Neutralizing Anti-influenza a antibodies and uses thereof

Abstract

The present invention relates to an antibody and its binding fragment capable of binding to influenza A virus hemagglutinin and neutralizing at least one group 1 subtype and at least one group 2 subtype of influenza A virus.

Description

Neutralized anti-influenza A antibody and its uses The present invention relates to antibodies with wide neutralizing activity against influenza A virus and the use of such antibodies. The flu virus causes the annual flu epidemic and occasional pandemics, which poses a considerable threat to public health around the world. Seasonal influenza infection is associated with 200,000-500,000 deaths per year, especially among young children, immunocompromised patients and the elderly. Mortality rates usually increase further during the pandemic season. There is still a considerable unmet medical need for the development of effective antiviral therapies for the prevention and treatment of influenza infections in particularly underserved groups. There are three types of influenza viruses: type A, type B and type C. Influenza A virus can infect a wide variety of birds and mammals, including humans, pigs, chickens and ferrets. Influenza A virus can be classified into subtypes based on dual gene variants in the antigenic region of the two genes encoding the surface glycoprotein hemocytoplasmin (HA) and neuramine glycoidase (NA). HA is a receptor-binding and membrane-fusion glycoprotein that mediates the attachment of viruses and enters target cells; HA is the main target of protective humoral immune response. The HA protein has a trimeric structure and contains three identical copies of the single polypeptide precursor HA0. After the protein is decomposed and matured, it is cleaved into a pH-dependent, mestationary intermediate containing the spherical head (HA1) and the stem region (HA2). The "spherical head" at the distal end of the membrane forms the majority of the HA1 structure and contains sialic acid binding bags that enter the virus and the main antigenic domain. The membrane proximal "stem" structure assembled from HA2 and some HA1 residues contains a fusion mechanism that undergoes configuration changes in the late endosome low pH environment to trigger membrane fusion and penetration into cells. The degree of sequence homology between influenza A subtypes in HA1 (34%-59% homologous between subtypes) is less than that of HA2 region (51%-80% homologous). Neutralizing antibodies caused by influenza virus infection normally target variable HA1 spherical heads to prevent viral receptor binding and are usually strain-specific. Rarely, extensive cross-reacting single antibody targeting the spherical head of HA has been identified (Krause J.C. et al. 2011 J. Virol. 85; Whittle J. et al., 2011 PNAS 108; Ekiert DC et al., 2012 Nature 489; Lee PS et al., 2012 PNAS 109). In contrast, the structure of the shank region is relatively retained and a few widely neutralizing antibodies have recently identified a fusion step that binds to the HA shank to prevent virus entry to pH triggered (Ekiert D.C. et al., 2009 Science 324; Sui J. et al., Nat Struct Mol Biol 16; Wrammert J et al., 2011 J Exp Med 208; Ekiert D. C et al., 2011 Science 333; Corti D et al., 2010 J Clin Invest 120; Throsby M .,2008 PLoS One 3). Most of these stalk reactive neutralizing antibodies are specifically targeted against influenza A Group 1 virus or specifically targeted against the Group 2 virus. Recently, a shank binding antibody that cross-reacts with the first and second groups of viruses was isolated (Corti D). Wait for someone ,2011 Science 333; Li GM Wait for someone ,2012 PNAS 109 and Cyrille D Wait for someone ,2012 Science 337; Nakamura G Wait for someone ,2013, Cell Host & Microbe 14). To date, there are no commercially available antibodies that widely neutralize or inhibit all influenza A virus infection or attenuate diseases caused by influenza A virus. Therefore, novel antibodies against multiple subtypes of the first and second groups of influenza A virus are still needed. The present invention provides an antibody or binding fragment thereof that is capable of binding to influenza A virus hematoclin and neutralizing at least one first subtype of influenza A virus and at least one second subtype of influenza A virus. Preferably, the antibodies or binding fragments of the present invention are able to bind to influenza A virus hematoglobin and neutralize at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 influenza A virus population 1 subtypes and at least 1, 2, 3, 4, 5 or 6 influenza A virus population 2 subtypes. Further preferably, the antibodies or binding fragments of the present invention are able to bind to influenza A virus hematoclin and neutralize at least 5 influenza A virus population 1 subtypes and at least 1 or 2 influenza A virus population 2 subtypes. The hemoglobin subtype of influenza A virus is divided into two main phylogenetic groups, identified as the first group, which includes subtypes H1, H2, H5, H6, H8, H9, H11, H12, H13, H16 and H17; and the second group, which includes subtypes H3, H4, H7, H10, H14 and H15. In one embodiment, the antibody or binding fragment of the present invention is able to bind to and / or neutralize one or more influenza A virus population 1 subtypes selected from H1, H2, H5, H6, H8, H9, H11, H12, H13, H16 and H17 and variants thereof; and one or more influenza A virus population 2 subtypes selected from H3, H4, H7, H10, H14 and H15 and variants thereof. In another embodiment, the antibodies or binding fragments of the present invention are able to bind to and / or neutralize influenza A virus subtypes H1, H2, H5, H6, H8, H9, H11, H12, H13, H16 and H17, and influenza A virus subtypes H3, H4, H7, H10, H14 and H15, the first subtypes. In another embodiment, the antibody or binding fragment is able to bind to and / or neutralize the first subtypes H1, H2, H5, H6 and H9, and the second subtypes H3 and H7. In another embodiment, the antibody or binding fragment is able to bind to and / or neutralize the first subtypes H1, H2, H5 and H6, and the second subtypes H3 and H7. The present invention isolates naturally occurring human single antibody (mAb) based on IgG memory B cells collected from individual donors as starting materials. As described herein, optimization is used to produce antibody variants with improved characteristics. Optimized antibody variants do not occur naturally; they are produced using recombinant techniques. The antibodies or fragments thereof of the present invention bind to the HA shank region and neutralize infection of influenza A virus, which are selected from the group 1 and group 2 subtypes, respectively. The antibodies of the present invention are anti-influenza A HA stalk binding antibodies, which exhibit a wide coverage breadth or better neutralization activity against influenza A virus than the antibodies of the publication (antibody FI6v4, described in WO2013 / 011347A1), and are shown in Table 6 of Example 5. In addition, the antibodies of the present invention can be more effective than other mAbs in blocking HA maturation, as shown in Figure 1 of Example 6.In some embodiments, the antibody or binding fragment thereof comprises a set of six CDRs, wherein the set of six CDRs are selected from the group consisting of: (a) SEQ ID NO.: 3 HCDR1, SEQ ID NO.: 4 HCDR2, SEQ ID NO.: 5 HCDR3, SEQ ID NO.: 8 LCDR1, SEQ ID NO.: 9 LCDR2, and SEQ ID NO.: 10 LCDR3; (b) SEQ ID NO.: 13 HCDR1, SEQ ID NO.: 14 HCDR2, SEQ ID NO.: 15 HCDR3, SEQ ID NO.: 10 HCDR: 18 LCDR1, SEQ ID NO.: 19 LCDR2, SEQ ID NO.: 20 LCDR3; (c) SEQ ID NO.: 23 HCDR1, SEQ ID NO.: 24 HCDR2, SEQ ID NO.: 25 HCDR3, SEQ ID NO.: 28 LCDR1, SEQ ID NO.: 29 LCDR2, SEQ ID NO.: 30 LCDR3; (d) SEQ ID NO.: 33 HCDR1, SEQ ID NO.: 34 HCDR2, SEQ ID NO.: HCDR3 of 35, SEQ ID NO.: LCDR1 of 38, SEQ ID NO.: LCDR2 of 39, and SEQ ID NO.: LCDR3 of 40; (e) SEQ ID NO.: HCDR1 of 43, SEQ ID NO.: HCDR2 of 44, SEQ ID NO.: HCDR3 of 45, SEQ ID NO.: LCDR1 of 48, SEQ ID NO.: LCDR2 of 49, and SEQ ID NO.: LCDR3 of 50; (f) SEQ ID NO.: HCDR1 of 53, SEQ ID NO.: HCDR1 of 53, SEQ ID NO.: HCDR2 of 54, SEQ ID NO.: HCDR3 of 55, SEQ ID NO.: LCDR1 of 58, SEQ ID NO.: LCDR2 of 59, and SEQ ID NO.: LCDR3 of 60; (g) SEQ ID NO.: HCDR1 of 63, SEQ ID NO.: HCDR2 of 64, SEQ ID NO.: HCDR3 of 65, SEQ ID NO.: LCDR2 of 68, SEQ ID NO.: LCDR2 of 69, and SEQ ID NO.: LCDR3 of 70; (h) SEQ ID NO.: HCDR1 of 73, SEQ ID NO.: HCDR2 of 74, SEQ ID NO.: HCDR3 of 75, SEQ ID NO.: LCDR1 of 78, SEQ ID NO.: LCDR2 of 79, and LCDR3 of 80; (i) SEQ ID NO.: HCDR1 of 83, SEQ ID NO.: HCDR2 of 84, SEQ ID NO.: HCDR3 of 85, SEQ ID NO.: LCDR1 of 88, SEQ ID NO.: LCDR2 of 89, SEQ ID NO.: LCDR3 of 90; (j) SEQ ID NO.: HCDR1 of 93, SEQ ID NO.: HCDR2 of 94, SEQ ID NO.: HCDR3 of 95, SEQ ID NO.: LCDR1 of 98, SEQ ID NO.: LCDR2 of 99, and SEQ ID NO.: LCDR3 of 100; (k) SEQ ID NO.: HCDR1 of 103, SEQ ID NO.: HCDR2 of 104, SEQ ID NO.: HCDR3 of 105, SEQ ID NO.: LCDR1 of 108, SEQ ID NO.: LCDR2 and SEQ ID NO.: LCDR3 of 110; (l) SEQ ID NO.: HCDR1 of 113, SEQ ID NO.: HCDR2 of 114, SEQ ID NO.: HCDR3 of 115, SEQ ID NO.: LCDR1 of 118, SEQ ID NO.: LCDR2 of 119, SEQ ID NO.: LCDR3 of 110; (m) SEQ ID NO.: HCDR1 of 123, SEQ ID NO.: HCDR2 of 124, SEQ ID NO.: HCDR3 of 125, SEQ ID NO. NO.: LCDR1 of 128, SEQ ID NO.: LCDR2 of 129, and SEQ ID NO.: LCDR3 of 130; (n) SEQ ID NO.: HCDR1 of 133, SEQ ID NO.: HCDR2 of 134, SEQ ID NO.: HCDR3 of 135, SEQ ID NO.: LCDR1 of 138, SEQ ID NO.: LCDR2 of 139, and SEQ ID NO.: LCDR3 of 140; and (o) SEQ ID NO.: HCDR1 of 143, SEQ ID NO.: HCDR1 of 143, SEQ ID NO.: HCDR2 of 144, SEQ ID NO.: HCDR3 of 145, SEQ ID NO.: LCDR1 of 148, SEQ ID NO.: LCDR2 of 149, and LCDR3 of 150; (p) A set of six CDRs according to any one of (a) to (o) which comprises one or more amino acid substitutions, deletions or insertions; (q) A set of six CDRs according to any one of (a) to (p) which comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions; (r) A set of six CDR HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3 according to any one of (a) to (q), comprising: (i) HCDR1 having an amino acid sequence that is consistent with or consists of 3 or less amino acid residues substituted with respect to SEQ ID NO: 3; (ii) HCDR2 having an amino acid sequence that is consistent with or consists of 5 or less amino acid residues substituted with respect to SEQ ID NO: 4; (iii) HCDR3 having an amino acid sequence that is consistent with or consists of 6 or less amino acid residues substituted with respect to SEQ ID NO: 5; (iv) NO:6 is consistent with or comprises substituted by 5 or less amino acid residues and / or one deleted amino acid sequence; (v) LCDR2 is consistent with or comprises substituted by SEQ ID NO:7 or comprises substituted by 5 or less amino acid residues; and (vi) LCDR3 is consistent with or comprises substituted by SEQ ID NO:8 is an amino acid sequence; (s) a set of six CDRs HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3, which comprises: (i) HCDR1, wherein: Kabat residue 31 is S, Kabat residue 32 is N or Y, Kabat residue 33 is N, S or R, Kabat residue 34 is A, Kabat residue 35 is V or T, Kabat residue 35A is W Kabat residue 35B is N (SEQ ID NO: 161); (ii) HCDR2, where: Kabat residue 50 is R, Kabat residue 51 is T, Kabat residue 52 is Y, Kabat residue 52A is Y, Kabat residue 53 is R, Kabat residue 54 is S, Kabat residue 55 is K or G, Kabat residue 56 is W, Kabat residue 57 is Y, Kabat residue 58 is N or Y, Kabat residue 59 is D, Kabat residue 60 is Y, Kabat residue 61 is A, Kabat residue 62 is E, V or d, Kabat residue 63 is S or F, Kabat residue 64 is V or L, Kabat residue 65 is K (SEQ ID NO: 162); (iii) HCDR3, where: Kabat residue 95 is S or G, Kabat residue 96 is G, Kabat residue 97 is H, Kabat residue 98 is I, Kabat residue 99 is T, Kabat residue 100A is F, Kabat residue 100B is G, Kabat residue 100C is V or L, Kabat residue 100D is N, Kabat residue 100E is V or I, Kabat residue 100F is D, Kabat residue 100G is A, Kabat residue 100F is F or Y, Kabat residue 101 is D, Kabat residue 102 is M, I or V (SEQ ID NO: 163); (iv) LCDR1, where: Kabat residue 24 is R, Kabat residue 25 is T, A or absent, Kabat residue 26 is S or A, Kabat residue 27 is Q, Kabat residue 28 is S or R, Kabat residue 29 is L, Kabat residue 30 is S, N or R Kabat residue 31 is S, Kabat residue 32 is Y, Kabat residue 33 is L, T or D, Kabat residue 34 is H (SEQ ID NO: 164); (v) LCDR2, wherein: Kabat residue 50 is A, Kabat residue 51 is A, T or S, Kabat residue 52 is S or T, Kabat residue 53 is S or T, Kabat residue 54 is L or R, Kabat residue 55 is Q, L or G, Kabat residue 56 is S (SEQ ID NO: 165); and (vi) LCDR3, wherein: Kabat residue 89 is Q, Kabat residue 90 is Q or L, Kabat residue 91 is S, Kabat residue 92 is R, and Kabat residue 93 is T (SEQ ID NO: 166). The present invention provides antibodies and binding fragments including the following set of six CDRs: HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3, and the set of six CDRs are shown in Tables 11 and 13. The variant antibody sequence of the present invention may be 75% or more (eg, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more) amino acid sequence identity with the sequences listed in this application. In some embodiments, sequence consistency is calculated relative to the full length of the reference sequence (ie, the sequences listed in this application). In some other embodiments, the percentage of consistency as mentioned herein is determined by the preset parameters [Blosum 62 matrix; void opening penalty = 11 and void expansion penalty = 1] as specified by NCBI (the National Center for Biotechnology Information); http: / / www.ncbi.nlm.nih.gov / ). Variants are also included within the scope of the present invention. Therefore, variants of the sequences enumerated in this application are also included within the scope of the present invention. Variants of antibody sequences with improved affinity and / or efficacy may be obtained using methods known in the art and are included within the scope of the present invention. For example, amino acid substitutions can be used to obtain antibodies with further improved affinity. Alternatively, codon optimization of nucleotide sequences can be used to improve the translation efficiency in the expression system used to produce antibodies. In addition, polynucleotides containing sequences with optimized antibody specificity or neutralization activity by applying directed evolutionary methods to any of the nucleic acid sequences of the present invention are also within the scope of the present invention.The present invention provides an antibody or binding fragment thereof of the invention comprising a VH and / or VL having at least 75% consistency with VH and / or VL selected from the group consisting of: (a) VH of SEQ ID NO.: 2 and VL of SEQ ID NO.: 7, (b) SEQ ID NO.: 12 and VL of SEQ ID NO.: 17, (c) SEQ ID NO.: 22 and VH of SEQ ID NO.: 27 VL, (d) SEQ ID NO.: 32 and VL of SEQ ID NO.: 37 VL, (e) SEQ ID NO.: 42 VH and SEQ ID NO.: 42 VH: VL of 47, (f) SEQ ID NO.: VH of 52 and SEQ ID NO.: VL of 57, (g) SEQ ID NO.: VH of 62 and SEQ ID NO.: VL of 67, (h) SEQ ID NO.: VH of 72 and SEQ ID NO.: VL of 77, (i) SEQ ID NO.: VH of 82 and SEQ ID NO.: VL of 87, (j) SEQ ID NO.: VH of 92 and SEQ ID NO.: VL of 97, (k) SEQ ID NO.: VH of 102 and SEQ ID NO.: VH of 102 and SEQ ID NO.: VL of 107, (l) SEQ ID NO.: VH of 112 and SEQ ID NO.: VL of 117, (m) SEQ ID NO.: VH of 122 and SEQ ID NO.: VL of 127, (n) SEQ ID NO.: VH of 132 and SEQ ID NO.: VL of 137, (o) SEQ ID NO.: VH of 142 and SEQ ID NO.: VL of 147, and (p) SEQ ID NO: VH of 152 and SEQ ID NO: VL of 157. The antibodies or binding fragments thereof of the invention may include VH and VL selected from the group consisting of (a) SEQ ID NO.: 2 VH and SEQ ID NO.: 7 VL, (b) SEQ ID NO.: 12 VH and SEQ ID NO.: 17 VL, (c) SEQ ID NO.: 22 VH and SEQ ID NO.: 27 VL, (d) SEQ ID NO.: 32 VH and SEQ ID NO.: 37 VL, (e) SEQ ID NO.: 42 VH and SEQ ID NO.: 47 VL, (f) SEQ ID NO.: VH of 52 and SEQ ID NO.: VL of 57, (g) SEQ ID NO.: VH of 62 and SEQ ID NO.: VL of 67, (h) SEQ ID NO.: VH of 72 and SEQ ID NO.: VL of 77, (i) SEQ ID NO.: VH of 82 and SEQ ID NO.: VL of 87, (j) SEQ ID NO.: VH of 92 and SEQ ID NO.: VL of 97, (k) SEQ ID NO.: VH of 102 and SEQ ID NO.: VL of 107, (l) SEQ ID NO.: VH of 112 and SEQ ID NO.: VL of 117, (m) SEQ ID NO.: VH of 122 and SEQ ID NO.: VL of 127, (n) SEQ ID NO.: VH of 132 and SEQ ID NO.: VL of 137, (o) SEQ ID NO.: VH of 142 and SEQ ID NO.: VL of 147, and (p) SEQ ID NO: VH of 152 and SEQ ID NO: VL of 157. The antibodies or binding fragments thereof of the present invention may be selected from the group consisting of immunoglobulin molecules, single antibodies, chimeric antibodies, CDR transplant antibodies, humanized antibodies, Fab, Fab', F(ab')2, Fv, disulfide-linked Fv, scFv, single domain antibodies, bifunctional antibodies, multispecific antibodies, dual specific antibodies, and bispecific antibodies. The antibodies or binding fragments thereof of the invention may include: VH containing a human germline framework (preferably VH6-1) and / or VL containing a human germline framework (preferably VK1-39). Preferably, the antibody or binding fragment thereof of the present invention comprises: VH comprising the human germline framework VH6-1 and VL comprising the human germline framework VK1-39. VH6 frameworks are rarely used in antibodies. The antibody or binding fragment thereof of the present invention may contain an Fc region, preferably IgG1, IgG2 or IgG4 or binding fragment thereof. In one embodiment, the antibody of the invention comprises a human IgG constant domain with one or more amino acid substitutions relative to the wild-type human IgG constant domain. The antibodies of the present invention may include a human IgG constant domain with M252Y, S254T and T256E ("YTE") amino acid substitutions, wherein the amino acid residues are numbered according to the EU index, such as in Kabat. The present invention also provides antibodies or binding fragments thereof that are capable of binding to influenza A virus hemoglobin and neutralizing at least one first subtype and at least one second subtype of influenza A virus, characterized in that the antibody or binding fragments thereof compete with the antibodies of the present invention for binding to influenza A virus hemoglobin. Therefore, the invention comprises antibodies or fragments thereof that bind to the same antigenic determinant as the antibody of the invention, or antibodies that compete for binding with the antibody of the invention. The invention further provides an isolated nucleic acid encoding an antibody or fragment thereof of the invention. The nucleic acid is preferably cDNA. The present invention also includes nucleic acid sequences encoding the light chain and heavy chain of the antibody of the present invention and the CDR. Therefore, nucleic acid sequences encoding light chains and heavy chains and CDRs of exemplary antibodies of the present invention are provided herein. SEQ ID numbers are provided for nucleic acid sequences encoding CDR, heavy and light chain variable regions of illustrative antibodies of the present invention. Due to the redundancy of the genetic code, there will be variants of such sequences encoding the same amino acid sequence. The present invention further provides a vector comprising the isolated nucleic acid of the present invention; the vector is preferably a manifestation vector. In addition, the present invention provides a host cell comprising an isolated nucleic acid or vector of the present invention. Suitable host cells include mammalian cell lines, such as cell lines derived from HEK or CHO cells. In addition, the present invention provides a method for producing an antibody or fragment of the present invention, which comprises culturing a host cell of the present invention under conditions suitable for expressing the antibody or fragment thereof. Such methods may additionally include isolating an antibody or fragment thereof from a host cell culture and formulating the isolated antibody or fragment into a composition as appropriate. The present invention further provides a composition comprising an antibody or fragment thereof of the present invention and a pharmaceutically acceptable carrier. The invention also provides a composition comprising an antibody or fragment thereof, histamine and NaCl at a pH of about 5.5 to about 6.5, preferably at a pH of about 6.0; more preferably at a pH of about 5.5 to about 6.5, preferably at a pH of about 5.5 to about 6.5, preferably at a pH of about 5.5 to about 6.5, preferably at a pH of about 20 to about 30 mM histamine and about 0.1 to about 0.2 M NaCl; preferably at a pH of about 5.5 to about 6.5, for example 25 mM His and 0.15 M NaCl at a pH of about 6.0. In addition, the present invention provides: - an antibody or fragment thereof of the present invention for preventing or treating influenza A infection in an individual; - use of an antibody or fragment thereof in the present invention in the manufacture of an agent for preventing or treating influenza A infection in an individual; - a method for preventing or treating influenza A infection in an individual, which comprises administering an antibody or fragment thereof; - use of a fusion step to prevent the pH triggering of influenza A virus from entering a cell; or - use of an antibody or fragment thereof in the present invention to inhibit the maturation of influenza A virus. Exemplary antibodies of the present invention include, but are not limited to: antibody 3, antibody 5, antibody 6, antibody 8, antibody 10, antibody 11, antibody 12, antibody 13, antibody 14 and antibody 15. The present invention also provides the use of the antibodies or binding fragments of the invention in vitro diagnosis of influenza A infection in individuals. Introduction The present invention provides antibodies that bind to the influenza A virus hemoglobin (HA) stalk and neutralize the influenza A virus infect the first and second subtypes, including human forms and fragments, derivatives / conjugates and compositions thereof as described herein; such anti-influenza A virus HA stalk antibodies are referred to herein as antibodies of the invention. As used herein, the term "neutralization" refers to the ability of an antibody or binding fragment thereof to an infectious agent such as influenza A virus and to reduce the biological activity (eg, toxicity) of the infectious agent. The minimum requirement for neutralization is the ability of the antibody or its binding fragment to the infectious agent. In one embodiment, the antibody or binding fragment of the invention immunospecifically binds at least one of the specified antigenic determinants or antigenic determinants of the influenza A virus. In a more specific embodiment, the antibody or binding fragment of the invention immunospecifically binds at least one of the specified antigenic determinants or antigenic determinants of the influenza A virus HA shank protein. Antibodies can neutralize the activity of infectious agents such as influenza A virus at different points during the life cycle of the virus. For example, antibodies may interfere with the attachment of the virus to a target cell by interfering with the interaction of the virus with one or more cell surface receptors. Alternatively, antibodies may interfere with the post-attachment interaction of the virus with one or more of its receptors, for example by receptor-mediated internalization. In one embodiment, the antibody or binding fragment thereof neutralizes the activity of influenza A by interfering with the fusion process, such as by interfering with the fusion of the virus with the endosomal membrane. In another embodiment, the antibody or binding fragment thereof interferes with protease-mediated HA0 cleavage, thereby interfering with viral maturation and formation of HA2 viral fusion peptides. For example, in one embodiment, an antibody or binding fragment thereof interferes with protease-mediated HA0 cleavage necessary for influenza A virus activation. As used herein, the term "antibody" is also referred to as immunoglobulins, encompasses single antibody (including full-length single antibody), human antibody, humanized antibody, camel antibody, chimeric antibody, single-chain Fv (scFv), single-chain antibody, single-domain antibody, domain antibody, Fab fragment, F(ab')2 fragment, antibody fragment that exhibits the desired biological activity (eg, antigen binding moiety), disulfide-linked Fv (dsFv) and antigen-determined binding fragments against individual genotype (anti-Id) antibodies (including, for example, anti-Id antibodies of antibodies of the invention), intracellular antibodies and any of the above. In detail, antibodies include immunoglobulin molecules and immunoactive fragments of immunoglobulin molecules, that is, molecules containing at least one antigen binding site. The immunoglobulin molecule may have any isotype (eg, IgG, IgE, IgM, IgD, IgA and IgY), sub-isotype (eg, IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or isotype (eg, Gm, for example, Glm (f, z, a or x), G2m (n), G3m (g, b or c), Am, Em and Km (1, 2 or 3)). Human antibodies are typically heterotetrameric glycoproteins of about 150,000 Daltons, composed of two identical light (L) chains and two identical heavy (H) chains. Each light chain is connected to the heavy chain by a covalent disulfide bond, while the number of disulfide bonds is different between heavy chains of different immunoglobulin homotypes. Each heavy and light chain also has regular intervals in-chain disulfide bridge bonds. Each heavy chain has a variable domain (VH) at one end, followed by a large number of constant domains (CH). Each light chain has a variable domain (VL) at one end and a constant domain (CL) at the other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain and the light chain variable domain is aligned with the variable domain of the heavy chain. Light chains are classified as lambda chains or κ chains based on the amino acid sequence of the constant region of the light chain. The variable domain of the κ light chain can also be expressed herein as VK. The antibodies of the present invention include full-length or intact antibodies, antibody fragments (including antigen binding fragments), native sequence antibodies or amino acid variants, human antibodies, humanized antibodies, post-translationally modified antibodies, chimeric antibodies or fusion antibodies, immune conjugates and functional fragments thereof. The antibodies may be modified in the Fc region to provide the desired effector function or serum half-life. As discussed in more detail below, using appropriate Fc regions, naked antibodies bound on the cell surface may induce cytotoxicity, for example via antibody-dependent cytotoxicity (ADCC) or by recruiting complement in complement-dependent cytotoxicity (CDC), or by recruiting nonspecific cytotoxic cells that express one or more binding antibodies that recognize the effector ligands of influenza A virus HA stem and subsequently cause cell phagocytosis in antibody-dependent cell-mediated phagocytosis (ADCP), or some other mechanism. Alternatively, certain other Fc regions may be used if the removal or reduction of effect functions is required to minimize side effects or therapeutic complications. The Fc region of the antibodies of the present invention can be modified to increase the binding affinity of FcRn and thus increase the serum half-life. Alternatively, the Fc region may bind to PEG or albumin to increase serum half-life, or to produce some other binding of the desired effect. The anti-influenza A virus HA shank antibody of the present invention is suitable for diagnosing, preventing, treating and / or alleviating one or more symptoms of influenza A virus infection in mammals. The present invention provides a composition comprising the anti-influenza A virus HA shank antibody and a carrier of the present invention. For the purpose of preventing or treating influenza A virus infection, the composition may be administered to a patient in need of such treatment. The present invention also provides formulations containing the anti-influenza A virus HA shank antibody and carrier of the present invention. In one embodiment, the formulation is a therapeutic formulation comprising a pharmaceutically acceptable carrier. In certain embodiments, the invention provides methods suitable for preventing or treating influenza A infection in a mammal, comprising administering to the mammal a therapeutically effective amount of an antibody. Antibody therapeutic compositions can be administered short-term (acute), long-term or intermittently as directed by the physician. In certain embodiments, the invention also provides articles containing at least anti-influenza A virus HA shank antibodies, such as sterile dosage forms and sets. Sets containing antibodies may be provided for detection and quantification of in vitro influenza A virus, for example in ELISA or Western dot method. Such antibodies suitable for detection may have labels such as fluorescent or radiolabeled. Term Before describing the invention in detail, it is understood that the invention is not limited to a particular composition or process step and thus may be varied. It should be noted that unless the context clearly indicates otherwise, the singular forms "a" and "the" used in this specification and the scope of the patent application include plural indicators. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the invention belongs. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd Edition, 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd Edition, 1999, Academic Press; and the Oxford Dictionary of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press provides skilled people with a general dictionary of many of the terms used in the present invention. Amino acids may be mentioned herein by their generally known three-letter symbols or single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Committee. Likewise, nucleotides may be mentioned by the single letter codes they are generally accepted. Unless otherwise specified, the number of amino acids in the variable domain, complementarity determining region (CDR) and framework region (FR) of an antibody follows the Kabat definition as described in Sequences of Proteins of Immunological Interest, 5th Edition Public Health Service, National Institutes of Health, Bethesda, MD. (1991). Using this numbering system, the actual linear amino acid sequence may contain fewer or additional amino acids corresponding to the shortened or inserted FR or CDR of the variable domain. For example, the heavy chain variable domain may include a single amino acid insertion after residue 52 of H2 (according to residue 52a of Kabat) and an insertion residue after heavy chain FR residue 82 (according to residue 82a, 82b and 82c of Kabat, etc.). The Kabat number of residues in a given antibody can be determined by comparing the antibody sequence to the homologous region of the "standard" Kabat numbering sequence. Maximum alignment of framework residues often requires inserting "spacer" residues in the numbering system to be used in the Fv region. Additionally, the consistency of certain individual residues at any given Kabat site number may vary between antibody chains due to interspecies or dual gene differences. Anti-flu A Virus HA Stalk Antibodies In certain embodiments, the antibody is isolated and / or purified and / or pyrogen-free antibody. As used herein, the term "purified" refers to other molecules, such as polypeptides, nucleic acid molecules, that have been identified and isolated and / or recovered from components of the natural environment. Thus, in one embodiment, the antibody of the invention is a purified antibody, wherein it has been isolated from one or more components of its natural environment. As used herein, the term "isolated antibody" refers to an antibody that does not contain substantially other antibody molecules having different antigen specificity (eg, an isolated antibody specifically bound to an influenza A virus HA stalk that does not contain substantially binding to an antigen other than an influenza A virus HA stalk). Thus, in one embodiment, the antibody of the invention is an isolated antibody, wherein it has been isolated from an antibody with different specificity. Typically, the isolated antibody is a single antibody. Furthermore, the isolated antibodies of the present invention may be substantially free of one or more other cellular substances and / or chemical substances and are referred to herein as isolated and purified antibodies. In one embodiment of the invention, the combination of "isolated" single antibody is related to antibodies that have different specificities and are combined in well-defined compositions. Methods for the production and purification / isolation of antibodies are described in more detail below. The isolated antibodies of the invention comprise an antibody amino acid sequence disclosed herein encoded by any suitable polynucleotide or any isolated or formulated antibody. The antibodies of the present invention immunospecifically bind at least one prescribed antigen determinant unique to the influenza A virus HA stem protein. As used herein, the term "antigen determinant" refers to a protein determinant capable of binding to an antibody. Antigenic determinants usually include chemically active surface groups such as molecules of amino acids or sugar side chains, and generally have specific three-dimensional structural characteristics as well as charge-to-mass ratio characteristics. The difference between a configuration antigen determinant and a non-configured antigen determinant is that the binding to the former rather than the latter is lost in the presence of a denaturing solvent. In one embodiment, the antibody or binding fragment thereof binds to an antigenic determinant retained in at least H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16 or H17 or all of the influenza A HA subtypes. In another embodiment, the antibody or binding fragment thereof binds to an antigen determinant selected from one or more of H1, H2, H5, H6, H8, H9, H11, H12, H13 and H16 or at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 influenza A virus population 1 subtypes and selected from one or more of H3, H4, H7, H10, H14 and H15 or at least 1, 2, 3, 4, 5 or 6 subtypes 2 subtypes. In one embodiment, the antibody or binding fragment thereof is at an EC of about 0.01 μg / ml to about 5 μg / ml, or about 0.01 μg / ml to about 0.5 μg / ml, or about 0.01 μg / ml to about 0.1 μg / ml, or less than about 5 μg / ml, 1 μg / ml, 0.5 μg / ml, 0.1 μg / ml, or 0.05 μg / ml 50 Bind at least 17H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16 or H17 or all influenza A subtypes. In another embodiment, the antibody or binding fragment thereof is at an EC of about 0.01 μg / ml to about 5 μg / ml, or about 0.01 μg / ml to about 0.5 μg / ml, or about 0.01 μg / ml to about 0.1 μg / ml, or less than about 5 μg / ml, 1 μg / ml, 0.5 μg / ml, 0.1 μg / ml, or 0.05 μg / ml 50Binding one or more or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 influenza A virus population 1 subtypes selected from H1, H2, H5, H6, H8, H9, H11, H12, H13 and H16 or at least 1, 2, 3, 4, 5, or 6 influenza A virus subtypes selected from H3, H4, H7, H10, H14 and H15. In one embodiment, the antibody or its binding fragment recognizes an antigenic determinant which is a linear antigenic determinant or a continuous antigenic determinant. In another embodiment, the antibody or binding fragment thereof recognizes a nonlinear or constitutive antigen determinant. In one embodiment, the antigenic determinant is located in the highly retained shank region of HA2. In a more specific embodiment, the antibody or binding fragment binds to a constitutive antigenic determinant in the highly retained shank region of HA2. In one embodiment, the antigenic determinant comprises as contact residues selected from one or more amino acids: positions 18, 19, 42, 45 in the shank region of HA2 (positions are numbered according to the H3 numbering system as described in Weiss et al., J. Mol. Biol. (1990) 212, 737-761 (1990)). In a more specific embodiment, the antigenic determinant comprises one or more amino acids selected from the group consisting of 18, 19, 42 and 45 as contact residues of HA2. In another embodiment, the antigenic determinant comprises amino acids 18, 19, 42 and 45 in the shank region of HA2 as contact residues. In another embodiment, the antigenic determinant comprises amino acids 18, 19 and 42 in the shank region of HA2 as contact residues. Antigenic determinants recognized by antibodies or binding fragments thereof of the invention may have many uses. For example, purified or synthetic forms of antigenic determinants can be used to induce an immune response (ie, as a vaccine or for the production of antibodies for other purposes) or to screen serum for immune responses between the antibodies and antigenic determinants. In one embodiment, an antigenic determinant recognized by the antibody or binding fragment thereof of the invention or an antigen having such an antigenic determinant may be used as a vaccine to cause an immune response. In another embodiment, the antibodies and binding fragments of the invention can be used to monitor the quality of the vaccine, for example, by determining whether the antigen in the vaccine contains the correct immunogenic antigenic determinant of the correct configuration. Variable Regions As used herein, the term "parent antibody" refers to an antibody encoded by an amino acid sequence used to prepare a variant or derivative as defined herein. The parent polypeptide may contain a natural antibody sequence (ie, naturally occurring, including naturally occurring dual gene variants) or an antibody sequence with a pre-existing amino acid sequence modification (such as other insertions, deletions, and / or substitutions) of a naturally occurring sequence. The parent antibody may be a humanized antibody or a human antibody. In certain embodiments, the antibodies of the invention are variants of the parent antibody. As used herein, the term "variant" refers to an antibody whose amino acid sequence differs from the amino acid sequence of the "parent" antibody by adding, deleting, and / or substituting one or more amino acid residues into the parent antibody sequence. The antigen-binding portion of an antibody comprises one or more fragments of an antibody retaining the ability to specifically bind to the antigen. The antigen binding function of the antibody has been demonstrated may be performed by fragments of the full-length antibody. Examples of binding fragments encompassed in the "antigen-binding moiety" of an antibody include: (i) a Fab fragment, a monovalent fragment composed of VL, VH, CL and CH1 domains; (ii) a F(ab')2 fragment, a bivalent fragment of two Fab fragments linked by a disulfide bridge bond located in the hinge region; (iii) a Fd fragment composed of VH and CH1 domains; (iv) a Fv fragment composed of a single arm of the antibody; (v) a dAb fragment composed of the VH domain (Ward et al., (1989) Nature 341:544-546) and (vi) an isolated complementary determining region (CDR). Furthermore, although the two domains VL and VH of the Fv fragment are encoded by independent genes, they can be bonded by synthetic linkers using recombinant methods, enabling the preparation of a single protein chain (called single-stranded Fv (scFv) in which the VL region pairs with the VH region to form a monovalent molecule (called single-stranded Fv (scFv); see, for example, Bird et al. (1988) Science 242: 423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85: 5879-5883). Such single-chain antibodies are also intended to be covered by the "antigen-binding portion" of the term antibody. Such antibody fragments were obtained using conventional techniques known to those skilled in the art, and the fragments were screened for utility in the same manner as intact antibodies. The antigen binding moiety can be produced by recombinant DNA technology or by enzymatic or chemical cleavage of intact immunoglobulins. The antibodies of the present invention comprise at least one antigen binding domain comprising the VH and VL domains described herein. In certain embodiments, the purified antibody comprises VH and / or VL with a given percentage of identity to at least one of the VH and / or VL sequences disclosed in Table 1. As used herein, the term "percent sequence identity (%)" (also including "homology") is defined as the percentage of amino acid residues or nucleotides in the candidate sequence consistent with amino acid residues or nucleotides in the reference sequence such as the parent antibody sequence after aligning the sequence and introducing a void (if required) to achieve maximum sequence identity without taking into account any retained substitution as part of the sequence identity. In addition to manual, local homology algorithms such as Smith and Waterman, 1981, Ads App. Math. 2, 482, local homology algorithms such as Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, similarity search methods by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 85, 2444, or GAP, BESTFIT, FASTA, BLAST P, BLAST in computer programs using these algorithms (Wisconsin Genetics Software Package). N and TFASTA, Genetics Computer Group, 575 Science Drive, Madison, Wis.) generate sequences for best comparison. The antibodies of the present invention may include a VH amino acid sequence having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identity to the VH amino acid sequence described herein. The antibody may have a VH amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the VH amino acid sequence described herein. The antibodies of the invention may include VL amino acid sequences having at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% identity to the VL amino acid sequence described herein. The antibody may have a VL amino acid sequence that has at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the VL amino acid sequence described herein. As described herein, antibodies within the scope of the present invention are able to neutralize one or more first group subtypes and one or more second group subtypes. Complementary Decision Zone (CDR) Although the variable domains (VH and VL) contain antigen binding regions, the variability is not uniformly distributed throughout the variable domains of the antibody. It is concentrated in a segment called a complementary determination region (CDR), in both the light chain (VL or VK) and the heavy chain (VH) variable domain. The relatively highly retained portion of the variable domain is called the framework region (FR). The variable domains of natural heavy and light chains each contain four FR regions connected by three CDRs mainly in a beta-sheet configuration that form a loop connecting the beta-sheet structure and in some cases a part of the beta-sheet structure. The CDRs in each strand are held together closely by the FR and with the CDRs of other strands, helping to form antigen binding sites for antibodies (see Kabat et al., supra). The three CDRs of the heavy chain are called CDR-H1, CDR-H2 and CDR-H3, and the three CDRs of the light chain are called CDR-L1, CDR-L2 and CDR-L3. Use the Kabat numbering system in this article. Thus, CDR-H1 starts at approximately amino acid 31 (ie approximately 9 residues after the first cysteine ​​residue), includes approximately 5-7 amino acids, and ends at the next tyrosine residue. CDR-H2 begins at the fifteenth residue after the CDR-H1 terminus, including approximately 16-19 amino acids, and ends at the next sperminic acid or eluent amino acid residue. CDR-H3 begins at approximately the thirty-third amino acid residue after the end of CDR-H2; includes 3-25 amino acids; and ends at the sequence W-G-X-G, where X is any amino acid. CDR-L1 begins at approximately residue 24 (ie, after cysteine ​​residue); includes approximately 10-17 residues; and ends at the next tyrosine residue. CDR-L2 begins at approximately the sixteenth residue after the end of CDR-L1 and includes approximately 7 residues. CDR-L3 begins at approximately the thirty-third residues after the end of CDR-L2; includes approximately 7-11 residues and ends at the sequence F-G-X-G, where X is any amino acid. Note that CDRs vary considerably between antibodies (and by definition will not exhibit homology with Kabat sequences). The present invention encompasses neutralizing anti-influenza A HA shank antibodies that contain amino acids of substantially the same sequence as those described herein. An amino acid sequence substantially the same as the sequences described herein include sequences containing retained amino acid substitutions and amino acid deletion and / or insertion in the amino acid sequences displayed in SEQ ID NO: 102, 112, 122, 132 or 142. Retaining amino acid substitution refers to the replacement of the first amino acid by a second amino acid of a chemical and / or physical property (eg, charge, structure, polarity, hydrophobicity / hydrophilicity) similar to that of the first amino acid. Retention substitution includes the replacement of one amino acid in the following groups by another amino acid: ionacid (K), spermine (R) and histamine (H); asparagine (D) and glutamic acid (E); asparagine (N), glutamic acid (Q), sericine (S), thresine (T), tyrosine (Y), K, R, H, D and E; acetic acid (A), valine (V), leucine (L), isochloric acid (I), proline (P), amphetamine (F), tryptic acid (W), methiamine (M), cysteine ​​(C) and glycine (G); F, W and Y; C, S and T. The variable domains of the framework region heavy chain and light chain each contain four framework regions (FR1, FR2, FR3, FR4), which are relatively highly retained parts of the variable domain. The four FRs of the heavy chain are called FR-H1, FR-H2, FR-H3 and FR-H4, and the four FRs of the light chain are called FR-L1, FR-L2, FR-L3 and FR-L4. The Kabat numbering system is used in this article, see Table 1, Kabat et al., supra. Thus, FR-H1 starts at position 1 and ends at approximately amino acid 30, FR-H2 is approximately amino acids 36 to 49, FR-H3 is approximately amino acids 66 to 94, and FR-H4 is approximately amino acids 103 to 113. FR-L1 starts at amino acid 1 and ends at approximately amino acid 23, FR-L2 is approximately amino acids 35 to 49, FR-L3 is approximately amino acids 57 to 88, and FR-L4 is approximately amino acids 98 to 107. In certain embodiments, the framework region may contain a substitution according to the Kabat numbering system, such as insertion at 106A of FR-L1. In addition to naturally occurring substitutions, one or more modifications (eg, substitutions) of the FR residues may also be introduced into the antibodies of the invention, with the limitation of which neutralization ability is retained. In certain embodiments, it results in an improvement or optimization of the binding affinity of the antibodies to the HA stalk of the influenza A virus. Examples of framework region residues to be modified include framework region residues that directly non-covalently bind antigens (Amit et al., Science, 233:747-753 (1986)); framework region residues that interact with / influence CDR configuration (Chothia et al., J. Mol. Biol., 196:901-917 (1987)); and / or framework region residues involved in VL-VH interfaces (U.S. Patent No. 5,225,539). In another embodiment, the FR may contain one or more amino acid changes for the purpose of "germacy". For example, the amino acid sequences of the selected antibody heavy and light chains are different from the germline heavy and light chain amino acid sequences, and where certain framework residues of the selected VL and / or VH chains are different from the germline configuration (for example, due to somatic mutations in the immunoglobulin gene used to prepare the phage library), it may be necessary to "recover mutations" of the selected antibody into the germline configuration (ie, to change the framework amino acid sequence of the selected antibody so that it is the same as the germline framework amino acid sequence). Such "restor mutations" (or "germlineization") of framework residues can be achieved by standard molecular biological methods of introducing specific mutations (eg site-directed mutation induction; PCR-mediated mutation induction and similar methods). Nucleotide sequence encoding antibody of the present invention In addition to the above-mentioned amino acid sequence, the present invention also provides nucleotide sequences corresponding to amino acid sequences and encoding human antibodies of the present invention. In one embodiment, the invention provides a polynucleotide comprising a nucleotide sequence encoding an antibody or fragment thereof as described herein. It includes, but is not limited to, nucleotide sequences encoding the above-mentioned amino acid sequence. Therefore, the present invention also provides a polynucleotide sequence encoding the VH and VL framework regions of the CDR and FR of the antibodies described herein and a performance vector for their efficient expression in cells (eg, mammalian cells). Methods of making antibodies using polynucleotides are described in more detail below. The invention also encompasses polynucleotides that hybridize to polynucleotides encoding antibodies of the invention described herein under stringent or lower stringency hybridization conditions, such as defined herein. As used herein, the term "strength" refers to experimental conditions (eg, temperature and salt concentration) of hybridization experiments to indicate the degree of homology between the probe and the filter-bound nucleic acid; the higher the stringency, the higher the homology percentage between the probe and the filter-bound nucleic acid. Strict hybridization conditions include, but are not limited to, highly stringent conditions of hybridization to filter-bound DNA in 6× sodium chloride / sodium citrate (SSC), followed by washing one or more times in 0.2× SSC / 0.1% SDS at about 50-65°C, such as hybridization to filter-bound DNA in 6× SSC at about 45°C, followed by highly stringent conditions of washing one or more times in 0.1× SSC / 0.2% SDS at about 65°C, or any other stringent hybridization conditions known to those skilled in the art (see, eg, Ausubel, F.M. et al. ed. 1989 Current Protocols in Molecular Biology, Vol. 1, Green Publishing Associates, Inc. and John Wiley and Sons, Inc., NY on pages 6.3.1 to 6.3.6 and 2.10.3). A substantially consistent sequence may be a polymorphic sequence, i.e. an alternative sequence or dual gene in the population. The difference in dual genes can be as small as one base pair. A substantially consistent sequence may also include a mutagenetic sequence, including a sequence containing a silencing mutation. The mutation may include one or more residue changes, deletion of one or more residues, or insertion of one or more additional residues. Polynucleotides can be obtained and nucleotide sequences of polynucleotides can be determined by any method known in the art. For example, if the nucleotide sequence of an antibody is known, the polynucleotide encoding the antibody can be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., BioTechniques 17:242 (1994)), which briefly involves the synthesis of overlapping oligonucleotides containing a portion of the sequence encoding the antibody, adhesion and binding of the oligonucleotides and subsequently amplification of the bonded oligonucleotides by PCR. The polynucleotide encoding the antibody can also be produced from nucleic acids of suitable sources. If a pure line containing a nucleic acid encoding a particular antibody is not available, but the sequence of an antibody molecule is known, the nucleic acid encoding an immunoglobulin can be chemically synthesized, or obtained by PCR amplification using synthetic primers that can hybridize to the 3' and 5' ends of the sequence or by selecting, for example, a pure line of cDNA encoding a library of cDNAs specifically identified for specific gene sequences, for example, from a suitable source (e.g., an antibody cDNA library, or a cDNA library produced from any tissue or cell that expresses an antibody (such as a fusion tumor cell selected to express an antibody), or a nucleic acid (preferably polyA+RNA) isolated from such tissue or cell. The amplified nucleic acids produced by PCR can then be selected into a replicable colonization vector using any method well known in the art. Once the nucleotide sequence and corresponding amino acid sequence of the antibody are determined, the nucleotide sequence of the antibody can be manipulated using methods well-known in this technology for manipulating nucleotide sequences, such as recombinant DNA technology, site-directed mutation induction, PCR, etc. (see, for example, Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., and Ausubel et al., ed., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, The technique described in NY) to produce antibodies with different amino acid sequences, for example to cause amino acid substitution, deletion and / or insertion. Binding Features As mentioned above, the anti-influenza A virus HA shank antibody of the present invention specifically or preferentially immunospecifically binds at least one of the specified antigenic determinants or antigenic determinants, peptides, subunits, fragments, parts or any combination thereof relative to other polypeptides. As used herein, the term "antigen determinant" or "antigen determinant" refers to a protein determinant capable of binding to an antibody, wherein the term "binding" is preferably used herein with respect to specific binding. Such protein determinants or antigen determinants are usually composed of chemically active surface groups of molecules such as amino acids or sugar side chains, and usually have specific three-dimensional structural characteristics as well as charge-to-mass ratio characteristics. The difference between a configuration antigen determinant and a non-configured antigen determinant is that the binding to the former rather than the latter is lost in the presence of a denaturing solvent. As used herein, the term "discontinuous antigenic determinant" refers to a constitutive antigenic determinant on a protein antigen formed by at least two separate regions in a primary sequence of a protein. The interaction between antigen and antibody is the same as other non-covalent protein-protein interactions. Generally, there are four types of binding interactions between an antigen and an antibody: (i) hydrogen bond, (ii) dispersion force, (iii) electrostatic force between Lewis acid and Lewis base and (iv) hydrophobic interaction. Hydrophobic interactions are the main driving force for antibody-antigen interactions and are based on water repulsion rather than molecular attraction of non-polar groups (Tanford, 1978). However, certain physical forces also contribute to antigen-antibody binding, such as the shape of the antigen determinant is fitted or complementary to different antibody binding sites. In addition, other substances and antigens can cross-react with the antibody to compete for available free antibodies. Measuring the affinity constant and binding specificity between an antigen and an antibody is a key element in determining the efficacy of the prevention, treatment, diagnosis and research methods of the use of the antibodies of the present invention. "Binding affinity" generally refers to the total strength of a non-covalent interaction between a single binding site of a molecule (eg, an antibody) and its binding partner (eg, an antigen). Unless otherwise indicated, "binding affinity" as used herein refers to an inherent binding affinity that reflects the 1:1 interaction between a binding pair (eg, an antibody and an antigen). The affinity of molecule X to its collocation Y can generally be expressed by the equilibrium dissociation constant (Kd), which is in the ratio k off / k on calculate. See, e.g., Chen, Y., et al., (1999) J. Mol Biol293:865-881. Affinity can be measured by commonly used methods known in the art, including those described and exemplified herein. Examples of commercially available systems for kinetic characterization include OCTET ® Family instruments. Low-affinity antibodies generally bind slowly to antigens and tend to dissociate easily, while high-affinity antibodies generally bind faster to antigens and tend to bind for a longer period of time. Various methods for measuring binding affinity are known in the art, and any of these methods can be used to achieve the purposes of this invention. The determination of affinity can be measured using specific techniques described elsewhere in the Examples section and methods well-known in the art. One such method includes measuring the dissociation constant "Kd" by radiolabeled antigen binding assay (RIA) using the Fab version of the antibody of interest and its antigen as described below: by placing the Fab with the lowest concentration of ( 125 I) Label antigen equilibrium, and then capture the binding antigen with an antifab antibody coated plate to measure the binding affinity of Fab to antigen solution (Chen et al., (1999) J. Mol Biol293:865-881). To establish the analytical conditions, microtiter plates (Dynex) were coated overnight with 50 mM sodium carbonate (pH 9.6) containing 5 μg / ml of capture anti-Fab antibody (Cappel Lab) and subsequently blocked with PBS containing 2% (w / v) bovine serum albumin for two to five hours at room temperature (about 23°C). In a non-adsorbent plate (Nunc #269620), place 100 pM or 26 pM [ 125 I] Antigens are serial dilutions of Fab of interest (e.g., consistent with the evaluation of the anti-VEGF antibody Fab-12, Presta et al., (1997) Cancer Res.57:4593-4599) Mix. Fab of interest is then cultivated overnight; however, the culture can last for a longer period of time (eg 65 hours) to ensure equilibrium is achieved. Thereafter, the mixture is transferred to a capture plate at room temperature for incubation (eg, 1 hour). The solution was then removed and the plate was washed 8 times with PBS containing 0.1% Tween-20. When the plate was dried, 150 μl / well of scintillator (MicroScint-20; Packard) was added and the plate was counted for tens of minutes using a Topcount gamma counter (Packard). The concentrations of each Fab that provide less than or equal to 20% maximum binding were selected for competitive binding analysis. In another case, the Kd value can be measured using BIAcore™-2000 or BIAcore™-3000 (BIAcore, Inc., Piscataway, N.J.) at 25°C by using surface plasma resonance analysis. Briefly, carboxymethylated dextran biosensor wafers (CM5, BIAcore Inc) were activated according to the supplier's instructions using N-ethyl-N'-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS). The antigen was diluted to 5 μg / ml (about 0.2 μM) with 110 mM sodium acetate pH 4.8, followed by injection at a flow rate of 5 μl / min to obtain a coupling protein of approximately 10 reaction units (RU). After antigen injection, 1M ethanolamine was injected to block unreacted groups. For kinetic measurements, a two-fold serial dilution of Fab (0.78 nM to 500 nM) was injected at 25°C at a flow rate of approximately 25 μl / min into PBS (PBST) containing 0.05% Tween 20. The association rate was calculated by simultaneously fitting the association and dissociation sensor maps (k) using a simple one-to-one Langmuir binding model (BIAcore evaluation software version 3.2). on ) and dissociation rate (k off ). If the association rate determined by the above surface plasma resonance analysis exceeds 10 6 M -1 S -1 , the association rate can be determined by increasing or decreasing fluorescent emission intensity (excitation = 295 nm; emission = 340 nm, 16 nm bandpass) at 25°C in the presence of an antigen with an increased concentration measured by a spectrometer (such as Aviv Instruments equipped with a flow-off device or the 8000 Series SLM-Aminco spectrophotometer with a stirred photolysis tank) using fluorescent emission intensity (excitation = 295 nm; emission = 340 nm, 16 nm bandpass) at 25°C. "Association Rate" or "k" of the present invention on ”The BIAcore™-2000 or BIAcore™-3000 (BIAcore, Inc., Piscataway, N.J.) as described above can also be used by the same surface plasma resonance technology described above. Methods and reagents suitable for determining the binding characteristics of antibodies or altered / mutant derivatives thereof of the invention (discussed below) are known and / or commercially available in the art (US Patent No. 6,849,425; No. 6,632,926; No. 6,294,391; No. 6,143,574). In addition, devices and software designed for such dynamic analysis are commercially available (e.g., Biacore ® A100 and Biacore ® 2000 Instruments; Biacore International AB, Uppsala, Sweden). In one embodiment, antibodies of the invention (including binding fragments or variants thereof) may also be described or specified in their binding affinity for influenza A virus polypeptides. Generally, the Kd of antibodies with high affinity is less than 10 -7 M. In one embodiment, the antibody or binding fragment thereof is less than or equal to 5×10 -7 M, 10 -7 M, 5×10 -8 M, 10 -8 M, 5×10 -9 M, 10 -9 M, 5×10 -10 M, 10 -10 M, 5×10 -11 M, 10 -11 M, 5×10 -12 M, 10 -12 M, 5×10 -13 M, 10 -13 M, 5×10 -14 M, 10 -14 M, 5×10 -15 M or 10 -15 The dissociation constant of M or Kd binds to influenza A polypeptide or fragments or variants thereof. Influenza A polypeptides may include HA polypeptides. In a more specific embodiment, the antibody or binding fragment thereof is less than or equal to 5×10 -10 M, 10 -10 M, 5×10 -11 M, 10 -11 M, 5×10 -12 M or 10 -12 The dissociation constant of M or Kd binds to influenza A polypeptide or fragments or variants thereof. The present invention encompasses antibodies that bind to influenza A polypeptides with dissociation constants or Kd in the range between any of the individual enumeration values. In another embodiment, the antibody or binding fragment of the invention is less than or equal to 5×10 -2 sec -1 , 10 -2 sec -1 , 5×10 -3 sec -1 Or 10 -3 sec -1 , 5×10 -4 sec -1 , 10 -4 sec -1 , 5×10 -5 sec -1 Or 10 -5 sec -1 , 5×10 -6 sec -1 , 10 -6 sec -1 , 5×10 -7 sec -1 Or 10 -7 sec -1 Dissociation rate (k off ) binds influenza A polypeptide or fragments or variants thereof. In a more specific embodiment, the antibody or binding fragment of the invention is less than or equal to 5×10 -4 sec -1 , 10 -4 sec -1 , 5×10 -5 sec -1 Or 10 -5 sec -1 , 5×10 -6 sec -1 , 10 -6 sec -1 , 5×10 -7 sec -1 Or 10 -7 sec -1 Dissociation rate (k off ) binds influenza A polypeptide or fragments or variants thereof. The present invention also covers the dissociation rate (k) in the range between any of the individual enumeration values ​​(k) off ) Antibodies that bind to influenza A polypeptide. In another embodiment, the antibody or binding fragment of the invention is greater than or equal to 10 3 M -1 sec -1 , 5×10 3 M -1 sec -1 , 10 4 M -1 sec -1 , 5×10 4 M -1 sec -1 , 10 5 M -1 sec -1 , 5×10 5 M -1 sec -1 , 10 6 M -1 sec-1, 5×10 6 M -1 sec -1 , 10 7 M -1 sec-1 or 5×10 7 M -1 sec -1 The association rate (k on ) binds influenza A polypeptide or fragments or variants thereof. In a more specific embodiment, the antibody or binding fragment of the invention is greater than or equal to 10 5 M -1 sec -1 , 5×10 5 M -1 sec -1 , 10 6 M -1 sec-1, 5×10 6 M -1 sec -1 , 10 7 M -1sec -1 Or 5×10 7 M -1 sec -1 The association rate (k on ) binds influenza A polypeptide or fragments or variants thereof. The present invention covers association rates (k) in the range between any of the individual enumeration values ​​(k) on ) Antibodies that bind to influenza A polypeptide. In one embodiment, the binding analysis can be performed directly in combination with the analysis or competition in combination with the analysis form. The detection can be performed using standard ELISA or standard flow cytometry analysis in combination. In direct binding assays, binding of candidate antibodies to their homologous antigens was tested. On the other hand, competitive binding assays evaluate the ability of candidate antibodies to compete with known antibodies or other compounds to bind to the influenza A virus HA stem. Generally, any method for detecting the binding of an antibody to an influenza A virus HA stem is encompassed within the scope of the invention for detecting and measuring the binding characteristics of an antibody. Those skilled in this art should recognize such well-known methods and will not be described in detail here. These methods are also used to screen a set of antibodies that provide the desired characteristics. The antibodies of the present invention immunospecifically bind to the influenza A virus HA stem and are able to neutralize influenza A virus infection. Neutralization analysis may be performed as described in the Examples section herein or using other methods known in the art. The term "inhibition concentration 50%" (abbreviated as "IC" 50 ”) indicates the concentration of the inhibitor (eg, antibodies of the present invention) required to neutralize influenza A virus 50%. Generally, those who are familiar with this technology should understand that the lower ICs are 50 The value is equivalent to a more effective inhibitor. In one embodiment, the neutralization efficacy of the antibodies or binding fragments thereof of the invention in micro-neutralization assays for neutralizing influenza A virus is expressed as a 50% inhibitory concentration (IC) of a range of about 0.01 μg / ml to about 50 μg / ml, or between about 0.01 μg / ml to about 5 μg / ml antibody, or between about 0.01 μg / ml to about 0.1 μg / ml antibody (IC) of about 50% inhibitory concentration (IC) of about 0.01 μg / ml to about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.01 μg / ml to about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.01 μg / ml to about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.01 μg / ml to about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.1 μg / ml antibody (IC) of about 0.01 μg / ml). 50 μg / ml). The maximum concentration of antibodies used for the trace neutralization assays described herein is 50 μg / ml. The high efficacy of the antibodies of the present invention means that the lower concentration of antibodies can be used to achieve 50% neutralization of influenza A virus. In certain embodiments, the antibodies of the invention can induce cell death. Antibodies that induce cell death are antibodies that turn live cells into inviolable cells. In vitro cell death can be determined in the absence of complement and immune effector cells to distinguish cell death induced by antibody-dependent cell-mediated cytotoxicity (ADCC) or complement-dependent cytotoxicity (CDC). Therefore, cell death analysis can be performed using heat-inactivated serum (ie, in the absence of complement) and in the absence of immune effector cells. To determine whether the antibody can induce cell death, the loss of membrane integrity can be assessed relative to untreated cells. The loss of membrane integrity is caused by propidium iodide (PI) and trypan blue (see Moore et al. Cytotechnology 17:1-11 (1995)) or absorption of 7AAD is evaluated. In one particular embodiment, the antibodies of the invention can induce cell death via apoptosis. Antibodies that induce apoptosis are antibodies that induce progressive cell death as determined by binding of phospholipid binding protein V, breaking of DNA, cell atrophy, expansion of endoplasmic reticulum, cell breakage and / or formation of membrane sacs (called apoptotic bodies). A variety of methods can be used to evaluate cellular events associated with apoptosis. For example, phosphatidyl filamentic acid (PS) translocation can be measured by phospholipid binding protein binding; DNA breakage can be assessed via DNA laddering; and nuclear / chromatin aggregation and DNA breakage can be assessed by any increase in subdiploid cells. Preferably, the antibody that induces apoptosis is an antibody that causes the induction of phospholipid binding protein binding in the phospholipid binding protein binding in the phospholipid binding protein binding is about 2 to 50 times, preferably about 5 to 50 times, and preferably about 10 to 50 times, relative to the untreated cells. In another particular embodiment, the antibodies of the invention may induce cell death via antibody-dependent cytotoxicity (ADCC) and / or complement-dependent cell-mediated cytotoxicity (CDC) and / or antibody-dependent cell-mediated phagocytosis (ADCP). The ADCC activity and CDC activity of human IgG1 subclass antibodies generally involve binding of the Fc region of the antibody to an antibody receptor present on the surface of an effector cell such as a killer cell, a natural killer cell or activated macrophage cell effector cell (hereinafter referred to as "FcγR"). Various complement components can be combined. Regarding binding, it has been shown that several amino acid residues in the hinge region and the second domain of the C region of the antibody (hereinafter referred to as the "Cγ2 domain") are important ( Eur. J. Immunol., 23, 1098 (1993), Immunology, 86, 319 (1995), Chemical Immunology, 65, 88 (1997)) and sugar chains in the Cγ2 domain ( Chemical Immunology, 65, 88 (1997)) is also important. To evaluate the ADCC activity of the antibody of interest, in vitro ADCC assays such as those described in US Patent No. 5,500,362 may be used. Analyses can also be performed using commercially available sets such as CytoTox 96® (Promega). Effector cells suitable for such assays include, but are not limited to, peripheral blood monocytes (PBMCs), natural killer (NK) cells and NK cell lines. Expressing transgenic gene Fc receptors (eg CD16) and related signaling polypeptides (eg FC) ε NK cell lines of RI-γ) can also act as effector cells (WO 2006 / 023148). For example, the ability of any particular antibody to mediate dissolution by complement activation and / or ADCC can be analyzed. The cells of interest are allowed to grow and label in vitro; antibodies are added to the cell culture in combination with immune cells activated by antigen-antibody complexes (i.e., effector cells participating in the ADCC reaction). Complement activation of antibodies can also be tested. In either case, cell lysis is detected by a marker released by autolytic cells. The degree of cell lysis can also be determined by detecting the release of cytoplasmic proteins (eg, LDH) into the serum layer. In fact, the patient's own serum can be used as a source of complement and / or immune cells to screen antibodies. Antibodies that can mediate human ADCC in in vitro tests can then be used in a therapeutic manner for a specific patient. The ADCC activity of the molecule of interest can also be evaluated in vivo, for example, in such et al. In animal models disclosed in Proc. Natl. Acad. Sci. (USA) 95:652-656 (1998). Furthermore, techniques for regulating (ie increasing or decreasing) the ADCC of antibodies and the CDC activity level as appropriate are well known in this art (eg, U.S. Patent No. 5,624,821; No. 6,194,551; No. 7,317,091). The antibodies of the invention may or may be modified to have the ability to induce ADCC and / or CDC. Analysis of the determination of ADCC function can be practiced using human effector cells to evaluate human ADCC function. Such assays may also include analysis intended to screen for antibodies that induce, mediate, enhance, and block cell death through necrosis and / or apoptosis mechanisms. Such methods include the use of feasible dye analysis, detection and analysis of Cass protease and the measurement of DNA breakage assays, which can be used to evaluate the apoptotic activity of cells cultured with the antibody of interest in vitro. Antibody Production The following description is used to produce illustrative techniques for the production of antibodies suitable for the present invention. Single antibody Single antibody can be prepared using a variety of techniques known in this technology, including the use of fusion tumors (Kohler et al., Nature, 256:495 (1975); Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd Edition 1988); Hammerling et al., Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981), recombinant and phage presentation techniques or combinations thereof. As used herein, the term "single antibody" refers to antibodies obtained from a population of substantially homologous antibodies or isolated antibodies, for example, individual antibodies containing the population are identical except for mutations that may be present in a minor amount. Single antibody is highly specific for single antigen sites. Furthermore, in contrast to multiple antibody preparations including different antibodies against different determinants (antigen determinants), each single antibody targets the same determinants on the antigen. In addition to its specificity, the advantage of single antibody is that it can be synthesized without contamination with other antibodies. The modifier "single strain" should not be understood as the need to produce antibodies by any particular method. The following is a description of a representative method for producing single antibodies, which are not intended to be limiting and can be used to produce, for example, single mammalian antibodies, chimeric antibodies, humanized antibodies, human antibodies, domain antibodies, bifunctional antibodies, vaccine bodies, linear antibodies and multispecific antibodies. Fusion tumor technology The method of using fusion tumor technology to generate and screen specific antibodies is conventional and well-known in this technology. In a fusion tumor method, mice or other suitable host animals (such as hamsters) are immunized as described above to generate lymphocytes that produce or are able to produce antibodies that will specifically bind to antigens for immunization. Alternatively, lymphocytes can be immunized in vitro. After immunization, lymphocytes are isolated and subsequently fused with myeloma cell lines using a suitable fusion agent or fusion partner such as polyethylene glycol to form fusion tumor cells (Goding, Monoclonal Antibodies:Principles and Practice, pp. 59-103 (Academic Press, 1986)). In certain embodiments, the selected myeloma cells are those myeloma cells that are highly fusion, support the stable and high content of the selected antibody-producing cells, and are sensitive to selective media selected against unfused parental cells. In one aspect, the myeloma cell line is a murine myeloma strain, such as a myeloma strain derived from MOPC-21 and MPC-11 mouse tumors available from Salk Institute Cell Distribution Center, San Diego, Calif. USA and SP-2 and derivatives (eg, X63-Ag8-653 cells) of American Type Culture Collection, Rockville, Md. USA. Human myeloma and mouse-human hybrid myeloma cell lines have also been described for the production of human single antibody (Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al., Monoclonal Antibody Production Techniques and Applications, pp. 51-63 (Marcel Dekker, Inc., New York, 1987)). Once fusion tumor cells producing antibodies with the desired specificity, affinity and / or activity are identified, pure lines can be colonized by restriction dilution procedures and grown by standard methods (Goding, supra). Mediums suitable for this purpose include, for example, D-MEM or RPMI-1640 medium. In addition, fusion tumor cells can grow in vivo in the form of ascites tumors in animals, for example by injecting cells into mice intraperitoneally. The sub-pure secreted single antibody is appropriately isolated from the culture medium, ascites or serum by conventional antibody purification procedures such as affinity chromatography (eg, using protein A or protein G-agarose) or ion exchange chromatography, affinity tags, hydroxyapatite chromatography, gel electrophoresis, dialysis, etc. An exemplary purification method is described in more detail below. Reorganization DNA Techniques for the use of recombinant DNA techniques to generate and screen specific antibodies are conventional and well known in this technique (eg, US Patent No. 4,816,567). DNA encoding a single antibody can be easily isolated and / or sequenced using conventional procedures (eg by using oligonucleotide probes that specifically bind to genes encoding heavy and light chains of murine antibodies). Once isolated, the DNA is placed in the expression vector and is then transfected into a host cell such as E. coli cells, simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not produce antibody proteins to synthesize a single antibody in the recombinant host cell. Comments on the recombinant performance of DNA encoding antibodies in bacteria include Skerra et al. Curr. Opinion in Immunol., 5:256-262 (1993) and Pluckthun, Immunol. Revs., 130:151-188 (1992). As described below with respect to antibodies produced by phages and humanized by antibodies, DNA or genetic material of recombinant antibodies can be obtained from sources other than fusion tumors to produce antibodies of the invention. Recombinant manifestations of antibodies or variants thereof generally require the construction of expression vectors containing polynucleotides encoding antibodies. Therefore, the present invention provides a replicable vector comprising a nucleotide sequence encoding an antibody molecule, a heavy or light chain of an antibody, a heavy or light chain variable region of an antibody or a portion thereof, or a heavy or light chain CDR of a heavy or light chain. Such vectors may include nucleotide sequences encoding a constant region of an antibody molecule (see, for example, US Patent Nos. 5,981,216; Nos. 5,591,639; Nos. 5,658,759 and Nos. 5,122,464), and the variable domains of the antibodies may be selected in such vectors for expressing the entire heavy chain, the entire light chain, or the entire heavy chain and the light chain. Once the expression vector is transferred to the host cell by conventional technology, the transfected cells are then cultured by conventional technology to produce antibodies. Therefore, the invention includes host cells that contain polynucleotides that encode antibodies or fragments thereof, or heavy or light chains thereof, or parts thereof, or single chain antibodies of the invention, operatively linked to a heterologous promoter. In certain embodiments that express a double-chain antibody, the vector encoding both the heavy and light chains may be co-expressed in the host cell to express the entire immunoglobulin molecule, as detailed below. Mammalian cell lines that can be used as hosts to exhibit recombinant antibodies are well known in this art and include a variety of immortalized cell lines available from the American Type Culture Collection (ATCC), including but not limited to Chinese hamster ovary (CHO) cells, HeLa cells, young hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (such as Hep G2), human epithelial kidney 293 cells and a variety of other cell lines. Different host cells have characteristics and specific mechanisms of post-translational processing and modification of proteins and gene products. The appropriate cell line or host system may be selected to ensure proper modification and processing of the displayed antibody or part thereof. For this purpose, eukaryotic host cells with cellular mechanisms for proper processing of primary transcripts, glycosylation and phosphorylation of gene products can be used. Such mammalian host cells include, but are not limited to, CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, W138, BT483, Hs578T, HTB2, BT2O and T47D, NS0 (murine myeloma cell lines that do not endogenously produce any functional immunoglobulin chains), SP20, CRL7O3O and HsS78Bst cells. Single antibodies can be recombinantly produced using human cell lines developed by immortalization of human lymphocytes. The human cell line PER.C6. (Crucell, Netherlands) can be used to recombinantly produce single antibody. Other cell lines that can be used as hosts to show recombinant antibodies include, but are not limited to, insect cells (eg, Sf21 / Sf9, squid moth ( Trichoplusia ni) Bti-Tn5b1-4) or yeast cells (such as Saccharomyces cerevisiae ( S. cerevisiae), Pichia genus ( Pichia), US 7326681; et al.), plant cells (US 20080066200); and chicken cells (WO 2008142124). In certain embodiments, the antibodies of the invention are manifested in cell lines that stably express the antibody. Stable performance can be used for long-term and high yield production of recombinant proteins. For example, cell lines that stably express antibody molecules can be generated. The host cell may be properly engineered to transform vectors including performance control elements (eg, promoters, enhancers, transcription terminators, polyadenylation sites, etc.) and selectable marker genes. After the introduction of foreign DNA, cells can be grown in proliferation medium for 1-2 days, and then transferred into selective medium. The optional markers in the recombinant plastids confer resistance to selection and allow cells to stably integrate the plastids into their chromosomes for growth and to form a region of variation that can be selected and amplified into cell lines in sequence. Methods for producing stable cell lines at high yields are well known in the art and reagents are generally commercially available. In certain embodiments, the antibodies of the invention are manifested in cell lines that transiently express the antibody. Transient transfection is a process in which the nucleic acid introduced into the cell is not integrated into the genome or chromosomal DNA of the cell. It is actually retained in the cell as an extrachromosomal element (eg, as a free gene body). The transcription process of the nucleic acid of the free genome is not affected and produces a protein encoded by the nucleic acid of the free genome. Stable or transiently transfected cell lines retain cell culture media and conditions well known in this technology, resulting in the manifestation and production of single antibody. In certain embodiments, the mammalian cell culture medium is based on a commercially available medium formulation, including, for example, DMEM or Ham's F12 (Ham's F12). In other embodiments, the cell culture medium is modified to support cell growth and increased bioprotein performance. As used herein, the terms "cell culture medium", "culture medium" and "media formulation" refer to nutrient solutions for cell maintenance, growth, proliferation or amplification in an artificially live extraviral environment outside of multicellular organisms or tissues. The cell culture medium may be optimized for use in a particular cell culture, including, for example, a cell culture growth medium formulated to promote cell growth, or a cell culture production medium formulated to promote recombinant protein production. The terms nutrients, ingredients and components may be used interchangeably herein to refer to the components that make up the cell culture medium. In one embodiment, the cell line is maintained using a feed batch method. As used herein, "feed batch method" refers to the method in which feed batch cell cultures are supplied with additional nutrients after first incubation with basal culture medium. For example, the feed batching method may include adding supplemental culture medium within a given time period according to the determined feed arrangement. Thus, "feed batch cell culture" refers to a cell culture in which cells (usually mammalian cells) and medium are initially supplied to the culture vessel and additional culture nutrients are fed to the culture continuously or in discrete increments during the culture, with or without periodic cells and / or product collection prior to termination of culture. The cell culture medium used and the nutrients contained therein are known to those skilled in this art. In one embodiment, the cell culture medium comprises a basal medium and at least one hydrolysate, such as a hydrolysate based on soybean, a hydrolysate based on yeast, or a combination of two types of hydrolysate, to produce an improved basal medium. In another embodiment, the additional nutrients may include basal medium only, such as concentrated basal medium, or may include hydrolysate only or concentrated hydrolysate. Suitable basal media include, but are not limited to, Dulbecco's Modified Eagle's Medium; DMEM, DME / F12, Minimum Essential Media (MEM), Basal Media Eagle (BME), RPMI 1640, F-10, F-12, alpha-minimum Essential Media (α-MEM), Glasgow's Minimum Essential Media (G-MEM), PF CHO (see, for example, EX-CELL™ 325 PF CHO serum-free medium (SAFC Bioscience), and Iscove's Modified Dulbecco's Medium. Other examples of basal medium that can be used in the present invention include BME basal medium (Gibco-Invitrogen; see also Eagle, H (1965) Proc. Soc. Exp. Biol. Med. 89, 36); Dalbecco-Invitrogen (# 31600); see also Dulbecco and Freeman (1959) Virology 8, 396; Smith et al. (1960) Virology 12, 185. Tissue Culture Standards Committee, In Vitro 6:2, 93); CMRL 1066 medium (Gibco-Invitrogen (#11530); see also Parker R. C. et al. (1957) Special Publications, N.Y. Academy of Sciences, 5, 303). The basal medium may be serum-free, meaning that the medium does not contain serum (such as fetal bovine serum (FBS), horse serum, goat serum or serum from any other animal known to those skilled in the art) or no animal protein medium or chemical limit medium. The basal medium may be modified to remove certain non-nutritional components found in standard basal medium, such as various inorganic and organic buffers, surfactants and sodium chloride. Removal of such components from the basal cell medium increases the concentration of the remaining nutrient components, and can improve total cell growth and protein performance. In addition, the omitted components may be added back to the cell culture medium containing the modified basal cell culture medium according to the requirements of cell culture conditions. In certain embodiments, the cell culture medium contains at least one of the following nutrients: iron source, recombinant growth factor; buffers; surfactants; volume permeability concentration regulator; energy; and non-animal hydrolysate. In addition, the modified basal cell culture medium may contain an amino acid, vitamin or a combination of amino acids and vitamins, depending on the situation. In another embodiment, the modified basal medium further contains glutamide, such as L-glutamide, and / or methylaminetrexate. Antibody production can be carried out in large quantities by using bioreactor processes using feed batch, batch, perfusion or continuous feed bioreactor methods known in the art. Large-scale bioreactors have a capacity of at least 1000 liters, preferably about 1,000 to 100,000 liters. Such bioreactors can use a stirrer impeller to distribute oxygen and nutrients. Small scale bioreactors generally refer to culturing cells in a volume capacity of no more than about 100 liters and may range from about 1 liter to about 100 liters. Alternatively, a single-use bioreactor (SUB) can be used for large-scale or small-scale cultures. Temperature, pH, agitation, aeration and seeding density will vary depending on the host cell used and the recombinant protein to be expressed. For example, recombinant protein cell cultures may be maintained at a temperature of 30°C to 45°C. The pH of the medium can be monitored during the culture process so that the pH is maintained at an optimal level, which for some host cells is within the pH range of 6.0 to 8.0. The drive mixing impeller can be used for agitation in such culture methods. The rotational speed of the impeller may be about 50 to 200 cm / sec blade tip speed, but other air lift or other mixing / inflating systems known in the art may still be used, depending on the type of host cell cultured. Provide sufficient inflatration to maintain dissolved oxygen concentrations of about 20% to 80% air saturated in the culture, also depending on the selected host cell cultured. Alternatively, the bioreactor may inject air or oxygen directly into the culture medium. Other oxygen supply methods exist, including bubble-free inflation systems using hollow fiber membrane inflators. Phage presentation technology Single antibody or antibody fragment can be used by McCafferty et al. Nature, 348:552-554 (1990). Clackson et al., Nature, 352:624-628 (1991) and Marks et al. J. Mol. Isolation from the antibody phage library generated by the technique described in Biol., 222:581-597 (1991). In such methods, antibodies can be isolated by screening using recombinant combinatorial antibody library (preferably scFv phage presentation library) prepared from human VL and VH cDNA prepared from mRNA derived from human lymphocytes. Methodology for preparing and screening such libraries is known in this art. In addition to commercially available sets (eg Pharmacia recombinant phage antibody system, Catalog No. 27-9400-01 for the generation of phage presentation libraries; and Stratagene SurfZAP TM In addition to phage presentation sets, catalog number 240612), examples of methods and reagents particularly suitable for the generation and screening of antibody presentation libraries can be found in, for example, US Patent No. 6,248,516; US Patent No. 6,545,142; 6,291,158; 6,291,159; 6,291,160; 6,291,161; 6,680,192; 5,969,108; 6,172,197; 6,806,079; 5,885,793; 6,521,404; 6,544,731; 6,555,313; 6,593,081; 6,582,915; 7,195,866. Therefore, these techniques are a feasible alternative to the traditional single-short antibody fusion tumor technique for generating and isolating single-short antibodies. In a phage presentation method, the functional antibody domain is presented on the surface of a phage particle with a polynucleotide sequence encoding it. In one particular embodiment, such phages may be employed to present antigen-binding domains expressed by lineage or combinatorial antibody libraries (eg, human or murine). Antigens, such as labeled antigens or antigens bound to or captured on solid surfaces or beads, may be used to select or identify phages that exhibit antigen binding domains that bind to the antigen of interest. The phages used in these methods are usually filamentous phages, which include fd and M13 binding domains manifested by the Fv antibody domain stabilized by Fab, Fv or disulfide and the phage gene III or VIII protein recombinantly fused with the phage gene III or VIII protein. As described in the above references, after phage selection, the antibody coding region may be isolated by the bacteriophage and used to produce a full antibody including human antibodies, humanized antibodies or any other desired antigen binding fragments, and, for example, described in detail below, manifest in any desired host including mammalian cells, insect cells, plant cells, yeasts and bacteria. For example, techniques for recombinant production of Fab, Fab' and F(ab')2 fragments may also be employed using methods known in the art, such as those disclosed in PCT Publication WO 92 / 22324; Mullinax et al., BioTechniques 12(6):864-869 (1992); and Better et al., Science 240:1041-1043 (1988). Examples of techniques useful in the production of single-chain Fv and antibodies include those described in US Patent Nos. 4,946,778 and 5,258,498. Therefore, the above-mentioned techniques and techniques well known in this technique can be used to produce recombinant antibodies isolated from binding domain autophage presentation library of ScFv, for example. Antibody purification and isolation Once the antibody molecule has been produced by recombinant or fusion tumor manifestations, it can be purified by any method known in the art for purification of immunoglobulin molecules, for example by chromatography (eg ion exchange; affinity, especially by affinity of specific antigen protein A or protein G; and sieve column chromatography), centrifugation, differential solubility or by any other standard techniques for purifying proteins. Additionally, antibodies or fragments thereof of the invention may be fused to a heterologous polypeptide sequence (referred to herein as "tag") to facilitate purification. When recombinant techniques are used, antibodies can be produced in the cells, in the periplasmic space or are secreted directly into the culture medium. If the antibody is produced in the cell, as a first step, for example, by centrifugation or ultrafiltration, the microparticle fragments of the host cell or lysed fragments are removed. Carter et al. Bio / Technology 10:163-167 (1992) describes the procedure for isolating antibodies secreted into the periplasmic gap of E. coli. In the case of secretion of antibodies into the culture medium, the clear layer of such manifestation systems is usually first concentrated using a commercially available protein concentration filter (eg, Amicon or Millipore Pellicon ultrafiltration unit). In any previous step, a protease inhibitor such as PMSF may be included to inhibit proteolysis, and an antibiotic may be included to prevent the growth of foreign contaminants. Antibody compositions prepared from cells can be purified using either alone or in combination with other purification steps, such as hydroxyapatite chromatography, hydrophobic interaction chromatography, ion exchange chromatography, gel electrophoresis, dialysis and / or affinity chromatography. The suitability of protein A as an affinity ligand depends on the type and isotype of any immunoglobulin Fc domain present in the antibody and should be understood by those skilled in this art. Matrixes that attach affinity ligands are most often agarose, but other matrixes are available. Mechanical stability matrix such as controlled microporous glass or poly(styrene divinyl)benzene has faster flow rates and shorter processing times than flow rates and treatment times that can be achieved with agarose. When the antibody contains CH 3 Bakerbond ABX resin (J.T. Baker, Phillipsburg, NJ) is suitable for purification in the domain. Other techniques for protein purification can also be used depending on the recovery of antibodies, such as ion exchange column fractionation, ethanol precipitation, reverse phase HPLC, silica chromatography, heparin chromatography, anionic or cation exchange resins (such as polyasparacic acid columns) SEPHAROSE™ chromatography, chromatography focusing, SDS-PAGE and ammonium sulfate precipitation. Following any preliminary purification step, a mixture containing the antibody and contaminant of interest may be subjected to a low pH hydrophobic interaction chromatography using a dissolution buffer between pH between about 2.5 and 4.5, preferably at a low salt concentration (eg, about 0-0.25 M salt). Thus, in certain embodiments, substantially purified / isolated antibodies of the invention are provided. In one embodiment, such isolated / purified recombinant antibodies can be administered to the patient to mediate prophylactic or therapeutic effects. Preventive agents are drugs or therapeutic agents designed and used to prevent the occurrence of diseases, conditions or infections. The therapeutic agent is specifically associated with treatment of a specific disease, condition or infection. The therapeutic dose is the amount required to treat a specific disease, condition or infection. In another embodiment, such isolated / purified antibodies can be used to diagnose influenza A virus infection. Human Antibodies Human antibodies can be produced using methods well-known in the art. Human antibodies avoid some problems associated with antibodies with variable and / or constant regions of mice or rats. The presence of such proteins derived from mice or rats can quickly clear the antibody or cause the patient to develop an immune response against the antibody. Human antibodies can be obtained in vitro methods. Suitable examples include, but are not limited to, bacteriophage presentation (MedImmune (previous CAT), Morphosys, Dyax, Biosite / Medarex, Xoma, Symphogen, Alexion (previous Proliferon), Affimed), ribosome presentation (MedImmune (previous CAT), yeast presentation and the like. Phage presentation techniques (see, for example, US Patent No. 5,969,108) can be used to produce human antibodies and antibody fragments in vitro from immunoglobulin variable (V) domain gene lineages of unimmune donors. According to this technique, the antibody V domain gene is selected in the same frame into the primary or secondary sheath protein gene of a filamentous phage (such as M13 or fd), and present on the surface of the phage particles in the form of a functional antibody fragment. Since filamentous particles contain a single strand of DNA replica of the phage genome, the selection based on the functional properties of the antibodies also enables the selection of genes encoding antibodies that display their characteristics. Therefore, bacteriophage simulates some characteristics of B cells. Phage presentation may be performed in various formats, which are reviewed, for example, Johnson, Kevin S. and Chiswell, David J., Current Opinion in Structural Biology3:564-571 (1993). Phage presentation may use several V gene segment sources. Clackson et al. Nature, 352:624-628 (1991) A diversified array of antioxazolone antibodies was isolated from a random combination of V genes derived from spleens of immune mice. Antibodies that can construct a lineage of V genes of unimmunized human donors and target arrays of diversity antigens (including autoantigens) can be basically as follows by Marks et al. J. Mol. Biol. 222:581-597 (1991) or Griffith et al. EMBO J.12:725-734 (1993) to separate the techniques. See also U.S. Patent Nos. 5,565,332 and 5,573,905. As discussed above, human antibodies can also be produced by in vitro activated B cells (see US Patent Nos. 5,567,610 and 5,229,275). Immunoglobulin genes undergo various modifications during the maturation of the immune response, including recombination between V, D and J gene segments, homotyping and hypermutation in variable regions. Recombinant and somatic hypermutation are the basis for the production of antibody diversity and affinity maturity, but it can also produce sequence tendencies that can make commercial production of such immunoglobulins as therapeutic agents difficult or increase the risk of antibody immunogenicity. Generally, mutations in the CDR region may help improve affinity and function, while mutations in the framework region may increase the risk of immunogenicity. This risk can be reduced by restoring the framework mutation to the germline while ensuring that antibody activity is not adversely affected. Diversification methods can also produce some structural tendencies or such structural tendencies can exist within the germline sequence to contribute to heavy and light chain variable domains. Independent of the source, it may be necessary to remove possible structural tendencies that can lead to increased instability, coagulation, product heterogeneity, or immunogenicity. Examples of undesirable tendencies include unpaired cysteines (which may cause disulfide bond scrambling or variable sulfhydryl adduct formation), N-linked glycosylation sites (generating heterogeneity of structure and activity), and deamides (eg, NG, NS), isomerization (DG), oxidation (exposed methiamine), and hydrolyzed (DP) sites. Therefore, to reduce the risk of immunogenicity and improve medical characteristics, it may be necessary to restore the framework sequence to the germline, restore the CDR to the germline and / or remove the structural tendency. Thus, in one embodiment, when the particular antibody differs from its corresponding germline sequence at the amino acid level, the antibody sequence may be mutated back to the germline sequence. Such modified mutations can be made to occur at positions one, two, three or three or any combination of mutated positions using standard molecular biotechnology. Antibody fragments In certain embodiments, the antibody of the invention is an antibody fragment or an antibody containing such fragments. Antibody fragments occupy part of the full-length antibody and are generally their antigen-binding region or variable region. Examples of antibody fragments include Fab, Fab', F(ab') 2 and Fv clips. Bifunctional antibody; linear antibody (US Patent No. 5,641,870) and single-chain antibody molecules. Traditionally, such fragments are obtained by proteolyzing intact antibodies using techniques well-known in the art. However, such fragments can now be produced directly by recombinant host cells. Fab, Fv and scFv antibody fragments are all manifested in E. coli and are secreted from E. coli, so a large number of such fragments are easily generated. In one embodiment, the antibody fragment may be isolated from the antibody phage library discussed above. Alternatively, Fab'-SH fragments can be recovered directly from E. coli and chemically coupled to form F(ab') 2 Fragments (Carter et al., Bio / Technology, 10:163-167 (1992)). According to another method, F(ab') 2 The fragments can be isolated directly from recombinant host cell cultures. Other techniques for producing antibody fragments will be apparent to those skilled in this art. In other embodiments, the selected antibody is a single-stranded Fv fragment (scFv). In certain embodiments, the antibody is not a Fab fragment. Fv and scFv are the only species with complete combination sites without a constant region; therefore, they are suitable for reduced nonspecific binding during use in vivo. The scFv fusion protein can be constructed to produce a fusion of the effector protein at the amine or carboxy terminus of the scFv. In certain embodiments, the antibodies of the invention are domain antibodies, such as antibodies containing small functional binding units of the antibody, corresponding to variable regions of heavy chains (VH) or light chains (VL) of human antibodies. Examples of domain antibodies include, but are not limited to, those domain antibodies of Domantis (see, for example, WO04 / 058821; WO04 / 081026; WO04 / 003019; WO03 / 002609; U.S. Patent No. 6,291,158; No. 6,582,915; No. 6,696,245; and No. 6,593,081). In certain embodiments of the invention, the antibodies of the invention are linear antibodies. "Line antibody" comprises a pair of tandem Fd segments (VH-CH1-VH-CH1) which form a pair of antigen binding regions. See Zapata et al. Protein Eng., 8(10):1057-1062 (1995). Other amino acid sequence modifications In addition to the above-mentioned human, humanized and / or chimeric antibodies, the present invention also covers other modifications and variants and fragments of the antibodies of the present invention, including one or more amino acid residues and / or polypeptides in the variable light chain (VL) domain and / or variable heavy chain (VH) domain and / or Fc region substitution, addition and / or deletion and post-translational modifications. In such modifications are antibody conjugates, wherein the antibody has been covalently attached to the moiety. Molecules suitable for attachment to antibodies include, but are not limited to, proteins, peptides, drugs, labels, and cytotoxins. Such changes may be made to the antibody to alter or fine-tune the characteristics (biochemistry, binding and / or function) of antibodies that are themselves suitable for the treatment and / or diagnosis of influenza A infection. Methods for forming conjugates, performing alterations of amino acids and / or polypeptides, and post-translational modifications are well known in the art, some of which are described in detail below. The amino acid changes of the antibody must result in the sequence being less than 100% consistent with the above identified antibody sequence or parent antibody sequence. In certain embodiments, in this case, the antibodies mostly have sequence identity of about 25% to about 95% to about 95% of the amino acid sequence of the heavy or light chain variable domain of the antibody as described herein. Thus, in one embodiment, the modified antibody may have an amino acid sequence that has at least 25%, 35%, 45%, 55%, 65%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity or similarity to the amino acid sequence of the heavy or light chain variable domain of the antibody as described herein. In another embodiment, the modified antibody may have an amino acid sequence that has at least 25%, 35%, 45%, 55%, 65%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity or similarity to the amino acid sequence of the heavy or light chain CDR1, CDR2, or CDR3 of the antibody as described herein. In another embodiment, the modified antibody may have an amino acid sequence that has at least 25%, 35%, 45%, 55%, 65%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity or similarity to the amino acid sequence of the heavy or light chain FR1, FR2, FR3, or FR4 of the antibody as described herein. In certain embodiments, the altered anti-system is generated by introducing one or more amino acid changes (eg, substitution, deletion and / or addition) into one or more variable regions of the antibody. In another embodiment, the amino acid changes are introduced into the framework region. Changes to one or more framework residues may lead to improved binding affinity of the antibody against antigen. This may be particularly true when such changes are made to humanized antibodies that may be from species different from those of the CDR region. Examples of framework region residues to be modified include framework region residues that directly non-covalently bind antigens (Amit et al., Science, 233:747-753 (1986)); framework region residues that interact with / influence CDR configuration (Chothia et al., J. Mol. Biol., 196:901-917 (1987)); and / or framework region residues involved in VL-VH interfaces (U.S. Patent Nos. 5,225,539 and 6,548,640). In one embodiment, about one to about five framework residues may be varied. Sometimes, even without the hypervariable region residues have been changed, this may be sufficient to produce antibody mutants suitable for preclinical testing. However, the altered antibody should normally contain additional hypervariable region changes. A procedure suitable for the production of altered antibodies is called "Cunningham and Wells", Science, 244:1081-1085 (1989)). In this method, one or more hypervariable region residues are replaced by alanine or polyacrylate residues to alter the interaction of the amino acid with the target antigen. The hypervariable region residues that show functional sensitivity to substitution are then improved by introducing additional or other mutations at or against substitution sites. Therefore, although the site where the amino acid sequence variant is introduced is predetermined, the nature of the mutation itself does not need to be predetermined. Alelanine mutants produced in this manner are screened for biological activity as described herein. In certain embodiments, the substituted variant involves substitution of one or more hypervariable region residues of the parent antibody (eg, humanized or human antibody). Generally, the resulting variant selected for further development should have improved biological properties relative to the parent antibody that produces it. The convenient way to produce such substituted variants involves the maturation of affinity using phages (Hawkins et al., J. Mol. Biol., 254:889-896 (1992) and Lowman et al. Biochemistry, 30(45):10832-10837 (1991)). In short, several hypervariable region sites (eg, 6-7 sites) are mutated, and all possible amino acid substitutions are generated at each site. When fused to the gene III product of M13 encapsulated in each particle, the resulting antibody mutant appears in a monovalent manner from the filamentous phage particles. Then, as disclosed herein, mutants presented by bacteriophages are screened for their biological activity (eg, binding affinity). Mutations in an antibody sequence may include substitutions, deletions (including internal deletions), additions (including additions to produce fusion proteins), or retained substitutions of amino acid residues within and / or adjacent amino acid sequences, but retained substitutions lead to "silent" changes because the change produces functionally equivalent antibodies. "Retained" amino acid substitution may be performed on the basis of similar polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphoteric properties of the residues involved. For example, non-polar (hydrophobic) amino acids include acetic acid, leucine, isochloric acid, valine, proline, acetyleucine, tryptic acid and methiamine; polar neutral amino acids include glycine, seric acid, threonic acid, cysteine, tyrosine, asparagine and glutamic acid; positively charged (base) amino acids include spermic acid, lyamic acid and histamine; and negatively charged (acidic) amino acids include asparagine and glutamic acid. In addition, glycine and proline are residues that can affect chain orientation. Non-reserved substitutions are bound to be accompanied by exchanges between one of the members of one of these categories and one of the members of the other category. Furthermore, non-classical amino acids or chemical amino acid analogs may be introduced into the antibody sequence in substituted or added form, if necessary. Non-classical amino acids include, but are not limited to, D-isomers of common amino acids, alpha-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, gamma-Abu, ε-Ahx, 6-aminohexanoic acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, orchidine, orthoylamine, orvalanic acid, hydroxyproline, saric acid, citrul acid, oxidized cysteine, third butylglycylamine, phenylglycylamine, cyclohexylparinic acid, β-parinic acid, fluoro-amino acid, design amino acids such as beta-methylamine acid, Cα-methylamine acid, Nα-methylamine acid and general amino acid analogs. In another embodiment, any cysteine ​​residues not involved in maintaining the proper configuration of the antibody may also be generally substituted with seric acid to improve the oxidative stability of the molecule and to prevent abnormal crosslinking. Conversely, cysteine ​​bonds may be added to the antibody to improve its stability (especially if the antibody is an antibody fragment such as an Fv fragment). Mutations Fc Regions: variants of the Fc region (eg, amino acid substitution and / or addition and / or deletion) enhance or weaken the effect function of the antibody (see, for example, US Patent No. 5,624,821; No. 5,885,573; No. 6,538,124; No. 7,317,091; No. 5,648,260; No. 6,538,124; WO 03 / 074679; WO 04 / 029207; WO 04 / 099249; WO 99 / 58572; U.S. Publication No. 2006 / 0134105; 2004 / 0132101; 2006 / 0008883), and can alter the drug metabolic kinetic properties (eg, half-life) of the antibody (see U.S. Patent Nos. 6,277,375 and 7,083,784). Thus, in certain embodiments, the antibodies of the invention comprise altered Fc regions (also referred to herein as "mutated Fc regions"), wherein one or more changes have been made in the Fc region to alter the functional properties and / or pharmacokinetic properties of the antibody. Such alterations may lead to a decrease or increase in Clq binding and complement-dependent cytotoxicity (CDC) or FcγR binding of IgG, as well as a decrease or increase in antibody-dependent cytotoxicity (ADCC) or antibody-dependent cell-mediated phagocytosis (ADCP). The present invention encompasses antibodies described herein with variant Fc regions, wherein variations have been made to fine-tune (enhance or weaken) the effect function to provide the desired effect function. Therefore, the antibodies of the present invention contain a variant Fc region (ie, a modified Fc region that has been discussed below). The antibodies of the present invention containing the variant Fc region are also referred to herein as "Fc variant antibodies". As used herein, nature refers to an antibody that has an unmodified parental sequence and contains a natural Fc region, which is referred to herein as "natural Fc antibody". Fc variant antibodies can be produced by a number of methods well known to those skilled in the art. Non-limiting examples include isolating an antibody coding region (eg from a fusion tumor) and performing one or more desired substitutions in the Fc region of the isolated antibody coding region. Alternatively, the antigen-binding portion (eg, a variable region) of the antibody may be selected into a vector encoding a variant Fc region. In one embodiment, the variant Fc region exhibits a similar level of elicited effect function compared to the native Fc region. In another embodiment, the variant Fc region exhibits a higher eliciting effect function than the native Fc. Some specific embodiments of the variant Fc region are described in detail below. Methods for measuring effect functions are well known in this art. The effect function of the antibody is modified by changes in the Fc region, including, but not limited to, changes in amino acid substitution, amino acid addition, amino acid deletion and post-translational modification (eg, glycosylation) of Fc amino acids. The methods described below can be used to fine-tune the ratio of the effect function of the antibodies of the invention and the binding properties (eg, affinity and specificity) of the Fc region to FcR to produce therapeutic antibodies with the desired properties. It should be understood that the Fc region as used herein includes a polypeptide comprising an antibody constant region (excluding the first constant region immunoglobulin domain). Therefore, Fc refers to the last two constant region immunoglobulin domains of IgA, IgD and IgG, the last three constant region immunoglobulin domains of IgE and IgM, and the flexible hinge from the N-terminus to these domains. For IgA and IgM, Fc may include a J-chain. For IgG, Fc contains the immunoglobulin domains Cγ2 and Cγ3 and the hinge between Cγ1 and Cγ2. Although the boundaries of the Fc region can be changed, the human IgG heavy chain Fc region is usually defined to contain residues C226 or P230 relative to its carboxy terminus, with the numbering according to the EU index as set forth by Kabat. Fc may refer to this region alone or in the case of an antibody, an antibody fragment or an Fc fusion protein. Polymorphisms have been observed at many different Fc locations, including, but not limited to, positions 270, 272, 312, 315, 356, and 358 as numbered by the EU index, and therefore there may be a slight difference between the proposed sequence and the sequences in the previous art. In one embodiment, the Fc variant antibody exhibits a binding affinity change to one or more Fc receptors compared with the native Fc antibody, including, but not limited to, FcRn, FcγRI (CD64, including the isoforms FcγRIA, FcγRIB and FcγRIC); FcγRII (CD32, including the isoforms FcγRIIA, FcγRIIB and FcγRIIC); and FcγRIII (CD16, including the isoforms FcγRIIIA and FcγRIIIB). In one embodiment, the Fc variant antibody binds to one or more Fc ligands relative to the native Fc antibody. In another embodiment, the Fc variant antibody more or less exhibits an increase or decrease in affinity for the Fc ligand by at least 2 times, or at least 3 times, or at least 5 times, or at least 7 times, or at least 10 times, or at least 20 times, or at least 30 times, or at least 40 times, or at least 50 times, or at least 60 times, or at least 70 times, or at least 80 times, or at least 90 times, or at least 100 times, or at least 200 times, or at least 200 times, or 5 times to 50 times, or 25 times to 100 times, or 75 times to 200 times, or 100 times to 200 times, or 100 times to 200 times. In another embodiment, the Fc variant antibody more or less exhibits affinity for the Fc ligand compared with the native Fc antibody of at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5%. In certain embodiments, the Fc variant antibody has an affinity for the Fc ligand. In other embodiments, the affinity of the Fc variant antibody to the Fc ligand is reduced. In one particular embodiment, the binding of the Fc variant antibody to the Fc receptor FcγRIIIA is enhanced. In another particular embodiment, the binding of the Fc variant antibody to the Fc receptor FcγRIIB is enhanced. In another particular embodiment, the binding of the Fc variant antibody to both the Fc receptors FcγRIIIA and FcγRIIB is enhanced. In certain embodiments, the Fc variant antibody that enhances binding to FcγRIIIA has no concomitant increase in binding to the FcγRIIB receptor compared to the native Fc antibody. In one particular embodiment, the binding of the Fc variant antibody to the Fc receptor FcγRIIIA is reduced. In another particular embodiment, the binding of the Fc variant antibody to the Fc receptor FcγRIIB is reduced. In another particular embodiment, the Fc variant antibody that exhibits an affinity altered to FcγRIIIA and / or FcγRIIB is enhanced to the Fc receptor FcRn. In another particular embodiment, the Fc variant antibody that exhibits an affinity change for FcγRIIIA and / or FcγRIIB is altered relative to the native Fc antibody binding to C1q. In one embodiment, the Fc variant antibody more or less exhibits affinity for the FcγRIIIA receptor of at least 2 times, or at least 3 times, or at least 5 times, or at least 7 times, or at least 10 times, or at least 20 times, or at least 30 times, or at least 40 times, or at least 50 times, or at least 60 times, or at least 70 times, or at least 80 times, or at least 90 times, or at least 100 times, or at least 200 times, or 2 times to 10 times, or 5 times to 50 times, or 25 times to 100 times, or 75 times to 200 times, or 100 times to 200 times, or 100 times to 200 times. In another embodiment, the Fc variant antibody exhibits more or less affinity for FcγRIIIA compared to the native Fc antibody of at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5%. In one embodiment, the Fc variant antibody more or less exhibits affinity for the FcγRIIB receptor of at least 2 times, or at least 3 times, or at least 5 times, or at least 7 times, or at least 10 times, or at least 20 times, or at least 30 times, or at least 40 times, or at least 50 times, or at least 60 times, or at least 70 times, or at least 80 times, or at least 90 times, or at least 100 times, or at least 200 times, or 2 times to 10 times, or 5 times to 50 times, or 25 times to 100 times, or 75 times to 200 times, or 100 times to 200 times, or 100 times to 200 times. In another embodiment, the Fc variant antibody exhibits more or less affinity for FcγRIIB compared to the native Fc antibody of at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5%. In one embodiment, the Fc variant antibody exhibits an increased or decreased affinity for C1q relative to the native Fc antibody. In another embodiment, the Fc variant antibody more or less exhibits affinity for the C1q receptor of at least 2 times, or at least 3 times, or at least 5 times, or at least 7 times, or at least 10 times, or at least 20 times, or at least 30 times, or at least 40 times, or at least 50 times, or at least 60 times, or at least 70 times, or at least 80 times, or at least 90 times, or at least 100 times, or at least 200 times, or 2 times to 10 times, or 5 times to 50 times, or 25 times to 100 times, or 75 times to 200 times, or 100 times to 200 times, or 100 times to 200 times. In another embodiment, the Fc variant antibody exhibits more or less affinity for C1q compared to the native Fc antibody of at least 90%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5%. In another particular embodiment, the binding of the Fc variant antibody that exhibits altered affinity for Ciq is enhanced to the Fc receptor FcRn. In another particular embodiment, the Fc variant antibody that exhibits an affinity change for C1q is altered in binding to FcγRIIIA and / or FcγRIIB relative to the native Fc antibody. Antibodies can guide attack and destroy through multiple processes collectively referred to in this technology as antibody effect function are well known in this technology. One of these processes is called "antibody-dependent cell-mediated cytotoxicity" or "ADCC", which refers to the cytotoxic form of the cell-toxin receptor (FcR) that binds to certain cytotoxin cells (such as natural killer (NK) cells, neutrophils and macrophages) that enables such cytotoxin effector cells to specifically bind to cells carrying antigens and subsequently kill the cells with cytotoxins. Specific high affinity IgG antibodies are directed to the surface of the cell "group" of cytotoxin cells and are required for such killing. Cells dissolve extracellularly, requiring direct cell-to-cell contact without involving complement. Another process covered by the term effect function is complement-dependent cytotoxicity (hereinafter referred to as "CDC"), which refers to a biochemical event that destroys cells through the complement system. The complement system is a complex protein system found in normal plasma, which is combined with antibodies to destroy pathogens and other foreign cells. Another process encompassed by the term effector function is antibody-dependent cell-mediated phagocytosis (ADCP), which refers to a cell-mediated response in which nonspecific cytotoxin cells exhibiting one or more effector ligands recognize antibodies bound to the cell and subsequently cause phagocytosis of the cell. It is expected that Fc variant antibodies are characterized by in vitro functional analysis used to determine one or more FcγR-mediated effector cell functions. In certain embodiments, the Fc variant antibody has similar binding properties and effector cell functions in an in vivo model such as those described and disclosed herein as those based on in vivo analysis. However, the present invention does not exclude Fc variant antibodies that do not exhibit the desired phenotype in vitro analysis but exhibit the desired phenotype in vivo. In certain embodiments, the antibody comprising an Fc variant has enhanced cytotoxic or phagocytic activity (eg, ADCC, CDC, and ADCP) relative to the antibody comprising a native Fc region. In one particular embodiment, the Fc variant antibody has a cytotoxic or phagocytic activity that is at least 2 times, or at least 3 times, or at least 5 times, or at least 10 times, or at least 50 times, or at least 100 times, or at least 200 times, or 2 times to 10 times, or 5 times to 50 times, or 25 times to 100 times, or 75 times to 200 times, or 100 times to 200 times, or 100 times to 200 times, or 100 times to 200 times. Alternatively, Fc variant antibodies have reduced cytotoxic or phagocytic activity relative to native Fc antibodies. In one particular embodiment, the Fc variant antibody has a cytotoxic or phagocytic activity at least 2 times, or at least 3 times, or at least 5 times, or at least 10 times, or at least 50 times, or at least 100 times, or at least 200 times, or 2 times to 10 times, or 5 times to 50 times, or 25 times to 100 times, or 75 times to 200 times, or 100 times to 200 times, or 100 times to 200 times, or 100 times to 200 times, or 100 times to 200 times, or 200 times. In certain embodiments, the Fc variant antibody exhibits reduced ADCC activity compared to the native Fc antibody. In another embodiment, the Fc variant antibody exhibits an ADCC activity at least 2 times, or at least 3 times, or at least 5 times, or at least 10 times, or at least 50 times, or at least 100 times, or at least 200 times, or 2 times to 10 times, or 5 times to 50 times, or 25 times to 100 times, or 75 times to 200 times, or 100 times to 200 times, or 100 times to 200 times, or 100 times to 200 times, or 100 times to 200 times, or 200 times.In another embodiment, the Fc variant antibody exhibits a reduced ADCC activity of at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 100%, or at least 200%, or at least 300%, or at least 400%, or at least 500% ADCC activity relative to the native Fc antibody. In certain embodiments, the Fc variant antibody does not have detectable ADCC activity. In certain embodiments, the decrease and / or attenuation of ADCC activity can be attributed to the reduced affinity of the Fc variant antibody to the Fc ligand and / or receptor. In an alternative embodiment, the Fc variant antibody exhibits increased ADCC activity compared to the native Fc antibody. In another embodiment, the Fc variant antibody exhibits ADCC activity at least 2 times, or at least 3 times, or at least 5 times, or at least 10 times, or at least 50 times, or at least 100 times greater than the native Fc antibody. In another embodiment, the Fc variant antibody exhibits an increase of at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 100%, or at least 200%, or at least 300%, or at least 400%, or at least 500% ADCC activity relative to the native Fc antibody. In certain embodiments, the increased ADCC activity may be attributed to an increased affinity of the Fc variant antibody to the Fc ligand and / or receptor. In one particular embodiment, the Fc variant antibody binds to the Fc receptor FcγRIIIA with respect to the native Fc antibody and has enhanced ADCC activity. In other embodiments, the Fc variant antibody has enhanced ADCC activity and increased serum half-life relative to the native Fc antibody. In another particular embodiment, the Fc variant antibody binds to the Fc receptor FcγRIIIA with respect to the native Fc antibody and has reduced ADCC activity. In other embodiments, the Fc variant antibody has reduced ADCC activity and increased serum half-life relative to the native Fc antibody. In certain embodiments, cytotoxicity is mediated by CDC, wherein the Fc variant antibody has enhanced or reduced CDC activity relative to the native Fc antibody. The complement activation pathway starts with binding of the first component (C1q) of the complement system to a molecule (eg, an antibody complexed with a homologous antigen). To evaluate complement activation, CDC analysis can be performed, for example, Gazzano-Santoro et al., 1996, . As stated in J. Immunol. Methods, 202:163. In one embodiment, the antibodies of the invention exhibit increased CDC activity compared to native Fc antibodies. In another embodiment, the Fc variant antibody exhibits a CDC activity at least 2 times, or at least 3 times, or at least 5 times, or at least 10 times, or at least 50 times, or at least 100 times, or at least 200 times, or 2 times to 10 times, or 5 times to 50 times, or 25 times to 100 times, or 75 times to 200 times, or 100 times to 200 times, or 100 times to 200 times, or 100 times to 200 times, or 100 times to 200 times. In another embodiment, the Fc variant antibody exhibits an increase of at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 100%, or at least 200%, or at least 300%, or at least 400%, or at least 500% CDC activity relative to the native Fc antibody. In certain embodiments, the increase in CDC activity can be attributed to the increased affinity of the Fc variant antibody for C1q display. The antibodies of the present invention can exhibit increased CDC activity compared with native Fc antibodies by means of COMPLEGENT® technology (Kyowa Hakko Kirin Co., Ltd.), which enhances CDC activity, which is one of the main mechanisms of action of the antibody. In a method called isotype chimerization, in which a portion of the antibody isotype IgG3 is introduced into the corresponding region of the therapeutic antibody standard isotype IgG1, the COMPLEGENT® technology significantly enhances CDC activity beyond IgG1 or IgG3 while retaining the required features of IgG1, such as ADCC, PK profile, and protein A binding. In addition, it can be used with POTELLIGENT® technology to form even excellent therapeutic Mabs (ACCRETAMAB®) with enhanced ADCC and CDC activities. The Fc variant antibody of the present invention can have enhanced ADCC activity and increased serum half-life relative to the native Fc antibody. The Fc variant antibody of the present invention can have CDC activity and an increased serum half-life relative to the native Fc antibody. The Fc variant antibody of the present invention can have enhanced ADCC activity, enhanced CDC activity and increased serum half-life relative to the native Fc antibody. The serum half-life of a protein containing an Fc region can be increased by increasing the binding affinity of the Fc region to FcRn. As used herein, the term "antibody half-life" means the pharmacokinetic properties of an antibody, which is a measure of the average survival time of an antibody molecule after administration. The antibody half-life may be expressed as the time required to eliminate 50% of a known amount of immunoglobulin from the patient's body (or other mammals) or its specific compartment (eg, as measured in serum, ie, circulating half-life) or other tissues. The half-life may vary from one immunoglobulin or immunoglobulin class to another. Generally, an increase in the half-life of the antibody results in an increase in the mean retention time (MRT) of the administered antibody in the cycle. The increase in half-life results in a decrease in the amount of drug administered to the patient and reduces the frequency of administration. To increase the serum half-life of the antibody, we may incorporate an antigenic determinant that binds the rescue receptor into the antibody (in particular the antibody fragment) as described in, for example, in US Patent No. 5,739,277. As used herein, the term "antigenic determinant binding to rescue receptors" refers to the antigenic determinant of the Fc region of the IgG molecule (eg, IgG1, IgG2, IgG3 or IgG4) responsible for increasing the in vivo serum half-life of the IgG molecule. Alternatively, antibodies of the invention with increased half-life may be produced by modifying amino acid residues identified as being involved in the interaction between Fc and FcRn receptors (see, for example, US Patent Nos. 6,821,505 and 7,083,784; and WO 09 / 058492). Furthermore, the half-life of the antibodies of the present invention can be increased by combining them with PEG or albumin by techniques widely employed in this technology. In some embodiments, the antibody comprising an Fc variant region of the invention increases half life by about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 60%, about 65%, about 70%, about 80%, about 85%, about 90%, about 95%, about 100%, about 125%, about 150%, or more than 150. In some embodiments, the antibody comprising an Fc variant region increases by about 2 times, about 3 times, about 4 times, about 5 times, about 10 times, about 20 times, about 50 times or more, or 2 times to 10 times, or 5 times to 25 times, or 15 times to 50 times, or 15 times to 50 times, or 15 times to 50 times, compared with the antibody comprising a native Fc region. In one embodiment, the invention provides an Fc variant, wherein the Fc region comprises modifications (e.g., amino acid substitution, amino acid insertion, amino acid deletion) at one or more positions selected from the group consisting of EU index numbers as set forth in Kabat: 221, 225, 228, 234, 235, 236, 237, 238, 239, 240, 241, 243, 244, 245, 247, 250, 251, 252, 254, 255, 256, 257, 262, 263, 264, 265, 266, 267, 268, 269, 279, 280, 284, 292, 296, 297, 298, 299, 305, 308, 313, 316, 318, 320, 322, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 339, 341, 343, 370, 373, 378, 392, 416, 419, 421, 428, 433, 434, 435, 436, 440 and 443. As the case may, the Fc region may include modifications at additional and / or alternative locations known to those skilled in the art (see, for example, US Patent Nos. 5,624,821; 6,277,375; 6,737,056; 7,083,784; 7,317,091; 7,217,797; 7,276,585; 7,355,008; 2002 / 0147311; 2004 / 0002587; 2005 / 0215768; 2007 / 0135620; 2007 / 0224188; 2008 / 0089892; WO 94 / 29351; and WO 99 / 58572). In addition, suitable amino acid positions and specific substitutions are illustrated in Tables 2 and 6-10 of US 6,737,056; tables present in Figure 41 of US 2006 / 024298; tables present in Figures 5, 12 and 15 of US 2006 / 235208; tables present in Figures 8, 9 and 10 of US 2006 / 0173170 and tables present in Figures 8-10, 13 and 14 of WO 09 / 058492. In one particular embodiment, the invention provides an Fc variant, wherein the Fc region comprises at least one substitution selected from the group consisting of EU index numbers as set forth in Kabat: 221K, 221Y, 225E, 225K, 225W, 228P, 234D, 234E, 234N, 234Q, 234T, 234H, 234Y, 234I, 234V, 234F, 235A, 235D, 235R, 235W, 235P, 235S , 235N, 235Q, 235T, 235H, 235Y, 235I, 235V, 235E, 235F, 236E, 237L, 237M, 237P, 239D, 239E, 239N, 239Q, 239F, 239T, 239H, 239Y, 240I, 240A, 240T, 240M, 241W, 241L, 241Y, 241E, 241R, 243W, 243L, 243Y, 243R, 243 Q, 244H, 245A, 247L, 247V, 247G, 250E, 250Q, 251F, 252L, 252Y, 254S, 254T, 255L, 256E, 256F, 256M, 257C, 257M, 257N, 262I, 262A, 262T, 262E, 263I, 263A, 263T, 263M, 264L, 264I, 264W, 264T, 264R, 264F, 264M, 2 64Y, 264E, 265A, 265G, 265N, 265Q, 265Y, 265F, 265V, 265I, 265L, 265H, 265T, 266I, 266A, 266T, 266M, 267Q, 267L, 268E, 269H, 269Y, 269F, 269R, 270E, 280A, 284M, 292P, 292L, 296E, 296Q, 296D, 296N, 296S, 296T, 296L, 296I, 296H, 296G, 297S, 297D, 297E, 298A, 298H, 298I, 298T, 298F, 299I, 299L, 299A, 299S, 299V, 299F, 299E, 305I, 308F, 313F, 316D, 318A, 318S, 320A, 320S, 322A, 322S, 325Q, 325L, 325I, 325D, 325 E, 325A, 325T, 325V, 325H, 326A, 326D, 326E, 326G, 326M, 326V, 327G, 327W, 327N, 327L, 328S, 328M, 328D, 328E, 328N, 328Q, 328F, 328I, 328V, 328T, 328H, 328A, 329F, 329H, 329Q, 330K, 330G, 330T, 330C, 330L, 333 0Y, 330V, 330I, 330F, 330R, 330H, 331G, 331A, 331L, 331M, 331F, 331W, 331K, 331Q, 331E, 331S, 331V, 331I, 331C, 331Y, 331H, 331R, 331N, 331D, 331T, 332D, 332S, 332W, 332F, 332E, 332N, 332Q, 332T, 332H, 332Y, 3 32A, 333A, 333D, 333G, 333Q, 333S, 333V, 334A, 334E, 334H, 334L, 334M, 334Q, 334V, 334Y, 339T, 370E, 370N, 378D, 392T, 396L, 416G, 419H, 421K, 428L, 428F, 433K, 433L, 434A, 424F, 434W, 434Y, 436H, 440Y and 443W. As the case may, the Fc region may contain additional and / or alternative amino acid substitutions known to those skilled in the art, including, but not limited to, Tables 2 and 6-10 of US 6,737,056; Tables 2 and 6-10 of US 6,737,056; Tables present in Figures 41 of US 2006 / 024298; Tables present in Figures 5, 12 and 15 of US 2006 / 235208; Tables present in Figures 8, 9 and 10 of US 2006 / 0173170 and the amino acid substitutions illustrated in Tables 8, 9 and 10 of WO 09 / 058492. In one particular embodiment, the invention provides an Fc variant antibody, wherein the Fc region comprises at least one modification (eg, amino acid substitution, amino acid insertion, amino acid deletion) at one or more positions selected from the group consisting of 228, 234, 235 and 331 as set forth by Kabat. In one embodiment, modification is to be replaced by at least one of the EU index numbers selected from the group consisting of 228P, 234F, 235E, 235F, 235Y and 331S as described in Kabat. In another particular embodiment, the invention provides an Fc variant antibody, wherein the Fc region is an IgG4 Fc region and comprises at least one modification at one or more locations selected from the group consisting of 228 and 235 as set forth in Kabat. In another particular embodiment, the Fc region is the IgG4 Fc region and non-naturally occurring amino acids are selected from the group consisting of 228P, 235E and 235Y as described in Kabat. In another particular embodiment, the invention provides an Fc variant, wherein the Fc region comprises at least one non-naturally occurring amino acid at one or more positions selected from the group consisting of 239, 330 and 332 as set forth in Kabat. In one embodiment, modification is to be at least one substituted for the group consisting of 239D, 330L, 330Y and 332E as described by the EU index number as set forth in Kabat. In a particular embodiment, the invention provides an Fc variant antibody, wherein the Fc region comprises at least one non-naturally occurring amino acid at one or more positions selected from the group consisting of 252, 254 and 256 as set forth by Kabat.In one embodiment, modification is to be at least one substituted for the group consisting of 252Y, 254T and 256E as set forth by the EU index number as set forth in Kabat. In particularly preferred antibodies of the invention, modifications are made of three substitutions 252Y, 254T and 256E (called "YTE") as set forth in Kabat, see U.S. 7,083,784. In certain embodiments, the effect function caused by the IgG antibody is strongly determined by the carbohydrate moiety attached to the Fc region of the protein (Claudia Ferrara et al., 2006, Biotechnology and Bioengineering 93:851-861). Therefore, glycosylation of the Fc region can be modified to increase or decrease effector function (see, for example, Umana et al., 1999, Nat. Biotechnol 17:176-180; Davies et al., 2001, Biotechnol Bioeng 74:288-294; Shields et al., 2002, J Biol Chem 277:26733-26740; Shiinkawa et al., 2003, J Biol Chem 278:3466-3473; U.S. Patent No. 6,602,684; No. 6,946,292; No. 7,064,191; No. 7,214,775; No. 7,393,683; No. 7,425,446; No. 7,504,256; U.S. Publication No. 2003 / 0157108; No. 2003 / 0003097; No. 2009 / 0010921; Potillegent™ Technology (Biowa, Inc. Princeton, N.J.); GlycoMAb™ Glycosylation Engineering Retrofit Technology (GLYCART biotechnology AG, Zurich, Switzerland). Thus, in one embodiment, the Fc region of the antibody of the present invention comprises altered glycosylation of amino acid residues. In another embodiment, altered glycosylation of the amino acid residue results in a reduced effector function. In another embodiment, altered glycosylation of the amino acid residue results in an increase in effector function. In one particular embodiment, the Fc region has reduced trehalose sylation. In another embodiment, the Fc region is trehalose-free (see, for example, US Patent Application Publication No. 2005 / 0226867). In one form, host cells (eg, CHO cells, duckweed (duckweed) are engineered to produce highly detrehalose-dehydrosylated antibodies. Such antibodies whose effect function (specifically ADCC) are increased by more than 100-fold higher ADCC than antibodies produced by parental cells (Mori et al., 2004, Biotechnol Bioeng 88: 901-908; Cox et al., 2006, Nat Biotechnol., 24: 1591-7). Adding sialic acid to the oligosaccharides on the IgG molecule can enhance the anti-inflammatory activity of the IgG molecule and alter its cytotoxicity (Keneko et al., Science, 2006, 313: 670-673; Scallon et al., Mol. Immuno. 2007 Mar; 44(7): 1524-34). The above mentioned studies have demonstrated that IgG molecules with increased sialylation have anti-inflammatory properties, while IgG molecules with decreased sialylation have increased immunostimulatory properties (eg, increased ADCC activity). Therefore, the antibodies may be modified with appropriate sialylation distribution for specific therapeutic applications (US Publication No. 2009 / 0004179 and International Publication No. WO 2007 / 005786). In one embodiment, the Fc region of the antibody of the present invention comprises a sialylated distribution that is altered compared to the native Fc region. In one embodiment, the Fc region of the antibody of the present invention comprises an increased sialylation profile compared to the native Fc region. In another embodiment, the Fc region of the antibody of the present invention comprises a reduced sialylation profile compared to the native Fc region. In one embodiment, the Fc variants of the present invention may be combined with other known Fc variants, such as Ghetie et al., 1997, Nat Biotech. 15:637-40; Duncan et al., 1988, Nature 332:563-564; Lund et al., 1991, J. Immunol 147:2657-2662; Lund et al., 1992, Mol Immunol 29:53-59; Alegre et al., 1994, Transplantation 57:1537-1543; Hutchins et al., 1995, Proc Natl. Acad Sci U S A92:11980-11984; Jefferis et al., 1995, Immunol Lett. 44:111-117; Lund et al., 1995, Faseb J 9:115-119; Jefferis et al., 1996, Immunol Lett 54:101-104; Lund et al., 1996, J Immunol 157:4963-4969; Armour et al., 1999, Eur J Immunol 29:2613-2624; Idusogie et al., 2000, J Immunol 164:4178-4184; Reddy et al., 2000, J Immunol 164:1925-1933; Xu et al., 2000, Cell Immunol 200:16-26; Idusogie et al., 2001, J Immunol 166:2571-2575; Shields et al., 2001, J Biol Chem 276:6591-6604; Jefferis et al., 2002, Immunol Lett 82:57-65; Presta et al., 2002, Biochem Soc Trans 30:487-490); US Patent No. 5,624,821; No. 5,885,573; No. 5,677,425; No. 6,165,745; No. 6,277,375; No. 5,869,046; No. 6,121,022; No. 5,624,821; No. 5,648,260; No. 6,528,624; No. 6,194 ,551; No. 6,737,056; No. 7,122,637; No. 7,183,387; No. 7,332,581; No. 7,335,742; No. 7,371,826; No. 6,821,505; No. 6,180,377; No. 7,317,091; No. 7,355,008; No. 2004 / 0002587 and WO 99 / 58572. Other modifications and / or substitutions and / or additions and / or deletions of the Fc domain should be readily apparent to those skilled in this art. Glycosylation In addition to the ability of glycosylation to change the antibody effect function, modified glycosylation in the variable region can change the affinity of the antibody for antigen. In one embodiment, the glycosylation pattern in the variable region of the antibody of the invention is modified. For example, glycosylated antibodies can be prepared (ie, the antibodies lack glycosylation). Glycosylation can be modified to, for example, increase the affinity of the antibody against the antigen. Such carbohydrate modifications can be achieved by, for example, altering one or more glycosylation sites within the antibody sequence. For example, one or more amino acid substitutions may be performed that eliminate one or more variable region framework glycosylation sites to thereby eliminate glycosylation at that site. Such glycosylation increases the affinity of antibodies against antigens. Such methods are further described in further detail in US Patent Nos. 5,714,350 and 6,350,861. One or more amino acid substitutions may also be performed to eliminate glycosylation sites present in the Fc region (eg asparagine 297 of IgG). Furthermore, glycosylated antibodies can be produced in bacterial cells lacking the essential glycosylation mechanism. Antibody Conjugates In certain embodiments, antibodies of the invention bind or covalently attach to a substance using methods well known in the art. In one embodiment, the attachment substance is a therapeutic agent, a detectable marker (also referred to herein as a reporter molecule), or a solid support. Materials suitable for attachment to antibodies include, but are not limited to, amino acids, peptides, proteins, polysaccharides, nucleosides, nucleotides, oligonucleotides, nucleic acids, haptens, drugs, hormones, lipids, lipid components, synthetic polymers, polymeric particles, biological cells, viruses, fluorescent balls, chromophores, dyes, toxins, haptens, enzymes, antibodies, antibody fragments, radioisotopes, solid matrix, semisolid matrix, and combinations thereof. Methods for binding or covalently attaching another substance to an antibody are well known in the art. In certain embodiments, the antibodies of the invention bind to a solid support. The antibody may be bound to the solid support as part of the screening and / or purification and / or manufacturing method. Alternatively, the antibodies of the invention may be bound to a solid support as part of a diagnostic method or composition. Solid support materials suitable for the present invention are generally substantially insoluble in the liquid phase. A large number of support materials are available and known to those skilled in the art. Therefore, solid support includes solid and semi-solid substrates, such as aerogels and hydrogels, resins, beads, biological wafers (including thin-film-coated biological wafers), microfluidic wafers, silicon wafers, porous disks (also known as microtiter disks or microculture disks), films, conductive and non-conductive metals, glass (including microscope slides), and magnetic support. More specific examples of solid support include silicone, polymeric film, particles, derived plastic film, glass beads, cotton, plastic beads, alumina gels, polysaccharides such as agarose gel, poly(acrylate), polystyrene, poly(acrylamide), polyols, agarose, agar, cellulose, dextran, starch, FICOLL, heparin, hepatic sugar, amylopectin, mannan, inulin, nitrocellulose, diazocellulose, polyvinyl chloride, polypropylene, polyethylene (including poly(ethylene glycol), nylon, latex beads, magnetic beads, paramagnetic beads, superparamagnetic beads, starch and the like. In some embodiments, the solid support may include reactive functional groups, including, but not limited to, hydroxy, carboxyl, amine, thiol, aldehyde, halo, nitro, cyano, amide, urea, carbonate, amine formate, isocyanate, cyanoate, sulfonate, sulfonamide, cylindrical, etc., for attachment of antibodies of the present invention. Suitable solid phase support can be selected based on the desired end use and the suitability of various synthetic solutions. For example, when an amide bond is required to attach the antibodies of the invention to a solid support, resins generally suitable for peptide synthesis may be employed, such as polystyrene (for example, PAM-resin obtained from Bachem Inc., Peninsula Laboratories, etc.), POLYHIPE™ resin (from Aminotech, Canada), polyamide resin (from Peninsula Laboratories), polystyrene resin grafted with polyethylene glycol (TentaGel™, Rapp Polymere, Tubingen, Germany), polydimethyl-acrylamide resin (from Milligen / Biosearch, California) or PEGA beads (from Polymer Laboratories). In certain embodiments, antibodies of the invention bind to labels for the purpose of diagnostic and other analyses of detectable antibodies and / or their associated ligands. The labels described herein for binding to antibodies and used in the methods and compositions of the invention are any chemical moiety (organic or inorganic) that exhibit absorption maximums at wavelengths greater than 280 nm and retain their spectral properties when covalently attached to the antibody. Labels include, but are not limited to, chromophores, fluorescent proteins, phosphorescence dyes, tandem dyes, particles, haptens, enzymes, and radioisotopes. In certain embodiments, the antibody binds to a fluorescent group. Therefore, fluorescent groups used to label antibodies of the invention include, but are not limited to, pyrene (including any of the corresponding derivative compounds disclosed in U.S. Patent No. 5,132,432), anthracene, naphthalene, acridine, stilbene, indole or benzoindole, oxazole or benzooxazole, thiazole or benzothiazole, 4-amine-7-nitrobenzo-2-oxazole (NBD), cyanine (including any corresponding compounds in U.S. Patent Nos. 6,977,305 and 6,974,873), carboxylica (including U.S. serial number 09 / 557,275; Patent No. 4,981,977; No. 5,268,486; No. 5,569,587; No. 5,569,766; No. 5,486,616; No. 5,627,027; No. 5,808,044; No. 5,877,310; No. 6,002,003; No. 6,004,536; No. 6,008,373; No. 6,043,025; No. 6,127,134; No. 6,130,094; No. 6,133,445; and publication 02 / 26891, WO 97 / 40104, WO 99 / 51702, WO 01 / 21624; EP 1 065 250 any corresponding compounds in A1), carbostyryl, porphyrin, salicylate, o-aminobenzoate, aza, perylene, pyridine, quinoline, boron polyazadicyclopentadiene (including U.S. Patent No. 4,774,339; No. 5,187,288; No. 5,248,782; No. 5,274,113 and No. 5,433,896), dibenzopiperam (including U.S. Patent No. 6,162,931; No. 6,130,101; No. 6,229,055; No. 6,339,392; 5,451,343; No. 5,227,487; No. 5,442,045; No. 5,798,276; No. 5,846,737; No. 4,945,171; any corresponding compounds disclosed in U.S. serial numbers 09 / 129,015 and 09 / 922,333), ozoazine (including any corresponding compounds disclosed in U.S. Patent No. 4,714,763) or benzooxazine, carbazine (including any corresponding compounds disclosed in U.S. Patent No. 4,810,636), naphthylone, coumarin (including U.S. Patent No. 5,696,15 7; No. 5,459,276; corresponding compounds disclosed in 5,501,980 and 5,830,912), benzofuran (including corresponding compounds disclosed in US Patent Nos. 4,603,209 and 4,849,362), and benzonabenone (including any corresponding compounds disclosed in US Patent No. 4,812,409) and derivatives thereof. As used herein, oxazines include resorufins (including any corresponding compounds disclosed in 5,242,805), amineoxazine, diamineoxazine and benzo-substituted analogs. In one particular embodiment, the fluorescent ball bound to the antibodies described herein includes dibenzopiperan (rhodol, rhodamine, luciferin and derivatives thereof), coumarin, cyanine, pyrene, oxazine, and boron polyazadicyclopentadiene. In other embodiments, such fluorescent balls are sulfonated dibenzopiran, fluorinated dibenzopiran, sulfonated coumarin, fluorinated coumarin and sulfonated cyanine. It also includes dyes sold under the trade name, and is generally referred to as ALEXA FLUOR®, DyLight, CY® dyes, BODIPY®, OREGON GREEN®, PACIFIC BLUE™, IRDYE®, FAM, FITC and ROX™. The choice of the fluorescent ball attached to the antibody will determine the absorption and fluorescent emission properties of the bound antibody. Physical characteristics of fluorescent ball labeling of ligands that can be used for antibodies and antibody-bound ligands include, but are not limited to, spectral characteristics (absorption, emission and stokes shift), fluorescent intensity, lifetime, polarization and photobleaching rate, or combinations thereof. All such physical properties can be used to distinguish one fluorescent species from the other and thus allow multiple analysis. In some embodiments, the fluorescent ball has an absorption maximum at a wavelength greater than 480 nm. In other embodiments, the fluorescent balls are absorbed at 488 nm to 514 nm or close to 488 nm to 514 nm (especially suitable for excitation by the output of an argon ion laser excitation source) or close to 546 nm (especially suitable for excitation by a mercury arc lamp). In other embodiments, the fluorescent balls may be emitted in the NIR (near infrared region) for tissue or intact biological applications. Other desired properties of fluorescent labeling may include cell permeability and low toxicity, for example, if the labeling of the antibody will be performed in a cell or an organism (eg, a live animal). In certain embodiments, the enzyme is labeled and binds to the antibodies described herein. The enzyme is the desired marker because amplification of detectable signals can be obtained, resulting in an increase in analytical sensitivity. The enzyme itself does not produce detectable reactions, but is used to cleave the acceptor when it comes into contact with the appropriate acceptor, so that the converted acceptor produces fluorescent, colorimetric or luminescent signals. Enzyme amplification detectable signal because one enzyme with respect to the labeling agent can cause multiple receptors to be converted into detectable signals. The enzyme acceptor is selected to produce a better measured product, such as colorimetric, fluorescent or chemiluminescence. Such qualities are widely used in this technology and are well known to those skilled in this technology. In one embodiment, the colorimetric or fluorescent receptor is used in combination with the enzyme using oxidoreductase such as horseradish peroxidase and receptors such as 3,3'-diaminebenzidine (DAB) and 3-amine-9-ethylcarbazole (AEC) which produce differential colors (brown and red, respectively). Other colorimetric oxidoreductase receptors that produce detectable products include, but are not limited to: 2,2-thisazo-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), orthophenyldiamine (OPD), 3,3',5,5'-tetramethylbenzidine (TMB), o-anisinamine, 5-aminosalicylic acid, 4-chloro-1-naphthol. Fluorescent substances include, but are not limited to, hypervanillic acid or 4-hydroxy-3-methoxyphenylacetic acid; reduced benzothiazine and reduced benzothiazine, including Amplex ® Red agents and variants thereof (U.S. Patent No. 4,384,042); and reduced dihydrodiphenzopiperan, including dihydroluciferin (U.S. Patent No. 6,162,931); and dihydrodopamine, including dihydrodopamine 123. The peroxidase receptor tyrosine (U.S. Patent No. 5,196,306; No. 5,583,001 and No. 5,731,158) represents a unique class of peroxidase receptors because they are inherently detectable before the enzyme acts, but are "in-place" by the action of peroxidase during the process described as tyrosine signal amplification (TSA). Such ingredients are widely used to label antigens in samples such as cells, tissues or arrays for subsequent detection by microscopy, flow cytometry, optical scanning and fluorescence assays. In another embodiment, the colorimetric (and in some cases, fluorescent) receptor is used in combination with an enzyme in combination with a phosphatase, such as acid phosphatase, alkaline phosphatase or recombinant form of such phosphatase and such a phosphatase with a colorimetric receptor such as 5-bromo-6-chloro-3-indolyl phosphate (BCIP), 6-chloro-3-indolyl phosphate, 5-bromo-6-chloro-3-indolyl phosphate, p-nitrophenyl phosphate, or o-nitrophenyl phosphate, or with a colorimetric receptor such as 4-methylcoumarin phosphate, 6,8-difluoro-7-hydroxy-4-methylcoumarin phosphate (DiFMUP, US Patent No. 5,830,912), luciferin diphosphate, 3- O-methylluciferin phosphate, rehalein phosphate, 9 A combination of fluorescent substances of H-(1,3-dichloro-9,9-dimethylacridine-2-one-7-yl)phosphate (DDAO phosphate), or ELF 97, ELF 39 or related phosphate (US Patent Nos. 5,316,906 and 5,443,986). Glycosidase, in detail, β-galactosidase, β-glucuronidase and β-glucosidase, are additional suitable enzymes. Suitable colorimetric receptors include, but are not limited to, 5-bromo-4-chloro-3-indolyl beta-D-galactoside (X-gal) and similar indolyl galactosides, glucosides and glucosides, ortho-nitrophenyl β-D-galactosides (ONPG) and p-nitrophenyl β-D-galactosides. In one embodiment, the fluorescent receptor includes hydroxyl beta-D-galactoside, luciferin digalactoside (FDG), luciferin diglucoside and structural variants thereof (U.S. Patent No. 5,208,148; No. 5,242,805; No. 5,362,628; No. 5,576,424 and No. 5,773,236), 4-methylcoumarin β-D-galactoside, carboxycoumarin β-D-galactoside and coumarin fluoride (U.S. Patent No. 5,830,912). Additional enzymes include, but are not limited to, hydrolase enzymes such as cholinesterase and peptidase, oxidase such as glucose oxidase and cytochrome oxidase, and suitable reductases that are known as reductases. The enzyme and its appropriate receptors for producing chemiluminescence are preferred for some analyses. It includes, but is not limited to, natural and recombinant forms of luciferase and aequorin. Phosphatase, glycosidase and oxidase produce chemiluminescent receptors, such as those containing stable dioxetane, luminol, isoluminol and azylethyl ester, are otherwise suitable. In another embodiment, haptens such as biotin are also used as labels. Biotin is suitable because it can function in the enzyme system to further amplify detectable signals and can act as a label for affinity chromatography for separation purposes. For detection purposes, enzyme conjugates with affinity to biotin, such as antibiotic protein-HRP, are used. Subsequently, peroxidase receptors are added to generate detectable signals. Haptens also include hormones, naturally occurring drugs and synthetic drugs, contaminants, allergens, affecting molecules, growth factors, chemokines, cytokines, lymphokines, amino acids, peptides, chemical intermediates, nucleotides and the like. In certain embodiments, the fluorescent protein may bind to the antibody as a label. Examples of fluorescent proteins include green fluorescent proteins (GFPs) and phycobilidins and derivatives thereof. Fluorescent proteins (especially phycobilidin) are particularly suitable for labeling reagents that form tandem dye labels. For the purpose of obtaining a larger Stoke displacement, these tandem dyes contain fluorescent proteins and fluorescent balls, where the emission spectrum shifts from the wavelength of the absorption spectrum of the fluorescent protein to the distance. It is particularly advantageous for detecting low numbers of antigens in the sample, where the emitted fluorescent light is maximized, in other words, very little to no emission light is reabsorbed by the fluorescent protein. To this end, the fluorescent protein and the fluorescent ball act as energy transfer pairs, where the fluorescent protein is emitted at the wavelength absorbed by the fluorescent ball and the fluorescent ball is then emitted at a wavelength farther from the fluorescent protein than the wavelengths that may have been obtained only by the fluorescent protein. Particularly applicable combinations are combinations of phycobilidin disclosed in U.S. Patent No. 4,520,110; No. 4,859,582; sulfonyl-Rodamide fluorescent group disclosed in U.S. Patent No. 5,798,276, or sulfonated cyanine fluorescent group disclosed in U.S. Patent No. 6,977,305 and 6,974,873; or sulfonated dibenzopiran derivatives disclosed in U.S. Patent No. 6,130,101 and sulfonated dibenzopiran derivatives disclosed in U.S. Patent No. 4,542,104. Alternatively, the fluorescent ball acts as an energy donor and the fluorescent protein is an energy acceptor. In certain embodiments, the label is a radioisotope. Examples of suitable radioactive substances include, but are not limited to, iodine ( 121 I, 123 I, 125 I, 131 I), carbon ( 14 C), sulfur ( 35 S), tritium ( 3 H), indium ( 111 In, 112 In, 113m In, 115m In), pun( 99 Tc, 99m Tc), thallium ( 201 Ti), gallium ( 68 Ga, 67 Ga), palladium ( 103 Pd), molybdenum ( 99 Mo), xenon ( 135 Xe), fluorine ( 18 F) 153 Sm, 177 Lu, 159 Gd, 149 Pm, 140 La, 175 Yb, 166 Ho, 90 Y, 47 Sc, 186 Re, 188 Re, 142 Pr, 105 Rh and 97 Ru. Medical Treatment and Uses Antibodies and binding fragments and variants of the present invention can be used to treat influenza A virus infection, to prevent influenza A virus infection and / or to detect, diagnose and / or prognosis of influenza A virus infection. The diagnostic method may include contacting the antibody or antibody fragment with the sample. Such samples may be tissue samples taken from, for example, nasal cavity, sinus cavity, salivary gland, lung, liver, pancreas, kidney, ear, eye, placenta, digestive tract, heart, ovary, pituitary gland, adrenal gland, thyroid, brain or skin. Methods of detecting, diagnosing and / or prognosis may also include detecting an antigen / antibody complex. In one embodiment, the invention provides a method of treating an individual by administering to the individual an effective amount of an antibody or binding fragment thereof, or a pharmaceutical composition including the antibody or binding fragment thereof. In one embodiment, the antibody or binding fragment thereof is substantially purified (ie, substantially without substances that limit their effects or produce improper side effects). In one embodiment, the antibody or binding fragment of the invention is administered after exposure or after the individual has been exposed to or infected with the influenza A virus. In another embodiment, the antibody or binding fragment of the invention is administered prior to exposure or to an individual who has not been exposed to or has not been infected with the influenza A virus. In one embodiment, the antibody or binding fragment of the invention is administered to one or more sero-negative individuals of influenza A subtype. In another embodiment, the antibody or binding fragment of the invention is administered to one or more seropositive individuals of influenza A subtype. In one embodiment, the antibody or binding fragment of the invention is administered to the individual within 1, 2, 3, 4, 5 days of an infection or symptom onset. In another embodiment, the antibody or binding fragment thereof of the invention may be administered to the individual within 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 days after the onset of infection or symptoms. In one embodiment, the method reduces influenza A virus infection in an individual. In another embodiment, the method prevents, reduces the risk of influenza A virus infection in an individual or delays influenza A virus infection in an individual. In one embodiment, the individual is a mammal. In a more specific embodiment, the individual is a human. In one embodiment, the individual includes, but is not limited to, individuals who are particularly at risk of influenza A virus infection or are susceptible to influenza A virus infection, including, for example, individuals with immune insufficiency. The treatment may be a single dose or multiple doses of time, and the antibodies of the invention or binding fragments thereof may be used for passive immunization. In one embodiment, the antibody or binding fragment of the invention is administered to the individual in combination with one or more antiviral agents. In one embodiment, the antibody or binding fragment of the invention is administered to the individual in combination with one or more small molecule antiviral agents. Small molecule antiviral agents include neuramine glycoidase inhibitors such as oseltamivir (TAMIFLU®), zanamivir (RELENZA®), and adamantane (such as adamantine and adamantine). In another embodiment, the invention provides a composition for use as a medicament for preventing or treating influenza A virus infection. In another embodiment, the invention provides the use of an antibody or binding fragment thereof of the invention and / or a protein containing an antigenic determinant bound to an antibody or binding fragment of the invention for the manufacture of an agent for individual treatment and / or individual diagnosis. The antibodies and fragments described in the present invention can also be used to diagnose influenza A virus infection. Additionally, antigenic determinants capable of binding to antibodies of the invention can be used in sets to monitor the efficacy of vaccination procedures by detecting the presence of protective anti-influenza A virus antibodies. The antibodies, antibody fragments or variants and derivatives thereof described in the present invention can also be used in sets to monitor vaccine manufacturing with the desired immunogenicity. The invention also provides a method for preparing a pharmaceutical composition, which comprises the step of mixing a single antibody with one or more pharmaceutically acceptable carriers, wherein the antibody is a single antibody of the invention as described herein. Various delivery systems are known and can be used to administer antibodies or binding fragments thereof of the invention, including, but not limited to, encapsulating liposomes, microparticles, microcapsules, recombinant cells capable of exhibiting the antibody or antibody fragment, receptor-mediated internal drinking action, constructing nucleic acids as part of retroviral or other vectors, delivering naked nucleotides by electroporation delivery technology (as described in Muthumani et al., PLoS One. 2013 Dec 31;8(12):e84234. doi: 10.1371 / journal.pone.0084234. eCollection 2013), etc. Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The composition may be administered by any convenient route, such as by infusion or rapid injection, by absorption through epithelial or dermal mucosal lining (eg oral mucosa, rectal and intestinal mucosa, etc.), and may be administered with other biologically active agents including, but not limited to, small molecule antiviral compositions. Dosing can be systemic or local. Pulmonary administration can also be employed, for example, by using an inhaler or a sprayer and a formulation with a spray. In another embodiment, the composition can be delivered by a controlled release system. The invention also provides pharmaceutical compositions. Such compositions include a therapeutically effective amount of an antibody or binding fragment thereof of the invention and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutically acceptable" means that it is approved by the federal government or regulatory authority of the continental government or listed in the United States or other generally recognized pharmacopoeia for animals and more specifically for humans. The term "vehicle" refers to a diluent, adjuvant, excipient or vehicle administered with a therapeutic agent. Such pharmaceutical carriers may be sterile liquids such as water and oils, including petroleum, animal oil, vegetable oil or oils of synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. When the pharmaceutical composition is administered intravenously, water is the preferred carrier. Physiological saline aqueous solutions, dextrose and glycerol aqueous solutions can also be used as liquid carriers, especially in injectable solutions. Suitable medical excipients include starch, glucose, lactose, sucrose, gelatin, maltose, rice, flour, chalk, silicone, sodium stearate, glycerol monostearate, talc, sodium chloride, skim milk powder, glycerol, propylene, ethylene glycol, water, ethanol and the like. If desired, the composition may also contain trace amounts of wetting or emulsifying agents or pH buffering agents. Such compositions may be in the form of solutions, suspensions, emulsions, lozenges, pills, capsules, powders, sustained release formulations and the like. The composition may be formulated as a suppository with conventional binders and carriers such as triglycerides. Oral formulations may include standard carriers such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, and the like. In one embodiment, the pharmaceutical composition contains a therapeutically effective amount of an antibody or binding fragment thereof (preferably in purified form) and a suitable amount of a carrier to provide a form for proper administration to the patient. The formulation should be suitable for the dosing mode. Typically, for antibody therapeutic agents, the dosage administered to the patient is about 0.1 to 100 mg per kilogram of the patient's body weight. Example Example 1. Self-memory B Construction and optimization of human single antibody isolated from cell-isolated CD22+ IgG+ B cells were selected from cryopreserved peripheral blood monocytes (PBMCs) of selected donors for high-titer heterologous subtype antibodies and immortalized treatment was performed using Epstein Barr Virus (EBV) and CpG oligodeoxynucleotide 2006 and feeding cells in 3 cells per well. The culture serum layer containing the antibody was collected after 14 days and the binding activity against H5 (A / Vietnam / 1203 / 04) and H7 (A / NLD / 03) hematoglobin (HA) was determined by ELISA binding assay, respectively. It was found that four pure B cell lines (antibody 1, antibody 4, antibody 7 and antibody 9) could specifically bind to two HAs and thus collected. For the sequence of VH and VL genes of this pure line and based on the homology analysis of VH and VL V, D and J fragments using the Kabat database, it was found to be homology associations. It is worth noting that the VH of antibody 4 was found to have a degenerate nucleotide site encoding valine (encoded in antibody 5) or glutamic acid (encoded in antibody 6) in HCDR3. The VH and VL genes of the four antibodies were selected into the IgG1 expression vector (a small amount of sequence modification to facilitate selection and or codon optimization, resulting in 5 antibodies; antibody 3, antibody 5, antibody 6, antibody 8 and antibody 10; used in the following examples), and recombinant antibodies were produced by temporary transfection of mammalian cell lines derived from HEK or CHO cells. The clear layer from the transfected cells was collected after 7-10 days of culture, and the IgG was purified by protein A chromatography using affinity and dialyzed into PBS. Antibody 3 is further optimized to change the mutation of the somatic cell encoding a non-germline in the resulting variant in the framework region into an amino acid encoding a germline, and the CDR region is simply mutagenerated. As described above, the complete IgG construct containing different mutations was shown, and the crude material clear layer was screened by ELISA to select pure lines that had improved binding activity for H3 and H1 HA proteins. ELISA was performed using 0.15 µg / ml coated concentration of rabbit anti-human IgG to capture IgG from the serum layer and normalize, followed by addition of 0.5 µg / ml biotin-labeled HA subtype H1 (A / California / 7 / 04 (H1N1)) or subtype H3 (A / Perth / 16 / 09 (H3N2)) and incubation for one hour. The binding was detected by addition of streptavidin-HRP (1:5000) and the absorbance was read at 450 nm. Combinations confer favorable single mutations to the preferred binding and colonize into the combinatorial library, which is manifested as described above and screened by ELISA. This library method results in the formation of 5 additional antibody 3 variants, further characterizing these variants (antibodies 11-15). Example 2. Anti- HA Neutralizing antibodies (nAb) Combined with different subtypes HA was used to test whether the antigenic determinant of anti-HA antibodies was retained in HA of different subtypes, and HA cross-reactive ELISA binding analysis was performed. The 384-well Maxisorb ELISA disc (Nunc) was coated overnight at 4°C with PBS containing 0.5 μg / ml of recombinant HA (rHA), subtype H1 (A / California / 7 / 09 (H1N1)), subtype H2 (A / Swine / MO / 06 (H2N3)), subtype H3 (A / Perth / 16 / 09 (H3N2)), subtype H5 (A / Vietnam / 1203 / 04 (H5N1)), subtype H6 (A / Medot / HK / W312 / 97 (H6N1)), subtype H7 (A / Netherlands / 219 / 03 (H7N7)) and subtype H9 (A / Chicken / HK / G9 / 97 (H9N2)). The dish was washed with PBS containing 0.1% v / v Tween-20 to remove uncoated proteins, and then a blocking solution containing 1% (w / v) casein (Thermo Scientific) was added and incubated at room temperature for 1 hour. The blocking solution was discarded and anti-HA antibody was added 3-fold serially diluted in blocking solution (casein-PBS (Thermo Scientific) and incubated for 1 hour at room temperature. The plate was washed three times and bound to the peroxidase mouse anti-human IgG antibody (Jackson). The binding activity of the antibody was calculated by measuring the chemiluminescence signal after the addition of the Supersignal Pico receptor (Thermo Scientific), or by incubating with a component receptor (KPL), tetramethylbenzidine (TMB), followed by the addition of 2N sulfuric acid to stop the reaction, and the color change was measured at 450 nm. surface 1 Table 1 shows the total of the anti-HA IgG tested binding to recombinant HA isoforms H1, H2, H3, H5, H6, H9 and H7. At the highest concentration of the tested antibody (6 μg / ml), the subtype H9 of recombinant HA is recognized by antibody 3 and antibody 10, but not by antibody 5, antibody 6 and antibody 8. This indicates that most of these anti-HA IgG antigenic determinants are retained in HA molecules of different subtypes. surface 2 Table 2 shows all anti-HA IgG variants tested to be similar to EC 50 Values ​​bind to the first subtypes of recombinant HA group H1, H2, H5, H6 and H9. All variants bind to the 2nd HA protein (H3 and H7), however, antibody 11 and antibody 3 show activity as compared with antibodies 12-15. 50 The value increases and decreases. To extend these binding results to include more different HA subtypes, we performed additional binding studies based on the use of mobile cytometry in combination with HA-transfected cells. In this analysis, HEK cells were temporarily transfected with full-length wild-type HA expressions of the following subtypes: subtype H4 A / Duck / Czechoslovakia / 56 (H4N6)), subtype H10 (A / Chicken / Germany / N49 (H10N7)), subtype H11 (A / Duck / Memphis / 546 / 74 (H11N9)), subtype H12 (A / Duck / Alberta / 60 / 76 (H12N5)), subtype H13 (A / Gull / Maryland / 704 / 77 (H13N6)), subtype H14 (A / Marakhan / 263 / 82 (H14N5)), subtype H15 (A / Seagull / West Australia / 2576 / 79 (H15N9)), subtype H16 (A / Blackhead Guard / Sweden / 2 / 99 (H16N3)) and subtype H17 (A / Little Yellow-Shouldered Bat / Guatemala / 164 / 2009 (H17N10)). Forty-eight hours after transfection, cells were separated with trypsin and incubated on ice with 5 μg / ml antibody 3 or antibody 12 for 1 hour. After 1 hour incubation, antibodies bound to the surface of cells that exhibited HA proteins were then stained with goat anti-human IgG Daylight 649 (Jackson ImmunoResearch) and detected by flow cytometry. Figure 1A shows the shift of fluorescence intensity when the antibody binds to cells that exhibit HA (white) versus cells transfected with mimetics (gray). Antibody 3 binds to all HAs tested except H12, and antibody 12 binds to all HAs tested in both groups (group 1 H11, H12, H13, H16 and H17 and group 2 H4, H10, H14 and H15). Example 3 By using Octet Kinetic Characterization HA With antibodies 3 and antibodies 5 IgG1 In a 384 tilted aperture disc, affinity force measurement was performed using a ForteBio Octet QK 384 dynamic analyzer (Menlo Park, CA). All reagents were diluted in Octet Kinetics Buffer (ForteBio). The His-tagged HA of different subtypes was fixed at 10 µg / mL on the anti-His sensor: subtype H1 (A / California / 7 / 04 (H1N1)) and subtype H3 (A / Perth / 16 / 09 (H3N2)). Anti-HA mAb association / dissociation was then monitored in a 2-fold dilution of 100 nM plus zero mAb control. Any offsets to the association and dissociation of the original data were corrected in the zero mAb control and subsequently output to GraphPad Prism (San Diego, CA) for affinity curve fitting. In the imposed limit >5×10 -6 sec -1 In the case of the , the data are fitted using global association / dissociation fitting. As shown in Table 3, the two antibodies bind extremely high affinity to H1 at pM level at the detection limit at slow dissociation rate. At the sub-nM level, similar K of the two antibodies was observed using H3 trimers. on , K off and Kd. surface 3 Example 4 Anti- HA IgG1 The micro neutralization analysis of in vitro cross-reactivity neutralization activity (MNA) for different subtypes of viruses was modified by the previously described use of neuroamine glucotidase activity (NA) as a read-out accelerated viral inhibition analysis (Hassantoufighi, A. et al. 2010, Vaccine 28:790). Briefly, MDCK cells cultured in MEM medium (Invitrogen) supplemented with antibiotics, glutamic acid (intact MEM medium) and 10% (v / v) fetal bovine serum were MNA. 60 TCIDs 50 (50% tissue culture infection dose) virus was added in two wells to a 384-well dish in three-fold dilution of complete MEM medium containing 0.75 μg / ml trypsin (Worthington). After incubation at room temperature for 30 minutes, 2×10 per well was 2 x 10 per well 4 Add cells to the dish. 5% CO at 33℃ 2 After incubation in the incubator for about 40 hours, NA activity was measured by adding fluorescently labeled acceptor methylcoumarin-N-acetyl neuric acid (MU-NANA) (Sigma) to each well and incubating at 37°C for 1 hour. Virus replication represented by NA activity was quantified by reading fluorescence using the following settings in the fluorometer Envison (PerkinElmer): excitation 355 nm, emission 460 nm; 10 flashes per well. Neutralization titer (50% inhibitory concentration [IC 50 ]) is expressed as the final antibody concentration that reduces the fluorescent signal by 50% compared to the cell control well. Tables 4 and 5 show the influenza A viruses neutralized by different subtypes of anti-HA antibodies tested: H1-PR34 (A / Puerto Rico / 8 / 34 (H1N1)); H1-PR34-OR (A / Puerto Rico / 8 / 34 (H1N1) containing NA 274Y (N2 number) mutation conferring oseltamivir resistance; H1-FM47 (A / Fort Monmouth / 1 / 47 (H1N1)); H1-NJ76 (A / New Jersey / 8 / 76 (H1N1)); H1-Kaw86 (A / Kawasaki / 9 / 86 (H1N1)); H1-TX91 (caA / Texas / 36 / 91 (H1N1)): H1-BJ95 (ca A / Beijing / 262 / 95 (H1N1)); H1-Ncal99 (ca A / New Caledonia / 20 / 99 (H1N1)); H1-SD07 (ca A / South Dakota / 6 / 07 (H1N1)); H1-CA09 (ca A / California / 7 / 09 (H1N1)); H1-CA09-OR (ca A / California / 7 / 09 (H1N1) containing NA 274Y (N2 number) mutation conferring oseltamivir resistance; H5-VN04 (ca A / Vietnam / 1203 / 04 (H5N1)); H5-HK03 (ca A / Hong Kong / 213 / 03 (H5N1)); H9-HK97 (ca A / Chicken / Hong Kong / G9 / 97 (H9N2); H2-JP57 (ca A / Japan / 57 (H2N2)); H2-MO06 (ca A / Pig / Missouri / 06 (H2N3)); H6-HK97 (ca A / Thumb / Hong Kong / W312 / 97 (H6N1)); H6-AB85 (ca A / Wilberta / 89 / 85 (H6N2)); H3-HK68 (A / Hong Kong / 8 / 68 (H3N2)); H3-Vic75 (A / Victoria / 3 / 75 (H3N2)); H3-LA87 (A / Los Angeles / 7 / 09 (H3N2)); H3-SD93 (A / Shan dong / 9 / 93 (H3N2)); H3-WH95 (ca A / Wuhan / 359 / 95 (H3N2)); H3-Syd97 (ca A / Sydney / 5 / 97 (H3N2)); H3-WH95-OR (ca A / Wuhan / 359 / 95 (H3N2)); H3-Pa99 (ca A / Panama / 2007 / 99 (H3N2)); H3-Wy03 (A / Wyoming / 03 / 03 (H3N2)); H3-WI05 (A / Wisconsin / 67 / 05 (H3N2)); H3-Perth09 (ca A / Perth / 16 / 09 (H3N2)); H3-VC11 (A / Victoria / 361 / 11 (H3N2)); H7-NLD03 (ca A / Netherlands / 219 / 03 (H7N7)); H7-BC04 (ca A / Brit. Columbia / CN-6 / 04 (H7N3-LP); H7-ANU13 (ca A / Anhui / 1 / 13 (H7N9). surface 4 Table 4 shows the anti-HA antibody neutralization of all the first influenza A viruses tested. All anti-HA antibodies except antibody 8 exhibited neutralizing activity against all H3 influenza A viruses tested, and all anti-HA antibodies except antibody 6 exhibited neutralizing activity against H7-NLD03 (ca A / Netherlands / 219 / 03 (H7N7)); H7-BC04 (ca A / Brit. Columbia / CN-6 / 04 (H7N3-LP). surface 5 Table 5 shows the lowered IC 50 At values, the antibody variant (antibodies 11-15) is more effective than parent antibody 3 in neutralizing all the tested population 1 and 2 influenza A viruses. In addition, the antibodies also neutralize three viruses that are engineered to mutations in NA proteins that confer oseltamivir resistance (OR). Example 5. Anti- HA IgG Targeting pig sources H3N2 Neutralization of sexual activity in viruses . The neutralizing activity of anti-HA antibody 3 and variants (antibodies 11-15) against newly emerging pig-derived H3N2 viruses (A / Minnesota / 11 / 2010 and A / Indiana / 10 / 2011) was measured in the trace neutralization as described in Example 4. Antibody FI6v4 (described in WO2013 / 011347A1) was used as the control antibody. As shown in two independent experiments in Table 6, antibody 3 and antibody variants (antibodies 11-15) are more effective than FI6v4 in neutralizing pig-derived A / Indiana / 10 / 2011 H3N2 viruses. At the highest concentration of the antibody tested (50 μg / ml), antibody 3 and antibody variants strongly neutralize the pig-derived A / Minnesota / 11 / 2010 H3N2 virus, while FI6v4 failed to neutralize. surface 6 Example 6. Anti- HA Neutralizing antibodies inhibit influenza fusion and protease mediation HA0 Cleavage . To test antibody-mediated fusion inhibition, low pH-induced erythrocytogenesis was performed via the modified protocol described previously (Wang T.T. et al., 2010 PLoS Pathog. 6). In short, A / Puerto Rico / 8 / 34 virus (10×10 6 TCID50) was incubated on ice for 10 minutes with human red blood cells (2% final red blood cell concentration). The dilutions of antibody 3, antibody 12 and non-related antibody MPE8v3 were incubated with the virus at room temperature for 30 minutes. Then red blood cells were added to the virus-antibody mixture at 37°C for 30 minutes, and finally sodium acetate buffer (0.5 M pH 5.0) was added at 37°C for another 45 minutes. The samples were centrifuged at 400 x g for 6 minutes and incubated at room temperature for another 45 minutes, and then centrifuged at 400 x g for 6 minutes to aggregate the red blood cells into pellets. The serum layer was then transferred to an ELISA disk to determine the amount of NADPH released by measuring absorbance at 540 nm (Fig. 1B). The results showed that antibody 3 and antibody 12 effectively inhibit viral fusion, while a human single antibody MPE8v3 (Corti et al., 2013 Nature 501) targeting paramyxovirus fusion protein could not inhibit low pH-induced fusion. To test antibody-mediated blockade of HA maturation, recombinant HA of A / New Caledonia / 20 / 99 (H1N1) was incubated with antibody 3, FI6v4, FE17.23 or isotope control antibodies with 15:1 (mAb:HA) for 40 minutes. The antibody-HA mixture was then exposed to 2.5 μg / ml TPCK-treated trypsin and incubated at 37°C for 5, 10 and 20 minutes. The samples were isolated on a polyacrylamide gel and subsequently transferred to a nitrocellulose membrane for western ink dot analysis using biotin-labeled human mAbs (FO32) (Humabs) that recognize HA2 and HA0 of influenza A virus strains (Fig. 1C). The results showed that antibody 3 was more effective than FI6v4 in blocking protease-mediated HA0 cleavage. In contrast, the single human antibody FE17.23 and the control antibody that recognizes the HA spherical head cannot inhibit protease-mediated HA0 cleavage. In a separate experiment, we used the same conditions mentioned above to compare protease cleavage inhibition of antibody 12 and antibody 14 compared with antibody 3 (Figure 1D). The results show that antibodies 12 and 13 have similar ability to block protease cleavage as antibody 3. Example 7. Anti- HA Antibody display Fc Effective antibodies have the potential to clear cells of infected viruses via the following Fc effector functions, such as antibody-dependent cytotoxicity (ADCC), antibody-dependent cellular phagocytosis (ADCP), and complement-dependent killing (CDC). To confirm the ADCC activity of anti-HA antibodies, we tested our ability to kill cells infected with viruses in the presence of human natural killer (NK) cells. ADCC analysis was performed on MDCK cells infected with A / Hong Kong / 8 / 68 with MOI 20. Infected cells were incubated with serially diluted antibodies and subsequently incubated with purified NK cells selected from human PBMC (Miltenyi) at a ratio of effector cells to target cells of 6:1. The infected cells, antibodies and NK cell mixtures were incubated for 4 hours and the cell killing was measured by LDH release (Roche). Figure 2 shows that all four anti-HA stalk antibodies show dose-dependent killing of infected MDCK cells. To measure the ability of anti-HA antibodies to mediate phagocytosis, we use MDCK cells stably transfected with HA from A / Hong Kong / 8 / 68 as the target cells. Human monocytes were isolated from PBMCs and cultured for 7 days in the presence of M-CSF to differentiate into macrophages. Human macrophages and target cells showing HA are fluorescently marked purple and green (CellTrace Violet or CSFE, Invitrogen). Labeled effector cells and target cells were incubated in the presence of serially diluted antibodies at a ratio of 6:1 for 2 hours and subsequently analyzed by flow cytometry. The percentage of phagocytosis is measured as the percentage of purple-stained macrophages (double positive) that are also positive for green target cells. Figure 3 shows that all anti-HA antibodies display similar levels of ADCP, as expected, nonspecific control antibodies do not exhibit phagocytosis. To measure the ability of anti-HA antibodies to act together with complement to mediate the killing of infected cells, we conducted CDC analysis. In this analysis, MDCK cells were infected with A / Puerto Rico / 8 / 34 with MOI 2 and were incubated with a 1:18 effector to target ratio with serial diluted antibodies and Cedarlane derived from rabbits. Cell killing was measured by LDH release (Roche). Figure 4 shows that all anti-HA antibodies display the ability to mediate cell killing in the presence of complement. Example 8. Anti- HA Preventive and therapeutic effects of antibodies The protective efficacy of human neutralizing antibodies (nAbs) against influenza virus infection was evaluated in a six to eight-week-old BALB / c (Harlan Laboratories) mouse model. Mice were treated with different doses of nAb before or after lethal virus challenge. Preventive activity (Figure 5 and Figure 6) was administered to 8 groups of mice at 0.1, 0.3, 1, 3 and 10 mg / kg doses of antibody 3, or 10 mg / kg human isotype non-related control IgG in a single intraperitoneal injection (IP) volume of 100 µl. Four hours after administration, mice were inoculated with 7 times the 50 µl volume of 50% mice lethal dose (7 MLD 50 ) A / California / 7 / 09 (H1N1) (H1-CA09) or 7:1 A / PR / 8:A / HK / 8 / 68 HA (H3N1) (H3-HK68) recombinant strain. Mice were weighed on the day of virus challenge or the day before the virus and monitored daily weight loss and survival for 14 days (miles with weight loss of ≥25% were euthanized). Antibody 3 imparts protection in a dose-dependent manner. IP injection of 1 mg / kg or above antibody 3 provides comprehensive protection in animals challenged by H1-CA09 (Figure 5) and H3-HK68 (Figure 6). Lower antibody doses (0.3 mg / kg) also have a high degree of protection of 90% protection. As expected, none of the mice receiving 10 mg / kg isotype control mAb survived the challenge of fatal infection. Therapeutic activity ( picture 7 And pictures 8) Mice were inoculated with 3 MLD 50 H1-CA09 was injected with antibody 3 (Figure 7) at 24 and 48 hours after infection or 5 MLD at 72, 96 and 120 hours after infection 50 H3-HK68 (Figure 8). Mice challenged by H1-CA09 were protected with 30 mg / kg antibody 3 IP treatment 24 and 48 hours after infection, and mice challenged by H3-HK68 were protected with 30 mg / kg antibody 3 IP treatment 72 and 96 hours after infection. In H1 and H3 models, treatment with the same dose of non-related isotype control antibodies at 0 or 24 hours after infection failed to protect mice from lethal challenge, with survival rates of 0 or 12.5%, respectively. Antibody 3 Therapeutic activity of variants ( picture 9 And pictures 10) Mice inoculated with 3 MLD 50 H1-CA09 and injected with antibodies 24 hours after infection (Figure 9), or inoculated with 7 MLD 50 H3-HK68 was injected with antibodies 48 hours after infection (Fig. 10). 87.5-100% mice challenged by H1-CA09 were protected with 2 mg / kg antibody 3 and variant mAb (antibody 11, antibody 12 and antibody 14) IP treatment, and 50-87.5% mice challenged by H3-HK68 were protected with different doses of 3 mg / kg. As expected, in the H1 and H3 models, treatment with the same dose of non-related isotype control antibodies failed to protect mice at 24 or 48 hours after infection, with survival rates of 0 or 12.5%, respectively. Example 9. Anti- HA The therapeutic effect of the antibody and small molecule inhibitor oseltamivir is to directly compare the protective efficacy and combination therapy effects of the anti-HA nAb and the small molecule neuroamine glycoidase (NA) inhibitor oseltamivir. We use the mouse influenza infection model described in Example 8. Anti- HA nAb Comparison with oseltamivir treatment ( picture 11 And pictures 12) Mice inoculated with 3 MLD 50 H1-CA09 was treated with 10 mg / kg antibody 12 or 25 mg / kg oseltamivir (BID, lasting 5 days) 4 hours before infection or 1 or 2 days after infection (Figure 11). Mice that were 100% challenged by H1-CA09 were protected with antibody 12 before and 1 day after infection, and all animals treated with oseltamivir died from this infection. All animals treated with the same dose of non-related isotype control 4 hours before infection died, with a survival rate of 0%. In addition, mice were inoculated with 7 MLD 50H3-HK68 was then treated with 10 mg / kg antibody 12 or 25 mg / kg oseltamivir (BID, lasting 5 days) 1, 2, 3 or 4 days after infection (Figure 12). Animals treated with antibody 12 1, 2 or 3 days after infection showed a 100% survival rate, while treatment with oseltamivir only showed a 60%-20% survival rate at the same time points. As expected, mice treated with the same dose of non-related isotype control antibodies died of infection with a survival rate of 10%. Anti- HA nAb Combination with oseltamivir ( picture 13) To evaluate the additive effect of the combination of anti-HA mAb and oseltamivir, mice were inoculated with 7 MLD 50 H3-HK68 was treated with the combination of the optimal concentration of antibody 12 (2.5 or 0.3 mg / kg), 25 mg / kg oseltamivir (BID, for 5 days), or antibody 12 (2.5 or 0.3 mg / kg) and 25 mg / kg oseltamivir (BID, for 5 days) 3 days after infection (Figure 13). Only 10-20% of animals were protected with antibody 12 or oseltamivir alone, while 80% of animals were protected with 2.5 mg / kg of antibody 12 and oseltamivir, and 50% of animals were protected with 0.3 mg / kg of antibody 12 and oseltamivir. Example 10. Anti- HA Antibodies and small molecule inhibitors target ferrets H5N1 Therapeutic effects of influenza infection The protective efficacy of anti-HA nAb and oseltamivir against highly pathogenic influenza virus infection was evaluated in Triple Farms of the five to six months of age. All ferrets pass through 1.0 mL (approximately 0.5 mL per nostril) 1 LD 90 A / VN / 1203 / 04 (H5N1) highly pathogenic avian influenza virus was challenged intranasally and then treated with 25 mg / kg single dose of antibody 12 or 25 mg / kg oseltamivir (BID, lasting 5 days) 1, 2 or 3 days after infection. The percentage of survival for each group (n=7) was calculated (Figure 14). The ferrets treated with antibody 12 were protected with oseltamivir 1, 2 and 3 days after infection and the ferretamivir treated with 100% survival rate. However, when oseltamivir treatment started 2 and 3 days after infection, only 71% survived (12 deaths per day) and 29% survived (9 deaths per day) respectively. As expected, animals treated with 25 mg / kg of non-related isotype control antibodies 1 day after infection failed to survive, with a survival rate of 0%. Example 11. By selecting single antibody resistance mutants (MARM) Identification of antigen determinants . Antibody resistance mutants were isolated from three H3N2 viruses using two different methods. A / Aichi / 2 / 68 (Aichi / 68) H3N2 and high concentration antibody 12 (125×IC 50 ) incubated for 1 hour, and then the mixture of virus and antibody was adsorbed at 30,000 TCID50 per well to MDCK cells in a 10×96 well plate and in antibody 12 (10×IC 50 ) cultured in the presence of. Three putative antibodies 12 HK2 / 68 MARM, which exhibited cytopathic effect (CPE) on infected cells up to 3 days after infection. The HA gene was amplified by RT-PCR and subsequently sequenced. Sequence analysis revealed 2 non-synonymous substitutions compared to parental sequences (Table 7). These two nucleotide changes encode monoamine acid substitutions of isochloric acid (I) to spermic acid (R) and asparagine (D) to tyrosine (Y) at amino acid positions 18 and 19 of the highly retained shank region of HA2, respectively. Or, at concentrations from 2-5×IC 50 Increased to 100×IC 50 In the presence of antibody 12, the continuous succession of influenza H3N2 viruses A / Wisconsin / 67 / 2005 (WI05) and ca A / Panama / 2007 / 1999 (Pa99). Mutants that may be leaked are selected by limited dilution and sequence analysis of their homologous HA genes. Monoamine acid changes in HA2 were identified at positions 19 D to Y and 42 of glutamic acid (Q) to R. In addition, a combination of amino acid substitution of histamine (H) to Q at position 156 in HA1 and D19Y, or a combination of amino acid changes of D to asparagine (N) at position 19 and residue 45 in HA2; or a double mutation of a combination of acetic acid (A) to threonic acid (T) and Q42R at position 196 in HA1 (Table 7). Similarly, when Pa99 reaches 100×IC at concentration 50 When the antibody 12 is continuously residing, monoamine acid substitutions at HA2 residues 42 (Q42R) and 45 (I45T) are selected (Table 7). Representative MARM variants shown in Table 7 were used for micro-neutralization assays to further evaluate the phenotypic sensitivity of such MARM neutralization by antibody 12. The results showed that WI05 MARM with mutations D19Y, H156Q / D19Y, D19N / I45N, Q42R or A196T / Q42R was selected in vitro; Pa99 MARM with Q42R or I45T, and Aichi / 68 MARM with mutations D19Y or I18R was less sensitive to antibody neutralization. When compared with its parent wild-type virus strain, the calculated IC was 50 The values ​​increased in ranges from >8 times of the Pa99 resistance pure system to >180 times of the WI05 resistance variant, respectively (Table 8). To evaluate the effect of such amino acid substitution on sensitivity to neutralization by antibody 12, a recombinant A / Hong Kong / 1-5 / 68 (rHK68) H3 variant encoding individual mutations was generated and evaluated using micro-neutralization assays. As shown in Table 9, the H3 rHK68_I18R and rHK68_D19Y variants showed resistance to antibody 12 at the highest concentration tested (~200 µg / mL) and conferred a >130-fold reduction in sensitivity to antibody 12 neutralization compared to wild-type rHK68 virus. The monoamine acid change Q42R in rHK68 results in a moderate reduction in sensitivity to neutralization by antibody 12 by about 8 times. However, the amino acid substitutions identified in the HA protein of the selected MARM (K156Q, A196T, I45N or I45T) did not alter the sensitivity of the recombinant HK68 virus encoding such substitution to antibody 12 in the micro neutralization assay. These results indicate that antibody 12 recognizes the constitutive antigen determinant in the highly retained shank region of HA2 and that the amino acid at positions 18, 19, 42 or 45 is a key contact residue. surface 7. Amino acid substitution identified in H3 HA of antibody 12 resistance mutant surface 8. Sensitivity of H3 resistant variants to antibody 12 neutralization (Neut) surface 9. Sensitivity of rHK68 H3 variant to antibody 12 neutralization (Neut) Table 10 VH consistency percentage of anti-HA antibody series Table 11 VH comparison of anti-HA antibody series (sequences: SEQ ID NO: 167, 2, 12, 22, 152, 32, 42, 52, 62, 72, 82, 92, 102, 112, 122, 132 and 142, respectively) Table 12 Percent of VL consistency of anti-HA antibody series Table 13 VL comparison of anti-HA antibody series (sequences: SEQ ID NO: 168, 7, 17, 27, 157, 37, 47, 57, 67, 77, 87, 97, 107, 117, 127, 137 and 147 respectively) Influenza A References: Corti, D., et al. 2010. Heterosubtypic neutralizing antibodies are produced by individuals immunized with a seasonal influenza vaccine. J Clin Invest 120:1663-1673. Corti, D., et al. 2011. A neutralizing antibody selected from plasma cells that binds to group 1 and group 2 influenza A hemagglutinins. Science 333:850-856. Corti D., et al. 2013. Cross-neutralization of four paramyxoviruses by a human monoclonal antibody. Nature 501(7467):439-43. Ekiert, D. C. et al. 2009. Antibody recognition of a highly conserved influenza virus epidemic. Science 324: 246-251. Ekiert, D. C. et al. 2011. A highly conserved neutralizing epidemic on group 2 influenza A viruses. Science 333:843-850. Ekiert, D. C., et al. 2012. Cross-neutralization of influenza A viruses mediated by a single antibody loop. Nature 489: 526-532. Krause, J. C., et al. 2011. A broadly Neutralizing human monoclonal antibody that recognizes a conserved, novel epitope on the global head of the influenza H1N1 virus hemagglutinin. J. Virol. 85:10905-10908. Lee, P.S., et al. 2012. Heterosubtypic antibody recognition of the influenza virus hemagglutinin receptor binding site enhanced by avidity. Proc Natl Acad Sci U S A. 109: 17040-17045 Li G.M. et al 2012. Pandemic H1N1 influenza vaccine induces a recall response in humans that favors broadly cross-reactive memory B cells. Proc Natl Acad Sci U S A.109: 9047-9052. Nakamura G. et al 2013. An in vivohuman-plasmablast enrichment technique allows rapid identification of therapeutic influenza a antibodies. Cell host microbe 14:93-103 Sui, J., et al. 2009. Structure and functional bases for broad-spectrum neutralization of avian and human influenza A viruses. Nat Struct Mol Biol 16: 265-273. Throsby, M., et al. 2008. Heterosubtypic neutralizing monoclonal antibodies cross-protective against H5N1 and H1N1 recovered from human IgM+ memory B cells. PLoS One 3: e3492 Wang T.T., et al., 2010. Broadly protected monoclonal antibodies against H3 influenza viruses following sequential immunization with different hemagglutinins. PLoS Pathog. 6(2):e1000796. Whittle, J. R. R., et al. 2011. Broadly neutralizing human antibody that Recognizes the receiver-binding pocket of influenza virus hemagglutinin. Proc Natl Acad Sci U S A. 108:14216-14221. Wrammert, J., et al. 2011. Broadly cross-reactive antibodies dominate the human B cell response against 2009 pandemic H1N1 influenza virus infection. J Exp Med. 208:181-193. Sequence list information Antibody 1 ( Original cDNA) Antibody 2 ( Antibody 1 The form of expression ) Antibody 3 ( Codon-optimized antibodies 2) Antibody 4 ( Original cDNA) HCDR3 degenerate nucleotides in t or a Antibody 5 ( Antibody 4 HCDR3 V The form of expression ) Antibody 6 ( Antibody 4 HCDR3 E The form of expression ) Antibody 7 ( Original cDNA) Antibody 8 ( Antibody 7 The form of expression ) Antibody 9 ( Original cDNA) Antibody 10 ( Antibody 9 The form of expression ) Antibody 11 Antibody 12 Antibody 13 Antibody 14 Antibody 15 Antibody 3-GL Figure 1A shows the binding of antibody 3 and antibody 12 to the subtypes H11, H12, H13, H16, H17, H4, H10, H14 and H15 of the HA proteins surface-represented. Histograms depict the fluorescent intensity of antibodies bound to HA-transfected cells represented in white or mimetics represented in gray. Figure 1B shows the percentage of inhibition of fusion of chicken red blood cells to A / Puerto Rico / 8 / 34 in the presence of antibody 3, antibody 12 or MPE8v3 (non-related virus fusion protein antibody) (Corti D et al., 2013, Nature 501). 1C and 1D show the immune ink dots that were not lysed (HA0) after 5, 10 or 20 minutes of trypsin decomposition. The decomposition reactant in 1C contains HA (inlet), or HA pretreated with FI6v4 (revealed in WO 2013 / 011347A1), antibody 3, FE17.23 (spherical head specific mAb) (Corti D et al., 2010, J Clin Invest 120) or non-related control antibody (control IgG), and the decomposition reactant in 1D contains HA (inlet), or HA, antibody 12, antibody 14 or non-related control antibody (control IgG) pretreated with 3. Figure 2 shows the percentage of NK cell-mediated killing of MDCK cells infected with A / HK / 8 / 68 in the presence of increased amounts of antibody 3, antibody 11, antibody 12 and antibody 14. Figure 3 shows the percentage of macrophages that phagocytize MDCK target cells showing A / HK / 8 / 68 HA in the presence of increased amounts of antibody 3, antibody 11, antibody 12 and antibody 14 or non-related isotype control (control IgG). Figure 4 shows the percentage of complement-dependent killing of A / PR / 8 / 34 infected MDCK cells in the presence of increased amounts of antibody 3, antibody 11, antibody 12 and antibody 14. Figure 5 shows the percentage of active animals in each population studied when different concentrations of antibody 3 or non-related control antibodies (control IgG) were administered to mice 4 hours before infection with the lethal dose of H1N1 influenza virus. Figure 6 shows the percentage of active animals in each population studied when different concentrations of antibody 3 or non-related control antibodies (control IgG) were administered to mice 4 hours before infection with the lethal dose of H3 influenza virus. Figure 7 shows the percentage of active animals present in each population when mice were infected with a lethal dose of H1N1 influenza virus and treated with 30 mg / kg antibody 3 or non-related control antibody (control IgG) at different time points (1 and 2 days after infection). Figure 8 shows the percentage of active animals in the study populations of mice infected with lethal doses of H3 influenza virus and treated with 30 mg / kg antibody 3 or non-related control antibodies (control IgG) at different time points (3, 4 and 5 days after infection). Figure 9 shows the percentage of active animals present in each population of mice that were infected with a lethal dose of H1N1 influenza virus and treated with 2 mg / kg antibody 3, antibody 11, antibody 12, antibody 14 or non-related control antibody (control IgG) 1 day after infection. Figure 10 shows the percentage of active animals present in each population of mice that were infected with a lethal dose of H3 influenza virus and treated with 3 mg / kg antibody 3, antibody 11, antibody 12, antibody 14 or non-related control antibody (control IgG) 2 days after infection. Figure 11 shows the percentage of active animals present in the populations of the study of the study of the treatment of 25 mg / kg BID oseltamivir at a lethal dose of H1N1 influenza virus at different time points (4 hours before infection, 1 day after infection, or 2 days after infection). Figure 12 shows the percentage of active animals present in the populations of mice with a lethal dose of H3 influenza virus and started at different time points (1, 2, 3 or 4 days after infection) or 25 mg / kg oral oseltamivir twice daily (BID) for 5 days, or a single dose of 10 mg / kg antibody 12, or 10 mg / kg non-related control antibody (control IgG). Figure 13 shows the percentage of active animals in the study of a combination of mice infected with the lethal dose of H3 influenza virus and treated with a single dose of antibody 12, 25 mg / kg BID oseltamivir for 5 days, or 2.5 mg / kg or 0.3 mg / kg antibody 12 and 25 mg / kg BID oseltamivir for 5 days 2 days after infection. Figure 14 shows the percentage of ferrets in each population studied after infection with lethal doses of H5N1 influenza virus and treated with 25 mg / kg single dose of antibody 12, 25 mg / kg BID oseltamivir for 5 days or non-related control antibodies (control IgG) 1, 2 or 3 days after infection. Figure 15 shows the alignment of HA2 proteins for influenza A virus strain selected by MARM (sequence SEQ ID NO: 169 to 172, respectively). <![CDATA[<110> MEDIMMUNE, LLC]]> Swiss Business Hanbes Biopharmaceutical Company (HUMABS BIOMED SA) <![CDATA[<120> Neutralized Anti-Influenza A Antibody and Its Use]]> <![CDATA[<140> ]]> <![CDATA[<141> 2014-10-02]]> <![CDATA[<150> 62 / 002,414]]> <![CDATA[<151> 2014-05-23]]> <![CDATA[<150> 61 / 885,808]]> <![CDATA[<151> 2013-10-02]]> <![CDATA[<160> 172 ]]> <![CDATA[<170> PatentIn version 3.5]]> <![CDATA[<210> 1]]> <![CDATA[<211> 385]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 1]]> cagatacagc tgcaggagtc gggtccagga ctggtgaagc cctcgcagac cctctcactc 60 acctgtgcca tctccggggga cagtgtctct agcaacaatg ctgtttggaa ctggatcagg 120 cagtccccat cgagaggcct tgagtggctg ggaaggacat actacaggtc caagtggttat 180 aatgattatg cagaatctgt gaaaagtcga ataaccgtca atccagaacac atccaagaac 240 cagttctcccc tgcacctgaa gtctgtgact cccgaggaca cggctgtgttt ttactgtgta 300 cgatctggcc acattacggtttggagtg aatgttgacg cttttgatat gtggggccaa 360 gggacaatgg tcaccgtctc ttcag 385 <![CDATA[<210> 2]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 2]]> Gln Ile Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Asn Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Thr Val Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu His Leu Lys Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95 Phe Tyr Cys Val Arg Ser Gly His Ile Thr Val Phe Gly Val Asn Val 100 105 110 Asp Ala Phe Asp Met Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 3]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 3]]> Ser Asn Asn Ala Val Trp Asn 1 5 <![CDATA[<210> 4]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 4]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 5]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 5]]> Ser Gly His Ile Thr Val Phe Gly Val Asn Val Asp Ala Phe Asp Met 1 5 10 15 <![CDATA[<210> 6]]> <![CDATA[<211> 309]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 6]]> gacatccaga tcaccagcagtc gccatcctcc ctgtctgcat ctgtaggaga cagagtaacc 60 atcacttgcc ggacaagtca gagccttagt agctatttac attggtatca gcagaaacca 120 gggaaagcccccccaagctcct gatctatgctgctgcatccagttt tgcaaagtgg ggtcccatcatca 180 aggttcagtg gcagtggatc tgggacagattcactctca ccatcagttag tctgcaacct 240 gaagattttg caacttacta ctgtcaacag agtcggacgtttcggccaagg gaccaaggt 300 gaaatcaaa 309 <![CDATA[<210> 7]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 7]]> Asp Ile Gln Ile Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Leu Ser Ser Tyr 20 25 30 Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 8]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 8]]> Arg Thr Ser Gln Ser Leu Ser Ser Tyr Leu His 1 5 10 <![CDATA[<210> 9]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 9]]> Ala Ala Ser Ser Leu Gln Ser 1 5 <![CDATA[<210> 10]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 10]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 11]]> <![CDATA[<211> 385]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 11]]> caggtacagc tgcaggagtc gggtccaggagga ctggtgaagc cctcgcagac cctctcactc 60 acctgtgcca tctccggggga cagtgtctct agcaacaatg ctgtttggaa ctggatcagg 120 cagtccccat cgagaggcct tgagtggctg ggaaggacat actacaggtc caagtggttat 180 aatgattatg cagaatctgt gaaaagtcga ataaccgtca atccagaacac atccaagaac 240 cagttctcccc tgcacctgaa gtctgtgact cccgaggaca cggctgtgttt ttactgtgta 300 cgatctggcc acattacggtttggagtg aatgttgacg cttttgatat gtggggccaa 360 gggacaatgg tcaccgtctc ttcag 385 <![CDATA[<210> 12]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 12]]> Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Asn Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Thr Val Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu His Leu Lys Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95 Phe Tyr Cys Val Arg Ser Gly His Ile Thr Val Phe Gly Val Asn Val 100 105 110 Asp Ala Phe Asp Met Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 13]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> person]]> process sequence <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 13]]> Ser Asn Asn Ala Val Trp Asn 1 5 <![CDATA[<210> 14]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 14]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 15]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 15]]> Ser Gly His Ile Thr Val Phe Gly Val Asn Val Asp Ala Phe Asp Met 1 5 10 15 <![CDATA[<210> 16]]> <![CDATA[<211> 309]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 16]]> gacatccaga tgaccagcagtc gccatcctcc ctgtctgcat ctgtaggaga cagagtaacc 60 atcacttgcc ggacaagtca gagccttagt agctatttac attggtatca gcagaaacca 120 gggaaagcccccccaagctcct gatctatgctgctgcatccagttt tgcaaagtgg ggtcccatcatca 180 aggttcagtg gcagtggatc tgggacagattcactctca ccatcagttag tctgcaacct 240 gaagattttg caacttacta ctgtcaacag agtcggacgtttcggccaagg gaccaaggt 300 gaaatcaaa 309 <![CDATA[<210> 17]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 17]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Leu Ser Ser Tyr 20 25 30 Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 18]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 18]]> Arg Thr Ser Gln Ser Leu Ser Ser Tyr Leu His 1 5 10 <![CDATA[<210> 19]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 19]]> Ala Ala Ser Ser Leu Gln Ser 1 5 <![CDATA[<210> 20]]> <![CDATA[<211> 5]]> <![CDATA[<212> ]]>PRT <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 20]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 21]]> <![CDATA[<211> 384]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 21]]> caggtccagc tgcaggagag cggccccgga ctggtcaagc cttcacagac actgagcctg 60 acatgcgcca ttagcggaga tagcgtgagc tccaacaatg ccgtggaa ctggatcagg 120 cagtctccaa gtcgaggact ggagtggctg ggacgaacat actatagatc caagtggttac 180 aatgactatg ctgaatcagt gaaaagccgaattgtca accccgatac ctccaagaat 240 cagttctctc tgcacctgaa aagtgtgacc ccgaggacaca cagccgtgtt ctactgcgtc 300 agaagcggcc atatcaccgt ctttggcgtc aatgtggatg ctttcgatat gtggggggcag 360 gggactatgg tcaccgtgtc aagc 384 <![CDATA[<210> 22]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 22]]> Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Asn Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Thr Val Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu His Leu Lys Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95 Phe Tyr Cys Val Arg Ser Gly His Ile Thr Val Phe Gly Val Asn Val 100 105 110 Asp Ala Phe Asp Met Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 23]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 23]]> Ser Asn Asn Ala Val Trp Asn 1 5 <![CDATA[<210> ]]>24 <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 24]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 25]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 25]]> Ser Gly His Ile Thr Val Phe Gly Val Asn Val Asp Ala Phe Asp Met 1 5 10 15 <![CDATA[<210> 26]]> <![CDATA[<211> 309]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 26]]> gatattcaga tgacccagag cccttccagc ctgtccgctt cagtggggga tcgagtgacc 60 attacctgcc gaaccagcca gagcctgagc tcctacctgc actggtatca gcagaagccc 120 ggcaaagcccc ctaagctgctgctgccgccgcttctagtc tgcagtccgg agtgccaagc 180 cggttctccg gatctgggag tggaaccgac tttacccctga caatttcaag cctgcagcccccccc 240 gaggatttcg ctacatacta ctgtcagcag agcagaactt tcggcagcagcagcagg cactaaggtg 300 gagatcaaa 309 <![CDATA[<210> 27]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 27]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Leu Ser Ser Tyr 20 25 30 Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 28]]> <![CDATA[<211> 11]]> <![CDATA[<212]]>> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> <![CDATA[ Peptide <![CDATA[<400> 28]]> Arg Thr Ser Gln Ser Leu Ser Ser Tyr Leu His 1 5 10 <![CDATA[<210> 29]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 29]]> Ala Ala Ser Ser Leu Gln Ser 1 5 <![CDATA[<210> 30]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 30]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 31]]> <![CDATA[<211> 385]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 31]]> caggtccagc tgcagcagtc aggtccaggagga ctggtgaagc cctcgcagac cctctcactc 60 acctgtgcca tctccggggga cagagtctct agcaacagtg ctgtttggaa ctggatcagg 120 cagtccccat cgagaggcct cgagtggctg ggaaggacat attacaggtc caaatggttat 180 tatgattatg cagaatctgt gaaaagtcga atagttatcg acccagaac atccaagaac 240 caggtctcccc tgcagttgaa ttctgtgact cccgaggact cggcttatata ttactgtgca 300 agaggtggcc aattacggt gtttggggctg aatattgacg cttatgatatttggggccaa 360 ggggcaaagg tcaccgtgtc ttcag 385 <![CDATA[<210> 32]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 32]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Arg Val Ser Ser Asn 20 25 30 Ser Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Tyr Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Val Ile Asp Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Val Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Ser Ala Ile 85 90 95 Tyr Tyr Cys Ala Arg Gly Gly His Ile Thr Val Phe Gly Leu Asn Ile 100 105 110 Asp Ala Tyr Asp Ile Trp Gly Gln Gly Ala Lys Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 33]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 33]]> Ser Asn Ser Ala Val Trp Asn 1 5 <![CDATA[<210> 34]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 34]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Tyr Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 35]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 35]]> Gly Gly His Ile Thr Val Phe Gly Leu Asn Ile Asp Ala Tyr Asp Ile 1 5 10 15 <![CDATA[<210> 36]]> <![CDATA[<211> 307]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 36]]> gacatccaggagg tgaccagtc tccgtcctcc ctgtctgcat ctgtaggagacagtcacc 60 actctcttgcc gggcacagag ccttagcagc tacttacatt ggtatcagcagagagagagagagagagagag 120 caacccccta aactcctgat ctatgctgca aaccactttgc aaagtggggt cccatcacgg 180 ttcagtggta gtggatctgg gacagatttc actctcacca tcagtactttt ccaagctgaa 240 gatgttgcca cttactattg tcaacaggttcg gccaagggaccaaggttgaa 300 atcaaac 307 <![CDATA[<210> 37]]> <![CDATA[<211> 102]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 37]]> Asp Ile Gln Val Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Gln Ser Leu Ser Ser Tyr Leu 20 25 30 His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr 35 40 45 Ala Ala Thr Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Thr Phe Gln Ala Glu 65 70 75 80 Asp Val Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln Gly 85 90 95 Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 38]]> <![CDATA[<211> 10]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 38]]> Arg Ala Gln Ser Leu Ser Ser Tyr Leu His 1 5 10 <![CDATA[<210> 39]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 39]]> Ala Ala Thr Thr Leu Gln Ser 1 5 <![CDATA[<210> 40]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 40]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 41]]> <![CDATA[<211> 385]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 41]]> caggtacagc tgcagcagtc aggtccaggagga ctggtgaagc cctcgcagac cctctcactc 60 acctgtgcca tctccggggga cagagtctct agcaacagtg ctgtttggaa ctggatcagg 120 cagtccccat cgagaggcct cgagtggctg ggaaggacat attacaggtc caaatggttat 180 tatgattatg cagaatctgt gaaaagtcga atagttatcg acccagaac atccaagaac 240 caggtctcccc tgcagttgaa ttctgtgact cccgaggact cggcttatata ttactgtgca 300 agaggtggcc aattacggt gtttggggctg aatattgacg cttatgatatttggggccaa 360 ggggcaatgg tcaccgtctc ttcag 385 <![CDATA[<210> 42]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 42]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Arg Val Ser Ser Asn 20 25 30 Ser Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Tyr Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Val Ile Asp Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Val Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Ser Ala Ile 85 90 95 Tyr Tyr Cys Ala Arg Gly Gly His Ile Thr Val Phe Gly Leu Asn Ile 100 105 110 Asp Ala Tyr Asp Ile Trp Gly Gln Gly Ala Met Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 43]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 43]]> Ser Asn Ser Ala Val Trp Asn 1 5 <![CDATA[<210> 44]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 44]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Tyr Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 45]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 45]]> Gly Gly His Ile Thr Val Phe Gly Leu Asn Ile Asp Ala Tyr Asp Ile 1 5 10 15 <![CDATA[<210> 46]]> <![CDATA[<211> 307]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 46]]> gacatccaga tgaccagcagtc tccgtcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 actctcttgcc gggcacagag ccttagcagc tacttacatt ggtatcagcagagagagagagagagagagag 120 caacccccta aactcctgat ctatgctgca aaccactttgc aaagtggggt cccatcacgg 180 ttcagtggta gtggatctgg gacagatttc actctcacca tcagtactttt ccaagctgaa 240 gatgttgcca cttactattg tcaacaggagt cggacgttcg gccaagggaccaaggtggag 300 atcaaac 307 <![CDATA[<210> 47]]> <![CDATA[<211> 102]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 47]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Gln Ser Leu Ser Ser Tyr Leu 20 25 30 His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr 35 40 45 Ala Ala Thr Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Thr Phe Gln Ala Glu 65 70 75 80 Asp Val Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln Gly 85 90 95 Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 48]]> <![CDATA[<211> 10]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 48]]> Arg Ala Gln Ser Leu Ser Ser Tyr Leu His 1 5 10 <![CDATA[<210> 49]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 49]]> Ala Ala Thr Thr Leu Gln Ser 1 5 <![CDATA[<210> 50]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 50]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 51]]> <![CDATA[<211> 385]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 51]]> caggtacagc tgcagcagtc aggtccaggagga ctggtgaagc cctcgcagac cctctcactc 60 acctgtgcca tctccggggga cagagtctct agcaacagtg ctgtttggaa ctggatcagg 120 cagtccccat cgagaggcct cgagtggctg ggaaggacat attacaggtc caaatggttat 180 tatgattatg cagaatctgt gaaaagtcga atagttatcg acccagaac atccaagaac 240 caggtctcccc tgcagttgaa ttctgtgact cccgaggact cggcttatata ttactgtgca 300 agaggtggcc acattacgga gtttggggctg aatattgacg cttatgatatttggggccaa 360 ggggcaatgg tcaccgtctc ttcag 385 <![CDATA[<210> 52]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 52]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Arg Val Ser Ser Asn 20 25 30 Ser Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Tyr Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Val Ile Asp Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Val Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Ser Ala Ile 85 90 95 Tyr Tyr Cys Ala Arg Gly Gly His Ile Thr Glu Phe Gly Leu Asn Ile 100 105 110 Asp Ala Tyr Asp Ile Trp Gly Gln Gly Ala Met Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 53]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 53]]> Ser Asn Ser Ala Val Trp Asn 1 5 <![CDATA[<210> 54]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence]]>: Synthesis Peptides <![CDATA[<400> 54]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Tyr Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 55]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 55]]> Gly Gly His Ile Thr Glu Phe Gly Leu Asn Ile Asp Ala Tyr Asp Ile 1 5 10 15 <![CDATA[<210> 56]]> <![CDATA[<211> 307]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 56]]> gacatccaga tgaccagcagtc tccgtcctcc ctgtctgcat ctgtaggaga cagagtcacc 60 actctcttgcc gggcacagag ccttagcagc tacttacatt ggtatcagcagagagagagagagagaga 120 caacccccta aactcctgat ctatgctgca aaccactttgc aaagtggggt cccatcacgg 180 ttcagtggta gtggatctgg gacagatttc actctcacca tcagtactttt ccaagctgaa 240 gatgttgcca cttactattg tcaacaggagt cggacgttcg gccaagggaccaaggtggag 300 atcaaac 307 <![CDATA[<210> 57]]> <![CDATA[<211> 102]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 57]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Gln Ser Leu Ser Ser Tyr Leu 20 25 30 His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr 35 40 45 Ala Ala Thr Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly Ser 50 55 60 Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Thr Phe Gln Ala Glu 65 70 75 80 Asp Val Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln Gly 85 90 95 Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 58]]> <![CDATA[<211> 10]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 58]]> Arg Ala Gln Ser Leu Ser Ser Tyr Leu His 1 5 10 <![CDATA[<210> 59]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 59]]> Ala Ala Thr Thr Leu Gln Ser 1 5 <![CDATA[<210> 60]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 60]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 61]]> <![CDATA[<211> 385]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 61]]> caggtacagc tgcagcagtc aggtccaggagga ctggtgaagc cctcgcagac cctctccctcctc 60 acctgtgtca tctccggagaga cactgtctct agcaacagag ctacttggaa ttggatgagg 120 cagtccccat tgagaggcct tgagtggctg ggaaggacat actacaggtc caagtggttat 180 aatgattacg cagtttctgt gaaaagtcga gtagtcatca acccagacac atccaagaac 240 caagtctcccc tgcagttgaa cactgtgact cccgatgact cgggtgtata cttttgtgca 300 agaggtggcc acatcacggt ctttggagt aatattgacg cttttgacat ctggggcctc 360 gggacaaagg tcaccgtctc ttcag 385 <![CDATA[<210> 62]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 62]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Val Ile Ser Gly Asp Thr Val Ser Ser Asn 20 25 30 Arg Ala Thr Trp Asn Trp Met Arg Gln Ser Pro Leu Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Val Ser Val Lys Ser Arg Val Val Val Ile Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Val Ser Leu Gln Leu Asn Thr Val Thr Pro Asp Asp Ser Gly Val 85 90 95 Tyr Phe Cys Ala Arg Gly Gly His Ile Thr Val Phe Gly Val Asn Ile 100 105 110 Asp Ala Phe Asp Ile Trp Gly Leu Gly Thr Lys Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 63]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 63]]> Ser Asn Arg Ala Thr Trp Asn 1 5 <![CDATA[<210> 64]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 64]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala Val Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 65]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 65]]> Gly Gly His Ile Thr Val Phe Gly Val Asn Ile Asp Ala Phe Asp Ile 1 5 10 15 <![CDATA[<210> 66]]> <![CDATA[<211> 310]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 66]]> gacatccagg tgaccagtc tccatcctcctcc ctgtctgcat ctgtaggagacagttacc 60 atctcttgcc gggcaagtca gagacttaat agttatctac attggtatca gcagacacca 120 gggcaagcccccccgaagctgctgctgatctatgca acgtccactttt tgcaaagtgg ggtctcacca 180 agattcagtg gcagtggatc tgggacagat ttcactctca ccatcagcag tctccaacct 240 gaagatgttg caacttacta ctgtcaattg agtcggacgttt tcggccacggg gaccaaggtt 300 gaaatcaaac 310 <![CDATA[<210> 67]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 67]]> Asp Ile Gln Val Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Arg Leu Asn Ser Tyr 20 25 30 Leu His Trp Tyr Gln Gln Thr Pro Gly Gln Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Thr Ser Thr Leu Gln Ser Gly Val Ser Pro Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Gln Leu Ser Arg Thr Phe Gly His 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 68]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 68]]> Arg Ala Ser Gln Arg Leu Asn Ser Tyr Leu His 1 5 10 <![CDATA[<210> 69]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 69]]> Ala Thr Ser Thr Leu Gln Ser 1 5 <![CDATA[<210> 70]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 70]]> Gln Leu Ser Arg Thr 1 5 <![CDATA[<210> 71]]> <![CDATA[<211> 385]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 71]]> caggtacagc tgcagcagtc aggtccaggagga ctggtgaagc cctcgcagac cctctccctcctc 60 acctgtgtca tctccggagaga cactgtctct agcaacagag ctacttggaa ttggatgagg 120 cagtccccat tgagaggcct tgagtggctg ggaaggacat actacaggtc caagtggttat 180 aatgattacg cagtttctgt gaaaagtcga gtagtcatca acccagacac atccaagaac 240 caagtctcccc tgcagttgaa cactgtgact cccgatgact cgggtgtata cttttgtgca 300 agaggtggcc acatcacggt ctttggagt aatattgacg cttttgacat ctggggcctc 360 gggacaaagg tcaccgtctc ttcag 385 <![CDATA[<210> 72]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 72]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Val Ile Ser Gly Asp Thr Val Ser Ser Asn 20 25 30 Arg Ala Thr Trp Asn Trp Met Arg Gln Ser Pro Leu Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Val Ser Val Lys Ser Arg Val Val Val Ile Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Val Ser Leu Gln Leu Asn Thr Val Thr Pro Asp Asp Ser Gly Val 85 90 95 Tyr Phe Cys Ala Arg Gly Gly His Ile Thr Val Phe Gly Val Asn Ile 100 105 110 Asp Ala Phe Asp Ile Trp Gly Leu Gly Thr Lys Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 73]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 73]]> Ser Asn Arg Ala Thr Trp Asn 1 5 <![CDATA[<210> 74]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 74]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala Val Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 75]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 75]]> Gly Gly His Ile Thr Val Phe Gly Val Asn Ile Asp Ala Phe Asp Ile 1 5 10 15 <![CDATA[<210> 76]]> <![CDATA[<211> 310]]> <![CDATA[<212> DNA]]> <![CDATA[<213]]>> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> <![CDATA[ polynucleotide <![CDATA[<400> 76]]> gacatccaga tgaccagcagtc tccatcctcc ctgtctgcat ctgtaggaga cagagttacc 60 atctcttgcc gggcaagtca gagacttaat agttatctac attggtatca gcagacacca 120 gggcaagcccccccgaagctgctgctgatctatgca acgtccactttt tgcaaagtgg ggtctcacca 180 agattcagtg gcagtggatc tgggacagat ttcactctca ccatcagcag tctccaacct 240 gaagatgttg caacttacta ctgtcaattg agtcggacgtttttg tcggccacggg gaccaaggtg 300 gaaatcaaac 310 <![CDATA[<210> 77]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 77]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Arg Leu Asn Ser Tyr 20 25 30 Leu His Trp Tyr Gln Gln Thr Pro Gly Gln Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Thr Ser Thr Leu Gln Ser Gly Val Ser Pro Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Val Ala Thr Tyr Tyr Cys Gln Leu Ser Arg Thr Phe Gly His 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 78]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 78]]> Arg Ala Ser Gln Arg Leu Asn Ser Tyr Leu His 1 5 10 <![CDATA[<210> 79]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 79]]> Ala Thr Ser Thr Leu Gln Ser 1 5 <![CDATA[<210> 80]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 80]]> Gln Leu Ser Arg Thr 1 5 <![CDATA[<210> 81]]> <![CDATA[<211> 385]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 81]]> caagtagc tgcagcagtc aggtccaggagga ctggtgaagc cctcgcagac cctctcactc 60 acctgtgcca tctccggggga cagtgtctct agcaacagtg ctacttggaa ctggatcagg 120 cagtccccat cgagaggcct tgagtggctg ggaaggacat actacaggtc caagtggttat 180 aatgattatg cagattttct gaaaaggcga ataaccatca atccagaacacacacac 240 gaggtctcccc tgcggctgac ctctgtgact cccgacgaca cggctttgta ttactgtgca 300 agaggtggcc aattacggttggagtg aatattgacg cctttgacgt ctgggggccaa 360 gggacaatgg ccaccgtctc ttcag 385 <![CDATA[<210> 82]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 82]]> Gln Val Glu Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Ser Ala Thr Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Asp Phe Leu Lys Arg Arg Ile Thr Ile Asn Pro Asp Thr Ser Asn Asn 65 70 75 80 Glu Val Ser Leu Arg Leu Thr Ser Val Thr Pro Asp Asp Thr Ala Leu 85 90 95 Tyr Tyr Cys Ala Arg Gly Gly His Ile Thr Val Phe Gly Val Asn Ile 100 105 110 Asp Ala Phe Asp Val Trp Gly Gln Gly Thr Met Ala Thr Val Ser Ser 115 120 125 <![CDATA[<210> 83]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 83]]> Ser Asn Ser Ala Thr Trp Asn 1 5 <![CDATA[<210> 84]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 84]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala Asp Phe Leu 1 5 10 15 Lys Arg <![CDATA[<210> 85]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 85]]> Gly Gly His Ile Thr Val Phe Gly Val Asn Ile Asp Ala Phe Asp Val 1 5 10 15 <![CDATA[<210> 86]]> <![CDATA[<211> 310]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 86]]> gacatccagg tgaccaggtc tccatcctcctcc ctgtctgcat ctgtaggagacacacc 60 atctcttgcc ggacaagtca gagccttagg agctatttac attggtatca gcaaaaacca 120 gggaaagccccccccaagctcct gatctatgcttt tcatccacttt tacaaagtgg ggtcccatcatca 180 aggttcagtg gcagtggatc tgggacagattcactctca ccatcagcaa tctccaacct 240 gaagattttg caacttacta ctgtcaactg agtcggacgtt tcggccaagggggggggaaggt 300 gaaatcaaac 310 <![CDATA[<210> 87]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 87]]> Asp Ile Gln Val Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Ile Thr Ile Ser Cys Arg Thr Ser Gln Ser Leu Arg Ser Tyr 20 25 30 Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ser Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Leu Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 88]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> person]]> process sequence <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 88]]> Arg Thr Ser Gln Ser Leu Arg Ser Tyr Leu His 1 5 10 <![CDATA[<210> 89]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 89]]> Ala Ser Ser Thr Leu Gln Ser 1 5 <![CDATA[<210> 90]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 90]]> Gln Leu Ser Arg Thr 1 5 <![CDATA[<210> 91]]> <![CDATA[<211> 385]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 91]]> caggtacagc tgcagcagtc aggtccaggagga ctggtgaagc cctcgcagac cctctcactc 60 acctgtgcca tctccggggga cagtgtctct agcaacagtg ctacttggaa ctggatcagg 120 cagtccccat cgagaggcct tgagtggctg ggaaggacat actacaggtc caagtggttat 180 aatgattatg cagattttct gaaaaggcga ataaccatca atccagaacacacacac 240 gaggtctcccc tgcggctgac ctctgtgact cccgacgaca cggctttgta ttactgtgca 300 agaggtggcc aattacggttggagtg aatattgacg cctttgacgt ctgggggccaa 360 gggacaatgg tcaccgtctc ttcag 385 <![CDATA[<210> 92]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 92]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Ser Ala Thr Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Asp Phe Leu Lys Arg Arg Ile Thr Ile Asn Pro Asp Thr Ser Asn Asn 65 70 75 80 Glu Val Ser Leu Arg Leu Thr Ser Val Thr Pro Asp Asp Thr Ala Leu 85 90 95 Tyr Tyr Cys Ala Arg Gly Gly His Ile Thr Val Phe Gly Val Asn Ile 100 105 110 Asp Ala Phe Asp Val Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 93]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 93]]> Ser Asn Ser Ala Thr Trp Asn 1 5 <![CDATA[<210> 94]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 94]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala Asp Phe Leu 1 5 10 15 Lys Arg <![CDATA[<210> 95]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 95]]> Gly Gly His Ile Thr Val Phe Gly Val Asn Ile Asp Ala Phe Asp Val 1 5 10 15 <![CDATA[<210> 96]]> <![CDATA[<211> 310]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 96]]> gacatccaga tgaccagcagtc tccatcctcc ctgtctgcat ctgtaggaga cagaatcacc 60 atctcttgcc ggacaagtca gagccttagg agctatttac attggtatca gcaaaaacca 120 gggaaagccccccccaagctcct gatctatgcttt tcatccacttt tacaaagtgg ggtcccatcatca 180 aggttcagtg gcagtggatc tgggacagattcactctca ccatcagcaa tctccaacct 240 gaagattttg caacttacta ctgtcaactg agtcggacgtttcggccaagg 300 gagatcaaac 310 <![CDATA[<210> 97]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 97]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Ile Thr Ile Ser Cys Arg Thr Ser Gln Ser Leu Arg Ser Tyr 20 25 30 Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ser Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Leu Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 98]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 98]]> Arg Thr Ser Gln Ser Leu Arg Ser Tyr Leu His 1 5 10 <![CDATA[<210> 99]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 99]]> Ala Ser Ser Thr Leu Gln Ser 1 5 <![CDATA[<210> 100]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 100]]> Gln Leu Ser Arg Thr 1 5 <![CDATA[<210> 101]]> <![CDATA[<211> 384]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 101]]> caggtccagc tgcagcagag cggccccgga ctggtcaagc cttcacagac actgagcctg 60 acatgcgcca ttagcggaga tagcgtgagc tcctacaatgcc ccgtgtggaa ctggatcagg 120 cagtctccaa gtcgaggact ggagtggctg ggacgaacat actatagatc cgggtggttac 180 aatgactatg ctgaatcagt gaaaagccgaatattaca accccgatac ctccaagaat 240 cagttctctc tgcagctgaa cagtgtgacc ccgaggacaca cagccgtgtgta ctactgcgcc 300 agaagcggcc atatcaccgt ctttggcgtc aatgtggatg ctttcgatat gtggggggcag 360 gggactatgg tcaccgtgtc aagc 384 <![CDATA[<210> 102]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 102]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Tyr 20 25 30 Asn Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Gly Trp Tyr Asn Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Ser Gly His Ile Thr Val Phe Gly Val Asn Val 100 105 110 Asp Ala Phe Asp Met Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 103]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 103]]> Ser Tyr Asn Ala Val Trp Asn 1 5 <![CDATA[<210> 104]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 104]]> Arg Thr Tyr Tyr Arg Ser Gly Trp Tyr Asn Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 105]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 105]]> Ser Gly His Ile Thr Val Phe Gly Val Asn Val Asp Ala Phe Asp Met 1 5 10 15 <![CDATA[<210> 106]]> <![CDATA[<211> 309]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 106]]> gatattcaga tgacccagag cccttccagc ctgtccgctt cagtggggga tcgagtgacc 60 attacctgcc gaaccagcca gagcctgagc tcctacacgc actggtatca gcagaagccc 120 ggcaaagcccc ctaagctgctgctgccgccgcttctagtc ggctgtccgg agtgccaagc 180 cggttctccg gatctgggag tggaaccgac tttacccctga caatttcaag cctgcagcccccccc 240 gaggatttcg ctacatacta ctgtcagcag agcagaactt tcggcagcagcagcagg cactaaggtg 300 gagatcaaa 309 <![CDATA[<210> 107]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 107]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Leu Ser Ser Tyr 20 25 30 Thr His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Arg Leu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 108]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 108]]> Arg Thr Ser Gln Ser Leu Ser Ser Tyr Thr His 1 5 10 <![CDATA[<210> 109]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 109]]> Ala Ala Ser Ser Arg Leu Ser 1 5 <![CDATA[<210> 110]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 110]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 111]]> <![CDATA[<211> 384]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 111]]> caggtccagc tgcagcagag cggccccgga ctggtcaagc cttcacagac actgagcctg 60 acatgcgcca ttagcggaga tagcgtgagc tcctacaatgcc ccgtgtggaa ctggatcagg 120 cagtctccaa gtcgaggact ggagtggctg ggacgaacat actatagatc cgggtggttac 180 aatgactatg ctgaatcagt gaaaagccgaatattaca accccgatac ctccaagaat 240 cagttctctc tgcagctgaa cagtgtgacc ccgaggacaca cagccgtgtgta ctactgcgcc 300 agaagcggcc atatcaccgt ctttggcgtc aatgtggatg ctttcgatat gtggggggcag 360 gggactatgg tcaccgtgtc aagc 384 <![CDATA[<210> 112]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 112]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Tyr 20 25 30 Asn Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Gly Trp Tyr Asn Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Ser Gly His Ile Thr Val Phe Gly Val Asn Val 100 105 110 Asp Ala Phe Asp Met Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 113]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 113]]> Ser Tyr Asn Ala Val Trp Asn 1 5 <![CDATA[<210> 114]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 114]]> Arg Thr Tyr Tyr Arg Ser Gly Trp Tyr Asn Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 115]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 115]]> Ser Gly His Ile Thr Val Phe Gly Val Asn Val Asp Ala Phe Asp Met 1 5 10 15 <![CDATA[<210> 116]]> <![CDATA[<211> 309]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 116]]> gatattcaga tgacccagag cccttccagc ctgtccgctt cagtggggga tcgagtgacc 60 attacctgcc gaaccagcca gagcctgagc tcctacacgc actggtatca gcagaagccc 120 ggcaaagccc ctaagctgct gatctacgcc gcttctagtc gggggtccgg agtgccaagc 180 cggttctccg gatctgggag tggaaccgac tttacccctga caatttcaag cctgcagcccccccc 240 gaggatttcg ctacatacta ctgtcagcag agcagaactt tcggcagcagcagcagg cactaaggtg 300 gagatcaaa 309 <![CDATA[<210> 117]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 117]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Leu Ser Ser Tyr 20 25 30 Thr His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Arg Gly Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 118]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 118]]> Arg Thr Ser Gln Ser Leu Ser Ser Tyr Thr His 1 5 10 <![CDATA[<210> 119]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 119]]> Ala Ala Ser Ser Arg Gly Ser 1 5 <![CDATA[<210> 120]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence]]> Description: Synthesis Peptides <![CDATA[<400> 120]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 121]]> <![CDATA[<211> 384]]> <![CDATA[<212> DNA]]> <![CDATA[<213> person]]> process sequence <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 121]]> caggtccagc tgcagcagag cggccccgga ctggtcaagc cttcacagac actgagcctg 60 acatgcgcca ttagcggaga tagcgtgagc tcctacaatgcc ccgtgtggaa ctggatcagg 120 cagtctccaa gtcgaggact ggagtggctg ggacgaacat actatagatc cgggtggttac 180 aatgactatg ctgaatcagt gaaaagccgaatattaca accccgatac ctccaagaat 240 cagttctctc tgcagctgaa cagtgtgacc ccgaggacaca cagccgtgtgta ctactgcgcc 300 agaagcggcc atatcaccgt ctttggcgtc aatgtggatg ctttcgatat gtggggggcag 360 gggactatgg tcaccgtgtc aagc 384 <![CDATA[<210> 122]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 122]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Tyr 20 25 30 Asn Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Gly Trp Tyr Asn Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Ser Gly His Ile Thr Val Phe Gly Val Asn Val 100 105 110 Asp Ala Phe Asp Met Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 123]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 123]]> Ser Tyr Asn Ala Val Trp Asn 1 5 <![CDATA[<210> 124]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial]]> Sequence <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 124]]> Arg Thr Tyr Tyr Arg Ser Gly Trp Tyr Asn Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 125]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 125]]> Ser Gly His Ile Thr Val Phe Gly Val Asn Val Asp Ala Phe Asp Met 1 5 10 15 <![CDATA[<210> 126]]> <![CDATA[<211> 309]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 126]]> gatattcaga tgacccagag cccttccagc ctgtccgctt cagtggggga tcgagtgacc 60 attacctgcc gaaccagcca gagcctgagc tcctacgacc actggtatca gcagaagccc 120 ggcaaagcccc ctaagctgctgctgccgccgcttctagtc ggctgtccgg agtgccaagc 180 cggttctccg gatctgggag tggaaccgac tttacccctga caatttcaag cctgcagcccccccc 240 gaggatttcg ctacatacta ctgtcagcag agcagaactt tcggcagcagcagcagg cactaaggtg 300 gagatcaaa 309 <![CDATA[<210> 127]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 127]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Leu Ser Ser Tyr 20 25 30 Asp His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Arg Leu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 128]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 128]]> Arg Thr Ser Gln Ser Leu Ser Ser Tyr Asp His 1 5 10 <![CDATA[<210> 129]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400>]]> 129 Ala Ala Ser Ser Arg Leu Ser 1 5 <![CDATA[<210> 130]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 130]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 131]]> <![CDATA[<211> 384]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 131]]> caggtccagc tgcagcagag cggccccgga ctggtcaagc cttcacagac actgagcctg 60 acatgcgcca ttagcggaga tagcgtgagc tccaacaatg ccgtggaa ctggatcagg 120 cagtctccaa gtcgaggact ggagtggctg ggacgaacat actatagatc caagtggttac 180 aatgactatg ctgaatcagt gaaaagccgaatattaca accccgatac ctccaagaat 240 cagttctctc tgcagctgaa cagtgtgacc ccgaggacaca cagccgtgtgta ctactgcgcc 300 agaagcggcc atatcaccgt ctttggcgtc aatgtggatg ctttcgatat gtggggggcag 360 gggacacacag tcaccgtctc ctcacc 384 <![CDATA[<210> 132]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 132]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Asn Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Ser Gly His Ile Thr Val Phe Gly Val Asn Val 100 105 110 Asp Ala Phe Asp Met Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 133]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 133]]> Ser Asn Asn Ala Val Trp Asn 1 5 <![CDATA[<210> 134]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 134]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 135]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 135]]> Ser Gly His Ile Thr Val Phe Gly Val Asn Val Asp Ala Phe Asp Met 1 5 10 15 <![CDATA[<210> 136]]> <![CDATA[<211> 309]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 136]]> gatattcaga tgacccagag cccttccagc ctgtccgctt cagtggggga tcgagtgacc 60 attacctgcc gaaccagcca gagcctgagc tcctacacgc actggtatca gcagaagccc 120 ggcaaagcccc ctaagctgctgctgccgccgcttctagtc ggctgtccgg agtgccaagc 180 cggttctccg gatctgggag tggaaccgac tttacccctga caatttcaag cctgcagcccccccc 240 gaggatttcg ctacatacta ctgtcagcag agcagaactt tcggcagcagcagcagg cactaaggtg 300 gagatcaaa 309 <![CDATA[<210> 137]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 137]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Leu Ser Ser Tyr 20 25 30 Thr His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Arg Leu Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 138]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 138]]> Arg Thr Ser Gln Ser Leu Ser Ser Tyr Thr His 1 5 10 <![CDATA[<210> 139]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 139]]> Ala Ala Ser Ser Arg Leu Ser 1 5 <![CDATA[<210> 140]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 140]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 141]]> <![CDATA[<211> 384]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 141]]> caggtccagc tgcagcagag cggccccgga ctggtcaagc cttcacagac actgagcctg 60 acatgcgcca ttagcggaga tagcgtgagc tccaacaatg ccgtggaa ctggatcagg 120 cagtctccaa gtcgaggact ggagtggctg ggacgaacat actatagatc caagtggttac 180 aatgactatg ctgaatcagt gaaaagccgaatattaca accccgatac ctccaagaat 240 cagttctctc tgcagctgaa cagtgtgacc ccgaggacaca cagccgtgtgta ctactgcgcc 300 agaagcggcc atatcaccgt ctttggcgtc aatgtggatg ctttcgatat gtggggggcag 360 gggacacacag tcaccgtctc ctcacc 384 <![CDATA[<210> 142]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 142]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Asn Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Ser Gly His Ile Thr Val Phe Gly Val Asn Val 100 105 110 Asp Ala Phe Asp Met Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 143]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 143]]> Ser Asn Asn Ala Val Trp Asn 1 5 <![CDATA[<210> 144]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<22]]>0>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> <![CDATA[ Peptide <![CDATA[<400> 144]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 145]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 145]]> Ser Gly His Ile Thr Val Phe Gly Val Asn Val Asp Ala Phe Asp Met 1 5 10 15 <![CDATA[<210> 146]]> <![CDATA[<211> 309]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 146]]> gatattcaga tgacccagag cccttccagc ctgtccgctt cagtggggga tcgagtgacc 60 attacctgcc gaaccagcca gagcctgagy tcctacacgc actggtatca gcagaagccc 120 ggcaaagccc ctaagctgct gatctacgcc gcttctagtc gggggtccgg agtgccaagc 180 cggttctccg gatctgggag tggaaccgac tttacccctga caatttcaag cctgcagcccccccc 240 gaggatttcg ctacatacta ctgtcagcag agcagaactt tcggcagcagcagcagg cactaaggtg 300 gagatcaaa 309 <![CDATA[<210> 147]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 147]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Leu Ser Ser Tyr 20 25 30 Thr His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Arg Gly Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 148]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 148]]> Arg Thr Ser Gln Ser Leu Ser Ser Tyr Thr His 1 5 10 <![CDATA[<210> 149]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 149]]> Ala Ala Ser Ser Arg Gly Ser 1 5 <![CDATA[<210> 150]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 150]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 151]]> <![CDATA[<211> 384]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 151]]> caggtccagc tgcagcagag cggccccgga ctggtcaagc cttcacagac actgagcctg 60 acatgcgcca ttagcggaga tagcgtgagc tccaacaatgccgtgtggaa ctggatcagg 120 cagtctccaa gtcgaggact ggagtggctg ggacgaacat actatagatc caagtggttac 180 aatgactatg ctgaatcagt gaaaagccgaatattaca accccgatac ctccaagaat 240 cagttctctc tgcagctgaa cagtgtgacc ccgaggacaca cagccgtgtgta ctactgcgcc 300 agaagcggcc atatcaccgt ctttggcgtc aatgtggatg ctttcgatat gtggggggcag 360 gggacacacag tcaccgtctc ctcacc 384 <![CDATA[<210> 152]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 152]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Asn Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Ser Gly His Ile Thr Val Phe Gly Val Asn Val 100 105 110 Asp Ala Phe Asp Met Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 153]]> <![CDATA[<211> 7]]> <![CDATA[<212]]>> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> <![CDATA[ Peptide <![CDATA[<400> 153]]> Ser Asn Asn Ala Val Trp Asn 1 5 <![CDATA[<210> 154]]> <![CDATA[<211> 18]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 154]]> Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala Glu Ser Val 1 5 10 15 Lys Ser <![CDATA[<210> 155]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 155]]> Ser Gly His Ile Thr Val Phe Gly Val Asn Val Asp Ala Phe Asp Met 1 5 10 15 <![CDATA[<210> 156]]> <![CDATA[<211> 309]]> <![CDATA[<212> DNA]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Polynucleotides <![CDATA[<400> 156]]> gatattcaga tgacccagag cccttccagc ctgtccgctt cagtggggga tcgagtgacc 60 attacctgcc gaaccagcca gagcctgagc tcctacctgc actggtatca gcagaagccc 120 ggcaaagcccc ctaagctgctgctgccgccgcttctagtc tgcagtccgg agtgccaagc 180 cggttctccg gatctgggag tggaaccgac tttacccctga caatttcaag cctgcagcccccccc 240 gaggatttcg ctacatacta ctgtcagcag agcagaactt tcggcagcagcagcagg cactaaggtg 300 gagatcaaa 309 <![CDATA[<210> 157]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 157]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Leu Ser Ser Tyr 20 25 30 Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 158]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 158]]> Arg Thr Ser Gln Ser Leu Ser Ser Tyr Leu His 1 5 10 <![CDATA[<210> 159]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 159]]> Ala Ala Ser Ser Leu Gln Ser 1 5 <![CDATA[<210> 160]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<400> 160]]> Gln Gln Ser Arg Thr 1 5 <![CDATA[<210> 161]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (2)..(2)]]> <![CDATA[<223> Asn or Tyr]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (3)..(3)]]> <![CDATA[<223> Asn, Ser or Arg]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (5)..(5)]]> <![CDATA[<223> Val or Thr]]> <![CDATA[<400> 161]]> Ser Xaa Xaa Ala Xaa Trp Asn 1 5 <![CDATA[<210> 162]]> <![CDATA[<211> 17]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (7)..(7)]]> <![CDATA[<223> Lys or Gly]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222>]]> (10)..(10) <![CDATA[<223> Asn or Tyr]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (14)..(14) ]]> <![CDATA[<223> Glu, Val or Asp]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (15)..(15) ]]> <![CDATA[<223> Ser or Phe]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (16)..(16) ]]> <![CDATA[<223> Val or Leu]]> <![CDATA[<400> 162]]> Arg Thr Tyr Tyr Arg Ser Xaa Trp Tyr Xaa Asp Tyr Ala Xaa Xaa Xaa 1 5 10 15 Lys <![CDATA[<210> 163]]> <![CDATA[<211> 16]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (1)..(1)]]> <![CDATA[<223> Ser or Gly]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (6)..(6)]]> <![CDATA[<223> Val or Glu]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (9)..(9)]]> <![CDATA[<223> Val or Leu]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (11)...(11)]]> <![CDATA[<223> Val or Ile]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (14)..(14)]]> <![CDATA[<223> Phe or Tyr ]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (16)..(16)]]> <![CDATA[<223> Met, Ile or Val]]> <![CDATA[<400> 163]]> Xaa Gly His Ile Thr Xaa Phe Gly Xaa Asn Xaa Asp Ala Xaa Asp Xaa 1 5 10 15 <![CDATA[<210> 164]]> <![CDATA[<211> 11]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (2)..(2) ]]> <![CDATA[<223> Thr, Ala or absent]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (3)..(3) ]]> <![CDATA[<223> Ser or Ala]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (5)..(5)]]> <![CDATA[<223> Ser or Arg]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (7)..(7)]]> <![CDATA[<223> Ser, Asn or Arg]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (10)..(10)]]> <![CDATA[<223> Leu, Thr or Asp]]> <![CDATA[<400> 164]]> Arg Xaa Xaa Gln Xaa Leu Xaa Ser Tyr Xaa His 1 5 10 <![CDATA[<210> 165]]> <![CDATA[<211> 7]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (2)..(2) ]]> <![CDATA[<223> Ala, Thr or Ser]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (3)..(4) ]]> <![CDATA[<223> Ser or Thr]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (5)..(5) ]]> <![CDATA[<223> Leu or Arg]]> <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (6)..(6) ]]> <![CDATA[<223> Gln, Leu or Gly]]> <![CDATA[<400> 165]]> Ala Xaa Xaa Xaa Xaa Xaa Ser 1 5 <![CDATA[<210> 166]]> <![CDATA[<211> 5]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptides <![CDATA[<220>]]> <![CDATA[<221> MOD_RES]]> <![CDATA[<222> (2)..(2)]]> <![CDATA[<223> Gln or Leu]]> <![CDATA[<400> 166]]> Gln Xaa Ser Arg Thr 1 5 <![CDATA[<210> 167]]> <![CDATA[<211> 128]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 167]]> Gln Val Gln Leu Gln Gln Ser Gly Pro Gly Leu Val Lys Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Ala Ile Ser Gly Asp Ser Val Ser Ser Asn 20 25 30 Asn Ala Val Trp Asn Trp Ile Arg Gln Ser Pro Ser Arg Gly Leu Glu 35 40 45 Trp Leu Gly Arg Thr Tyr Tyr Arg Ser Lys Trp Tyr Asn Asp Tyr Ala 50 55 60 Glu Ser Val Lys Ser Arg Ile Thr Ile Asn Pro Asp Thr Ser Lys Asn 65 70 75 80 Gln Phe Ser Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Val 85 90 95 Tyr Tyr Cys Ala Arg Ser Gly His Ile Thr Val Phe Gly Val Asn Val 100 105 110 Asp Ala Phe Asp Met Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 115 120 125 <![CDATA[<210> 168]]> <![CDATA[<211> 103]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Artificial Sequence]]> <![CDATA[<220>]]> <![CDATA[<223> Description of artificial sequence: Synthesis]]> Peptide <![CDATA[<400> 168]]> Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Thr Ser Gln Ser Leu Ser Ser Tyr 20 25 30 Leu His Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ala Ala Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Arg Thr Phe Gly Gln 85 90 95 Gly Thr Lys Val Glu Ile Lys 100 <![CDATA[<210> 169]]> <![CDATA[<211> 221]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Influenza A virus]]> <![CDATA[<400> 169]]> Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly Ile 20 25 30 Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asn Gln Ile 35 40 45 Asn Gly Lys Leu Asn Arg Leu Ile Gly Lys Thr Asn Glu Lys Phe His 50 55 60 Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp Leu 65 70 75 80 Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn Ala 85 90 95 Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr Asp 100 105 110 Ser Glu Met Asn Lys Leu Phe Glu Arg Thr Lys Lys Gln Leu Arg Glu 115 120 125 Asn Ala Glu Asp Met Gly Asn Gly Cys Phe Lys Ile Tyr His Lys Cys 130 135 140 Asp Asn Ala Cys Ile Gly Ser Ile Arg Asn Gly Thr Tyr Asp His Asp 145 150 155 160 Val Tyr Arg Asp Glu Ala Leu Asn Asn Arg Phe Gln Ile Lys Gly Val 165 170 175 Glu Leu Lys Ser Gly Tyr Lys Asp Trp Ile Leu Trp Ile Ser Phe Ala 180 185 190 Ile Ser Cys Phe Leu Leu Cys Val Ala Leu Leu Gly Phe Ile Met Trp 195 200 205 Ala Cys Gln Lys Gly Asn Ile Arg Cys Asn Ile Cys Ile 210 215 220 <![CDATA[<210> 170]]> <![CDATA[<211> 221]]> <![CDATA[<212> PRT]]> <![CDATA[<213> Influenza A virus]]> <![CDATA[<400> 170]]> Gly Ile Phe Gly Ala Ile Ala Gly Phe Ile Glu Asn Gly Trp Glu Gly 1 5 10 15 Met Val Asp Gly Trp Tyr Gly Phe Arg His Gln Asn Ser Glu Gly Thr 20 25 30 Gly Gln Ala Ala Asp Leu Lys Ser Thr Gln Ala Ala Ile Asn Gln Ile 35 40 45 Asn Gly Lys Leu Asn Arg Leu Ile Glu Lys Thr Asn Glu Lys Phe His 50 55 60 Gln Ile Glu Lys Glu Phe Ser Glu Val Glu Gly Arg Ile Gln Asp Leu 65 70 75 80 Glu Lys Tyr Val Glu Asp Thr Lys Ile Asp Leu Trp Ser Tyr Asn Ala 85 90 95 Glu Leu Leu Val Ala Leu Glu Asn Gln His Thr Ile Asp Leu Thr Asp 100 105 110 Ser Glu Met Asn Lys Leu Phe Glu Arg Thr Lys Lys Gln ...

Claims

1. An isolated antibody or its binding fragment having a variant Fc region, wherein the isolated antibody or its binding fragment is capable of binding to influenza A virus hemagglutinin and neutralizing at least one group 1 subtype and at least one group 2 subtype of influenza A virus and having an increased serum half-life relative to a natural Fc antibody, wherein the isolated antibody or its binding fragment having the variant Fc region has increased binding affinity for FcRn, and wherein the isolated antibody or its binding fragment comprises HCDR1 of SEQ ID NO.: 103, HCDR2 of SEQ ID NO.: 104, HCDR3 of SEQ ID NO.: 105, LCDR1 of SEQ ID NO.: 108, LCDR2 of SEQ ID NO.: 109 and LCDR3 of SEQ ID NO.:

110.

2. The isolated antibody or its binding fragment as claimed in claim 1, wherein the variant Fc region includes a modification at one or more of the following EU index numbers as described in Kabat: 221, 225, 228, 234, 235, 236, 237, 238, 239, 240, 241, 243, 244, 245, 247, 250, 251, 252, 254, 255, 256, 257, 262, 263, 264, 265, 266, 267. 268, 269, 279, 280, 284, 292, 296, 297, 298, 299, 305, 308, 313, 316, 318, 320, 322, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 339, 341, 343, 370, 373, 378, 392, 416, 419, 421, 428, 433, 434, 435, 436, 440 and 443.

3. The isolated antibody or its binding fragment as claimed in claim 2, wherein the modification is selected from substitution, insertion and deletion.

4. The isolated antibody or its binding fragment as claimed in claim 2, wherein the variant Fc region contains at least one substitution selected from the EU index numbers described in Kabat: 221K, 221Y, 225E, 225K, 225W, 228P, 234D, 234E, 234N, 234Q, 234T, 234H, 234Y, 234I, 234V, 234F, 235A, 235D, 235R, 235W, 235P, 235S, 235N, 235Q, 235T, 235H, 235Y, 235I, 235V, 235E, 235F, 236E, 237L, 237M, 237P, 239D, 239E, 239N. , 239Q, 239F, 239T, 239H, 239Y, 240I, 240A, 240T, 240M, 241W, 241L, 241Y, 2 41E, 241R, 243W, 243L, 243Y, 243R, 243Q, 244H, 245A, 247L, 247V, 247G, 250E , 250Q, 251F, 252L, 252Y, 254S, 254T, 255L, 256E, 256F, 256M, 257C, 257M, 2 57N, 262I, 262A, 262T, 262E, 263I, 263A, 263T, 263M, 264L, 264I, 264W, 264T , 264R, 264F, 264M, 264Y, 264E, 265A, 265G, 265N, 265Q, 265Y, 265F, 265V, 2 65I, 265L, 265H, 265T, 266I, 266A, 266T, 266M, 267Q, 267L, 268E, 269H, 269Y , 269F, 269R, 270E, 280A, 284M, 292P, 292L, 296E, 296Q, 296D, 296N, 296S, 2 96T, 296L, 296I, 296H, 296G, 297S, 297D, 297E, 298A, 298H, 298I, 298T, 298F , 299I, 299L, 299A, 299S, 299V, 299H, 299F, 299E, 305I, 308F, 313F, 316D, 3 18A, 318S, 320A, 320S, 322A, 322S, 325Q, 325L, 3251, 325D, 325E, 325A, 325T , 325V, 325H, 326A, 326D, 326E, 326G, 326M, 326V, 327G, 327W, 327N, 327L, 32 8S, 328M, 328D, 328E, 328N, 328Q, 328F, 3281, 328V, 328T, 328H, 328A, 329F,329H, 329Q, 330K, 330G, 330T, 330C, 330L, 330Y, 330V, 330I, 330F, 330R, 330H, 331G, 331A, 331L, 331M, 331F, 331W, 331K, 331Q, 331E, 331S, 331V, 331I, 331C, 331Y, 331H, 331R, 331N, 331D, 331T, 332D, 332S, 332W, 332F, 332E, 332N, 332Q, 332T, 332H, 332Y, 332A, 333A, 333D, 333G, 333Q, 333S, 333V, 334A, 334E, 334H, 334L, 334M, 334Q, 334V, 334Y, 339T, 370E, 370N, 378D, 392T, 396L, 416G, 419H, 421K, 428L, 428F, 433K, 433L, 434A, 434W, 434Y, 436H, 440Y and 443W.

5. The isolated antibody or its binding fragment as claimed in claim 2, wherein the variant Fc region contains one or more modifications at the location of the EU index number selected from 428 and 434 as described in Kabat.

6. The isolated antibody or its binding fragment as claimed in claim 2, wherein the variant Fc region contains one or more amino acid substitutions at positions selected from 428 and 434 by the EU index number described in Kabat.

7. The isolated antibody or its binding fragment as claimed in claim 4, wherein the variant Fc region contains one or more amino acid substitutions selected from 428L, 428F, 434A, 434W and 434Y.

8. The isolated antibody or its binding fragment as claimed in claim 2, wherein the variant Fc region contains one or more modifications at a position selected from the EU index numbers described in Kabat, 252, 254, 256.

9. The isolated antibody or its binding fragment as claimed in claim 8, wherein the variant Fc region contains one or more amino acid substitutions selected from 252Y, 254T and 256E.

10. The isolated antibody or its binding fragment as claimed in claim 9, wherein the variant Fc region contains amino acid substitutions of 252Y, 254T and 256E.

11. The isolated antibody or its binding fragment as claimed in claim 1, wherein the variant Fc region is a variant of the wild-type human IgG4 Fc region.

12. The isolated antibody or its binding fragment as claimed in claim 1, comprising VH of SEQ ID NO.: 102 and VL of SEQ ID NO.: 107, wherein the variant Fc region comprises one or more amino acid substitutions selected from 428L, 428F, 434A, 434W and 434Y.

13. The isolated antibody or its binding fragment thereof, as claimed in any of claims 1 to 11, comprises VH of SEQ ID NO.: 102 and VL of SEQ ID NO.:

107.

14. An isolated nucleic acid encoding an isolated antibody or a binding fragment thereof as described in any one of claims 1 to 13.

15. A vector comprising the isolated nucleic acid as claimed in claim 14.

16. A host cell comprising the isolated nucleic acid as claimed in claim 14.

17. A method for producing an isolated antibody or a binding fragment thereof as claimed in any one of claims 1 to 13, comprising culturing a host cell as claimed in claim 16 under conditions suitable for expressing the isolated antibody or the binding fragment thereof.

18. The method of claim 17, further comprising isolating the isolated antibody or its binding fragment from the host cell culture.

19. A composition comprising an isolated antibody or a binding fragment thereof as claimed in any one of claims 1 to 13, and a pharmaceutically acceptable carrier.

20. A composition comprising an isolated antibody or a conjugate fragment thereof as claimed in any one of claims 1 to 13 at pH 6.0, 25 mM His and 0.15 M NaCl.

21. The isolated antibody or its binding fragment as requested in claim 1, used for the prevention or treatment of an individual’s influenza A infection.

22. Use of an isolated antibody or a binding fragment thereof as claimed in any one of claims 1 to 13, for the manufacture of a pharmaceutical agent for the prevention or treatment of influenza A infection in an individual.

23. Use of a combination of an isolated antibody or a binding fragment thereof as claimed in any one of claims 1 to 13 with a small molecule antiviral composition for the preparation of a medicament for the prevention or treatment of influenza A infection in an individual.

24. As claimed in claim 23, wherein the small molecule antiviral composition is a neuraminidase inhibitor or adamantane.

25. As claimed in claim 23, wherein the small molecule antiviral composition is selected from oseltamivir, zanamivir, amantadine, rimantadine, and combinations thereof.

26. Use of an antibody or a binding fragment thereof as claimed in any one of claims 1 to 13 for in vitro diagnosis of influenza A infection in an individual.

Images