1.

9. The drug combination as claimed in claim 1, characterized in that the mass ratio of the TDG inhibitor to the immune checkpoint inhibitor is 1-10:10-1.

10. A medicine kit, characterized in that the medicine kit comprises: (A) A combination of medicines as described in any one of claims 1-9; (B) Instruction manual.

11. Use of a pharmaceutical combination as described in any one of claims 1-9, or a cassette as described in claim 10, characterized in that the pharmaceutical combination or cassette is used to prepare a medicament for treating tumors containing TP53 gene mutations; wherein the tumors containing TP53 gene mutations are selected from the group consisting of: lung cancer, liver cancer, skin cancer, bladder cancer, breast cancer, colon cancer, esophageal cancer, acute myeloid leukemia, or combinations thereof.

12. The use as claimed in claim 11, characterized in that the drug combination or cassette is used to inhibit the activity of TDG.

13. The use as claimed in claim 11, characterized in that the drug combination or kit is used to reduce the level of DHX9 in p53 mutant tumor cells, or the drug combination or kit is used to increase the level of dsRNA in p53 mutant tumor cells.

Images