5'-utr with improved translation efficiency, a synthetic nucleic acid molecule including the same, and a vaccine or therapeutic composition including the same

Abstract

This invention discloses synthetic nucleic acid molecules containing 5'-UTRs with improved translation efficiency and vaccine / therapeutic compositions containing the same. Specifically, it discloses 5'-UTR polynucleotides endowed with improved translation efficiency based on specific motifs, synthetic nucleic acid molecules containing the same, and vaccine / therapeutic compositions containing the synthetic nucleic acid molecules. Due to the improved translation efficiency of the 5'-UTR polynucleotides, the expression of target proteins can be effectively induced, thus benefiting various RNA-based applications, such as vaccines, in vivo / in vitro gene therapy, etc.

Description

a 5′-nontranslated region with improved translational efficiency, a synthetic nucleic acid molecule comprising it, and a vaccine or therapeutic composition comprising it The invention relates to a synthetic nucleic acid molecule comprising a 5'-nontranslational region (5'-UTR) with improved translational efficiency and a vaccine / therapeutic composition comprising thereof, specifically, a 5'-UTR polynucleotide conferred with improved translational efficiency based on a specific modulus, a synthetic nucleic acid molecule comprising thereof, and a vaccine / therapeutic composition comprising the synthetic nucleic acid molecule. The non-translated region (UTR) in mRNA is reported to play a key role in regulating the stability and translation of mRNA. UTRs are known to influence the initiation, prolongation and termination of translation, as well as mRNA stability and intracellular localization through interactions with RNA-binding proteins (Jackson RJ, et al., Nat Rev Mol Cell Biol. Vol. 11(2), pp. 113–127, 2010). Depending on the specific modulus of the UTR, it may improve or decrease the turnover (turnover) of the mRNA (Barrett LW, et al., Cell Mol Life Sci. Vol. 69(21), pp. 3613–34, 2012). Recently, data on the half-life of mRNA and corresponding UTR sequences have been published (Hoen PA, et al., Nucleic Acids Res. Vol. 39(2), pp. 556–566, 2012). The UTR represents the portion of the mRNA molecule upstream of the start codon and downstream of the stop codon, the nontranslated sequence. These regions are transcribed together with the coding regions because they are present in the mature mRNA therefore these regions are exons. The UTR upstream of the start codon of the mRNA is called the "5'-UTR", especially once transcribed it has the so-called "Kozak sequence", and the sequence corresponding to the (remaining 3') portion of the promoter. Kozak common sequences (Kozak consensus sequence, Kozak consensus, or Kozak sequence) are known to be found in eukaryotic mRNAs with a common sequence of (gcc)gccRccAUGG. The Kozak common sequence plays an important role in the initiation of the translation process. This sequence is named after Marilyn Kozak, who discovered its importance. This sequence in the mRNA molecule is recognized by the ribosome at the transcription start site, and the protein is encoded by the mRNA molecule from the transcription start site. This sequence or its possible variants are required by ribosomes to initiate translation. The sequence is identified by the symbol (gcc)gccRccAUGG, which integrates data analyzed by Kozak from a wide range of sources (a total of about 699). The details are as follows: lowercase letters represent the most common bases at a position, but the bases can still vary at that position; uppercase letters represent highly conserved bases, that is, the "AUGG" sequence is constant or rarely changes (if at all); "R" indicates that a purine (adenine or guanine) is always observed at this position (according to Kozak, adenine is more common); the sequence (gcc) in parentheses has an unclear meaning. Several means and methods have been published (US 10080809, US 2018-0353618, US 2019-0144883) to improve the stability of mRNA, reduce the immune response triggered by mRNA in cells or organisms, and improve the expression efficiency (i.e., transcription and / or translation efficiency). However, specifically, there is still a need to improve additional or alternative means to increase the expression efficiency (i.e., transcription and / or translation efficiency). This is because the expression efficiency is an important parameter for expected medical applications. For example, it determines the dosing and dosing interval of mRNA drugs and ultimately determines the bioavailability of the final product (i.e., the encoded peptide or protein). At the same time, there is also a need to further reduce the production cost of mRNA drugs, increase the yield of the produced mRNA molecules, and increase the available space for the coding region encoding the actual transgene (i.e., the target polypeptide) in the produced mRNA molecules. At the same time, since it was reported that when DNA and RNA encoding the target gene are directly injected into animals, the target gene will be expressed in live animals, and this expression can establish immunity (Wolff JA et al. Science, 247: 1465-8, 1990), gene vaccines have been developed. Vaccination with gene vaccines against selected antigens, such as characteristic components on the surface of bacteria, virus particles, and tumor antigens, elicits the desired immune response. Generally speaking, vaccination is one of the key achievements of modern medicine. However, there are currently effective vaccines for only a limited number of diseases. Therefore, infections that cannot be prevented by vaccination still affect millions of people every year. DNA and RNA can be used as nucleic acid molecules for gene administration in gene therapy or gene vaccination, and DNA is known to be relatively stable and easy to handle compared to RNA. However, if the DNA fragment introduced into the patient's genome is inserted into an undesirable location, the DNA may pose potential risks, leading to gene damage. Moreover, unwanted anti-DNA antibodies may appear, and another problem is that the expression level of the peptide or protein expressed through DNA administration and subsequent transcription / translation is limited. The presence or absence of specific transcription factors that regulate DNA transcription has a significant impact on the expression level of the administered DNA. In the absence of specific transcription factors, DNA transcription does not produce sufficient amounts of RNA, and thus, the amount of the translated and produced peptide or protein is also limited. Meanwhile, when RNA is used as a means of gene administration, RNA can directly synthesize proteins in the cytoplasm without the need for transcription, unlike DNA which has to enter the cell nucleus, so there is no risk of interfering with cell chromosomes and causing unwanted gene damage. In addition, since RNA has a shorter half-life compared to DNA, it does not cause long-term gene modification (Sayour EJ, et al., J Immunother Cancer Vol. 3, 13, 2015). When a general RNA vaccine is delivered into cells, it is only activated for a short time to express the target protein and then is destroyed by enzymatic reactions within a few days, while the specific immune response to the expressed target antigen (protein) still exists. In addition, when RNA is used as a means of gene administration, it only functions when crossing the cell membrane and does not need to cross the nuclear membrane. Although a smaller amount is used compared to DNA, the target protein can be expressed in the same amount as DNA. Moreover, RNA itself has immune adjuvanticity, so compared to DNA, even a small dose can exert the same immune effect. By using RNA instead of DNA for gene vaccination, the risks of unwanted genomic integration and the production of anti-DNA antibodies can be minimized or avoided. However, RNA is considered to be a rather unstable molecule and may be easily degraded by the ubiquitously present ribonuclease (RNase). Despite the great progress made in the past few years, as an effective mRNA vaccination method capable of inducing an adaptive immune response, there is still inefficient mRNA translation in the art due to premature degradation of the antigen or inefficient release of mRNA from cells. In addition, in order to reduce concerns about potential safety and make the vaccine affordable in the third world, there is an increasing demand to reduce the dose of mRNA vaccines. There are many problems associated with delivering nucleic acids to induce desired reactions in biological systems. Nucleic acid-based therapies (such as vaccines) have great potential, but there is still a need to deliver nucleic acids more efficiently to appropriate locations within cells or organisms to realize this potential. However, the therapeutic and prophylactic applications of nucleic acids currently face two problems. First, free RNA is vulnerable to nuclease digestion in plasma. Second, free RNA has limited ability to enter the intracellular compartments where relevant translation factors are located. Lipid nanoparticles generated from cationic lipids and other lipid components (such as neutral lipids, cholesterol, polyethylene glycol (PEG), PEGylated lipids, and oligonucleotides) have been developed to prevent the degradation of RNA in plasma and to promote cellular uptake of nucleic acids. Accordingly, as a result of extensive efforts to solve the above problems and develop 5'-UTRs with improved translational efficiency, the inventors have found that a 5'-UTR with improved translational efficiency can be obtained by selecting artificial nucleic acid molecules from a combination of artificial nucleic acid molecules having a length of 30 bp that do not form secondary structures, contain fewer uridines, and do not contain sequences that reduce stability, thereby completing the present invention. One object of the present invention is to provide a 5'-UTR polynucleotide with improved translational efficiency. Another object of the present invention is to provide a synthetic nucleic acid molecule comprising the 5'-UTR polynucleotide with improved translational efficiency. Another object of the present invention is to provide a vaccine composition comprising the synthetic nucleic acid molecule. According to one aspect of the present invention, the above and other objects can be achieved by providing an isolated 5'-untranslated region (UTR) polynucleotide comprising a nucleotide sequence represented by the nucleic acid sequence of formula (I) below. Formula (I): AG[N 22 GCCACC According to another aspect of the present invention, there is provided an isolated 5'-untranslated region (UTR) polynucleotide comprising a nucleotide sequence represented by the nucleic acid sequence of formula (II) below. Formula (II): AGGA[N 19 RGCCACC wherein R represents A or G. According to another aspect of the present invention, there is provided a synthetic nucleic acid molecule in 5' to 3' orientation, comprising: a) a 5'-CAP structure; b) a 5'-UTR polynucleotide; c) at least one coding region; d) a 3'-untranslated region (3'-UTR); and e) 10 to 1000 polyadenylate tails or poly (A) tail-like sequences. According to another aspect of the present invention, there is provided a vaccine composition comprising the synthetic nucleic acid molecule. According to another aspect of the present invention, there is provided the use of a vaccine composition for preventing a disease. According to another aspect of the present invention, there is provided a method for preventing a disease, which comprises administering the vaccine composition. According to another aspect of the present invention, there is provided the use of a vaccine composition in the preparation of a medicament for preventing a disease. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein is well known and commonly used in the art. In the present invention, when the 5'-UTR with improved translation efficiency is selected based on a specific logic from the entire combination rather than extracted from genes existing in nature, it exhibits performance superior to that of the 5'-UTR existing in nature. That is, in one embodiment of the present invention, it is found that the 5'-UTR polynucleotide selected by the following steps exhibits improved translation efficiency. The steps are as follows: removing polynucleotide combinations that may have secondary structures from 30 polynucleotide combinations, as shown in Figure 1, selecting sequences for improving capping efficiency, removing UUU and UUUU motifs from this sequence, removing at least 15% uridine from this sequence, and removing sequences with poor stability (Figure 1). In one aspect, the present invention is directed to an isolated 5'-untranslated region (UTR) polynucleotide comprising a nucleotide sequence represented by the nucleic acid sequence of formula (I) below. Formula (I): AG[N 22 GCCACC In another aspect, the present invention is directed to an isolated 5'-untranslated region (UTR) polynucleotide comprising a nucleotide sequence represented by the nucleic acid sequence of formula (II) below. Formula (II): AGGA[N19]RGCCACC Wherein R represents A or G. In the present invention, the 5'-UTR can be any one of the nucleotide sequences represented by SEQ ID NOs: 1 to 33. [Table 1] As used herein, the term "UTR" refers to the untranslated regions located upstream (5') and / or downstream (3') of the coding region of a nucleic acid molecule described herein and thus typically present flanking the coding region. Thus, the term "UTR" generally encompasses the 3'-untranslated region ("3'-UTR") and the 5'-untranslated region ("5'-UTR"). The UTR can generally comprise or consist of nucleic acid sequences that are not translated into protein. Generally, the UTR contains "regulatory elements". As used herein, the term "regulatory element" refers to a nucleic acid sequence having the ability to affect the gene regulatory activity, expression of a nucleic acid sequence that can be transcribed, particularly affecting transcription or translation, and the nucleic acid sequence that can be transcribed is operably linked (either cis or trans). The term "regulatory element" includes promoters, enhancers, internal ribosome entry sites (IRESs), introns, leaders, transcription termination signals (such as polyadenylation signals and polyuridine sequences), and other expression regulatory elements. The regulatory element can act constitutively or in a time- and / or cell-specific manner. Optionally, the regulatory element can exert its function through the interaction (such as recruitment and binding) of a regulatory protein capable of regulating (including inducing, enhancing, reducing, eliminating, or preventing) the expression of a gene, particularly the transcription of a gene. The UTR is preferably "operably linked" in the coding region in a manner that controls (i.e., mediates or modulates, preferably enhances) the expression of the coding sequence, i.e., in a functional relationship. As used herein, the term "5'-UTR" refers to a portion of a nucleic acid molecule that is located 5' (i.e., "upstream") of the open reading frame and is not translated into protein. In the context of the present invention, the 5'-UTR starts at the transcription start site and ends at the nucleotide preceding the start codon of the open reading frame. The 5'-UTR may contain elements that regulate gene expression, i.e., the so-called "regulatory elements". Such regulatory elements may be, for example, ribosome binding sites. The 5'-UTR may be modified by post-transcriptional modification, such as addition of a 5'-CAP. Thus, the 5'-UTR preferably corresponds to the nucleic acid sequence located between the 5'-CAP and the start codon, particularly the sequence of mature mRNA, more specifically the sequence extending as follows: from the nucleotide at the 3' position of the 5'-CAP, preferably from the nucleotide immediately following the 3' position of the 5'-CAP, to the nucleotide at the 5' position of the start codon (transcription start site) of the protein-coding sequence, preferably to the nucleotide immediately preceding the 5' position of the start codon (transcription start site) of the protein-coding sequence. The nucleotide immediately following the 3' position of the 5'-CAP of mature mRNA typically corresponds to the transcription start site. The length of the 5'-UTR is usually less than 500, 400, 300, 250, or 200 nucleotides. In some embodiments, the length of the 5'-UTR is 10, 20, 30, 40, or more nucleotides, preferably 10 or 50 or fewer nucleotides. In another aspect, the present invention is directed to a synthetic nucleic acid molecule, which, in the 5' to 3' order, comprises: a) a 5'-CAP structure; b) a 5'-UTR polynucleotide; c) at least one coding region; d) a 3'-untranslated region (3'-UTR); and e) a polyadenylation tail or polyadenylation-like tail sequence of 10 to 1000 nucleotides. The 5'-CAP of native mRNA is involved in nuclear export, increases the stability of mRNA, and binds to the cap-binding protein (CBP) of mRNA, thereby stabilizing the mRNA at the cellular and translational stages by forming a mature circular mRNA species through the binding of the polyadenylation-binding protein to CBP. The cap further helps to remove the 5'-proximal intron during the mRNA splicing process. The 5'-CAP according to the present invention is a generally modified nucleotide (CAP analogue), particularly a guanine nucleotide added to the 5'-end of an mRNA molecule. Preferably, the 5'-CAP is added using a 5'-5'-triphosphate bond (also known as "m7GpppN"). Furthermore, examples of 5'-CAP structures include glycerol, inverted deoxyabasic residue (portion), 4',5'-methylene nucleotide, 1-(β-D-erythrofuranosyl) nucleotide, 4'-thionucleotide, carbocyclic nucleotide, 1,5-anhydrohexitol nucleotide, L-nucleotide, α-nucleotide, modified base nucleotide, threo-pentofuranosyl nucleotide, acyclic 3',4'-seco nucleotide, acyclic 3,4-dihydroxybutyl nucleotide, acyclic 3,5-dihydroxypentyl nucleotide, 3',3'-inverted nucleotide portion, 3',3'-inverted abasic portion, 3',2'-inverted nucleotide portion, 3',2'-inverted abasic portion, 1,4-butanediol phosphate, 3'-phosphoramidate, hexyl phosphate, hexylamine phosphate, 3'-phosphate, 3'-thiophosphate, dithiophosphate or a bridged or unbridged methylphosphonate moiety. These modified 5'-CAP structures can be used to modify the sequences of the synthetic nucleic acid molecules of the present invention. Additional modified 5'-CAP structures that can be used in the present invention include CAP1 (ribose of the nucleotide adjacent to the additionally methylated m7GpppN), CAP2 (ribose of the second nucleotide downstream of the additionally methylated m7GpppN), CAP3 (ribose of the third nucleotide downstream of the additionally methylated m7GpppN), CAP4 (ribose of the fourth nucleotide downstream of the additionally methylated m7GpppN), anti-reverse CAP analogue (ARCA), modified ARCA (e.g., ARCA modified with thiophosphate), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine and 2-azido-guanosine. In the present invention, the 5'-CAP structure can be formed by using chemical RNA synthesis or in vitro transcription (co-transcriptional capping) with a cCAP analogue, or a capping enzyme (e.g., a commercially available capping kit) can be used to form the CAP structure. In the present invention, a CAP analog refers to a non-polymerizable dinucleotide having CAP function, which promotes translation or localization and / or prevents degradation of an RNA molecule when introduced to the 5'-end of the RNA molecule. Non-polymerizable means that since the CAP analog does not have a 5'-triphosphate, it binds only at the 5'-end and thus cannot be extended in the 3'-direction by a template-dependent RNA polymerase. The CAP analog comprises a chemical structure selected from the group consisting of: m 7 GpppA, m 7 GpppAmpG, an unmethylated CAP analog, a dimethylated CAP analog, a trimethylated CAP analog (such as m2,2,7GpppA), a symmetric dimethylated CAP analog (such as m7Gpppm7A), or an anti-reverse CAP analog (such as ARCA, m7,2'OmeGpppA, m7,2'dGpppA, m7,3'OmeGpppA, m7,3'dGpppA, and tetraphosphate derivatives of the above analogs), but not limited thereto. Additional CAP analogs have been disclosed in the prior art (US 7,074,596, WO 2008 / 016473, WO 2008 / 157688, WO 2009 / 149253, WO 2011 / 015347, and WO 2013 / 059475). In the present invention, the 5'-CAP structure may be selected from the group consisting of m7GpppAmpG, m7,3'OmeApppG, and m7GpppA, but not limited thereto. In the present invention, the coding region may encode at least one protein selected from the group consisting of an antigenic protein, an allergic protein, a therapeutic protein, and fragments, mutants, or derivatives of the above proteins, but not limited thereto. In the present invention, the antigenic protein comprises at least one selected from the group consisting of a tumor antigen, a pathogenic antigen, an autoantigen, an alloantigen, and an allergen, but not limited thereto. As used herein, the term "tumor antigen" refers to an antigenic (poly)peptide or protein that is derived from or associated with a (preferably malignant) tumor or cancer disease. As used herein, the terms "cancer" and "tumor" are used interchangeably and refer to a cellular neoplasm that invades surrounding tissues and metastasizes to distant body sites, characterized by uncontrolled and usually rapid cell proliferation. The term includes both benign and malignant tumors. Malignant tumors of cancer are typically characterized by anaplasia, invasiveness, and metastasis; while benign tumors generally do not have these characteristics. The terms "cancer" and "tumor" specifically refer to tumors characterized by tumor growth and cancers of the blood and lymphatic systems. "Tumor antigens" are typically derived from cancer / tumor cells, preferably mammalian cancer / tumor cells, and can be located inside or on the surface of tumor cells and tumors, for example, systemic or solid tumors derived from mammals, preferably humans. The term "tumor antigen" generally includes tumor-specific antigens (TSAs) and tumor-associated antigens (TAAs). TSAs are typically derived from tumor-specific mutations and are specifically expressed by tumor cells. The more common TAAs are typically expressed by tumors and "normal" (healthy and non-tumor) cells. As used herein, the term "tumor antigen" can be a protein or nucleic acid sequence associated with a tumor, wherein each nucleic acid sequence encodes another peptide or protein, and at least one nucleic acid sequence can encode 5T4, 707-AP, 9D7, AFP, AlbZIP HPG1, α-5-β-1-integrin, α-5-β-6-integrin, α-actinogen-4 / m, α-methylacyl-CoA racemase, A T-4, ARTC1 / m, B7H4, BAGE-1, BCL-2, bcr / abl, β-catenin / m, BING-4, BRCA1 / m, BRCA2 / m, CA 1 5-3 / CA 27-29, CA 19-9, CA72-4, CA125, calreticulin, CAMEL, CASP-8 / m, cathepsin B, cathepsin L, CD19, CD20, CD22, CD25, CDE30, CD33, CD4, CD52, CD55, CD56, CD80, CDC27 / m, CDK4 / m, CDKN2A / m, CEA, CLCA2, CML28, CML66, COA-1 / m, coactosin-like protein, collagen XXIII, COX-2, CT-9 / BRD6, Cten, cyclin B1, cyclin D1, cyp-B, CYPB1, DAM-10, DAM-6, DEK-CAN, EFTUD2 / m, EGFR, ELF2 / m, EMMPRIN, EpCam, EphA2, EphA3, ErbB3, ETV6-AML1, EZH2, FGF-5, FN, Frau-1, G250, GAGE-1, GAGE-2, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE7b, GAGE-8, GDEP, GnT-V, gp100, GPC3, GPNMB / m, HAGE, HAST-2, hepsin, Her2 / neu, HERVK-MEL, HLA-A*0201-R1 7I, HLA-A1 1 / m, HLA-A2 / m, HNE, homeobox NKX3.1, HOM-TES-14 / SCP-1, HOM-TES-85, HPV-E6, HPV-E7, HSP70-2M, HST-2, hTERT, iCE, IGF-1 R, IL-13Ra2, IL-2R, IL-5, immature laminin receptor, kallikrein-2, kallikrein-4, i67, KIAA0205, KIAA0205 / m, KK-LC-1, K-Ras / m, LAGE-A1, LDLR-FUT, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A9, MAGE-A10, MAGE-A12, MAGE-B1, MAGE-B2, MAGE-B3, MAGE-B4, MAGE-B5, MAGE-B6, MAGE-B10, MAGE-B16, MAGE-B17, MAGE-C1, MAGE-C2, MAGE-C3, MAGE-D1, MAGED2, MAGE-D4, MAGE-E1, MAGE-E2, MAGE-F1, MAGE-HI, MAGEL2, Mammaglobin A, MART-1 / Melan-A, MART-2, MART-2 / m, Matrix protein 22, MC1R, M-CSF, ME1 / m, Mesothelin, MG50 / PXDN, MMP1-1, MN / CA IX-antigen, MRP-3, MUC-1, MUC-2, MUM-1 / m, MUM-2 / m, MUM-3 / m, Myosin class l / m, NA88-A, N-acetylglucosaminyltransferase-V, Neo-PAP, Neo-PAP / m, NFYC / m, NGEP, NMP22, NPM / ALK, N-Ras / m, NSE, NY-ESO-1, NY-ESOB, OA1, OFA-iLRP, OGT, OGT / m, OS-9, OS-9 / m, Osteocalcin, Osteopontin, pi 5, p190 sub bcr-abl, p53, p53 / m, PAGE-4, PAI-1, PAI-2, PAP, PART-1, PATE, PDEF, Pim-1-kinase, Pin-1, Pml / PARα, POTE, PRAME, PRDX5 / m, Prostate protein, Proteinase-3, PSA, PSCA, PSGR, PSM, PSMA, PTPRK / m, RAGE-1, RBAF600 / m, RHAMM / CD168, RU1, RU2, S-100, SAGE, SART-1, SART-2, SART-3, SCC, SIRT2 / m, Sp17, SSX-1, SSX-2 / HOM-MEL-40, SSX-4, STAMP-1, STEAP-1, Survivin, Survivin-2B, SYT-SSX-1, SYT-SSX-2, TA-90, TAG-72, TARP, TEL-AML1, TGF-β, TGF-βRII, TGM-4, TPI / m, TRAG-3, TRG, TRP-1, TRP-2 / 6b, TRP / INT2, TRP-p8, tyrosinase, UPA, VEGFR1, VEGFR-2 / FLK-1, WT1, and the immunoglobulin genotype of lymphocytes or the T cell receptor genotype of lymphocytes or homologs, fragments, variants, or derivatives of tumor antigens. In the present invention, the tumor antigen is selected from the group consisting of, but not limited to, NYESO-1, HER-2 / neu, MAGE-1, tyrosinase, MUC1, CEA, Mam-A, hTERT, Syalyl-Tn, WT1, alpha-fetoprotein, CA-125, gp-100, p53, Ras, Src, EGFRvIII, PSMA, GD2, Bcr-abl, survivin, PSA, EphA2, PAP, AFP, EpCAM, ALK, mesothelin, PSCA, MART-1, Melan-A, SCP-1, SPAG9, AKAP4, and OY-TES-1. In the present invention, the pathogenic antigen can be selected from the group consisting of antigens of bacteria, viruses, fungi, and protozoa. In the present invention, the pathogenic antigen can be derived from influenza virus, respiratory syncytial virus (RSV), coronavirus, herpes simplex virus (HSV), human papillomavirus (HPV), human immunodeficiency virus (HIV), Plasmodium, Staphylococcus aureus, dengue virus, trachoma chlamydia, cytomegalovirus (CMV), hepatitis B virus (HBV), Mycobacterium tuberculosis, rabies virus, and yellow fever virus or isomers, homologs, fragments, variants, or derivatives of such proteins. In the present invention, the viral antigen can be coronavirus, but not limited thereto. In the present invention, the coronavirus is human coronavirus 229E (HCoV-229E), human coronavirus OC43 (HCoV-OC43), severe acute respiratory syndrome coronavirus (SARS-CoV), human coronavirus NL63 (HCoV-NL63, a new human coronavirus), human coronavirus HKU1, Middle East respiratory syndrome coronavirus (MERS-CoV), or severe acute respiratory syndrome coronavirus 2 (SARS-Cov-2). In the present invention, the 3'-UTR is selected from the group consisting of, but not limited to, the β-globin 3'-UTR, CYBA 3'-UTR, albumin 3'-UTR, growth hormone (GH) 3'-UTR, VEEV 3'-UTR, hepatitis B virus (HBV) 3'-UTR, α-globin 3'-UTR, DEN 3'-UTR, barley yellow dwarf virus - PAV (BYDV-PAV) 3'-UTR, elongation factor 1 α1 (EEF1A1) 3'-UTR, manganese superoxide dismutase (MnSOD) 3'-UTR, the β subunit of mitochondrial H(+)-ATP synthase (β-mRNA) 3'-UTR, GLUT1 3'-UTR, MEF2A 3'-UTR, β-F1-ATPase 3'-UTR, and functional fragments thereof, and combinations thereof. As used herein, the term "3'-UTR" generally refers to the portion of an mRNA located between the protein-coding region (i.e., open reading frame, coding region) of the mRNA and the polyadenylation sequence. The 3'-UTR of an mRNA is not translated into an amino acid sequence. The 3'-UTR sequence is typically encoded by a gene that is transcribed into each mRNA during gene expression. This genomic sequence is first transcribed into an immature mRNA that contains optional introns. Then, during maturation, the immature mRNA is further processed into a mature mRNA. This maturation process includes steps such as, for example: 5'-capping, splicing the immature mRNA to remove optional introns, and modifying the 3' end, such as polyadenylating the 3' end of the immature mRNA and cleavage by optional endonucleases or exonucleases. In the present invention, the 3'-UTR corresponds to the mature mRNA sequence of nucleotides present from the 3' position of the stop codon in the protein-coding region to the 5' position of the polyadenylation sequence (preferably located immediately adjacent to the 5' position of the polyadenylation sequence). The term "corresponds" means that the 3'-UTR sequence can be an RNA sequence (such as the mRNA sequence used to define the 3'-UTR sequence) or a DNA sequence corresponding to this RNA sequence. In the present invention, the synthetic nucleic acid molecule further comprises a polyadenylate tail or a polyadenylate-like tail sequence. In a further embodiment, in order to stabilize the terminal groups that can be incorporated onto the polyadenylate tail. In another embodiment, the polyadenylate tail comprises a des-3'-hydroxyl tail. During RNA processing, a long chain of adenine nucleotides (polyadenylate tail) can be added to a polynucleotide, such as an mRNA molecule, to enhance stability. The 3' end of the transcript can be cleaved immediately after transcription to release a 3' hydroxyl group. Then, polyadenylate polymerase adds a chain of adenine nucleotides to the RNA. For example, a process called "polyadenylation" adds a polyadenylate tail that is approximately 80 to approximately 250 residues in length (a length of approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 residues). The polyadenylate tail can also be added after the construct is exported from the nucleus. According to the present invention, in order to stabilize the terminal groups that can be incorporated onto the polyadenylate tail. The polynucleotides of the present invention can include a des-3' hydroxyl tail. The polynucleotides can also include structural moieties or 2'-O-methyl modifications as proposed by Junjie Li et al. (Current Biology, Vol. 15, 1501-1507, August 23, 2005, the content of which is incorporated herein by reference in its entirety). The unique polyadenylate tail length provides a predetermined advantage of the polynucleotides of the present invention. Generally, if a polyadenylate tail is present, its length is greater than 30 nucleotides. In other embodiments, the length of the polyadenylate tail is greater than 35 nucleotides (e.g., at least approximately 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1,300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 nucleotides). In some embodiments, the polynucleotide or region thereof comprises from about 30 to about 3,000 nucleotides (e.g., 30 to 50, 30 to 100, 30 to 250, 30 to 500, 30 to 750, 30 to 1,000, 30 to 1,500, 30 to 2,000, 30 to 2,500, 50 to 100, 50 to 250, 50 to 500, 50 to 750, 50 to 1,000, 50 to 1,500, 50 to 2,000, 50 to 2,500, 50 to 3,000, 100 to 500, 100 to 750, 100 to 1,000, 100 to 1,500, 100 to 2,000, 100 to 2,500, 100 to 3,000, 500 to 750, 500 to 1,000, 500 to 1,500, 500 to 2,000, 500 to 2,500, 500 to 3,000, 1,000 to 1,500, 1,000 to 2,000, 1,000 to 2,500, 1,000 to 3,000, 1,500 to 2,000, 1,500 to 2,500, 1,500 to 3,000, 2,000 to 3,000, 2,000 to 2,500, and 2,500 to 3,000). In some embodiments, the polyadenylation tail is designed for the length of the entire polynucleotide or the length of a specific region of the polynucleotide. This design can be based on the length of the coding region, the specific characteristics or length of a specific region, or the length of the final product expressed from the polynucleotide. In this case, the length of the polyadenylation tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer than the length of the polynucleotide or its characteristic. The polyadenylation tail can also be designed as part of the polynucleotide to which it belongs. In this case, the polyadenylation tail can be at least 10, 20, 30, 40, 50, 60, 70, 80, or 90% of the total length of the construct, the constructed region, or the value obtained by subtracting the polyadenylation tail from the total length of the construct. In addition, the engineering of a binding site for polyadenylate-binding protein and the conjugation of the polynucleotide can enhance expression. In addition, multiple different polynucleotides can be joined together through their 3'-ends by modified nucleotides at the 3'-end of the polyadenylation tail via PABP (polyadenylate-binding protein). Transfection experiments can be performed in a suitable cell line, and protein production can be determined by ELISA 12 hours, 24 hours, 48 hours, 72 hours, and 7 days after transfection. In some embodiments, the polynucleotides of the present invention are designed to include a polyadenylate G-quartet region. A G-quartet is a cyclic hydrogen-bonded structure of four guanine nucleotides, which is formed by G-rich sequences in DNA and RNA. In this experiment, the G-quartet was incorporated at the end of the polyadenylate tail. Other parameters of the resulting polynucleotides were measured at multiple time points, including stability, protein production, and half-life. It was found that using the polyadenylate G-quartet results in protein production from mRNA being at least 75% equivalent to that from mRNA with a polyadenylate tail of only 120 nucleotides. In the present invention, a polyadenylate tail-like sequence can be any nucleic acid sequence capable of performing the function of a polyadenylate tail without limitation. Preferably, at least one nucleotide different from adenine and selected from the group consisting of uracil (U), cytosine (C), and guanine (G) is inserted between multiple adenines or located at the end of the polyadenylate tail, but is not limited thereto. In the present invention, the synthetic nucleic acid molecule can be RNA. In the present invention, the RNA can be selected from the group consisting of mRNA, viral RNA, self-replicating RNA, and replicon RNA, but is not limited thereto. In the present invention, the synthetic nucleic acid molecule can include at least one backbone-modified nucleic acid, sugar-modified nucleic acid, or base-modified nucleic acid, but is not limited thereto. Glycosyl modification: Modified nucleosides and nucleotides can be incorporated into modified mRNA compounds containing mRNA sequences as described herein, and the sugar moieties of the modified nucleosides and nucleotides can be modified. For example, the 2'-hydroxyl (OH) can be modified or replaced with several different "oxy" or "deoxy" substituents. Examples of "oxy-2'-hydroxyl modification" include: alkoxy or allyloxy (-OR, e.g., R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or glycosyl); polyethylene glycol (PEG), -O(CH 2 CH 2 O) n CH 2 CH 2OR; locked nucleic acid (LNA), in which the 2'-hydroxyl group is connected to the 4'-carbon of the same ribose sugar group, for example, in a manner bridged by a methylene group; and an amino group (-O-amino group, where the amino group, for example, NRR is an alkylamino group, a dialkylamino group, a heterocyclic group, an arylamino group, a diarylamino group, a heteroarylamino group, a diheteroarylamino group, ethylenediamine or a polyamino group) or an aminoalkoxy group, but not limited thereto. The "deoxy" modification includes hydrogen, an amino group (such as NH 2 , an alkylamino group, a dialkylamino group, a heterocyclic group, an arylamino group, a diarylamino group, a heteroarylamino group, a diheteroarylamino group or an amino acid), or the amino group can be attached to the sugar group through a linker, where the linker contains one or more of the C, N and O atoms. The sugar group can also contain at least one carbon with a stereochemical configuration opposite to the corresponding carbon in ribose. Therefore, the modified mRNA can contain nucleotides containing arabinose. Backbone modification: The phosphate backbone in the modified nucleosides and nucleotides can be further modified, and the modified nucleosides and nucleotides can be incorporated into a modified mRNA compound containing an mRNA sequence as described herein. The phosphate of the backbone can be modified by replacing at least one oxygen atom with another substituent. In addition, the modified nucleosides and nucleotides can contain a completely unmodified phosphate moiety replaced with a modified phosphate as described herein. Examples of the modified phosphate include but are not limited to thiophosphate, selenophosphate, boranophosphate, borate, hydrogen phosphonate, phosphoramidite, alkyl or aryl phosphonate and phosphate triester. Two unconnected oxygens of the dithiophosphate are replaced by sulfur. The phosphate linker can also be modified by replacing the connected oxygen with nitrogen (bridged phosphoramidite), sulfur (bridged thiophosphate) and carbon (bridged methylene phosphate). Base modification: Modified nucleosides and nucleotides can be incorporated into a modified mRNA compound containing an mRNA sequence as described herein, and the modified nucleosides and nucleotides can be further modified in the base moiety. Examples of the nucleobases found in mRNA include but are not limited to adenine, guanine, cytosine and uracil. For example, the nucleosides and nucleotides described herein can be chemically modified on the major groove surface. In some embodiments, the chemical modification of the major groove can include an amino group, a thiol group, an alkyl group or a halogen group. In a preferred embodiment of the present invention, the nucleotide analogs / modifiers are preferably determined by base modifications selected from the following: 2-amino-6-chloropurine ribonucleoside-5'-triphosphate, 2-aminopurine-ribonucleoside-5'-triphosphate, 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methylinosine-5'-triphosphate, 4-thiouridine-5'-triphosphate, 5-aminoallyl cytidine-5'-triphosphate, 5-aminoallyl uridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5-iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine ribonucleoside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-ribonucleoside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, O6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, and xanthosine-5'-triphosphate. The preferably base-modified nucleotides are selected from the group of base-modified nucleotides consisting of 5-methylcytidine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, and pseudouridine-5'-triphosphate. In some embodiments, the modified nucleosides include pyridin-4-one ribonucleosides, 5-aza-uridine, 2-thio-5-aza-uridine, pseudouridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 2'-O-methyl-uridine, 5-methyluridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-tauromethyluridine, 2-thio-uridine, 5-methoxy-uridine, 1-tauromethyl-pseudouridine, 5-tauromethyl-2-thio-uridine, 1-tauromethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseudouridine. In some embodiments, the modified nucleosides include 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, 5-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine. In other embodiments, the modified nucleosides include 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentyladenosine, N6-(cis-hydroxyisopentyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylcarbamoyladenosine, N6-sulphamoylcarbamoyladenosine, 2-methylthio-N6-sulphamoylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine. In other embodiments, the modified nucleosides include inosine, 1-methyl-inosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine. In some embodiments, the nucleotide can be modified in the major groove and can include replacing the hydrogen at C-5 of uracil with a methyl or halogen group. In certain embodiments, the modified nucleoside is 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine, 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, or 5'-O-(1-thiophosphate)-pseudouridine. In further embodiments, the modified mRNA can include nucleoside modifications selected from 6-aza-cytidine, 2-thio-cytidine, α-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydro-uridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, inosine, α-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, 6-chloro-purine, N6-methyl-adenosine, α-thio-adenosine, 8-azido-adenosine, and 7-deaza-adenosine. In another aspect, the present invention is directed to a vaccine composition comprising a synthetic nucleic acid molecule. The term "vaccine" is considered to be a prophylactic or therapeutic substance that typically provides at least one antigen, preferably an antigenic peptide or protein. For example, "providing at least one antigen" means that the vaccine contains the antigen or the vaccine contains, for example, a molecule encoding the antigen. Thus, the vaccines of the present invention can be derived from antigens such as tumor antigens, bacteria, viruses, fungi or protozoa, autoantigens, allergens or allogeneic antigens, preferably particularly contemplated to comprise at least one synthetic nucleic acid (RNA) molecule encoding at least one antigenic (poly)peptide or protein as defined herein, said synthetic nucleic acid (RNA) molecule inducing an immune response against each antigen when expressed and present in the immune system. However, synthetic nucleic acid (RNA) molecules encoding a target non-antigenic (poly)peptide or protein can also be used in the vaccines of the present invention. In the present invention, the synthetic nucleic acid molecule can be complexed with one or more lipids to form lipid nanoparticles or liposomes. The synthetic nucleic acid (RNA) molecule in the present invention is complexed or bound to, for example, one or more (poly)cationic compounds, preferably (poly)cationic polymers, (poly)cationic peptides or proteins (such as protamine), (poly)cationic polysaccharides and / or (poly)cationic lipids. In this case, the term "complexed" or "bound" means the binding of at least one synthetic nucleic acid (RNA) molecule to at least one compound, said at least one compound being essentially stable as a larger complex combination without covalent bonds binding thereto. Lipid In a preferred embodiment, the synthetic nucleic acid (RNA) molecule of the present invention is complexed or bound to lipids (particularly cationic and / or neutral lipids) to form one or more lipid nanoparticles or liposomes. Thus, in some embodiments, the synthetic nucleic acid (RNA) molecule of the present invention can be provided in the form of a lipid-based formulation, particularly in the form of liposomes and / or lipid nanoparticles comprising the synthetic nucleic acid (RNA) molecule. Lipid nanoparticle In some preferred embodiments, the synthetic nucleic acid (RNA) molecule of the present invention is complexed or bound to lipids (particularly cationic and / or neutral lipids) to form one or more lipid nanoparticles. Preferably, the lipid nanoparticles (LNP) can comprise the following components: (a) at least one synthetic nucleic acid molecule (RNA) of the present invention; (b) a cationic lipid; (c) an aggregation reducing agent (such as a polyethylene glycol (PEG) lipid or a modified PEG lipid); (d) optionally, a non-cationic lipid (such as a neutral lipid); and (e) optionally, a sterol. In some embodiments, the LNP may further comprise (i) at least one cationic lipid, (ii) a neutral lipid, and (iii) a sterol, such as cholesterol and PEG-lipid, in addition to at least one synthetic nucleic acid molecule (RNA) of the present invention, wherein the cationic lipid is present in an amount of about 20 to 60%, the neutral lipid is present in an amount of 5 to 25%, the sterol is present in an amount of 25 to 55%, and the PEG-lipid is present in an amount of 0.5 to 15%. In some embodiments, the synthetic nucleic acid molecule (RNA) of the present invention can be formulated into an aminoalcohol lipidoid. The aminoalcohol lipidoid that can be used in the present invention can be prepared by the method described in U.S. Patent No. 8,450,298, which is incorporated herein by reference in its entirety. Liposome In some embodiments, the synthetic nucleic acid (RNA) molecule of the present invention is formulated into liposomes. Cationic lipid-based liposomes can form complexes with negatively charged nucleic acids (such as RNA) through electrostatic interactions, resulting in the formation of complexes that offer the potential for biocompatibility, low toxicity, and large-scale production capacity required for in vivo clinical applications. Liposomes can fuse with the cell membrane for uptake; first, liposomes enter the cell through the phagocytosis pathway and then the nucleic acid is released from the endosome / carrier into the cytoplasm. Liposomes are essentially analogs of biological membranes and can be prepared from natural and synthetic phospholipids, and have long been regarded as drug delivery carriers due to their excellent biocompatibility. Liposomes are generally formed by a lipid bilayer, which can comprise cationic, anionic, or neutral (phospho)lipids and cholesterol surrounding an aqueous core. The lipid bilayer and the aqueous core can comprise hydrophobic or hydrophilic compounds. Liposomes can have one or more lipid membranes. Liposomes can be unilamellar, called "unilamellar liposomes", or multilamellar, called "multilamellar liposomes". The in vivo properties and behavior of liposomes can be modified by coating with hydrophilic polymers, such as by adding polyethylene glycol (PEG) to the liposome surface to provide steric stability. In addition, liposomes can be used for specific targeting by attaching ligands (such as antibodies, peptides, and carbohydrates) to the liposome surface or to the ends of the attached PEG chains. Liposomes usually exist as spherical vesicles and can have sizes ranging from 20 nanometers (nm) to several micrometers. Liposomes can have different diameters, such as multilamellar vesicles (MLV), small unilamellar vesicles (SUV), and large unilamellar vesicles (LUV), where the diameter of multilamellar vesicles (MLV) is several hundred nanometers and contains a series of concentric bilayers separated by narrow aqueous compartments, the diameter of small unilamellar vesicles (SUV) is less than 50 nm, and the diameter of large unilamellar vesicles (LUV) can range between 50 nm and 500 nm, but not limited thereto. Liposome designs can include but are not limited to opsonins or ligands to improve the attachment of liposomes to unhealthy tissues or to activate events such as endocytosis, but not limited thereto. Liposomes can have a low or high pH value to enhance the transport of pharmaceutical formulations. In the present invention, the vaccine composition can further comprise one or more adjuvants or active agents. Broadly speaking, the term "adjuvant" or "adjuvant component" is generally a pharmaceutical and / or immunological agent capable of modifying (e.g., enhancing another active agent such as a therapeutic agent or a vaccine). In the present context, an "adjuvant" can be considered any compound suitable for assisting in the administration and transport of the vaccine composition of the present invention. Specifically, an adjuvant preferably enhances the immunostimulatory properties of the added vaccine. In addition, an adjuvant is not limited thereto and initiates or enhances an immune response of the innate immune system, i.e., a non-specific immune response. An "adjuvant" generally does not elicit an adaptive immune response. So far, an "adjuvant" is not regarded as an antigen. That is, when administered, the vaccine of the present invention generally elicits an adaptive immune response due to an antigenic peptide or protein encoded by at least one coding sequence of the synthetic nucleic acid (RNA) molecule contained in the vaccine. Suitable adjuvants are known to those of ordinary skill in the art to which the present invention pertains and can be selected from any adjuvant suitable for assisting in eliciting an immune response in mammals in the present case, and can include: TDM, MDP, muramyl dipeptide, Pluronic, alum solution, aluminum hydroxide, ADJUMERTM (polyphosphazene), aluminum phosphate gel, glucan from algae, algammulin, aluminum hydroxide gel (alum), high protein adsorption aluminum hydroxide gel, low viscosity aluminum hydroxide gel, AF or SPT (an emulsion of squalane (5%), Tween 80 (0.2%), Pluronic L121 (1.25%), phosphate buffered saline, pH 7.4) or AVRIDINE™ (propylenediamine), but not limited thereto. In another aspect, the present invention is directed to the use of a vaccine composition for preventing a disease. As used herein, the term "disease" refers to an abnormality caused by an antigen of a tumor, bacterium, virus, fungus or protozoan, an autoantigen, an allergen or an allogeneic antigen, and can be cancer, tumor, autoimmune disease, inflammation, viral infection, bacterial infection, fungal infection, protozoan infection, etc., but is not limited thereto. As used herein, the term "prevention" refers to any act of suppressing a disease or delaying its progression by administering the vaccine composition of the present invention. In another aspect, the present invention is directed to a method for preventing a disease, which comprises administering a vaccine composition. In another aspect, the present invention is directed to the use of a vaccine composition in the preparation of a medicament for preventing a disease. Examples The present invention will be described in detail below with reference to the following examples. However, it will be obvious to those of ordinary skill in the art to which the present invention pertains that the following examples are provided only for illustrating the present invention and should not be construed as limiting the scope of the present invention. Example 1. 5'-UTR Selection All possible combinations of 5'-UTR polynucleotides with a size of 30 base pairs (bp) were constructed. Sequences with an average free energy of 0 that do not form a specific structure (such as a secondary structure) were selected. Sequences starting with the AGG sequence were selected to improve capping and transcription. AUG-like sequences were further removed from some sequences. Since uridine-rich elements reduce protein translation efficiency by immune sensing of TLR7 / 8, sequences containing UUU and UUUU motifs were removed. To enhance protein translation efficiency, uridine depletion was performed to remove 15% of uridine from the entire sequence. To improve the stability of mRNA, 5'-UTRs with the CGC sequence were removed, and a total of 33 5'-UTR sequences were selected (Figure 1). Example 2. Preparation of Nucleic Acids for Synthesizing mRNA Containing 5'-UTR 2-1. Linearization for Template DNA Preparation Linearization was performed using a restriction enzyme that cuts downstream of the polyadenylation site in the plasmid. The linearized DNA was separated using AMICON. Then, it was identified on a 1% agarose gel whether the plasmid DNA was cut. 2-2. In Vitro Transcription In vitro transcription is the process of synthesizing mRNA. The prepared template DNA was reacted with T7 RNA polymerase, buffer solution, NTPs (including natural and chemically modified NTPs), and other necessary elements for IVT at 37°C for 4 hours (hr), as shown in Table 2 (HiScribe™ T7 Quick High Yield RNA Synthesis Kit, NEB E2050S, US). [Table 2] When the reaction was completed, 1 μg of DNA was treated with 1 U of DNase I and then reacted at 37°C for 15 to 30 minutes (min) to remove the template DNA. After the reaction was completed, the IVT product was purified by the method recommended by the manufacturer of Invitrogen's MEGAclear™ kit (Austin, Tex.). Then, the purified mRNA was quantified by Nanodrop or UV / Vis absorption and the band pattern on the agarose gel was identified. 2 - 3. Purification of DsRNA Cellulose was used to remove the double-stranded RNA (dsRNA) generated during the IVT reaction. Pre-wash cellulose: 0.2 g of cellulose was released into 1 ml of buffer solution A in a 50 ml tube, and then a bench top-scale cellulose column was prepared. The compositions of buffer solution A and buffer solution B are shown in Table 3 below. [Table 3] Load IVT mRNA: The IVT mRNA dissolved in 500 μl of buffer solution A was loaded into the previously prepared column. The reaction was induced at room temperature for 30 minutes using a rotor to allow the cellulose to bind to the dsRNA. The product was centrifuged at 14,000 relative centrifugal force (g) for 1 minute, and the effluent was recovered and transferred to a new column. The reaction was performed again at room temperature for 30 minutes, centrifuged under the same conditions, and the effluent was recovered. Precipitate mRNA: The precipitate was recovered by isopropanol precipitation and dissolved in nuclease-free water. Example 3. Determination of the purity of the prepared mRNA 3 - 1. IP-RP UPLC To determine the purity of the prepared mRNA, the mRNA was analyzed using a reverse chromatography column such as C18 or C8. Use a water-based buffer solution and an acetonitrile (ACN)-based buffer solution as the mobile phase for chromatographic analysis. The water-based buffer solution and the ACN-based buffer solution contain an alkylammonium acetate-based ion-pairing additive containing TEAA (such as TBAA, TPAA, DMBAA, HAA, etc.). Clean and store the column using organic solvents such as acetonitrile and methanol. A buffer solution with a high water content is used as a weak cleaning buffer solution, and a buffer solution containing 10 - 50% organic solvent is used as a strong cleaning buffer solution and a seal wash buffer solution. Connect the TEAA in the water-based buffer solution to pump A, and connect the TEAA in the ACN-based buffer solution to pump B, and perform the initial priming process. Connect the column to the equipment, apply at least 5 CV (Column Volume) to the column under the initial gradient conditions and maintain equilibrium. Determine whether Δpsi is stable during the equilibrium period. Inject the mRNA and then analyze it under a gradient with an increasing proportion of organic solvent compared to the initial state. After analysis, clean and store the column using organic solvents such as acetonitrile and methanol, and apply at least 10 CV. 3 - 2. Dot blot method Perform the dot blot method to qualitatively determine whether double-stranded RNA (dsRNA) is an impurity. Bind the J2 antibody to dsRNA and thus use it as a probe to determine the presence or absence of dsRNA. Drop 2 μL of the IVT mRNA to be analyzed with a concentration of 100 - 200 ng / μL onto a positively charged nylon membrane (Merck / 11417240001), and completely dry it at room temperature for at least 1 hour. Use a UV cross-linker to cross-link the sample into the membrane for one cycle at 1,250 μJ / CM 2 and react it with a blocking solution of 4% non-fat milk (in 1X TBST) on a shaker at room temperature for 1 hour. Dilute the J2 primary antibody in the blocking solution at a ratio of 1:5000, and react it on a shaker at 4°C overnight. Use a shaker to wash the product 3 times with 1X TBST solution at room temperature for 10 minutes. Dilute the goat anti-mouse (IgG) secondary antibody conjugated with horseradish peroxidase (HRP) in the blocking solution at a ratio of 1:5000, and react it on a shaker at room temperature for 1 hour. Then, use a shaker to wash the product with 1X TBST solution at room temperature for 10 minutes, three times. Mix the ECL reagent 1 and 2 solutions in a 1:1 (v / v) ratio. Immerse the membrane in the mixture and expose it for 10 seconds. Visualize the bands using Chemi Doc. Example 4. Determination of the translation efficiency of the prepared mRNA Evaluation of the translation efficiency of the prepared mRNA by luciferase activity. Culture human embryonic kidney cell line HEK293T cells (human embryonic kidney cell line, ATCC CRL-3216) and Hela cells (human cervical epithelial cells, CCL2) in Dulbecco's modified Eagles medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. Culture Huh7 cells (human hepatocellular carcinoma cell line, Korea cell line bank, 60104) and SNU423 cells (human hepatocellular carcinoma cell line, Korea cell line bank, 00423) in RPMI-1640 (Gibco) medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. Transfect 250 ng of mRNA into a 12-well plate with lipofectamine 3000 (Invitrogen, Carlsbad, Calif). The control groups used in this study are as follows: 1. Human alpha globin A (modified from WO 2020 / 198337-derived sequence): AGTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACC (SEQ ID NO: 34) 2. Cytochrome b-245 alpha chain CYBA (WO 2020 / 198337): AGTGCGCGCCTAGCAGTGTCCCAGCCGGGTTCGTGTCGCC (SEQ ID NO: 35) 3. Ref UTR no. 1 (US2020 / 0208145): AGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC (SEQ ID NO: 36) 4. Ref UTR no. 2 (US2020 / 0208145): GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCCGGCGCCGCCACC (SEQ ID NO: 37) Add 20 μL of the bright-glo luciferase assay reagent to the transfected 96-well plate, then stain the 96-well plate for 1 minute and then shake it at room temperature for 10 minutes. Set the integration time to 0.3 seconds on the GloMax Navigator luminometer, and then measure the luciferase activity in the prepared plate. Dispense 20 μL of the stop glo luciferase assay reagent from the Dual-glo kit into the measurement plate, then leave the device at room temperature for 10 minutes and then shake the plate for 1 minute. Measure the luciferase activity using the GloMax Navigator luminometer. The results are shown in FIGS. 4 and 5. The translation efficiency of the mRNA containing the UTR of the present invention is superior to that of the control group in all cell lines. Although the specific constitution of the present invention has been described in detail, those of ordinary skill in the art to which the present invention pertains will understand that these detailed descriptions are provided as preferred embodiments for illustrative purposes and should not be construed as limiting the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended patent application scope and its equivalents. Industrial Applicability The 5'-UTR polynucleotide according to the present invention can effectively induce the expression of the target protein due to its improved translation efficiency, and thus contributes to various RNA-based applications, for example, vaccines, in vivo / in vitro gene therapy, etc. None The above and other objects, features and other advantages of the present invention will become more apparent and understandable through the following detailed description in conjunction with the drawings, wherein: FIG. 1 is a schematic diagram showing the process of selecting 5'-UTR candidate groups according to an embodiment of the present invention. FIG. 2 is a vector map of the vector formed to determine the in vitro transcription performance of the mRNA, and the mRNA contains the 5'-UTR selected in the embodiment of the present invention. FIG. 3 is a schematic diagram showing the structure of the mRNA containing the 5'-UTR selected in the embodiment of the present invention. FIG. 4 shows the expression efficiency of the mRNA containing the 5'-UTR selected in the embodiment of the present invention in HEK293T cell lines (A) and (B) and in HeLa cell lines (C) and (D). Figure 5 shows the expression efficiency of mRNAs containing the selected 5'-UTR in the Huh7 cell line (A) and (B) and in the SNU423 cell line (C) and (D) in embodiments of the present invention. TW202449158A_113131465_SEQL.xml

Claims

1. An isolated 5'-untranslated polynucleotide, wherein the 5'-untranslated polynucleotide comprises any one of the nucleotide sequences represented by SEQ ID NOs: 1, 4 to 10 and 14 to 33.

2. A synthetic nucleic acid molecule, in 5' to 3' order, comprising: a) a -5'-CAP structure; b) a separated 5'-untranslated polynucleotide as described in claim 1; c) at least one coding region; d) a -3'-untranslated region (3'-UTR); and e) 10 to 1000 poly(A) tails or poly(A) tail-like sequences, wherein the poly(A) tail-like sequence has a conformation different from adenine and selected from the group consisting of uracil (U), cytosine (C), and guanine (G) inserted between or at the end of the poly(A) tail.

3. The synthetic nucleic acid molecule as described in claim 2, wherein the 5'-CAP structure is selected from the group consisting of m7GpppAmpG, m7GpppApG and m7,3'OmeApppG.

4. The synthetic nucleic acid molecule as claimed in claim 2, wherein the coding region encodes at least one protein selected from the group consisting of antigenic proteins, allergenic proteins, therapeutic proteins, and fragments, mutants, or derivatives of the aforementioned proteins.

5. The synthetic nucleic acid molecule as claimed in claim 4, wherein the antigenic protein comprises at least one selected from the group consisting of tumor antigens, pathogenic antigens, autoantigens, allogeneic antigens and allergens.

6. The synthetic nucleic acid molecule as described in claim 5, wherein the tumor antigen is selected from the group consisting of NYESO-1, HER-2 / neu, MAGE-1, tyrosinase, MUC1, CEA, Mam-A, hTERT, Syalyl-Tn, WT1, alpha-fetoprotein, CA-125, gp-100, p53, Ras, Src, EGFRvIII, PSMA, GD2, Bcr-abl, survivin, PSA, EphA2, PAP, AFP, EpCAM, ALK, mesothelin, PSCA, MART-1, Melan-A, SCP-1, SPAG9, AKAP4, and OY-TES-1.

7. The synthetic nucleic acid molecule as described in claim 5, wherein the pathogenic antigen is selected from the group consisting of antigens of bacteria, viruses, fungi and protists.

8. The synthetic nucleic acid molecule as described in claim 7, wherein the virus is a coronavirus.

9. The synthetic nucleic acid molecule as described in claim 2, wherein the synthetic nucleic acid molecule is RNA.

10. The synthetic nucleic acid molecule as described in claim 9, wherein the RNA is selected from the group consisting of mRNA, viral RNA, self-replicating RNA and replicon RNA.

11. The synthetic nucleic acid molecule as described in claim 2, wherein the synthetic nucleic acid molecule comprises at least one backbone-modified nucleic acid, a glycosyl-modified nucleic acid, or a base-modified nucleic acid.

12. The synthetic nucleic acid molecule as described in claim 2, wherein the 3'-untranslated region is selected from the 3'-untranslated region of β-globulin, CYBA, albumin, growth hormone (GH), VEEV, hepatitis B virus (HBV), α-globulin, DEN, barley yellow dwarf virus-PAV (BYDV-PAV), elongation factor 1 α1 (EEF1A1), manganese superoxide dismutase (MnSOD), the β subunit (β-mRNA) of mitochondrial H(+)-ATP synthase, GLUT1, MEF2A The group consists of the 3'-untranslated region and the β-F1-ATPase 3'-untranslated region.

13. A vaccine composition comprising a synthetic nucleic acid molecule as described in any one of claims 2 to 10.

14. The vaccine composition as claimed in claim 13, wherein the synthetic nucleic acid molecule (RNA) is complexed or combined with one or more lipids to form one or more lipid nanoparticles or liposomes.

15. The vaccine composition as described in claim 13 further comprises one or more adjuvants or active agents.

Images