Compositions and methods for obtaining human alveolar cells and related uses thereof

Modulating TGF-β and BMP signaling in iPSC-derived and bud tip progenitor cells generates AT2-like cells with improved specificity and functionality, addressing the need for reliable alveolar cell acquisition for lung disease treatment.

US20260174819A1Pending Publication Date: 2026-06-25THE RGT UNIV OF MICHIGAN

Patent Information

Authority / Receiving Office
US · United States
Patent Type
Applications(United States)
Current Assignee / Owner
THE RGT UNIV OF MICHIGAN
Filing Date
2023-10-27
Publication Date
2026-06-25

Smart Images

  • Figure US20260174819A1-D00000_ABST
    Figure US20260174819A1-D00000_ABST
Patent Text Reader

Abstract

Accordingly, the present invention relates to methods and systems for growing, expanding and / or obtaining human alveolar cells from one or both of induced-pluripotent stem cell (iPSC) derived tissue and bud tip progenitor cells derived from human tissue in vitro. In particular, the invention disclosed herein relates to methods and systems for growing human alveolar type 2 (AT2)-like cells through modulation of TGF-b and BMP signaling in one or both of induced-pluripotent stem cell (iPSC) derived tissue and bud tip progenitor cells derived from human tissue in vitro.
Need to check novelty before this filing date? Find Prior Art

Description

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims priority to U.S. provisional patent application Ser. No. 63 / 419,830, filed Oct. 27, 2022, which is incorporated herein by reference in its entirety.SEQUENCE LISTING

[0002] The text of the computer readable sequence listing filed herewith, titled “UM_41215_601_SequenceListing.xml”, created Oct. 26, 2023, having a file size of 18,675 bytes, is hereby incorporated by reference in its entirety.FIELD OF THE INVENTION

[0003] The invention disclosed herein generally relates to methods and systems for growing, expanding and / or obtaining human alveolar cells from one or both of induced-pluripotent stem cell (iPSC) derived tissue and bud tip progenitor cells derived from human tissue in vitro. In particular, the invention disclosed herein relates to methods and systems for growing human alveolar type 2 (AT2)-like cells through modulation of TGF-β and BMP signaling in one or both of induced-pluripotent stem cell (iPSC) derived tissue and bud tip progenitor cells derived from human tissue in vitro.INTRODUCTION

[0004] Lung disease is the third-leading cause of death in the United States, with more than 400,000 deaths annually. Lung transplantation is a possible treatment for people who have end-stage lung disease. Lung transplantation is limited by the low availability of donor lungs. Moreover, surgical, medical and immunological complications cause considerable morbidity and mortality in this population. As a result, many patients die each year while on a waiting list or because of transplant complications.

[0005] Transplantation of alveolar cells obtained through modulation of lung bud tip progenitor cells is emerging as an alternative to whole organ transplantation. However, this approach is limited by a lack of reliable techniques for obtaining such alveolar cells. As such, an improved understanding and ability to obtain alveolar cells obtained through modulation of lung bud tip progenitor cells is needed.

[0006] The present invention addresses these needs.SUMMARY OF THE INVENTION

[0007] Alveolar type 2 (AT2) cells function as stem cells in the adult lung and aid in repair after injury. The current study aimed to understand the signaling events that control differentiation of this therapeutically relevant cell type during human development. Using lung explant and organoid models, experiments conducted during the course of developing the present invention identified opposing effects of TGFβ-and BMP-signaling, where inhibition of TGFβ-and activation of BMP-signaling in the context of high WNT-and FGF-signaling efficiently differentiated early lung progenitors into AT2-like cells in vitro. AT2-like cells differentiated in this manner exhibit surfactant processing and secretion capabilities, and long-term commitment to a mature AT2 phenotype when expanded in media optimized for primary AT2 culture. Comparing AT2-like cells differentiated with TGFβ-inhibition and BMP-activation to alternative differentiation approaches revealed improved specificity to the AT2 lineage and reduced off-target cell types. These findings reveal opposing roles for TGFβ-and BMP-signaling in AT2 differentiation and provide a new strategy to generate a therapeutically relevant cell type in vitro.

[0008] Accordingly, the present invention relates to methods and systems for growing, expanding and / or obtaining human alveolar cells from one or both of induced-pluripotent stem cell (iPSC) derived tissue and bud tip progenitor cells derived from human tissue in vitro. In particular, the invention disclosed herein relates to methods and systems for growing human alveolar type 2 (AT2)-like cells through modulation of TGF-β and BMP signaling in one or both of induced-pluripotent stem cell (iPSC) derived tissue and bud tip progenitor cells derived from human tissue in vitro.

[0009] In certain embodiments, the present invention provides methods for obtaining alveolar cells.

[0010] In some embodiments, the methods comprise culturing one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue in vitro, and obtaining alveolar cells from the cultured one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue.

[0011] In some embodiments, the methods consist essentially of culturing one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue in vitro, and obtaining alveolar cells from the cultured one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue.

[0012] In some embodiments, the methods consist of culturing one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue in vitro, and obtaining alveolar cells from the cultured one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue.

[0013] In any of such method embodiments, the culturing results in differentiation of the one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue into alveolar cells.

[0014] In any of such method embodiments, the culturing comprises simultaneous modulation of TGF-β pathway signaling and BMP pathway signaling.

[0015] In any of such method embodiments, the iPSC-derived lung tissue comprises iPSC-derived bud tip progenitor cells. In any of such method embodiments, the bud tip progenitor cells derived from human tissue are derived from human lung tissue. In any of such method embodiments, the bud tip progenitor cells express SOX9. In any of such method embodiments, the iPSC-derived tissue expresses SOX9.

[0016] In any of such method embodiments, the obtained alveolar cells are alveolar type 2 (AT2)-like cells and / or alveolar cell organoid tissue. In some embodiments, the alveolar organoid tissue comprises AT2-like cell organoid tissue. In some embodiments, the obtained AT2-like cells and / or alveolar cell organoid tissue express mature AT2 markers. In some embodiments, the obtained AT2-like cells and / or alveolar cell organoid tissue express one or more of: SFTPC, SFTPA1, LAMP3, HOPX, SFTPB, and HOPX. In some embodiments, the obtained AT2-like cells and / or alveolar cell organoid tissue do not express SOX9. In some embodiments, the obtained AT2-like cells and / or alveolar cell organoid tissue express lower amounts of SOX9 than the amount of SOX9 expressed in the one or both of iPSC-derived tissue and bud tip progenitor cells.

[0017] In any of such method embodiments, the culturing further comprises exposure to a progenitor media along with the simultaneous modulation of TGF-β pathway signaling and BMP pathway signaling. In some embodiments, the progenitor media comprises FGF7 and / or CHIR99021. In some embodiments, the progenitor media further comprises all-trans retinoic acid.

[0018] In any of such method embodiments, the culturing duration is not limited. In any of such method embodiments, the culturing duration is limited. In some embodiments, the culturation duration is for seven days. In some embodiments, the culturation duration is for fourteen days. In some embodiments, the culturation duration is for between seven and fourteen days. In some embodiments, the culturation duration is for between approximately seven (e.g., 4, 5, 6, 7, 8, 9, 10 days) and approximately fourteen days (e.g., 11, 12, 13, 14, 15, 16, 17 days).

[0019] In any of such method embodiments, the obtained alveolar cells are capable of expansion in media optimized for the expansion of primary adult alveolar cell organoids. In some embodiments, the media optimized for the expansion of primary adult alveolar cell organoids does not contain FGF10.

[0020] In any of such method embodiments, the obtained alveolar cells are capable of expansion for >100 days in media optimized for the expansion of primary adult alveolar cell organoids.

[0021] In any of such method embodiments, the obtained alveolar cells secrete lamellar bodies. In any of such method embodiments, the obtained alveolar cells have surfactant processing capabilities. In any of such method embodiments, the obtained alveolar cells have secretion capabilities.

[0022] In any of such method embodiments, the modulation of TGF-β signaling pathway signaling comprises TGF-β signaling pathway inhibition. In some embodiments, the TGF-β signaling pathway inhibition comprises culturing the one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue with an agent that inhibits the TGF-β signaling pathway. In some embodiments, the agent that inhibits the TGF-β signaling pathway is selected from the group consisting of:

[0023] a small molecule that inhibits the TGF-β pathway,

[0024] a protein that inhibits the TGF-β pathway,

[0025] an ALK5 inhibitor (e.g., A83-01 (CAS number: 909910-43-6), GW788388, RepSox, and SB-431542 (CAS number: 301836-41-9)),

[0026] SB-505124 (CAS number: 694433-59-5),

[0027] SB-525334 (CAS number: 356559-20-1),

[0028] LY364947 (CAS number: 396129-53-6),

[0029] SD-208 (CAS number: 627536-09-8), and

[0030] SJN2511 (CAS number: 446859-33-2).

[0031] In any of such method embodiments, the modulation of BMP signaling pathway signaling comprises BMP signaling pathway activation. In some embodiments, the BMP signaling pathway activation comprises culturing one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue with an agent that activates the BMP signaling pathway. In some embodiments, the agent that activates the BMP signaling pathway is selected from the group consisting of: BMP1, BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8a, BMP8b, BMP10, BMP11, BMP15, IDE1, IDE2, derivatives thereof, and mixtures thereof, small molecules that activate the BMP pathway, and proteins that activate the BMP pathway, and additionally may include ventromophins, 4′-hydroxy chalcone, apigenin, and combinations thereof.

[0032] In any of such method embodiments, the culturing and obtaining steps are conducted in vitro.

[0033] In certain embodiments, the present invention provides compositions comprising alveolar cells. In certain embodiments, the present invention provides compositions consisting essentially of alveolar cells. In certain embodiments, the present invention provides compositions consisting of alveolar cells. In any of such composition embodiments, the alveolar cells are obtained with any of methods for obtaining alveolar cells described herein.

[0034] In certain embodiments, the present invention provides methods of treating a mammalian subject having a damaged lung tissue with reduced function, comprising engrafting alveolar cells at the site of damaged lung tissue with reduced function, wherein the engrafted alveolar cells at the site of injury repopulate at least a portion of the site with the engrafted alveolar cells, wherein the repopulated engrafted alveolar cells supplement the function of the damaged lung tissue with reduced function, thereby treating the mammalian subject.

[0035] In certain embodiments, the present invention provides methods of treating a mammalian subject having a damaged lung tissue with reduced function, consisting essentially of engrafting alveolar cells at the site of damaged lung tissue with reduced function, wherein the engrafted alveolar cells at the site of injury repopulate at least a portion of the site with the engrafted alveolar cells, wherein the repopulated engrafted alveolar cells supplement the function of the damaged lung tissue with reduced function, thereby treating the mammalian subject.

[0036] In certain embodiments, the present invention provides methods of treating a mammalian subject having a damaged lung tissue with reduced function, consisting of engrafting alveolar cells at the site of damaged lung tissue with reduced function, wherein the engrafted alveolar cells at the site of injury repopulate at least a portion of the site with the engrafted alveolar cells, wherein the repopulated engrafted alveolar cells supplement the function of the damaged lung tissue with reduced function, thereby treating the mammalian subject.

[0037] In any of such treatment methods, the alveolar cells are obtained with any of methods for obtaining alveolar cells described herein.

[0038] In some embodiments, the mammalian subject is a human subject.

[0039] In some embodiments, the damaged lung tissue with reduced function is associated with, but not limited to, a condition caused by one or more of an injury that results in a loss of epithelial function, a post-lung transplant complication, and / or a genetic disorder. In some embodiments, the injury that results in loss of epithelial function is bronchiolitis obliterans. In some embodiments, the post-lung transplant complication is bronchiolitis obliterans. In some embodiments, the genetic disorder is one or more mutations that cause an impairment or a loss of epithelial cell function, wherein the genetic disorder is cystic fibrosis.

[0040] In certain embodiments, the present invention provides kits comprising alveolar cells.

[0041] In certain embodiments, the present invention provides kits consisting essentially of alveolar cells.

[0042] In certain embodiments, the present invention provides kits consisting of alveolar cells.

[0043] In any of such kit embodiments, the alveolar cells are obtained with any of methods for obtaining alveolar cells described herein.

[0044] In certain embodiments, the present invention provides kits comprising lung bud tip progenitor cells, TGF-β inhibiting agents, and BMP activating agents.

[0045] In certain embodiments, the present invention provides kits consisting essentially of lung bud tip progenitor cells, TGF-β inhibiting agents, and BMP activating agents.

[0046] In certain embodiments, the present invention provides kits consisting of lung bud tip progenitor cells, TGF-β inhibiting agents, and BMP activating agents.

[0047] Additional embodiments will be apparent to persons skilled in the relevant art based on the teachings contained herein.BRIEF DESCRIPTION OF DRAWINGS

[0048] FIG. 1A-M: High levels of BMP and low levels of TGF-□ signaling are associated with AT2 differentiation. FIG. 1A: Circle diagrams showing signaling network between cells in the lung progenitor niche (Bud Tip Progenitors, RSPO2-positive mesenchyme) and cells outside (Non-Bud Tip distal epithelium, TAGLN-positive mesenchyme) for WNT-, FGF-, BMP-and TGFβ-signaling pathways. Interaction edges are colored by signaling pathway source and thickness represents the relative strength of interaction. FIG. 1B, C: Dot plots showing expression of BMP and TGFβ ligands and BMP-signaling target ID2 in FIG. 1B BTPs and FIG. 1C RSPO2-positive mesenchyme. FIG. 1D: Fluorescent in situ hybridization for BMP4 and ID2 with co-immunofluorescent staining for SOX9 in 59 day and 112 day human lung. FIG. 1E, F: Quantification of FIG. 1E BMP4 and FIG. 1F ID2 FISH signal in mesenchymal and epithelial cell populations in distal lung sections at 59 and 112 days. Foci per cell is shown with number of cells examined in parentheses (column=mean, error=s.d.). Statistical significance (p) was calculated by one-way ANOVA with Bonferroni correction. FIG. 1G, H: Immunofluorescent staining for BTP marker SOX9 and FIG. 1G AT2 markers (ProSFTPC, ABCA3) or FIG. 1H AT1 marker AGER and epithelial marker ECAD in lung explants before (day 0) and after ALI culture (day 14). Images are representative of four biological replicates. FIG. 1I: Immunofluorescent staining in bud tip (SOX9-positive) and stalk (SOX9-negative) regions of lung epithelium in ALI explants at day 14 for AT2 (ProSFTPC, SFTPB), AT1 (PDPN, AGER), and HOPX (expressed in AT1 and AT2 cells in human). FIG. 1J: UMAP visualization of Louvain clustering of epithelial cells from days 3, 6, 9 and 12 of ALI explant culture. Cluster identities were assigned based on marker expression in part (FIG. 1K). FIG. 1K: Dot plot showing expression of AT2, AT1, Airway, BTP and proliferating cell markers in explant epithelial cell clusters. FIG. 1L: Dot plot showing expression of BMP and TGFβ ligands and BMP-signaling target ID2 in explant epithelial cell clusters. FIG. 1M: Immunofluorescent staining for pSMAD1 / 5 / 8 and ProSFTPC in 122 day fetal lung, day 6 ALI explants with and without 100 ng / mL NOGGIN. Images are representative of three biological replicates. Scales: FIG. 1D, G, H, M=50 μm, FIG. 1I=10 μm.

[0049] FIG. 2A-L: Ligand-receptor pairs contributing to BMP-and TGFb-signaling during fetal lung development and characterization of canalicular stage lung air-liquid interface (ALI) explant culture. Related to FIG. 1. FIG. 2A: Ligand receptor pairs contributing to cell-cell signaling predictions in FIG. 1A. FIG. 2B: Schematic of lung explant air-liquid interface culture. 0.5 cm2 pieces of distal canalicular stage lung are cultured on polycarbonate filters that float on growth-factor and serum-free media. FIG. 2C: Bright-field image of explant ALI cultures at day 12. Media is observed around the base of the explant, but otherwise the explant is exposed to air. Scale=1 mm. FIG. 2D,E: Immunofluorescent staining of AT2 markers (ProSFTPC, SFTPA) and BTP marker SOX9 in (FIG. 2D) canalicular stage lung explants before and after 6, 9 or 12 days of explant ALI culture or (FIG. 2E) adult lung. Scale=25 μm. FIG. 2F: UMAP visualization of Louvain clustering of all cells from day 3, day 6, day 9 and day 12 explants. Cluster identities were assigned based on marker expression in part g. FIG. 2G: Dot plot showing cluster specific marker expression. Marker specificity on the top row denotes cell type / state indicated by unique expression of markers shown. Prolif. =proliferation. Msthl. =mesothelium. FIG. 2H: Quantification of the percent contribution of each timepoint to clusters identified in integrated scRNA-sequencing data from ALI explant culture. The contribution of each timepoint to the full dataset is shown in the leftmost column. FIG. 2I: Comparison of AGER (top) and SFTPC (bottom) expression between BTPs in lung tissue prior to ALI explant culture, and clusters identified in computationally extracted epithelial cells. FIG. 2J: UMAP of computationally extracted epithelial cells from scRNA-sequencing of ALI explant culture with cells colored by days of ALI explant culture. FIG. 2K: Percent contribution of each timepoint to clusters identified in computationally extractedepithelium from integrated ALI explant scRNA-seq. The contribution of each timepoint to the full dataset is shown in the leftmost column. FIG. 2L: Dot plot comparing expression of AT2 markers in BTPs, explant AT2-like cells and primary AT2 cells. Explant AT2-like cells express higher AT2 markers than bud tip progenitors and less than adult AT2 cells.

[0050] FIG. 3A-E: BMP and TGF-β signaling exhibit opposing activities on alveolar type 2 differentiation in explants and BTP organoids. FIG. 3A: Immunofluorescent staining of AT2 markers (ProSFTPC and SFTPA) and BTP marker (SOX9) expression in BMP-inhibited (+NOGGIN) or BMP-activated (+BMP4) day 6 ALI explant cultures from canalicular stage human lung. Images are from a single biological replicate and representative of 3 biological replicates. FIG. 3B: Immunofluorescent staining of AT2 marker (ProSFTPC and SFTPA) and BTP marker (SOX9) expression in TGFβ-inhibited (+A8301) or TGFβ-activated (+TGFβ1) day 6 ALI explant cultures of canalicular stage human lung. Images are from a single biological replicate and are representative of 3 biological replicates. c Immunofluorescent staining of BTP marker (SOX9), AT2 marker (ProSFTPC) and basal cell marker (TP63) expression in untreated and TGFβ1-treated explants. Images are from a single biological replicate and are representative of 3 biological replicates. Scales: FIGS. 3A, B,C=25 μm. FIG. 3D: Schematic describing approach to compare the effect of individual and simultaneous TGFβ-inhibition and BMP-activation on AT2 marker expression in BTP organoids by RT-qPCR. FIG. 3E: RT-qPCR measurements of AT2 markers SFTPC, SFTPA1, LAMP3, SFTPB, HOPX and BTP marker SOX9 in BTP organoids cultured in progenitor media with addition of a TGFβ-inhibitor (+A8301), a BMP-activator (+BMP4) or both (+A8301 / +BMP4) for 7 days. Values shown are fold change relative to the progenitor media condition (column=mean, error=s.d.). Statistical comparison (p) was calculated using repeated measures one-way ANOVA with Dunnett's post hoc test on linearized (log-transformed) mean fold-change values for six biological replicates calculated from three technical replicates.

[0051] FIG. 4A-M: TGFβ-inhibition coupled with BMP-activation (CK+AB) efficiently differentiates BTP organoids to AT2-like cells. FIG. 4A: Immunofluorescent staining for AT2 markers (ProSFTPC, HTII-280, NAPSA, SFTPA) in BTP organoids maintained in bud tip progenitor media or 6 days CK+AB treatment. Scale=50 μm. FIG. 4B: Transmission electron microscopy images of BTP organoids after 21 days CK+AB treatment. LB=lamellar body, My=tubular myelin. Scales: left=1 μm, center=200 nm, right=20 nm. FIG. 4C: Violin plots of scRNA-seq showing the distribution of AT2 and BTP marker gene expression in BTP organoids and at indicated days of CK+AB treatment. FIG. 4D: Percentage of cells expressing indicated AT2 marker in BTP organoids and at indicated days of CK+AB treatment as determined by scRNA-seq. FIG. 4E: Percentage of cells in each phase of the cell cycle in BTP organoids and at indicated days of CK+AB treatment. FIG. 4F-I: UMAP visualization of integrated scRNA-seq of BTP organoids and days 1, 6 and 21 of CK+AB treatment showing with cells color coded by FIG. 4F cell cycle stage, FIG. 4G timepoint, FIG. 4H normalized expression of indicated gene or FIG. 4I lovain clustering, with cluster identities determined based on data shown in parts (FIG. 4F-H). FIG. 4J: Dot plot showing expression of markers of proliferation, airway, AT1, AT2 and BTP identity across Louvain clusters in part (FIG. 4I). FIG. 4K: Slingshot trajectory analysis of integrated scRNA-seq of BTP organoids and at days 1, 6 and 21 of CK+AB treatment. Trajectory originating in BTP organoids and terminating in area of day 21 high AT2 marker expressing cells is highlighted in red. Alternative trajectories are in gray and indexed for referencing in the manuscript. FIG. 4L: UMAP visualization of integrated scRNA-seq of BTP organoids and days 1, 6 and 21 of CK+AB treatment. Highest SFTPC / SFTPB / SFTPA1 co-expressing cells from analysis of each scRNA-seq timepoint (FIG. 5E-G) is highlighted and color coded by timepoint. FIG. 4M: Violin plots comparing AT2 gene module scores for BTP organoids and indicated days of CK+AB treatment.

[0052] FIG. 5A-G: Reproducibility of CK+AB response in multiple BTP organoid lines, evidence for maximal differentiation in the presence of BMP-activation and identification of clusters with the most AT2 marker overlap at each CK+AB treatment timepoint. Related to FIG. 4. FIG. 5A: RT-qPCR measurements showing arbitrary units of expression for AT2 markers (SFTPC, SFTPA1, NAPSA) and airway marker SOX2 in response to CK+AB over the course of 21 days for three BTP organoid lines. Values shown are mean arbitrary units of expression calculated from three technical replicates. FIG. 5B: Schematic of BTP organoid differentiation experiment analyzed by RT-qPCR in part c and immunofluorescent staining in part d. Modified CK+AB media made to inhibit BMP-signaling rather than activate it by replacing BMP4 with NOGGIN (CK+AN) was applied to BTP organoids for 14 days. Cultures were then divided with half receiving CK+AB and the other half maintained in CK+AN with analysis performed after an additional 7 days (21 days total). FIG. 5C: RT-qPCR measurements of AT2 marker expression in BTP organoids treated as schematized in part b. Values shown are fold change relative to the CK+AN condition color-coded by biological replicate (column=mean, error=s.d.). Statistical comparison (p) was computed by two-tailed ratio paired t-test on the mean arbitrary units of expression for six biological replicates calculated from three technical replicates. FIG. 5D: Immunofluorescent staining for AT2 markers (ProSFTPC, SFTPA) and BTP marker SOX9 in BTP organoids differentiated under the conditions schematized in part b. Scale=100 μm. FIG. 5E, F, G: UMAP visualization of Louvain clustering and gene expression for AT2 markers (SFTPC, SFTPA1, SFTPB) and proliferation marker TOP2A in CK+AB treated BTP organoids after (e) 1 day (f) 6 days (g) 21 days. The cluster with the highest overlapping expression of SFTPC, SFTPA and SFTPB is highlighted in the rightmost plot.

[0053] FIG. 6A-M: CK+AB differentiated organoids maintain AT2-like cells after long-term expansion. FIG. 6A: UMAP dimensional reduction color coded by Louvain cluster or expression of AT2 (SFTPC, SFTPA1, SFTPB), goblet (MUC5AC) and proliferation (TOP2A) markers in CK+AB induced organoids after 120 days in SFFF without FGF10. FIG. 6B: Dot plot of AT2 marker genes and MUC5AC in CK+AB induced organoids after 120 days in SFFF without FGF10. FIG. 6C, D: Primary AT2 organoids cultured in SFFF without FGF10 for 30 days or organoids differentiated with CK+AB or CK+DCI for 21 days and cultured an additional 120 days in SFFF without FGF10 are compared by FIG. 6C percentage of cells expressing indicated AT2 marker and FIG. 6D AT2 marker and progenitor marker SOX9 expression levels. FIG. 6E: Proportion of cells expressing MUC5AC in CK+AB or CK+DCI induced organoids after 120 days in SFFF without FGF10. FIG. 6F: Reference-based mapping of cells from indicated organoid type to published UMAP dimensional reduction of proximal and distal lung scRNA-seq. FIG. 6G, H: Percentage of cells mapping to FIG. 6G AT2 identities or FIG. 6H non-AT2 identities from indicated organoid type. FIG. 6I, J: UMAP of AT2-mapping cells from each organoid type color coded by FIG. 6I organoid source or FIG. 6J Louvain clustering. FIG. 6K: Violin plots showing expression of AT2 differentiation and maturation25 markers and progenitor marker SOX9 in AT2-mapping cells from indicated organoid type. FIG. 6L: Violin plots showing gene module scores for the top genes enriched in published scRNA-seq from human adult lungs29 (Table 4). For indicated samples, only AT2 mapping cells were compared. In vivo AT2s and Ciliated cells were extracted from the reference data used in part (FIG. 6F)45. FIG. 6M: Overlap of AT2 marker genes (Table 4) enriched in primary AT2 organoids relative to CK+AB or CK+DCI induced organoids. Only AT2 mapping cells were compared.

[0054] FIG. 7A-K: Optimization of expansion conditions for CK+AB induced AT2-like organoids. FIG. 7A: Brightfield images comparing growth between CK+AB induced AT2-like organoids over days 14-21 in CK+AB media and the first 7 days in SFFF. FIG. 7B: Immunofluorescent staining of AT2 markers in CK+AB induced AT2-like organoids in SFFF at indicated day. FIG. 7C: Transmission electron microscopy of CK+AB induced AT2-like organoids after 28 days in SFFF. FIG. 7D: Immunofluorescent staining of MUC5AC in CK+AB induced AT2-like organoids after 26 and 102 days in SFFF. FIG. 7E: RT-qPCR of SFTPC and MUC5AC expression in CK+AB induced AT2-like organoids over time in SFFF. Values shown are mean arbitrary units of expression calculated from three technical replicates (error=s.d). FIG. 7F: RT-qPCR of SFTPC and MUC5AC expression in SFFF or SFFF lacking indicated component. Values shown are fold change relative to SFFF for three technical replicates from one organoid line (column=mean, error=s.d.). FIG. 7G: Flow cytometry measurements of the percent HTII-280-positive cells in CK+AB induced AT2-like organoids after 50-60 days in SFFF media with and without FGF10 (column=mean, error=s.d.). Statistical comparison (p) was computed by one-tailed Student's paired t-test. FIG. 7H: Immunofluorescent staining comparing AT2 markers and MUC5AC between CK+AB induced AT2-like organoid cultures after 90 days in SFFF media with and without FGF10. FIG. 7I: RT-qPCR comparing AT2 markers and MUC5AC expression between CK+AB induced AT2-like organoids after 90 days in SFFF with and without FGF10. Values shown are fold change relative to SFFF (column=mean, error=s.d.). Statistical comparison (p) was computed by two-tailed ratio paired t-test on the mean arbitrary units of expression for four biological replicates (three for MUC5AC, see Methods) calculated from three technical replicates. FIG. 7J, K: Maximum intensity projection of confocal z-stack from whole mount immunofluorescent staining for HTII-280, ProSFTPC and SOX9 in CK+AB induced AT2-like organoids after FIG. 7J 20 days in SFFF FIG. 7K 70 days in SFFF without FGF10. Scales: FIG. 7A=500 μm, FIG. 7B, H, J, K=50 μm, FIG. 7C=1 μm.

[0055] FIG. 8A-F: Proliferative and morphological features of CK+AB induced AT2-like organoids in CK+AB, SFFF and SFFF without FGF10 medias. Related to FIG. 7. FIG. 8A: Immunofluorescent staining images of AT2 marker ProSFTPC and proliferation marker KI67 in CK+AB induced AT2-like organoids at the end of the final 7 days of 21 day CK+AB differentiation, or after the first 7 days of switching the culture to SFFF. Scale=100 μm. FIG. 8B: FACS gating strategy to determine percent of cells expressing HTII-280 in FIG. 7g. FIG. 8C, D, E: Immunofluorescent staining images of AT2 marker HTII-280 in CK+AB induced organoids expanded in SFFF for 20 days (c), CK+AB induced organoids expanded in SFFF without FGF10 for 60 days (d) or primary AT2 organoids in SFFF (e). Scales: (c)=10 μm, (d) (e)=5 μm. FIG. 8F: Maximum signal intensity projection of confocal images from whole mount immunofluorescent staining of AT2 markers ProSFTPC and SFTPA in CK+AB induced organoids expanded in SFFF without FGF10 for 90 days. ECAD staining is included in the merged image to identify cell boundaries. Scale=50 μm.

[0056] FIG. 9A-H: Composition of primary AT2 and CK+DCI induced organoids expanded in primary AT2 media for 120 days and RT-qPCR validation of differences between expanded CK+AB and CK+DCI induced organoids. Related to FIG. 6. FIG. 9A: UMAP visualization of Louvain clustering and gene expression in primary AT2 organoids cultured in SFFF without FGF10 for 30 days before analysis. AT2 markers (SFTPC, SFTPA1, SFTPA), proliferation marker TOP2A and goblet cell marker MUC5AC are shown. FIG. 9B: Dot plot showing an expanded panel of AT2 markers and goblet cell marker MUC5AC across Louvain clusters in primary AT2 organoids cultured SFFF without FGF10 for 30 days before analysis. FIG. 9C: UMAP visualization of Louvain clustering and gene expression in CK+DCI induced organoids expanded for 120 days in SFFF without FGF10. AT2 markers (SFTPC, SFTPA1, SFTPB), proliferation marker TOP2A and goblet cell marker MUC5AC are shown. FIG. 9D: Dot plot showing expression of an expanded panel of AT2 markers and goblet cell marker MUC5AC in Louvain clusters in CK+DCI induced organoids expanded for 120 days in SFF without FGF10. FIG. 9E: RT-qPCR measurements of MUC5AC expression in three BTP organoid lines induced with CK+AB or CK+DCI and expanded for 120 days in SFFF without FGF10. Values shown are arbitrary units of gene expression (column=mean, error=s.d.). Statistical significance (p) was calculated by one-tailed ratio paired t-test on the mean arbitrary units of expression for six biological replicates calculated from three technical replicates. FIG. 9F: Violin plot comparing expression of markers of non-AT2 lung epithelial cell types in primary AT2 organoids. FIG. 9G, H: Violin plots showing gene module scores for primary goblet cells extracted from an in vivo reference data set or goblet-like MUC5AC-positive cells extracted from day 120 CK+AB and CK+DCI AT2-like organoids in SFFF without FGF10. The gene module was comprised of the top (g) 200 genes enriched in the cluster annotated ‘MUC5AC+MUC5B+’ in the in vivoreference dataset or (h) 191 genes enriched in the cluster annotated ‘MUC5B+’ in the in vivo reference dataset.

[0057] FIG. 10A-L: CK+DCI induced AT2-like cells transition through an SCGB3A2-positive intermediate state not observed in CK+AB differentiations. FIG. 10A: Proportion of cells expressing indicated AT2 marker in BTP organoids and indicated days of CK+DCI treatment as determined by scRNA-seq. FIG. 10B, C: UMAP visualization of integrated scRNA-seq data from BTP organoids and days 1, 6 and 21 of CK+DCI treatment with cells color coded FIG. 10B by sample origin FIG. 10C Louvain clustering. Cluster identities are based on data shown in part (FIG. 10B, D-F), and examination of cluster-specific enrichment lists. FIG. 10D: Dot plot showing expression of proliferation, airway, AT1, AT2 and BTP markers across Louvain clusters from (c). e Slingshot trajectory analysis of integrated scRNA-seq data from BTP organoids and days 1, 6 and 21 of CK+DCI treatment. Trajectory originating in BTP organoids and terminating in area of day 21 high AT2 marker expressing cells is highlighted red. Alternative trajectories are gray and indexed for referencing in the paper. FIG. 10F: UMAP visualization showing expression of SCGB3A2, RNASE1, SFTPB and SFTPC. g Violin plots of gene expression showing expression of indicated markers in BTP organoids or indicated day of CK+AB or CK+DCI treatment. FIG. 10H: RT-qPCR measurements of SCGB3A2, SFTPA1 and SFTPC expression after 6 days treatment with CK+AB or CK+DCI. Values shown are fold change relative to BTP organoids in progenitor media (column=mean, error=s.d.). Statistical comparison (p) was computed by two-tailed ratio paired t-test on the mean arbitrary units of expression for six biological replicates calculated from three technical replicates. FIG. 10I: Reference-based mapping of cells from days 1, 6 and 21 of CK+AB or CK+DCI treatment onto previously published UMAP dimensional reduction of proximal and distal lung scRNA-seq. FIG. 10J, K: Percentage of cells treated with CK+AB or CK+DCI mapping to FIG. 10J AT2 identities FIG. 10K non-AT2 identities. FIG. 10L: UMAP visualization of CK+AB and CK+DCI datasets mapped onto reference dataset and color coded by day of treatment.

[0058] FIG. 11A-G: Characterization of the transcription response of BTP organoids to CK+DCI and identification of clusters with the most AT2 marker overlap at each timepoint of CK+DCI treatment. Related to FIG. 10. FIG. 11A: Comparison of the percentage of cells in each phase of the cell cycle in BTP organoids (day 0) and at indicated day of CK+DCI treatment. FIG. 11B: Violin plots comparing AT2 marker SFTPC or neuroendocrine marker expression (ASCL1, CHGA) in neuroendocrine-like cells present in either CK+DCI or CK+AB treated BTP organoids. Significance of differential enrichment (p) between the ASCL1-positive Neuroendocrine-like clusters from CK+DCI and CK+AB differentiations was determined by Wilcoxon Rank Sum test with Bonferroni correction. FIG. 11C: Dot plot showing markers enriched in clusters of unknown identity from integrated scRNA-seq data of CK+DCI treatment time course. FIG. 11D, E, F: UMAP visualization of Louvain clustering and gene expression for AT2 markers (SFTPC, SFTPA1) in CK+DCI treated BTOs after (d) 1 day (e) 6 days (f) 21 days. The cluster with the highest overlapping expression of SFTPC and SFTPA1 is highlighted in the rightmost plot. FIG. 11G: UMAP visualization of integrated scRNA-seq data from BTP organoids (day 0) and day 1, 6 and 21 of CK+DCI treatment with highest SFTPC / SFTPA1 co-expressing cells from independent analysis of each scRNA-seq timepoint (part d-f) highlighted and color coded by timepoint.

[0059] FIG. 12A-B: AT2 and BTP marker expression in BTP organoids under TGFb-inhibition and BMP-activation and the effect of all-trans retinoic acid (ATRA) on AT2 differentiation of BTP organoids. Related to FIG. 3. FIG. 12A: Immunofluorescent staining images of AT2 markers (ProSFTPC and SFTPA) and BTP marker SOX9 in BTP organoids cultured in progenitor media or progenitor media with addition of TGFb inhibitor A-8301 and BMP activator BMP4 alone or simultaneously for seven days. Scale=100 μm. FIG. 11B: RT-qPCR measurements comparing AT2 markers (SFTPC, SFTPA1, LAMP3, HOPX, SFTPB) or BTP marker SOX9 in response to simultaneous TGFb-inhibition and BMP activation in the presence (+A-8301 / BMP4) or absence (+A8301 / BMP4+ATRA Withdraw) of ATRA for seven days. Values shown are fold change relative to BTP organoids maintained in Progenitor media (column=mean, error=s.d.). Statistical comparison (p) was computed by two-tailed ratio paired t-test on the mean arbitrary units of expression for six biological replicates calculated from three technical replicates.DEFINITIONS

[0060] As used herein, the term “pluripotent stem cells (PSCs),” also commonly known as PS cells, encompasses any cells that can differentiate into nearly all cells, i.e., cells derived from any of the three germ layers (germinal epithelium), including endoderm (interior stomach lining, gastrointestinal tract, the lungs), mesoderm (muscle, bone, blood, urogenital), and ectoderm (epidermal tissues and nervous system). PSCs can be the descendants of totipotent cells, derived from embryonic stem cells (including embryonic germ cells) or obtained through induction of a non-pluripotent cell, such as an adult somatic cell, by forcing the expression of certain genes.

[0061] As used herein, the term “embryonic stem cells (ESCs),” also commonly abbreviated as ES cells, refers to cells that are pluripotent and derived from the inner cell mass of the blastocyst, an early-stage embryo. For purpose of the present invention, the term “ESCs” is used broadly sometimes to encompass the embryonic germ cells as well.

[0062] As used herein, the term “induced pluripotent stem cells (iPSCs),” also commonly abbreviated as iPS cells, refers to a type of pluripotent stem cells artificially derived from a normally non-pluripotent cell, such as an adult somatic cell, by inducing a “forced” expression of certain genes.

[0063] As used herein, the term “precursor cell” encompasses any cells that can be used in methods described herein, through which one or more precursor cells acquire the ability to renew itself or differentiate into one or more specialized cell types. In some embodiments, a precursor cell is pluripotent or has the capacity to becoming pluripotent. In some embodiments, the precursor cells are subjected to the treatment of external factors (e.g., growth factors) to acquire pluripotency. In some embodiments, a precursor cell can be a totipotent (or omnipotent) stem cell; a pluripotent stem cell (induced or non-induced); a multipotent stem cell; an oligopotent stem cells and a unipotent stem cell. In some embodiments, a precursor cell can be from an embryo, an infant, a child, or an adult. In some embodiments, a precursor cell can be a somatic cell subject to treatment such that pluripotency is conferred via genetic manipulation or protein / peptide treatment.

[0064] In developmental biology, cellular differentiation is the process by which a less specialized cell becomes a more specialized cell type. As used herein, the term “directed differentiation” describes a process through which a less specialized cell becomes a particular specialized target cell type. The particularity of the specialized target cell type can be determined by any applicable methods that can be used to define or alter the destiny of the initial cell. Exemplary methods include but are not limited to genetic manipulation, chemical treatment, protein treatment, and nucleic acid treatment.

[0065] As used herein, the term “cellular constituents” are individual genes, proteins, mRNA expressing genes, and / or any other variable cellular component or protein activities such as the degree of protein modification (e.g., phosphorylation), for example, that is typically measured in biological experiments (e.g., by microarray or immunohistochemistry) by those skilled in the art. Significant discoveries relating to the complex networks of biochemical processes underlying living systems, common human diseases, and gene discovery and structure determination can now be attributed to the application of cellular constituent abundance data as part of the research process. Cellular constituent abundance data can help to identify biomarkers, discriminate disease subtypes and identify mechanisms of toxicity.

[0066] As used herein, the term “organoid” is used to mean a 3-dimensional growth of mammalian cells in culture that retains characteristics of the tissue in vivo, e.g. prolonged tissue expansion with proliferation, multilineage differentiation, recapitulation of cellular and tissue ultrastructure, etc.DETAILED DESCRIPTION OF THE INVENTION

[0067] During lung development, all epithelial cells of the pulmonary airways and alveoli differentiate from specialized progenitor cells that reside at the tips of a tree-like network of epithelial tubes, called bud tip progenitors (BTPs) 1-3. During the pseudoglandular stage of development, BTPs undergo repeated bifurcations, a process known as branching morphogenesis, and give rise to the trachea and conducting airways (bronchi, bronchioles). Later, during the canalicular stage, cells of the alveolar epithelium begin to differentiate. Cells located within the epithelial stalk region directly adjacent to BTPs beginning to express alveolar type 1 (AT1) marker genes, and with the bud tip domain beginning to express markers consistent with alveolar type 2 (AT2) differentiation2-6. How descendants of BTPs are influenced to differentiate into airway or alveolar cell fates is determined by cues from their environment, but the mechanisms promoting human alveolar differentiation are not fully characterized7-9.

[0068] Clinical data has shown that treating premature infants with dexamethasone (a glucocorticoid receptor (GR) stimulating hormone) and / or inducers of cAMP signaling promotes lung epithelial maturation and surfactant production10-12. This information has been leveraged to develop methods to differentiate primary or iPSC-derived lung epithelium into AT2-like cells13-17. Interestingly, studies in mice have shown that GR signaling is not required for alveolar cell fate specification, but rather loss of GR leads to a reduced size of the alveolar compartment18,19. Likewise, AT2 differentiation is only moderately reduced in mice lacking the primary effector of cAMP signaling20. These results suggest that while GR signaling and cAMP can play an important role in alveolar cell maturation and surfactant production, other cell signaling pathways likely operate alongside GR / cAMP to promote alveolar specification from BTPs.

[0069] More recently, single cell characterization of the developing human lung has been applied to identify factors that regulate human BTPs and their differentiation5,6,21-23. Experiments conducted during the course of developing embodiments for the present invention focused on cell signaling events that occur during nascent alveolar differentiation in the developing human lung. Such experiments leveraged single cell RNA-sequencing (scRNA-seq) data from human fetal lungs and used computational approaches to interrogate the signaling events that take place between BTPs and RSPO2+ mesenchymal cells, which comprises a major component of the BTP niche22. Such experiments also developed and interrogated a serum- and growth factor-free human fetal lung explant system that undergoes nascent alveolar differentiation. Collectively, data from these analyses point to TGF-β and BMP signaling as important cell signaling pathways that work in opposition to promote AT2 differentiation, with low levels of TGF-β and high levels of BMP signaling associated with differentiation of BTPs to AT2 cells.

[0070] This model was tested in BTP organoids3, combining simultaneous TGF-β inhibition (TGF-βi) and BMP activation (BMPa) to efficiently induce AT2 differentiation in BTP organoids. AT2-like organoids generated using TGF-βi / BMPa maintain an AT2 phenotype when expanded in serum-free monoculture conditions optimized for primary adult human AT2 organoids. As a comparison for TGF-βi / BMPa induced AT2s, such experiments also applied a Dexamethasone and cyclic AMP (CK+DCI) protocol used commonly for generating iPSC-derived AT2-like cells17,24-25, and found that BTP organoids gave rise to AT2-like cells, albeit with reduced specificity. Nonetheless, CK+DCI induced AT2 cells could also be expanded in primary AT2 organoid media, facilitating 3-way comparison between organoids produced by each methods and benchmarked against primary adult AT2 organoids in the same media. This analysis revealed that TGF-βi / BMPa induced organoids maintain a more homogenous population of AT2-like cells than organoids differentiated with CK+DCI. Of note, comparison of AT2-phenotype retaining cells induced by both methods revealed highly similar AT2s based on scRNA-seq data. Induced AT2-like organoids were shown to be capable of expansion for >100 days in media optimized for the expansion of primary adult AT2 cell organoids, expression of mature AT2 markers, and secretion of lamellar bodies. Further experiments compared TGF-β / BMP induction against methods employed to generate iPSC-derived AT2 cells, and benchmarked induced organoids against adult AT2 organoids, revealing method-specific gene expression patterns, induction efficiencies, and specificity of cell types that emerge. These findings revealed a role for TGF-β and BMP in efficiently inducing early AT2 differentiation, leading to AT2-like cells with long-term expansion capabilities.

[0071] Taken together such findings identify TGFβ-and BMP-signaling as important pathways regulating nascent alveolar differentiation in vivo that can be leveraged to generate AT2-like organoids, which produce and secrete lamellar bodies, and have long-term expansion capabilities when grown in media optimized for primary AT2 organoids.

[0072] Accordingly, the present invention relates to methods and systems for growing, expanding and / or obtaining human alveolar cells from one or both of induced-pluripotent stem cell (iPSC) derived tissue and bud tip progenitor cells derived from human tissue in vitro. In particular, the invention disclosed herein relates to methods and systems for growing human alveolar type 2 (AT2)-like cells through modulation of TGF-β and BMP signaling in one or both of induced-pluripotent stem cell (iPSC) derived tissue and bud tip progenitor cells derived from human tissue in vitro.

[0073] In certain embodiments, the present invention provides methods for obtaining alveolar cells.

[0074] In some embodiments, the methods comprise culturing one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue in vitro, and obtaining alveolar cells from the cultured one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue.

[0075] In some embodiments, the methods consist essentially of culturing one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue in vitro, and obtaining alveolar cells from the cultured one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue.

[0076] In some embodiments, the methods consist of culturing one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue in vitro, and obtaining alveolar cells from the cultured one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue.

[0077] In any of such method embodiments, the culturing results in differentiation of the one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue into alveolar cells.

[0078] In some embodiments, the lung bud tip progenitor cells are derived from pluripotent stem cells. In some embodiments, the lung bud tip progenitor cells are derived from definitive endoderm cells. In some embodiments, the definitive endoderm cells are derived from pluripotent stem cells. In some embodiments, the pluripotent stem cells are embryonic stem cells and / or induced pluripotent stem cells and / or or cells obtained through somatic cell nuclear transfer.

[0079] In any of such method embodiments, the culturing comprises simultaneous modulation of TGF-β pathway signaling and BMP pathway signaling.

[0080] In any of such method embodiments, the iPSC-derived lung tissue comprises iPSC-derived bud tip progenitor cells. In any of such method embodiments, the bud tip progenitor cells derived from human tissue are derived from human lung tissue. In any of such method embodiments, the bud tip progenitor cells express SOX9. In any of such method embodiments, the iPSC-derived tissue expresses SOX9.

[0081] In any of such method embodiments, the obtained alveolar cells are alveolar type 2 (AT2)-like cells and / or alveolar cell organoid tissue. In some embodiments, the alveolar organoid tissue comprises AT2-like cell organoid tissue. In some embodiments, the obtained AT2-like cells and / or alveolar cell organoid tissue express mature AT2 markers. In some embodiments, the obtained AT2-like cells and / or alveolar cell organoid tissue express one or more of: SFTPC, SFTPA1, LAMP3, HOPX, SFTPB, and HOPX. In some embodiments, the obtained AT2-like cells and / or alveolar cell organoid tissue do not express SOX9. In some embodiments, the obtained AT2-like cells and / or alveolar cell organoid tissue express lower amounts of SOX9 than the amount of SOX9 expressed in the one or both of iPSC-derived tissue and bud tip progenitor cells.

[0082] In any of such method embodiments, the culturing further comprises exposure to a progenitor media along with the simultaneous modulation of TGF-β pathway signaling and BMP pathway signaling. In some embodiments, the progenitor media comprises FGF7 and / or CHIR99021. In some embodiments, the progenitor media further comprises all-trans retinoic acid.

[0083] In any of such method embodiments, the culturing duration is not limited. In any of such method embodiments, the culturing duration is limited. In some embodiments, the culturation duration is for seven days. In some embodiments, the culturation duration is for fourteen days. In some embodiments, the culturation duration is for between seven and fourteen days. In some embodiments, the culturation duration is for between approximately seven (e.g., 4, 5, 6, 7, 8, 9, 10 days) and approximately fourteen days (e.g., 11, 12, 13, 14, 15, 16, 17 days).

[0084] In any of such method embodiments, the obtained alveolar cells are capable of expansion in media optimized for the expansion of primary adult alveolar cell organoids. In some embodiments, the media optimized for the expansion of primary adult alveolar cell organoids does not contain FGF10.

[0085] In any of such method embodiments, the obtained alveolar cells are capable of expansion for >100 days in media optimized for the expansion of primary adult alveolar cell organoids.

[0086] In any of such method embodiments, the obtained alveolar cells secrete lamellar bodies. In any of such method embodiments, the obtained alveolar cells have surfactant processing capabilities. In any of such method embodiments, the obtained alveolar cells have secretion capabilities.

[0087] In some embodiments, the simultaneous modulation of TGF-β and BMP signaling comprises simultaneous inhibition of TGF-β signaling and activation of BMP signaling.

[0088] Such methods are not limited to a particular manner of inhibiting the TGF-β signaling pathway. Exemplary TGF-β inhibitors may be selected from A small molecules that inhibit the TGF-β pathway, proteins that inhibit the TGF-β pathway, and may include the following: ALK5 inhibitors (e.g., A83-01 (CAS number: 909910-43-6), GW788388, RepSox, and SB-431542 (CAS number: 301836-41-9)), SB-505124 (CAS number: 694433-59-5), SB-525334 (CAS number: 356559-20-1), LY364947 (CAS number: 396129-53-6), SD-208 (CAS number: 627536-09-8), SJN2511 (CAS number: 446859-33-2), and combinations thereof. The TGF-β inhibitor preferably has an inhibitory activity of 50% or more, more preferably 70% or more, still more preferably 80% or more, and particularly preferably 90% or more, compared with the level of TGF-β activity in the absence of the inhibitor. TGF-β activation activity can be assessed by methods well known to those skilled in the art.

[0089] Such methods are not limited to a particular manner of activating the BMP signaling pathway. Exemplary BMP signaling pathway activators may be selected from BMP1, BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8a, BMP8b, BMP10, BMP11, BMP15, IDE1, IDE2, derivatives thereof, and mixtures thereof, small molecules that activate the BMP pathway, and proteins that activate the BMP pathway, and additionally may include ventromophins, 4′-hydroxy chalcone, apigenin, and combinations thereof. The BMP activator preferably has an activation activity of 50% or more, more preferably 70% or more, still more preferably 80% or more, and particularly preferably 90% or more, compared with the level of BMP activity in the absence of the activator. BMP activation activity can be assessed by methods well known to those skilled in the art.

[0090] In some embodiments, the culturing and obtaining steps are conducted in vitro.

[0091] In some embodiments, the simultaneous inhibition of TGF-β signaling and activation of BMP signaling is for 6 or more hours; 12 or more hours; 18 or more hours; 24 or more hours; 36 or more hours; 48 or more hours; 60 or more hours; 72 or more hours; 84 or more hours; 96 or more hours; 120 or more hours; 150 or more hours; 180 or more hours; 240 or more hours; 11 days; 12 days, 13 days; 14 days, 15 days; 16 days; 17 days; 20 days; 24 days; 1 month; 6 months; etc.

[0092] In some embodiments, the simultaneous inhibition of TGF-β signaling and activation of BMP signaling is at a concentration of 10 ng / ml or higher; 20 ng / ml or higher; 50 ng / ml or higher; 75 ng / ml or higher; 100 ng / ml or higher; 120 ng / ml or higher; 150 ng / ml or higher; 200 ng / ml or higher; 500 ng / ml or higher; 1,000 ng / ml or higher; 1,200 ng / ml or higher; 1,500 ng / ml or higher; 2,000 ng / ml or higher; 5,000 ng / ml or higher; 7,000 ng / ml or higher; 10,000 ng / ml or higher; or 15,000 ng / ml or higher. In some embodiments, concentration is maintained at a constant level throughout the treatment. In other embodiments, concentration is varied during the course of the treatment. In some embodiments, the inhibition of TGF-β signaling and activation of BMP signaling is suspended in media that include fetal bovine serine (FBS) with varying HyClone concentrations. One of skill in the art would understand that the regimen described herein is applicable to any known activating or inhibiting agents, alone or in combination. When two or more activating or inhibiting agents are used, the concentration of each may be varied independently.

[0093] In some embodiments, an important step is to obtain stem cells that are pluripotent or can be induced to become pluripotent. In some embodiments, pluripotent stem cells are derived from embryonic stem cells, which are in turn derived from totipotent cells of the early mammalian embryo and are capable of unlimited, undifferentiated proliferation in vitro. Embryonic stem cells are pluripotent stem cells derived from the inner cell mass of the blastocyst, an early-stage embryo. Methods for deriving embryonic stem cells from blastocytes are well known in the art. For example, three cell lines (H1, H13, and H14) have a normal XY karyotype, and two cell lines (H7 and H9) have a normal XX karyotype. Additional stem cells that can be used in embodiments in accordance with the present invention include but are not limited to those provided by or described in the database hosted by the National Stem Cell Bank (NSCB), Human Embryonic Stem Cell Research Center at the University of California, San Francisco (UCSF); WISC cell Bank at the Wi Cell Research Institute; the University of Wisconsin Stem Cell and Regenerative Medicine Center (UW-SCRMC); Novocell, Inc. (San Diego, Calif.); Cellartis AB (Goteborg, Sweden); ES Cell International Pte Ltd (Singapore); Technion at the Israel Institute of Technology (Haifa, Israel); and the Stem Cell Database hosted by Princeton University and the University of Pennsylvania. Indeed, embryonic stem cells that can be used in embodiments in accordance with the present invention include but are not limited to SA01 (SA001); SA02 (SA002); ES01 (HES-1); ES02 (HES-2); ES03 (HES-3); ES04 (HES-4); ES05 (HES-5); ES06 (HES-6); BG01 (BGN-01); BG02 (BGN-02); BG03 (BGN-03); TE03 (13); TE04 (14); TE06 (16); UC01 (HSF1); UC06 (HSF6); WA01 (H1); WA07 (H7); WA09 (H9); WA13 (H13); WA14 (H14).

[0094] In some embodiments, the stem cells are further modified to incorporate additional properties. Exemplary modified cell lines include but not limited to H1 OCT4-EGFP; H9 Cre-LoxP; H9 hNanog-pGZ; H9 hOct4-pGZ; H9 in GFPhES; and H9 Syn-GFP.

[0095] More details on embryonic stem cells can be found in, for example, Thomson et al., 1998, Science 282 (5391): 1145-1147; Andrews et al., 2005, Biochem Soc Trans 33:1526-1530; Martin 1980, Science 209 (4458): 768-776; Evans and Kaufman, 1981, Nature 292 (5819): 154-156; Klimanskaya et al., 2005, Lancet 365 (9471): 1636-1641).

[0096] Alternative, pluripotent stem cells can be derived from embryonic germ cells (EGCs), which are the cells that give rise to the gametes of organisms that reproduce sexually. EGCs are derived from primordial germ cells found in the gonadal ridge of a late embryo, have many of the properties of embryonic stem cells. The primordial germ cells in an embryo develop into stem cells that in an adult generate the reproductive gametes (sperm or eggs). In mice and humans it is possible to grow embryonic germ cells in tissue culture under appropriate conditions. Both EGCs and ESCs are pluripotent. For purpose of the present invention, the term “ESCs” is used broadly sometimes to encompass EGCs.

[0097] In some embodiments, iPSCs are derived by transfection of certain stem cell-associated genes into non-pluripotent cells, such as adult fibroblasts. Transfection is typically achieved through viral vectors, such as retroviruses. Transfected genes include the master transcriptional regulators Oct-3 / 4 (Pouf51) and Sox2, although it is suggested that other genes enhance the efficiency of induction. After 3-4 weeks, small numbers of transfected cells begin to become morphologically and biochemically similar to pluripotent stem cells, and are typically isolated through morphological selection, doubling time, or through a reporter gene and antibiotic selection. As used herein, iPSCs include but are not limited to first generation iPSCs, second generation iPSCs in mice, and human induced pluripotent stem cells. In some embodiments, a retroviral system is used to transform human fibroblasts into pluripotent stem cells using four pivotal genes: Oct3 / 4, Sox2, Klf4, and c-Myc. In alternative embodiments, a lentiviral system is used to transform somatic cells with OCT4, SOX2, NANOG, and LIN28. Genes whose expression are induced in iPSCs include but are not limited to Oct-3 / 4 (e.g., Pou5fl); certain members of the Sox gene family (e.g., Sox1, Sox2, Sox3, and Sox15); certain members of the Klf family (e.g., Klf1, Klf2, Klf4, and Klf5), certain members of the Myc family (e.g., C-myc, L-myc, and N-myc), Nanog, and LIN28.

[0098] More details on induced pluripotent stem cells can be found in, for example, Kaji et al., 2009, Nature 458:771-775; Woltjen et al., 2009, Nature 458:766-770; Okita et al., 2008, Science 322 (5903): 949-953; Stadtfeld et al., 2008, Science 322 (5903): 945-949; and Zhou et al., 2009, Cell Stem Cell 4 (5): 381-384.

[0099] In some embodiments, examples of iPS cell lines include but not limited to iPS-DF19-9; iPS-DF19-9; iPS-DF4-3; iPS-DF6-9; iPS (Foreskin); iPS (IMR90); and iPS (IMR90).

[0100] Such methods are not limited to a particular manner of accomplishing the directed differentiation of PSCs into definitive endoderm. Indeed, any method for producing definitive endoderm from pluripotent cells (e.g., iPSCs or ESCs) is applicable to the methods described herein. In some embodiments, pluripotent cells are derived from a morula. In some embodiments, pluripotent stem cells are stem cells. Stem cells used in these methods can include, but are not limited to, embryonic stem cells. Embryonic stem cells can be derived from the embryonic inner cell mass or from the embryonic gonadal ridges. Embryonic stem cells or germ cells can originate from a variety of animal species including, but not limited to, various mammalian species including humans. In some embodiments, human embryonic stem cells are used to produce definitive endoderm. In some embodiments, human embryonic germ cells are used to produce definitive endoderm. In some embodiments, iPSCs are used to produce definitive endoderm.

[0101] In certain embodiments, the present invention provides compositions comprising alveolar cells. In certain embodiments, the present invention provides compositions consisting essentially of alveolar cells. In certain embodiments, the present invention provides compositions consisting of alveolar cells. In any of such composition embodiments, the alveolar cells are obtained with any of methods for obtaining alveolar cells described herein.

[0102] In certain embodiments, the present invention provides methods of treating a mammalian subject having a damaged lung tissue with reduced function, comprising engrafting alveolar cells at the site of damaged lung tissue with reduced function, wherein the engrafted alveolar cells at the site of injury repopulate at least a portion of the site with the engrafted alveolar cells, wherein the repopulated engrafted alveolar cells supplement the function of the damaged lung tissue with reduced function, thereby treating the mammalian subject.

[0103] In certain embodiments, the present invention provides methods of treating a mammalian subject having a damaged lung tissue with reduced function, consisting essentially of engrafting alveolar cells at the site of damaged lung tissue with reduced function, wherein the engrafted alveolar cells at the site of injury repopulate at least a portion of the site with the engrafted alveolar cells, wherein the repopulated engrafted alveolar cells supplement the function of the damaged lung tissue with reduced function, thereby treating the mammalian subject.

[0104] In certain embodiments, the present invention provides methods of treating a mammalian subject having a damaged lung tissue with reduced function, consisting of engrafting alveolar cells at the site of damaged lung tissue with reduced function, wherein the engrafted alveolar cells at the site of injury repopulate at least a portion of the site with the engrafted alveolar cells, wherein the repopulated engrafted alveolar cells supplement the function of the damaged lung tissue with reduced function, thereby treating the mammalian subject.

[0105] In any of such treatment methods, the alveolar cells are obtained with any of methods for obtaining alveolar cells described herein.

[0106] In some embodiments, the mammalian subject is a human subject.

[0107] In some embodiments, the damaged lung tissue with reduced function is associated with, but not limited to, a condition caused by one or more of an injury that results in a loss of epithelial function, a post-lung transplant complication, and / or a genetic disorder. In some embodiments, the injury that results in loss of epithelial function is bronchiolitis obliterans. In some embodiments, the post-lung transplant complication is bronchiolitis obliterans. In some embodiments, the genetic disorder is one or more mutations that cause an impairment or a loss of epithelial cell function, wherein the genetic disorder is cystic fibrosis.

[0108] In certain embodiments, the present invention provides kits comprising alveolar cells.

[0109] In certain embodiments, the present invention provides kits consisting essentially of alveolar cells.

[0110] In certain embodiments, the present invention provides kits consisting of alveolar cells.

[0111] In any of such kit embodiments, the alveolar cells are obtained with any of methods for obtaining alveolar cells described herein.

[0112] In certain embodiments, the present invention provides kits comprising lung bud tip progenitor cells, TGF-β inhibiting agents, and BMP activating agents.

[0113] In certain embodiments, the present invention provides kits consisting essentially of lung bud tip progenitor cells, TGF-β inhibiting agents, and BMP activating agents.

[0114] In certain embodiments, the present invention provides kits consisting of lung bud tip progenitor cells, TGF-β inhibiting agents, and BMP activating agents.EXAMPLES

[0115] The following examples are illustrative, but not limiting, of the compounds, compositions, and methods of the present invention. Other suitable modifications and adaptations of the variety of conditions and parameters normally encountered in clinical therapy and which are obvious to those skilled in the art are within the spirit and scope of the invention. The use of pronouns such as “I”, “we”, and “our”, for example, refer to one or more of the inventors.Example I

[0116] This example demonstrates that the human bud tip niche increases BMP signaling and decreases TGF-β signaling activity over developmental time in vivo.

[0117] Using our previously published scRNA-seq data from human fetal lungs21 we applied CellChat26 to computationally interrogate cell-cell communication between BTPs and RSPO2-positive mesenchyme, which surrounds BTPs and is an established source of BTP niche cues in humans22. To identify interactions enriched in BTPs, we also included non-BTP distal epithelial cells (also referred to as ‘bud tip adjacent’, or stalk cells) and their associated mesenchyme population, identified by co-expression of SM22, ACTA2 and NOTUM5,22,27 This analysis predicted that RSPO2-positive mesenchyme is a source of WNT, BMP and FGF ligands (FIG. 1A). We also observed that BTPs were the main source of TGFβ ligands in this analysis, which is predicted to signal in an autocrine manner as well as to non-BTP epithelium and SM22-positive mesenchyme (FIG. 1A). We have previously shown that activation of TGFβ-and BMP-signaling are associated with BTP differentiation into airway21,23; therefore, to interrogate these pathways further, we analyzed predicted ligand-receptor pairs (FIG. 2A) and plotted the expression of expressed ligands over developmental time in BTPs and RSPO2-positive mesenchyme (FIG. 1B,C). This analysis revealed a trend of increasing transcription of BMP ligands, and the BMP-signaling target gene ID2, while TGFβ ligands remained unchanged or decreased over developmental time in both BTPs and RSPO2-positive mesenchyme. These changes correlated with decreasing levels of the BTP markers SOX2 and SOX9 as well as increased SFTPC expression in BTPs (FIG. 1B). To confirm increased BMP ligand and target gene expression with developmental time as suggested by our scRNA-seq analysis, we performed FISH for BMP4 and ID2 on tissue sections of pseudoglandular stage (59 days) and canalicular stage (112 days) human lung (FIG. 1D). Quantification of FISH foci in SOX9-positive BTPs, SOX9-negative (stalk, bud tip adjacent) non-BTP epithelium and their associated mesenchyme populations confirmed higher BMP4 in BTPs (SOX9-positive) than non-BTP (SOX9-negative) cells at both timepoints examined, which significantly increased in both populations at the later timepoint (FIG. 1E). ID2 transcription was also higher in BTPs compared to non-BTP epithelium at both timepoints and decreased in non-BTP epithelium at the later timepoint (FIG. 1F). These observations suggest that BTPs move towards a state of higher BMP-and lower TGFβ-signaling activity as development proceeds.Example II

[0118] This example demonstrates that nascent AT2 differentiation is associated with higher levels of BMP signaling and lower levels of TGF-β signaling activity.

[0119] Interrogating later stages of human lung development when alveolar differentiation occurs is challenging due to a lack of access to tissue. To overcome this limitation, we turned to air-liquid interface (ALI) explant cultures, which allows continued development in serum-free, growth-factor free media. We explanted small distal fragments of 15-18.5 week canalicular stage human lung into ALI culture on polycarbonate filters floating on serum-and growth factor-free media21,22,28 (FIG. 2B,C). The lung epithelium remained healthy and underwent changes in marker expression consistent with alveolar differentiation over the course of 14 days (FIG. 1G,H). In BTPs identified by SOX9 expression, we observed the onset of the AT2 cell marker ABCA3, which was not detected in BTPs prior to culture, as well as an increased intensity of ProSFTPC staining (FIG. 1G). In SOX9-negative cells, we saw expression of the AT1 marker AGER, which was limited in tissue prior to culture (FIG. 1H). IF analysis also revealed the onset of additional markers indicative of AT2 differentiation in bud tips, including SFTPC and SFTPB co-expression (FIG. 1I) and SFTPA, although frequency of SFTPA within the pool of ProSFTPC-positive cells was low relative to adult AT2s (FIG. 2D,E). PDPN was co-expressed in cells staining positive for AGER (FIG. 1I). HOPX was detected in both bud tip and stalk regions, although to a lesser extent in bud tips (FIG. 1I). Thus, canalicular stage ALI explants undergo nascent alveolar differentiation as evidenced by the onset of AT1 and AT2 markers.

[0120] To expand these findings, we carried out scRNA-seq on a timecourse of ALI explants at day three, six, nine and twelve of culture. This analysis confirmed the presence of epithelial cells expressing markers of AT1 (AQP4, AGER), AT2 (SFTPC) or airway (SOX2) identity as well as additional populations of mesenchymal, immune, endothelial and mesothelial cells from all timepoints examined (FIG. 2F, G). Extraction and re-clustering of epithelial cells identified a single cluster of airway cells, a cluster of proliferative cells, two clusters with AT1 marker expression and two clusters with AT2 marker expression (FIG. 1J, K). When compared to BTPs prior to culture, non-airway epithelial clusters in ALI explants had higher expression of AGER or SFTPC further supporting the conclusion that AT1 and AT2 differentiation occurs in ALI explant cultures (FIG. 2I). Based on recent descriptions of AT1 and AT2 populations in adult and developing lungs6,29,30,31, we classified clusters as ‘early’ and ‘later’ in the differentiation process, with later AT1s distinguished by increased RTKN2 and SPOCK2 expression, and later AT2s distinguished by increased expression of DNMBT1 and SFTPA1 (FIG. 1K). Early and later designations within AT1 and AT2 clusters based on marker expression were not strongly correlated with time in culture (FIG. 2J,K), indicating that differentiation is non-synchronous in explants. Nevertheless, comparing AT2 markers by scRNA-seq in BTPs, explant AT2s and adult AT2s confirmed broad AT2 marker onset relative to BTPs even when considered in bulk (FIG. 2L), except for SFTPA1, which was infrequently expressed relative to adult AT2 cells, as expected from IF analysis (FIG. 2D,E). Examination of BMP-and TGFβ-signaling ligands in explant epithelial populations suggested that cells differentiating towards AT1 transcribed higher levels of TGFβ ligands while cells differentiating into AT2s transcribed higher levels of BMP ligands and the BMP target ID2 (FIG. 1L). Indeed, relative to canalicular stage human fetal lung tissue, ALI explants had higher levels of BMP-dependent phosphoSMAD1 / 5 / 8, particularly in cells undergoing AT2 differentiation as indicated by SFTPC co-staining (FIG. 1M). We further observed that phosphoSMAD1 / 5 / 8 could be blocked by the BMP inhibitor NOGGIN in explants (FIG. 1M). These findings associate higher levels of BMP-signaling with cells undergoing AT2 differentiation and higher levels of TGFβ-signaling with cells undergoing AT1 differentiation in ALI explants.Example III

[0121] This example demonstrates that BMP and TGF-β signaling exhibit opposing activities on AT2 differentiation in explants and BTP organoids.

[0122] Given data from tissue and explants suggesting roles for BMP-and TGFβ-signaling during alveolar cell differentiation (FIG. 1), we functionally interrogated the role of BMP-and TGFβ-signaling in serum- and growth factor-free ALI explant cultures, focusing on the AT2 lineage. We used ProSFTPC-positive cells within ALI explants to identify nascent AT2 cells and used SFTPA co-expression as a readout for more advanced AT2 differentiation. SFTPA was undetected or limited to very low expression in a few cells in untreated ALI explants (FIG. 3A). Inhibition of BMP-signaling by addition of recombinant NOGGIN to the underlying media did not change SFTPA staining intensity or frequency relative to untreated ALI explants (FIG. 3A). In contrast, activation of BMP-signaling with recombinant BMP4 led to robust and readily detectable levels of SFTPA staining in ProSFTPC-positive cells (FIG. 3A).

[0123] Manipulation of TGFβ-signaling had the opposite effects on SFTPA expression. Here, SFTPA was increased in ProSFTPC positve cells upon addition of the TGFβ-signaling inhibitor A-8301 (FIG. 3B). In contrast, activation of TGFβ-signaling by the addition of recombinant TGFβ1 led to reduced ProSFTPC and barely detectible SFTPA staining (FIG. 3B), with most epithelial cells expressing TP63 (FIG. 2C), consistent with previous reports that TGFβ-activation promotes differentiation of BTPs towards airway21,32. Taken together these results show that TGFβ-inhibition and BMP-activation led to the strongest increases in SFTPA expression, suggesting functionally opposing roles of TGFβ-and BMP-signaling in AT2 differentiation.

[0124] To corroborate the results from explant cultures we turned to epithelial only ‘BTP organoids’, in which the BTP state is maintained in progenitor media consisting of a WNT-agonist CHIR099021, FGF7 (otherwise known as Keratinocyte Growth Factor-KGF) and all-trans retinoic acid (ATRA)3. Given the AT2 promoting effects of BMP-activation or TGFβ-inhibition in explants, we hypothesized that activation of BMP-signaling or inhibition of TGFβ-signaling in BTP organoids would differentiate BTP organoids towards the AT2 lineage. In addition, we hypothesized that combining both signaling cues through simultaneous TGFβ-inhibition and BMP-activation would lead to more robust differentiation than manipulating each signaling pathway independently. To test this, we supplemented bud tip progenitor media with A-8301 or BMP4 individually, or A-8301 and BMP4 in combination for seven days and compared the response of AT2 differentiation markers by RT-qPCR (FIG. 3D). Inhibition of TGFβ-signaling (+A-8301) significantly increased SFTPC and SFTPA1 over levels observed in bud tip progenitor media (FIG. 3E). Activation of BMP-signaling (+BMP4) significantly increased SFTPA1, LAMP3, SFTPB and HOPX (FIG. 3E). Neither treatment alone significantly reduced expression of the BTP marker SOX9. However, exceeding the effects of individual treatments, simultaneous TGFβ-inhibition and BMP-activation (+A-8301 / BMP4) significantly increased all AT2 markers examined while also significantly decreasing the BTP marker SOX9 (FIG. 3E). Examination of ProSFTPC, SFTPA and SOX9 protein by immunofluorescence corroborated the results of qPCR experiments, with +A-8301 / BMP4 treated cells co-expressing ProSFTPC and SFTPA while SOX9 was decreased (Supplementary FIG. 3A). These experiments were performed in bud tip progenitor maintenance media containing FGF7, WNT-agonist CHIR90221, and ATRA. The FGF-and WNT-signaling pathways are important components of the bud tip progenitor and AT2 niche in vivo and likewise are important for differentiation and maintenance of AT2s in vitro2,3,5,6,17,22,33,34,35, however, the role of ATRA in AT2 differentiation is less clear36,37 To test if ATRA is required for AT2 differentiation of BTPs we compared the effect of CHIR99021 / KGF (‘CK’) plus A-8301 / BMP4 (‘AB’) (referred to as CK+AB) in the presence or absence of ATRA by RT-qPCR. Removal of ATRA had mixed effects on AT2 differentiation, significantly enhancing SFTPC while reducing SOX9, while other markers were unchanged and SFTPB was reduced (Supplementary FIG. 3B). Because ATRA removal had very modest effects and did not positively or negatively impact AT2 differentiation we removed it in subsequent experiments.Example IV

[0125] This example demonstrates that TGF-β-inhibition coupled with BMP activation efficiently differentiates BTP organoids to AT2-like cells.

[0126] To further evaluate the extent to which CK+AB is capable of differentiating BTP organoids towards an AT2 phenotype we further characterized cells differentiated with this method, focusing on the maturity of cells over the course of extended treatment, the efficiency of differentiation, and whether AT2-like cells made in this manner are committed to an AT2 identity when removed from differentiation media.

[0127] To examine the extent of AT2 differentiation in CK+AB treated BTP organoids, we first evaluated additional markers of AT2 identity by IF. Compared to cultures from the same passage maintained in bud tip progenitor media, we observed robust co-expression of ProSFTPC with additional AT2 markers including HTII-28038, NAPSA or SFTPA within 6 days of treatment (FIG. 4A). By RT-qPCR, CK+AB treated organoids increased AT2 markers over the course of 21 days and had reduced expression of the airway marker SOX2 (Supplementary FIG. 4A). Expression of AT2 genes / proteins was maximal when BMP-signaling was activated, even if BMP-signaling was inhibited early during differentiation as BTP organoids cultured with A-8301 plus NOGGIN for 21 days had significantly less AT2 differentiation than parallel cultures in which BMP4 was added for the last seven days (Supplementary FIG. 4B-D). To determine if CK+AB treated cells possessed lamellar bodies, an important benchmark for AT2 maturation, we examined CK+AB treated BTP organoids at day 21 by Transmission Electron Microscopy (TEM). In contrast to the few and poorly formed lamellar bodies observed in spontaneously differentiated BTP organoids3, we observed abundant lamellar bodies located intracellularly and within the lumen of organoids (‘LB’ in FIG. 4B). Moreover, lamellar bodies within the lumen appeared to be processed into tubular myelin, an ordered surfactant structure produced in the alveolar airspace39,40 (‘My’ in FIG. 4B), indicating AT2-like cells differentiated by CK+AB treatment possess functional capacity for lamellar body assembly, secretion, and extracellular processing.

[0128] To investigate broader transcriptional changes in response to CK+AB treatment we performed scRNA-seq on BTP organoids in progenitor media (day 0), or after 1, 6 or 21 days of CK+AB treatment. Comparison of each timepoint confirmed the expected onset of AT2 markers and downregulation of BTP markers (FIG. 4C). Analysis of individual CK+AB treatment timepoints show that at day 1 and day 6 CK+AB treated cells expressed classical AT2 surfactant markers heterogeneously. By day 21 AT2 marker expression was more uniform with all cells expressing SFTPC and greater than 90% co-expressing SFTPA1 and / or SFTPB (FIG. 4D, FIG. 5E-G). The data also revealed a strong cell cycle dynamic in our timecourse data with an initial burst of cell proliferation at day 1 and reduced levels of proliferation in day 21 CK+AB treated cells relative to cells in BTP organoids (FIG. 4E,F). Integration of all treatment timepoints organized cells either as progressing through the cell cycle, or by increasing AT2 marker onset, which correlated with timepoint (FIG. 4E,G,H). Louvain clustering recognized day 0 BTPs as a single cluster, clustered day 1 and day 6 of CK+AB treatment together and separate from day 21 AT2-like cells (FIG. 4I). None of the CK+AB treated clusters identified expressed high levels of airway epithelial cell type markers, except for a very small number (<0.05% of cells) of SFTPC expressing cells that co-expressed neuroendocrine markers (SFTPCHI / ASCL1+; FIG. 4J). Trajectory analysis using Slingshot41 confirmed a trajectory originating from BTP organoids and terminating at day 21 cells expressing high levels of SFTPC (FIG. 4K, Trajectory 1). In general, this trajectory aligned with the cells in G1 phase of the cell cycle (FIG. 4E) and was in the location of cells with the highest levels of SFTPC / SFTPA1 / SFTPB, identified during analysis of individual timepoints and overlaid onto the integrated UMAP embedding (FIG. 4L, FIG. 5E-G). Other trajectories identified by this analysis led to clusters corresponding to stages of the cell cycle (Trajectories 4, 5 and 6), or terminated in areas of lower AT2 marker expression, possibly representing differentiation bottlenecks (Trajectories 2 and 3). To extend our characterization beyond a handful of AT2 and BTP marker genes, we performed scRNA-sequencing on primary adult AT2 organoids to define a list of the top 199 genes (Supplementary Table 3) enriched in primary AT2 organoids relative to BTP organoids (see methods, FIG. 6). We then used this list to assign a gene set module score42 to each cell in CK+AB treated BTP organoids. This analysis confirmed increasing acquisition of an AT2 molecular signature over 21 days CK+AB treatment (FIG. 4M). In total, these results show that with continued CK+AB treatment most cells acquire gene transcription consistent with AT2 differentiation without the co-differentiation of off-target cell types, suggesting that CK+AB efficiently differentiates BTPs to an AT2 identity.Example V

[0129] This example demonstrates that AT2-like cells induced by TGF-βi / BMPa expand in primary AT2-optimized media yet exhibit phenotypic instability.

[0130] Although gene and protein expression of CK+AB-induced AT2-like cells was similar to primary AT2 cells in vitro (FIG. 4), we observed a decrease in growth of induced AT2-like cultures over the course of CK+AB treatment, leading to very little proliferation / growth by 21 days of differentiation (FIG. 4F, FIG. 7A). Primary AT2 cells have recently been shown to have the capacity to undergo extensive self-renewal in serum-free monoculture if given the appropriate growth cues43,44. Therefore, we hypothesized that the continued growth of day 21 CK+AB induced AT2-like organoids requires specific AT2 growth conditions following acquisition of an AT2 identity.

[0131] To test this, we transitioned day 21 CK+AB AT2-like organoids into serum-free feeder-free (SFFF) media optimized to support the self-renewal of primary AT2 cells in 3D organoid culture43. Day 21 CK+AB treated organoids transitioned to SFFF greatly increased their rate of growth relative to the amount of growth observed in day 14-21 CK+AB treated organoids (FIG. 7A) and exhibited extensive KI67 staining (FIG. 8A), leading to highly proliferative cultures that could be passaged at a ratio of 1:6 every 7-14 days for at least 10 passages. Initially, AT2-like cells transitioned to SFFF were positive for AT2 markers ProSFTPC, HTII-280, SFTPB and SFTPA1 (FIG. 7B), and possessed lamellar bodies (FIG. 7C). With continued culture in SFFF, we observed loss of SFTPC expression and increasing expression of MUC5AC (FIG. 7D,E). This data indicates that the AT2 phenotype of CK+AB-induced cells is unstable in SFFF.Example VI

[0132] This example demonstrates that removal of FGF10 from SFFF reduces phenotypic instability of CK+AB-induced AT2 cells.

[0133] We hypothesized that CK+AB-induced AT2 cells may be sensitive to growth factors or other components in SFFF, given that the expansion media was developed and optimized for fully mature AT2 cells from adults. We tested two modified versions of SFFF, one without the p38 MAPK inhibitor BIRB797, and the other without FGF10. Interestingly, removal of BIRB797 or FGF10 led to improved expression of SFTPC (FIG. 7F). Additionally, removal of FGF10 led to a reduction of MUC5AC to near-zero levels, while removal of BIRB797 increased MUC5AC (FIG. 7F). Based on this data, additional experiments were carried out to compare the robustness of SFFF without FGF10 to maintain the AT2 phenotype of CK+AB induced AT2-like cells.

[0134] CK+AB induced AT2-like cells from multiple biological specimens were transitioned to SFFF with and without FGF10 for 60 days and interrogated by FACS to determine the percent of cells expressing HTII-280 (FIG. 7G, FIG. 8B), by IF for co-expression of AT2 markers (ProSFTPC, HTII-280, SFTPB, SFTPA) and MUC5AC expression (FIG. 7H) and by qRT-PCR to measure bulk expression levels of these markers (FIG. 7I). This data confirmed the robustness of SFFF without FGF10 to maintain AT2 gene / protein expression while expanding CK+AB induced AT2-like organoids.

[0135] We noted differences in the appearance of induced AT2-like cells / organoids grown in SFFF with or without FGF10. Organoids maintained in SFFF with FGF10 primarily possessed a cystic appearance and localized HTII-280 on the luminal surface of organoids (FIG. 7J, FIG. 8C). In contrast, organoids maintained in SFFF without FGF10 grew as clusters of cells with HTII-280 on the membrane facing away from the organoid lumen (FIG. 7K, FIG. 8D), similar to primary AT2 cultures in complete SFFF (FIG. 8E). CK+AB-induced AT2-like organoids maintained many SFTPA-positive cells that co-localized with ProSFTPC (FIG. 8F). Collectively, these results indicate that the AT2 phenotype of CK+AB differentiated AT2-like cells is repressed by FGF10, and that AT2-like cells expanded in SFFF without FGF10 maintain AT2 marker expression.

[0136] Collectively, these results indicate that the AT2 phenotype of TGF-βi / BMPa differentiated AT2-like cells is repressed by FGF10, and that AT2-like cells expanded in the absence of FGF10 maintain AT2 marker expression.Example VII

[0137] This example demonstrates that CK+AB induced organoids maintain AT2-like cells after long-term expansion.

[0138] To determine the similarity of expanded CK+AB induced AT2 organoids to primary AT2 organoids we carried out a direct head-to-head comparison in SFFF without FGF10 media by scRNA-seq. Additionally, given that well established methods have been developed to generate iPSC-derived AT2 cells, we also included this method in the comparison by treating BTP organoids with CK+DCI as previously described5,15,16,17. BTP organoids were differentiated with either CK+AB or CK+DCI for 21 days and then expanded for an additional 120 days in SFFF without FGF10. Primary AT2 organoids were established from HTII-280-positive cells isolated from adult (>60 years, deceased) distal lung cultures, expanded in SFFF for 90 days and passaged into SFFF without FGF10 media 30 days before scRNA-sequencing.

[0139] We first evaluated each dataset independently to assess the proportion of cells exhibiting an AT2 phenotype and to identify non-AT2 cell types (FIG. 6). Within CK+AB induced AT2 cells, heterogeneity was observed and highlighted by cluster specific enrichment of individual AT2-associated genes such as SFTPC and SFTPA1, whereas some genes such as SFTPB were uniformly expressed across all cells (FIG. 6A,B). In contrast, in primary AT2 cultures expression of SFTPC, SFTPA1 and SFTPB was uniformly high (FIG. 9 A,B). When compared to CK+DCI (FIG. 9 C,D), AT2-like organoids differentiated with CK+AB had a greater proportion of cells expressing (FIG. 6C) and higher expression levels of genes encoding surfactant proteins (FIG. 6D). Both CK+AB and CK+DCI induced organoids maintained higher levels of progenitor marker SOX9 than primary AT2s suggesting they are more progenitor-like than primary AT2 organoids (FIG. 6D). Additionally CK+AB and CK+DCI induced organoids contained MUC5AC-positive cells, suggestive of the presence of cells with a goblet cell identity, although to a much greater extent in CK+DCI induced organoids (FIG. 6E). Increased MUC5AC expression in expanded CK+DCI induced organoids relative to CK+AB organoids was reproducible across differentiations performed on multiple BTP organoid lines (FIG. 9E). MUC5AC-positive cells appeared to be the main off-target cell type in induced organoids, as markers of other cell types were either not broadly expressed or lower in induced relative to primary AT2 organoids (Supplementary FIG. 6F). Gene module scoring of MUC5AC-positive cells in CK+DCI and CK+AB using gene enrichment lists from two goblet cell populations in an adult reference dataset45 suggested that MUC5AC-positive goblet-like cells were immature in both conditions (FIG. 9 G,H). Based on these observations, we conclude that CK+AB AT2-like organoids maintain a larger proportion of cells with AT2-phenotype than CK+DCI AT2-like organoids in SFFF without FGF10.

[0140] To support this conclusion, we performed “reference-based” mapping46 of all three organoid types using scRNA-seq of adult human terminal airways and alveoli45 as a reference (FIG. 6F). The majority of cells from primary AT2 organoids mapped to AT2 or proliferating AT2 clusters (93%), with smaller proportions mapping to a recently discovered cell type in terminal respiratory bronchioles co-expressing SFTPC and SCGB3A245 (5%) or the neuroendocrine (1%) cluster (FIG. 6F-H). In day 120 CK+AB induced AT2-like organoids the majority (66%) of cells mapped to either AT2 or proliferating AT2 cells (FIG. 6F,G), with the remainder of the cells mapping to either neuroendocrine cells (29%) or MUC5AC+MUC5B+ goblet cells (4%) (FIG. 6F,H). In contrast to primary or CK+AB induced organoids, most cells in day 120 CK+DCI induced AT2-like organoids mapped to non-AT2 cell types, which comprised neuroendocrine cells (42%), MUC5AC+MUC5B+ goblet cells (25%) and AT1 cells (10%), leaving a smaller fraction of cells mapping to AT2 or proliferating AT2 cells (21%) (FIG. 6F-H). These results are consistent with our clustering and analysis of cell identity markers and indicate that treatment of BTP organoids with CK+AB generates a more homogenous population of AT2 cells than CK+DCI when expanded in SFFF without FGF10 reflecting commitment of CK+AB AT2-like cells towards an AT2 phenotype.Example VIII

[0141] This example demonstrates expanded AT2-like cells in CK+AB and CK+DCI organoids are transcriptionally similar to each other and distinct from primary AT2 organoids.

[0142] To assess the degree of similarity between cells retaining AT2-like cells in all three types of organoids, we extracted CK+AB and CK+DCI treated cells mapping to AT2 clusters in the adult human reference dataset (FIG. 6F) and used batch correction to integrate them along with primary AT2 organoid cells into a common UMAP (FIG. 6I,J). CK+AB and CK+DCI induced AT2-like cells clustered together, with little mixing into primary AT2 organoid cells (FIG. 6I), indicating that AT2-like cells differentiated with CK+AB or CK+DCI are transcriptionally similar to each other and distinct from primary AT2 organoids. In fact, lower resolution Louvain clustering revealed that AT2 mapping cells from primary AT2 organoids have more transcriptional heterogeneity amongst themselves than CK+AB or CK+DCI mapped AT2 cells have between each other (FIG. 6J). These findings are consistent with prior reports that AT2s differentiated in vitro retain an immature phenotype relative to primary AT2 organoids47.

[0143] Comparing expression of AT2 marker genes previously reported to describe AT2 differentiation and maturation25, we noted that expression of many of these genes was similar between AT2 mapping cells in induced organoids but was lower relative to cells from primary AT2 organoids (FIG. 6K). In addition SOX9 was higher in the AT2 mapping subset from induced organoids compared to primary AT2 organoids (FIG. 6K), suggesting induced organoids incompletely repress progenitor identity, regardless of method. To compare a broader set of AT2 markers we utilized a previously published list of 199 genes enriched in AT2 cells relative to all other lung cell types29 to calculate a module score42 for every cell mapping to the AT2 cluster in the reference dataset. As controls, we also included scRNA-seq data from in vivo primary AT2s45, and non-AT2 cell types including primary multiciliated cells45 and BTP organoids (experiments described herein). This analysis (FIG. 6I) scored cells retaining an AT2 phenotype from both differentiation methods similarly, and lower than primary AT2 organoids, supporting our conclusion from examining a smaller targeted list of AT2 marker genes (FIG. 6K). In addition, differential expression analysis revealed extensive overlap in AT2 markers expressed higher in primary AT2 organoids than AT2 mapping cells from both types of induced AT2-like organoids (FIG. 6M). Based on this comparison between the ‘best’ AT2-like cells from CK+AB induced, CK+DCI induced and primary AT2 organoids we conclude that under the expansion conditions used here, AT2-like cells induced by both methods possess an equivalent AT2 phenotype and are characterized by expression of many AT2 genes, but at lower levels relative to primary AT2 organoids.Example IX

[0144] This example demonstrates that CK+DCI induced AT2-like cells transition through an SCGB3A2-positive intermediate state not observed in CK+AB differentiation.

[0145] To further interrogate differences between CK+AB and CK+DCI induced AT2-like organoids, we performed a scRNA-seq timecourse of cultures from day 1, 6 and 21 of CK+DCI differentiation (FIG. 10) to time-match the data we generated for CK+AB induction (FIG. 4). Similar to results from CK+AB differentiations, we saw the onset of AT2 marker expression throughout most of the culture by day 21 (FIG. 10A). Cell cycle activity decreased upon CK+DCI treatment, rather than increased as observed in CK+AB time-series data (FIG. 11A, FIG. 4F). Integration of this time-series with undifferentiated ‘Day 0’ BTP organoids arranged day 1 and day 6 samples so that they were overlapping, and distinct from day 21 or day 0 cells (FIG. 10B-D). Clusters primarily comprised of cells from day 21 CK+DCI were present expressing markers of basal (TP63) and early-neuroendocrine identity (ASCL1), although relatively minor in size relative to the day 21 AT2-like cluster (FIG. 10B-D). Comparison between the ASCL1+clusters in CK+AB (FIG. 4) and the CK+DCI differentiations revealed statistically higher levels of ASCL1 in CK+DCI cells and similar levels of AT2 (SFTPC) or mature neuroendocrine (CHGA) markers (FIG. 11B). This analysis also identified two additional CK+DCI clusters from day 1 and day 6 cells not found in CK+AB differentiations that were defined by high solute transporter expression (Unknown 1) or unique expression of CXCL8, TF and LCN2 (Unknown 2) (FIG. 11C). Thus, similar to CK+AB differentiations, the vast majority of cells differentiate towards AT2 identity in response to CK+DCI treatment, although CK+DCI contains additional rare sub-populations not found in CK+AB, including unique clusters of day 1 and 6 cells as well as day 21 basal-like cells.

[0146] To ascertain the trajectory of cells differentiating towards AT2 identity in response to CK+DCI, we performed Slingshot analysis on the integrated time-series data and found a trajectory transitioning through day 1 and 6 cells and terminating in day 21 AT2-like cells (FIG. 10E, Trajectory 1). This trajectory was in general agreement with the location of cells co-expressing the highest levels of SFTPC / SFTPA1 identified during analysis of individual timepoints and overlaid on the integrated UMAP embedding (FIG. 11D-G). We also observed a trajectory corresponding to proliferation (Trajectory 2) and additional trajectories branching off from the AT2 trajectory to terminate in areas of neuroendocrine marker expression (Trajectory 3) or clusters of unknown identity from day 1 and 6 (Trajectory 4) (FIG. 10E). Examining gene expression at this major branching point, we observed SCGB3A2 and RNASE1 within the top 10 enriched genes. Expression of SCGB3A2 and RNASE1 preceded the onset of SFTPC along the AT2 trajectory (FIG. 10F), suggesting SCGB3A2 / RNASE1 co-expression marks cells differentiating to an AT2 identity in response to CK+DCI. Examination of gene expression during CK+AB differentiations showed that in contrast to CK+DCI, CK+AB treatment leads to sustained downregulation of SCGB3A2 and RNASE1, and similar pace of SFTPC onset (FIG. 10G). CK+AB response is further distinguished by earlier onset of SFTPA1 and LAMP3 and delayed onset of SFTPB relative to CK+DCI (FIG. 10G). These observations were reproducible by RT-qPCR across differentiations from multiple BTP organoid lines (FIG. 10H). Transcriptional differences between CK+AB and CK+DCI differentiations suggests differences in the transcriptional trajectory of cells as they acquire their AT2 identity in either differentiation media.

[0147] To understand the relevance of transcriptional differences between BTP organoid cells treated with CK+AB or CK+DCI to the alveolar region of the lung we again turned to reference-based mapping to distal adult lung epithelium scRNA-seq data45 (FIG. 10I-K). Most cells from CK+AB differentiation mapped to AT2 identities, with the remainder mapping to AT1 and neuroendocrine identities (FIG. 10-I-K). Cells from CK+DCI differentiation also contained many cells mapping to AT2, AT1 and neuroendocrine identities, but additionally mapped to basal, goblet, and both clusters of SFTPB+ / SCGB3A2+ secretory-like cells, which in this reference dataset represent epithelial cells specific to terminal respiratory bronchioles34,45 (FIG. 10I-K). Examination of cells by day of differentiation revealed that cells from CK+DCI differentiations mapping to the SFTPB+ / SCGB3A2+ cluster in the reference were transitional, existing at days 1 and 6 but not detected at day 21 (FIG. 10L).

[0148] This comparison demonstrates that AT2-like cells induced by either CK+AB and CK+DCI acquire AT2 marker expression through distinct transcriptional trajectories, with CK+DCI expressing markers of terminal respiratory bronchiole identities (SCGB3A2 / RNASE1) en route to AT2 cell identity.Example X

[0149] This example provides a discussion related to Examples I-IX.

[0150] Experiments described herein focused on the roles of TGFβ-and BMP-signaling during differentiation of human BTPs to AT2 cells. We show these pathways regulate AT2 differentiation in opposing fashion, with TGFβ-signaling acting to inhibit and BMP-signaling acting to promote AT2 differentiation. These activities are consistent with the proximal-distal patterning of these signaling pathways during mouse lung development, with TGFβ-ligands restricted to proximal areas of the lung that comprise the future airways48,49, and BMP-ligands restricted to bud tip progenitors in the distal areas of the lung that comprise the future alveoli50. Disruption of this patterning, either by overexpression of TGFβ1 in BTPs51, or overexpression of BMP inhibitors in BTPs52,53 arrests lung development, emphasizing the importance of TGFβ and BMP patterning for proper lung development. Taken together our analysis of TGFβ-and BMP-signaling in the developing human lung as well as our functional experiments in ALI explant cultures and BTP organoids support a model where low levels of TGFβ-signaling and increasing levels of BMP-signaling combine with the high WNT-and FGF-signaling environment in the bud tip niche to promote the differentiation of BTPs to AT2 cells.

[0151] In addition to the roles described above, TGFβ-signaling is also required for branching morphogenesis51,54,55, airway homeostasis and regeneration56,57, AT1 cell differentiation58,59,60, and BMP-signaling additionally regulates post-natal alveologenesis and AT2 cell homeostasis61,62. Moreover, aberrant TGFβ-signaling has been proposed to contribute to many lung diseases, including bronchopulmonary dysplasia63,64, idiopathic pulmonary fibrosis65,66 and asthma67,68. Thus, mechanisms regulating TGFβ-and BMP-signaling are of interest. In development, differential localization of specific mesenchymal populations, such as distally localized RSPO2+ mesenchyme, which we show here is a source of BMP ligand, or more proximally localized smooth-muscle and myofibroblast populations help to establish patterning. We also show here that canicular stage bud tips as late as 17.5 weeks (122 days) respond to TGFβ-signaling by upregulating airway differentiation markers, revealing that canicular stage bud tips remain competent for airway differentiation and suggesting that failure to repress TGFβ in airways would have catastrophic effects on bronchioalveolar organization of the lung epithelium, akin to lesions described in multiple subtypes of congenital lung malformations69,70. Additionally, our analysis of pseudoglandular and canicular stage human lung shows that BTPs themselves contribute to the dynamics of TGFβ and BMP ligand availability, emphasizing an important contribution of BTPs to shaping their own niche.

[0152] TGF and BMP ligands are part of a larger family of ancestrally related Transforming Growth Factors that regulate stem cells through opposing and cooperative activities in many tissues71,72,73,74 Canonically TGFβ-and BMP-signaling use different receptor complexes, intracellular mediators, and transcriptional co-factors which converge on the DNA-binding protein SMAD475. Work from our lab has shown that in the context of high TGFβ-signaling, BMP-signaling acts cooperatively to enhance airway differentiation of BTP organoids. Here we show that in the context of low TGFβ-signaling activity, BMP-signaling activity instead promotes AT2 differentiation of BTP organoids. Taken together these studies suggest that the balance between TGFβ-and BMP-signaling is a major determinant of cell fate in BTPs. This relationship mirrors that of studies in other organs where the balance of TGFβ-and BMP-signaling determines cell fate outcomes, with competition between TGFβ and BMP specific transcriptional co-factors for SMAD4 mediating crosstalk between signaling pathways76,77,78 Crosstalk between TGFβ-and BMP-signaling also occurs through protein-protein interactions and secondary messengers, which may be important for maintaining proximal-distal gradients of these pathways in the lung79. Interactions with other cell signaling pathways in the BTP niche like WNT-and FGF-signaling enhance the complexity of organ patterning and cell specification80. Airway and AT2 differentiation of BTP organoids provides a tractable model to further investigate mechanisms that translate TGFβ-and BMP-signaling levels into specific cell fates during human lung development.

[0153] Given that CK+AB and CK+DCI both induce the differentiation of BTP organoids to AT2-like cells an important question is whether both differentiation methods converge on similar mechanisms to accomplish AT2 differentiation. Glucocorticoids like dexamethasone have been reported to repress TGFβ-signaling in the lung81,82, which would support the idea that both methods induce a similar signaling environment in BTPs. However, our scRNA-seq timecourse of both differentiation strategies shows that CK+DCI contain an SCGB3A2-positive population not observed in CK+AB differentiations. The relevance of this gene expression difference between differentiation methods is not clear, but cells with SFTPB / SCGB3A2 co-expression have been identified during development21,32, as well as within terminal respiratory bronchioles of adults34,45, suggesting that CK+DCI induced BTP organoids transit through a transcriptional state similar to these in vivo cell types prior to acquiring maximal AT2 identity. Consistent with this interpretation we find by reference-based mapping that cells treated with CK+DCI align to SFTPB+ / SCGB3A2+ cells in terminal respiratory bronchioles specifically at days 1 and 6. The absence of a similar population in CK+AB differentiations argues for differences in the mechanisms by which CK+AB and CK+DCI induce AT2 differentiation. Combining the in vitro models of human lung development described here and in the literature with gene knockout / down83 and lineage tracing approaches32 will be important to further interrogate the gene networks and transitional states required for human AT2 differentiation.

[0154] We noted AT2-like organoids generated with either CK+AB or CK+DCI become contaminated with MUC5AC-positive goblet-like cells over time, a process that is accelerated by the presence of FGF10. This mirrors results of FGF10 overexpression in the mouse lung, which results in goblet cell metaplasia within alveoli84. Recently multiple studies have converged on the presence of mislocalized airway basal cells in the distal lungs associated with Idiopathic Pulmonary Fibrosis (IPF)85,86,87, which are proposed to arise through pathological transdifferentiation events originating from AT2 cells. In CK+AB cultures markers of basal (TP63) and goblet (SPDEF, MUC5AC, MUC5B) cells are not detected at the timepoints sampled during 21 days of differentiation, arguing that the MUC5AC-positive goblet-like cells arising in SFFF originate from AT2-like after day 21. Likewise, we do not observe a robust population of TP63-positive cells in either CK+AB or CK+DCI cultures after long-term expansion in SFFF without FGF10, suggesting MUC5AC expressing cells arise without a basal cell intermediate state. Thus, the AT2-like to goblet-like transition observed here seems distinct from what has been reported in IPF patients, where basal cells are present. Never-the-less goblet cell metaplasia is associated with IPF and other lung diseases including chronic obstructive pulmonary disorder (COPD), pulmonary infections and cancer88,89,90,91,92 making the AT2-to-goblet cell fate transition observed here worthy of deeper investigation.

[0155] Taken together, our data presented herein shows that TGFβ-and BMP-signaling work in opposition to regulate AT2 differentiation of BTPs during lung development. Translating these observations to in vitro organoid cultures, we show that inducing a state of low TGFβ-and high BMP-signaling activity, when combined with high WNT-and FGF-signaling activity, leads to robust differentiation of AT2-like organoids from BTP organoids in vitro. We anticipate AT2-like cells generated with CK+AB to complement existing methods to generate AT2-like cells, providing a valuable model for investigation of human lung biology and regeneration.Example XI

[0156] This example provides materials and methods related to Examples I-X.Human Lung Tissue

[0157] All research utilizing human lung tissue (8-18.5 weeks post conception lung, adult lung) was approved by the University of Michigan Institutional Review Board and written informed consent was obtained from all tissue donors for participating in the study. Human fetal lung tissue specimens were from presumably normal, de-identified specimens processed by the University of Washington Laboratory of Developmental Biology. Specimens included both male and female sexes. Tissue was shipped in Belzer-UW Cold Storage Solution (Thermo Fisher, Cat #NC0952695) at 4° C. and processed within 24 h of isolation. Histologically normal human adult distal lung tissue was obtained from de-identified specimens through the Michigan Medicine Thoracic Surgery Laboratory, kept at 4° C. immediately upon isolation, and processed within 24 h of isolation.Lung ALI Explant Cultures

[0158] Human fetal lung within the canalicular stage of lung development was utilized for lung ALI explant cultures (specifically 15-18.5 weeks post conception). Small pieces (<0.5 cm diameter) were dissected from distal regions of the lung and placed on Nucleopore Track-Etched Membrane disks (13 mm, 8 μm pore, poly-carbonate) (Sigma, Cat #WHA110414) floating on top of 500 μl of human lung ALI explant media (Advanced DMEM / F-12 (Thermo Fisher, Cat #12634010), 2 mM Glutamax (Thermo Fisher, Cat #35050061), 15 mM HEPES (Corning, Cat #25060CI), 1× B27 Supplement (Thermo Fisher, Cat #17504044) 1×N-2 Supplement (Thermo Fisher, Cat #17502048), 100 U / mL penicillin-streptomycin (Thermo Fisher, Cat #15140122)) in a 24-well tissue culture plate (Thermo Fisher, Cat #12565163). Where indicated, 1 μM A-8301 (APE×BIO Cat #A3133), 100 ng / mL rhTGFβ1 (R&D Systems Cat #240-B-002), 100 ng / mL rhNOGGIN (produced in-house) or 100 ng / mL BMP4 (R&D Systems Cat #314-BP-050) was added to human lung ALI explant media.BTP Organoid Establishment and Maintenance

[0159] Primary BTP organoid cultures from 15-18.5 weeks post conception lung tissue were established and maintained as previously reported3,21,22. BTP organoids were maintained in maintenance media (described below) under 8 mg / mL Matrigel (Corning Cat #354234), fed every three days and passaged 1:3 every 7-10 days by needle sheering.Needle Sheering

[0160] Organoids are needle sheered in preparation for passaging by passing the culture through a 27-gauge needle 3 times in 1 mL of media resulting in the fragmentation of organoids.Differentiation of BTP Organoids to AT2-Like Organoids

[0161] Differentiations were performed on BTP organoids at passage three by removing maintenance media consisting of: DMEM / F-12 (Corning, Cat #10-092-CV), 100 U / mL penicillin-streptomycin (Thermo Fisher, Cat #15140122), 1×B-27 supplement (Thermo Fisher, Cat #17504044), 1× N2 supplement (Thermo Fisher, Cat #17502048), 0.05% BSA (Sigma, Cat #A9647), 50 μg / mL L-ascorbic acid (Sigma,Cat #A4544), 0.4 μM 1-Thioglycerol (Sigma, Cat #M1753), 50 nM all-trans retinoic acid (Sigma, Cat #R2625), 10 ng / ml recombinant human FGF7 (R&D Systems, Cat #251-KG), and 3 μM CHIR99021 (APE×BIO, Cat #A3011) and replacing with differentiation media. For data in FIG. 3 multiple differentiation medias were tested, all of which consisted of maintenance media with the addition of 1 μM A-8301 and / or the addition of 100 ng / ml BMP4 and / or removal of all trans retinoic acid. B-27 supplement without vitamin A (Thermo Fisher, Cat #12587010) was used instead of full B-27 supplement in conditions in which all trans retinoic acid was removed. For data in all FIGS. 4, 6, 7, 10 differentiation media consisted of common components: DMEM / F12, 100 U / mL penicillin-streptomycin, 1×B-27 supplement without vitamin A, 1× N2 supplement, 0.05% BSA, 50 μg / mL L-ascorbic acid, 0.4 μM 1-Thioglycerol. 10 ng / ml recombinant human FGF7, and 3 μM CHIR99021. To make CK+AB differentiation media 1 μM A-8301 and 100 ng / mL BMP4 was added. To make CKDCI differentiation media 50 nM Dexamethasone (Sigma, Cat #D4902), 100 nM 3-isobutyl-1-methylxanthine (Sigma, Cat #I5879) and 100 nM 8-Bromoadensoine 3′,5′-cyclic monophosphate sodium salt (Sigma, Cat #B7880) was added. Differentiations were fed every three days and passaged at seven day intervals by needle sheering.Expansion of AT2-Like Organoids

[0162] After 21 days of differentiation in CK+AB or CK+DCI organoids were passaged and fed with SFFF or SFFF without FGF10 consisting of: Advanced DMEM / F12, 2 mM Glutamax, 1× B27 supplement, 100 U / mL penicillin-streptomycin, 15 mM HEPES, 0.05% BSA, 10 μM TGFβ inhibitor SB43152 (APExBIO, Cat #A8249), 1 μM p38 MAP kinase inhibitor BIRB796 (APExBIO, Cat #A5639), 3 μM CHIR99021, 50 ng / mL rhEGF (R&D Systems, Cat #236-EG) with (SFFF) or without the addition of 10 ng / mL FGF10 (produced in-house). Organoids were passaged every 7-14 days at a ratio of 1:6 by needle sheering93.Primary AT2 Organoid Establishment and Maintenance

[0163] Distal lung sections from a single patient were minced using a scalpel. Minced lung was enzymatically dissociated to a single cell suspension using 1 mg / mL collagenase A (Roche, Cat #10103578001), 2-4 U / mL elastase (Worthington, Cat #LS002274), and 0.1 mg / mL DNAse (Roche, Cat #10104159001), filtered through a 100 μM cell strainer, subjected to red blood cell lysis (Roche, Cat #11814389001), washed with PBS, and seeded into Matrigel. After two passages, cultures were subjected to FACS (see below: Fluorescence-activated Cell Sorting). AT2 cells were isolated on the basis of positive HTII-280 staining and reseeded into Matrigel with primary AT2 organoid media consisting of: Advanced DMEM / F12, 2 mM Glutamax, 1× B27 supplement, 100 U / mL penicillin-streptomycin, 15 mM HEPES, 0.05% BSA, 10 UM SB43152 (APE×BIO, Cat #A8249), 1 μM BIRB796 (APE×BIO), 3 μM CHIR99021, 50 ng / mL rhEGF and 10 ng / mL rhFGF10 (Cite Katsura). Organoids were expanded in primary AT2 organoid media and passaged every 3-4 weeks at a ratio of 1:2-3 by TrypLE-mediated dissociation.Preparation of Tissue, Explant and Organoids for Fluorescence In Situ mRNA Staining and Protein Immunofluorescent (IF) Staining

[0164] All samples processed were fixed for 24 h in 10% Neutral Buffered Formalin at room temperature with gentle agitation. Samples were washed 3× with UltraPure DNase / RNase-free distilled water (Thermo Fisher, Cat #10977015) and dehydrated through an alcohol series consisting of 25%, 50%, 75% and 100% methanol, followed by 100% and 70% ethanol. For tissue and explants each step was performed for at least 1 h. For organoids each step was performed for at least 15 min. In the case of explants and organoids, specimens were embedded in Histogel (VWR Cat #83009-992) prior to paraffin processing. Samples were paraffin processed in an automated tissue processor through the following series: 70%, 80%, 2× 95%, 3× 100% ethanol, 3× xylene and 3× paraffin with 1 h for each step. Tissue was embedded into paraffin blocks and cut into 5 μm-thick sections onto charged glass slides using a microtome. Slides were baked for 1 h at 60° C. immediately prior to staining.Fluorescence In Situ mRNA Hybridization (FISH)

[0165] FISH was performed using the RNAscope Multiplex Fluorescent V2 assay (ACDBio, Cat #323100) using manual assay probes from the ACDBio catalog (Hs-ID-C1: Cat #500901, Hs-BMP4-C2: Cat #454301-C2) according to the manufacturer's recommendations. Protease treatment and Antigen retrieval were performed for 6 and 15 min respectively. TSA-Cy5 (Akoya Biosciences, Cat #NEL745E001KT) was used to develop HRP-C2 and TSA-Cy3 (Akoya Biosciences Cat #NEL744001KT) was used to develop HRP-C1. For Protein Immunofluorescent co-stains, slides were washed in 1× Phosphate Buffered Saline (PBS) (Corning Cat #21-040) after final HRP-Blocker treatment and washes and immediately put into blocking solution for 1 h, followed by primary and secondary antibody stains as described in the Protein IF Staining protocol below.FISH Quantification

[0166] FISH foci were quantified using a custom automated image analysis pipeline in NIS-Elements AR v5 (Nikon). Nuclei were first segmented and cell borders were estimate by the ‘GrowObjects’ function. Thresholding was then performed to identify RNA foci and the number of foci in each cell was recorded. The lumen of epithelial cells was labeled manually and cells were automatically identified as epithelial based on proximity to lumen. SOX9 immunofluorescent signal for each nuclei was thresholded to distinguish SOX9-positive bud tip and SOX9-negative stalk cells. For each mesenchymal cell the distance (center to center) of the closest SOX9-positive and SOX9-negative epithelial cell was recorded. Distance values were used to categorize if a mesenchymal cell was nearest a SOX9-positive cell, a SOX9-negative cell, or far away (>50 μm) from both. Quantification was performed on 3× field of views per timepoint at 40× magnification.Protein IF Staining

[0167] Slides were treated with 2× HistoClear II (National Diagnostics, Cat #HS-202) washes, then rehydrated through washes in 100%, 95%, 70%, 30% ethanol for 4 min each, with buffer exchanges performed halfway through washing. Then, slides were washed 2×5 min with ddH20. Antigen retrieval in 1× Sodium Citrate Buffer (100 mM trisodium citrate (Sigma, Cat #S1804), 0.5% Tween-20 (Thermo Fisher, Cat #BP337), pH 6.0) for 20 min at 99° C. After washing 3× in ddH20 slides were blocked for 1 h with blocking solution: 5% normal donkey serum (Sigma, Cat #D9663), 0.1% Tween-20 in PBS. Slides were then incubated in primary antibodies diluted in blocking solution in a humidified chamber at 4° C. overnight. Slides were washed 3× in 1×PBS for 10 min each. Slides were incubated with secondary antibodies and DAPI (1 μg / mL) diluted in blocking solution for 1 h, then were washed 3× in 1×PBS for 5 min each. Slides were mounted in ProLong Gold (Thermo Fisher, Cat #P369300) and imaged within 2 weeks. Primary and secondary antibodies used in this study are available in Table 1.TABLE 1Primary and secondary antibodies usedfor immunofluorescent staining.AntibodyNameCompanyCatalog #DilutionRegistry IDPrimary AntibodiesGoat anti-R&D SystemsAF30751:500AB 2194160SOX9Rabbit anti-MilliporeAB55451:500AB 2239761SOX9Goat anti-R&D SystemsAF7481:500AB 355568CDH1Rabbit anti-Seven HillsWRAB-93371:500AB 2335890ProSFTPCBioreagentsMouse anti-Seven HillsWMAB-1:500AB 577285ABCA3Bioreagents17G524Mouse anti-Abcamab547411:250AB 2242462AGERRabbit anti-Santa Cruzsc-1344821:500AB 2162079PDPNBiotechnologyRabbit anti-Santa Cruzsc-302161:250AB 2120833HOPXBiotechnologyMouse anti-LeicaNCL-L-SPA1:200AB 564143SFTPAGoat anti-R&D SystemsBAF19161:500AB 2207173TP63Mouse anti-TerraceTB-27AHT2-1:100AB 2832931HTII-280Biotechnology280Mouse anti-LeicaNCL-L-1:500AB 10555426NAPSIN ANAPSIN AMouse anti-Abcamab790821:500AB 1603327MUC5ACAffiniPureJackson715-545-1501:500AB 2340846donkey anti-Immuno-mouse IgGResearchAlexaFluor488AffiniPureJackson715-165-1501:500AB 2340813donkey anti-Immuno-mouse IgGResearchCyanine3AffiniPureJackson715-605-1501:500AB 2340862donkey anti-Immuno-mouse IgGResearchAlexaFluor647Secondary AntibodiesAffiniPureJackson711-545-1521:500AB 2313584donkey anti-Immuno-rabbit IgGResearchAlexaFluor488AffiniPureJackson711-165-1521:500AB 2307443donkey anti-Immuno-rabbit IgGResearchCyanine3AffiniPureJackson711-605-1521:500AB 2492288donkey anti-Immuno-rabbit IgGResearchAlexaFluor647AffiniPureJackson705-545-1471:500AB 2336933donkey anti-Immuno-goat IgGResearchAlexaFluor488AffiniPureJackson705-165-1471:500AB 2307351donkey anti-Immuno-goat IgGResearchCyanine3AffiniPureJackson705-605-1471:500AB 2340437donkey anti-Immuno-goat IgGResearchAlexaFluor647AffiniPureJackson715-545-1401:500AB 2340845donkey anti-Immuno-mouse IgMResearchWhole Mount Protein IF Staining

[0168] Organoids were fixed in 10% NBF overnight at room temperature on a rocker. Tissue was then washed three times for 2 h in Organoid Wash Buffer (OWB) (0.1% Triton X-100, 0.2% BSA, 1×PBS) at RT on a rocker. Organoids were then submerged in CUBIC-L (TCI Chemicals Cat #T3740) for 48 h at 37° C. Organoids were then permeabilized with permeabilization solution (5% Normal Donkey Serum, 0.5% Triton X-100, 1×PBS) for 24 h at 4° C. Organoids were washed 1× with OWB and then incubated with primary antibody (diluted in OWB) for 24 h at 4° C. Organoids were then washed 3× with OWB and secondary antibody (diluted in OWB) was added for 2 h at RT. Organoids were washed an additional 3× with OWB and then cleared in CUBIC-R (TCI Chemicals Cat #T3741) with 1 μg / mL DAPI. Cleared organoids were mounted on slides with Secure-Seal Spacers (Invitrogen Cat #S24737) to accommodate 3-dimensional imaging.Preparation and Transmission Electron Microscopy of Organoids

[0169] Transmission electron microscopy sample preparation was performed by the University of Michigan BRCF Microscopy and Image Analysis Laboratory. Samples were fixed in 3% glutaraldehyde / 3% paraformaldehyde in 0.1 M cacodylate buffer (CB), pH 7.2. Samples were washed 3 times for 15 min in 0.1 M CB and then kept for 1 h on ice in 1.5% K4Fe(CN) 6+2%0.0 in 0.1 M CB. Samples were washed 3× in 0.1 M CB, followed by 3× in 0.1 M Na2+ Acetate Buffer, pH 5. Staining contrast enhancements by 1 h treatment with 2% Uranyl Acetate+0.1 M Na2+ Acetate Buffer, pH 5.2. Samples were then processed overnight in an automated tissue processor, including dehydration from H2O through 30%, 50%, 70%, 80%, 90%, 95%, 100% ethanol, followed by 100% acetone. Samples were infiltrated with Spurr's resin at an acetone: Spurr's resin ratio of 2:1 for 1 h, 1:1 for 2 h, 1:2 for 16 h, and absolute Spurr's resin for 24 h. After embedding and polymerization, samples were sectioned on an ultramicrotome. TEM samples were imaged on a JEOL JEM 1400 PLUS TE microscope.RNA Extraction, Reverse Transcription and RT-qPCR

[0170] Organoids were dislodged from Matrigel using a P1000 tip, pelleted in a 1.5 mL tube and flash frozen by placing the tube in a small amount of liquid nitrogen with minimal residual media. RNA was isolated from frozen pellets using the MagMax-96 Total RNA Isolation kit (Thermo Fisher, Cat #AM1830) according to the manufacturer's recommendations. RNA quality and yield was determined on a Nanodrop 2000 spectrophotometer. Reverse Transcription was performed in triplicate for each biological replicate using the SuperScript VILO cDNA kit with 200 ng RNA per reaction. After Reverse Transcription, cDNA was diluted 1:2 with DNAse / RNAse free water and 1 / 40th of the final reaction was used for each RT-qPCR measurement. RT-qPCR measurements were performed using a Step One Plus Real-Time PCR System (Thermo Fisher, Cat #43765592 R) using QuantiTect SYBR Green qPCR Master Mix (Qiagen, Cat #204145) with primers at a concentration of 500 nM. Sequences for RT-qPCR primers used in this manuscript are in Table 2.TABLE 2Primer sequences for RT-qPCR.TargetSequenceSCGB3A2F: GGGGCTAAGGAAGTGTGTAAATG (SEQ ID NO.: 1)R: CACCAAGTGTGATAGCGCCTC (SEQ ID NO.: 2)SFTPCF: AGCAAAGAGGTCCTGATGGA (SEQ ID NO.: 3)R: CGATAAGAAGGCGTTTCAGG (SEQ ID NO.: 4)SFTPA1F: TGTCCTCCTGGAAATGATGG (SEQ ID NO.: 5)R: GGCTTGGAGCTCCTCATCTA (SEQ ID NO.: 6)SFTPBF: GGGTGTGTGGGACCATGT (SEQ ID NO.: 7)R: CAGCACTTTAAAGGACGGTGT (SEQ ID NO.: 8)SOX2F: CCATCATTGGAGCAGGAATC (SEQ ID NO.: 9)R: GACCAGCGGTAAGATTTCCA (SEQ ID NO.: 10)MUC5ACF: GCACCAACGACAGGAAGGATGAG (SEQ ID NO.: 11)R: CACGTTCCAGAGCCGGACAT (SEQ ID NO.: 12)NAPSAF: TTCCGGGGCCACACTGAT (SEQ ID NO.: 13)R: GGTTCTCTCCATCCCCTCAG (SEQ ID NO.: 14)HOPXF: GCCTTTCCGAGGAGGAGAC (SEQ ID NO.: 15)R: TCTGTGACGGATCTGCACTC (SEQ ID NO.: 16)LAMP3F: GTTCTAAACGGAAGCAGACTCT (SEQ ID NO.: 17)R: CGTTGGGGTCGATGTTGAAG (SEQ ID NO.: 18)GAPDHF: CTCTGCTCCTCCTGTTCGAC (SEQ ID NO.: 19)R: TTAAAAGCAGCCCTGGTGAC (SEQ ID NO.: 20)Fluorescence-Activated Cell Sorting (FACS)

[0171] Organoids were retrieved from Matrigel by mechanical dissociation with a P1000, washed 2× with 1 mL PBS and, resuspended with TrypLE and incubated at 37° C. until a single cell suspension was obtained with light pipetting (typically 10 min). Cells were washed 3× with 1 mL of FACS buffer consisting of PBS, 2% BSA and 10 μM Y-27632 (APE×BIO, Cat #3008) and then filtered through a 30 μM mesh. Cells were stained for 1 h on ice in FACS buffer with a 1:60 dilution of anti HTII-280 IgM antibody. Cells were washed 3× with 1 mL of FACS buffer before 30 min of staining in FACS buffer with a 1:1000 dilution of anti-mouse IgM-Alexaflour-488 secondary antibody (Jackson Immunoresearch, Cat #715545140) on ice. After 3× washes with 1 mL of FACS buffer cells were suspended in FACS buffer with 1:4000 dilution of DAPI. Live cells (determined by exclusion of DAPI) positive for HTII-280 were identified by 488 emission intensity notably higher than primary only, secondary only controls and absence of 405 (DAPI) emission. All steps were carried out at 4° C. unless otherwise indicated. Cells were pelleted at 500×G for 5 min in swing bucket rotors. FACS was performed on either a Sony MA900 or the ThermoFisher Bigfoot Spectral Cell Sorter and analyzed in FlowJo v10.Preparation of Lung ALI Explant Cultures for Single Cell RNA-Sequencing (scRNA-Seq)

[0172] For scRNA-sequencing of Lung ALI explant cultures, the outside rind of n=3 explants at each timepoint (0, 3, 6, 9 and 12 days) was micro dissected and minced using a No. 1 Scalpel, discarding the center of the explant, which appeared necrotic in later timepoints. Pooled explants at each timepoint (0, 3, 6, 9 and 12 days) were dissociated using the Neural Tissue Dissociation Kit (P) (Mitenyi Biotec, Cat #130092628). Briefly minced explant tissue was resuspended in Mix 1 and incubated at 37° C. for 15 min. Mix 2 was then added and incubated for 10 min at 37° C. Cells were agitated by P1000 pipetting and then returned to the incubator for additional 10 min incubations at 37° C., followed by P1000 pipetting until a single cell suspension was achieved (˜30 min). Obtained single cell suspension was filtered through a 70 μm Flowmi Cell Stainer (Sigma, Cat #BAH136800070) and then resuspended in Red Blood Cell Lysis Buffer (Roche, 11814389001) for 15 min at 4° C. After Red Blood Cell Lysis, cells were washed twice with 2 mL 1× HBSS+1% BSA and then resuspended in Cryostor-CS10 (Sigma, Cat #C2874) for storage in liquid nitrogen. All Lung ALI explant culture samples were thawed and co-submitted for sequencing on the same day. Thawing of cells prior to sequencing consisted of adding 1:1 increments of RPMI+10% FBS drop-wise, with 1 min pauses every time the volume doubled, until a total volume of 32 mLs was achieved. Cells were then pelleted and resuspended in 1 mL HBSS+1% BSA and passed through a 40 μm Flowmi Cell Strainer (Sigma, Cat #BAH136800040), counted on a hemocytometer and submitted at 1000 cells / μl in HBSS+1% BSA to the University of Michigan Advanced Genomics Core for library preparation by the Chromium Next GEM Single Cell 3′ GEM, Library and Gel Bead Kit v3.1 (10× Genomics, Cat #PN1000128) targeting 7500 cells. scRNA-sequencing libraries were sequenced using a NovaSeq 6000 with S4 300 cycle reagents (Illumina, Cat #20028312). Cells were pelleted by spinning at 500×G for 5 min in a swing-bucket centrifuge. All steps were carried out using tips coated in HBSS+1% BSA and pre-chilled (4° C.) buffers and equipment.Preparation of Organoids for scRNA-Seq

[0173] Organoids were dislodged from Matrigel by mechanical dissociation using a p1000 pipette tip. Pelleted organoids were resuspended in TrypLE Express (Thermo Fisher, Cat #17105041) and incubated at 37° C., pipetting gently at 5 min intervals until a single cell suspension is obtained (˜10 min). Cells were washed 3× with Hanks Balanced Salt Solution (HBSS) (Thermo Fisher, Cat #14175095)+1% BSA and then passed through a 40 μm FlowMi Cell Strainer. Cells were counted on a hemocytometer and then resuspended at 1000 cells / μl in HBSS+1% BSA for submission to the the University of Michigan Sequencing Core, which prepared libraries using the Chromium Next GEM Single Cell 3′ GEM, Library and Gel Bead Kit v3.1 (10× Genomics, Cat #PN1000128) targeting 3500 cells. scRNA-sequencing libraries were sequenced using a NovaSeq 6000 with S4 300 cycle reagents. Cells / organoids were pelleted by spinning at 500×G for 5 min in a swing-bucket centrifuge. All steps were carried out using tips coated in HBSS+1% BSA and pre-chilled (4° C.) buffers and equipment.Expression and Purification of Recombinant Human FGF10

[0174] The expression plasmid for recombinant human FGF10 (pET21d-FGF10) was a gift from James A Bassuck (Bagai et al., 2002). FGF10 expression was induced by the addition of isopropyl-1-thio-B-D-galactopyranoside to Rosetta™2(DE3) pLysS carrying pET21d-FGF10 in 2× YT medium (BD Biosciences, Cat #244020) with Carbencillin (50 μg / mL) and Chloramphenicol (17 μg / mL). FGF10 was purified using a HiTrap-Heparin HP column (GE Healthcare, Cat #17040601) with step gradients of 0.2 to 0.92 M NaCl. Purity of FGF10 was assessed by SDS-PAGE gel and activity based on the efficiency to phosphorylate ERK1 / 2 in A549 cells (ATCC, Cat #CCL-185).scRNA-Seq AnalysisOverview

[0175] To identity clusters of cells with similar gene expression within scRNA-sequencing datasets we processed CellRanger filtered matrices using Seurat v4.046 in RStudio v1.4 running R v4.2. The general workflow involves filtering for high quality cells, normalizing counts to read depth, log transformation and scaling the normalized count data, identification of variable genes between cells, identification of principal components, batch correction (if applicable), uniform manifold approximation and Louvain clustering of cells.Quality Control

[0176] Cells were filtered for under or over (likely doublets) complexity by filtering based on number of features detected and for cell viability / quality based on the percentage of mitochondrial reads in a cell's transcriptome. Cells not conforming to the following parameters were removed from analysis: FIG. 1A-C, FIG. 2A-B—features detected: >500, <5000, mitochondrial reads: <10%; FIG. 1J-L and FIG. 2F,G,H,I,J,K,L—features detected: >1000, <12000,;mitochondrial reads: <10%, FIG. 4—features detected: >2500, <10,000; mitochondrial reads: <20%, FIG. 6—features detected: >2000, <10,000; mitochondrial reads: <20%; FIG. 10—features detected: >2500, <10,000; mitochondrial reads; <20%.Gene Expression Visualization and Differential Expression

[0177] Prior to visualization or analysis gene expression counts were normalized to total counts for each cell, multiplied by factor of 10,000 and natural log transformed. Significance of gene expression differences was determined by Wilcoxon Ranked Sum test and limited to genes with at least 25% of cells expressing within at least one group compared, and log 2 transformed normalized count differences greater than 0.25.Batch Correction

[0178] For the analysis of ALI explant cultures in FIG. 1 and FIG. 2 samples from multiple days of culture were batch corrected using the Seurat implementation of reciprocal PCA analysis. For the analysis of CK+AB treated (FIG. 4) and CK+DCI treated (FIG. 10) BTP organoids, day 0 BTP organoid samples were integrated with day 1, day 6 and day 21 treated samples using FastMNN94 through the SeuratWrappers package. For FIG. 6I,J AT2-mapping cells (part f) from primary AT2 organoids, CK+AB AT2-like organoids and CK+DCI AT2-like organoids were also batch corrected using FastMNN. In all cases batch correction was performed using the top 30 most variable principal components.Dimensional Reduction and Clustering

[0179] For samples processed individually, SCTransform was used for normalization and scaling prior to identification of variable features and reduction by Principal Component analysis (PCA). For batch corrected samples the corrected gene expression matrix was scaled and then used as input for PCA reduction. Using the top principal components (PCs) a neighborhood graph was constructed from 20 nearest neighbors focusing on highly variable PCs (FIG. 2F-H,L—18 PCs; FIG. 1J-L and FIG. 2I-K—7 PCs; FIG. 5 E-G—18 PCs; FIG. 4—30 PCs; FIG. 6A,B and FIG. 9A-D—16 PCs; FIG. 6I,J—30 PCs; FIG. 11D-F—16 PCs; FIG. 10B-F and FIG. 11G—30 PCs). Clusters were identified using the Louvain algorithm with specified resolution (FIG. 2F-I—0.5; FIG. 1J-I and FIG. 2I-K—0.4; FIG. 5E,F,G—0.5; FIG. 4—0.3; FIG. 6A,B and FIG.; 9A-D—0.5; FIG. 6I,J—0.2; FIG. 11D-F—0.5; FIG. 11B-F and FIG. 11G—0.3).Trajectory Analysis

[0180] Batch corrected scRNA-seq timecourse data from CK+AB and CK+DCI treated BTP organoids were clustered at increased resolution prior to trajectory analysis (FIG. 4K—1.0; FIG. 10E—1.0). Trajectory analysis was performed using Slingshot41 with the start cluster determined by the cluster with the highest proportion of cells from BTP organoids. Trajectories terminating in areas of high AT2 marker gene expression at day 21 were chosen as the trajectory corresponding to BTP organoid cells differentiating towards AT2-like identity.Gene Set Module Scoring

[0181] Gene set module scoring was performed using the Seurat v4 implementation of the gene set method developed by Tirosh et al.,42. Briefly control genes (100 control genes for each module gene) are randomly selected from a bin of similar expressed genes and then expression levels of genes in the module set relative to control genes are calculated. To define an AT2 differentiation gene module in FIG. 4M, scRNA-sequencing data from primary AT2 organoids in SFFF without FGF10 media was merged with scRNA-sequencing data from BTP organoids. Low resolution (0.1) Louvain clustering identified BTP organoids and primary AT2 organoids as distinct clusters of cells. Differential expression analysis was performed between each cluster to identify the top 199 genes significantly enriched in primary AT2 organoids over BTP organoids (Table 3). To define a gene module for in vivo AT2 cells in FIG. 6L-M, 205 markers reported to be AT2 enriched relative to all other lung cell populations in scRNA-sequencing data from adult lungs were used29. 6 of these genes were not detected in our sequencing data, leaving 199 in the scoring module (Table 4).TABLE 3199 genes enriched in primary alveolar type 2 organoidsrelative to bud tip progenitor organoids.GeneSymbolSFTPCALPLARPC1BCA2ALDH2SFTPA1RASGRF1C1orf116MT-ND4DGKDSFTPA2SLC22A31FTH1HIF1AZMAT3SFTPBS100A14CSTBTMEM238CD9NAPSAHOPXMT-ND3UQCR10GALNT10SPINK5SFTA1PLPCAT1MT-ATP6MEG3SLC34A2PHLDA2DRAM1SCNN1AIFI16SERPIND1CYB5AETV1HHIP-AS1CREG1HPGDCTSDNFICSTC1HLA-ASCGB3A1LMO3NNMTCBR1SELENBP1PIGRCD59NQO1MTUS1DHCR24AQP1C19orf33NPC2ACSL4ARHGDIBLRRK2SLC39A8ITGB6RAB27BTSTSFTA2C2RAB27ASNHG7STOMHLA-DRAMT-CO2HSPH1LY6EACSL1HHIPCACNA2D2EPHX1MEGF9SLC66A1LCEACAM6LGI3LGALS3CEBPACTSSCD74SDR16C5MSMO1SLC6A20FAHAQP5HLA-DRB1FBP1SNX25PARM1VEPH1MICAL2GPX4ANXA1COX17NUPR1TFPIBCL2L1CYP1B1TMEM125FTLTNCNFIXSDC1HLA-DOASFTPDS100A6HLA-CTGFBR2MCUR1SERPINA1POLR2LBRI3ADIPOR1MFSD2AKRT7ICAM1DCXRHLA-BSNX30SCDCAPN2LAMP3HIP1HLA-DMAMMP28MT-ND4LSFRP5C16orf89TSTD1ADGRF5ABCA3FGGYACSS2HLA-DPA1CATAK1MT-CO1HLA-DPB1MYO1BFOLR1GGTLC1SLPIIL18MSNDCBLD2S100A9MT-ND5ISCUTGM2CD36MPZL2HPCAL1HSPB8SUSD2CHI3L1LIPHCPMDBIDUOX1MGST1PID1XISTCDC25BCAPN8RHOBTB2TMEM213SDC4IL1R1EPDR1FASNAP000357.2PLXND1QPRTALOX15BSFNMEGF6SULT1A1CTSHRPS26MBNL1ADGRF1CCND2SELENOWGGT5TAOK3C3B2MPDXKMID1IP1MALLSELENOPCXCL17AQP4TABLE 4199 genes enriched in primary alveolar type 2 cells relative to allother lung cell types. List from reference 27.Gene SymbolSFTPCTMEM163MSMO1PID1HLA-DMBNPC2CXCL2KIAA1324LAQP1CYP51A1SFTPA1SFTA3SNX30HSD17B4CHP1NAPSAHHIP-AS1ETV1SNX25CREB3L1SFTPA2CD74PARM1PEBP1GSPT1CTSHETV5ZNF385BFGGCD83PGCSLC34A2FASNC1orf21BRI3SFTPDDMBT1FBP1SPTSSAHMGCS1LAMP3FGGYHMOX1IDI1PTP4A3ABCA3HLA-DRB1CITED2CXCL17SOCS3CHI3L2RASGRF1PLD3AKAP13SERPINB1CA2NECAB1PMM1BTG1AZGP1DBISELENBP1CDC42EP1FMO5PNRC1SERPINA1SDR16C5ODC1FDPSSOD2WIF1TFPIORM1RAB27AXBP1LRRK2HOPXHLA-DMATMSB4XGADD45GC11orf96RND1SPRY4ASAH1CSF3NRGNCD36SMAGPBLVRBNFKBIZSFTA2FABP5ACADLFLRT3TXNIPPLA2G1BMUC1B3GNT8SECISBP2LCXCL3HHIPRGS16AGPAT2CDK2AP2PLIN2PEBP4ALPLESAMRBPMS-AS1SEC61GCPB2ALOX15BASRGL1TSC22D1MED24NNMTLRRC36EPHX1MRPL14MFSD2AKCNJ15LPLCHCHD7SFTPBCSF3RQDPRSTC1HLA-DPB1SCDCISHADI1CRTAC1LGALSLMTRRATP6V0E1C2LANCL1-AS1CHI3L1NTN4MALLPPP1R1BLGMNLDHAMID1IP1SLC46A2CD44TIFASLC22A31DCXRHLA-DQB1GEMFTLC3S100A14SAT2P3H2NFKBIAMSNSTEAP4HLA-DPA1BMP2MLPHSLC25A5AK1DUSP6GADD45BTMEM41ALHFPL3-AS2SLC6A14MBIPPOLR2CC4BPAHLA-DRB5SOCS2IFITM2C16orf89AREGGSTA4LTA4HCACNA2D2GKN2EP300-AS1TPD52L1HLA-DRACATTTNZFP36TMEM243EDNRBACSL4ENO1DRAM1CEBPDZDHHC3SCP2LPCAT1KCNJ8HPCKS2Reference-Based MappingExtracted epithelial cells from scRNA-sequencing of human proximal and distal airways were downloaded from Gene Expression Omnibus (GSE178360)45 and used as reference. Data was normalized and variable features were identified in organoid data, and pre-existing variable features in the reference were used. Reference PCA was projected onto query data using the 20 most variable PCs to identity anchors which were applied for cell identity assignment in the query and additionally for projecting query data on the reference UMAP utilizing the MapQuery function in Seurat v4.Statistical Analysis

[0183] Statistical analysis was performed in PRISM 9 (GraphPad Software).FACS

[0184] For FIG. 7G statistical significance (p) between the percent of HTII-280-positive cells in SFFF with and without FGF10 was calculated by paired Student's t-test.Image Quantification

[0185] For FIG. 1E,F statistical significance (p) was calculated between the #of foci per cell within the same cell population at different timepoints or between different populations at the same timepoint by one-way ANOVA with Bonferroni correction.RT-qPCR

[0186] For RT-qPCR data arbitrary units (AUs) of gene expression was first calculated using the following equation: 2(GAPDHCt-TargetCt)×10,000. For FIG. 12B, FIG. 5D, FIG. 7I, FIG. 9E, and FIG. 10H the AUs for each biological replicate were calculated from the mean of technical replicates and a ratio paired t-test was performed between the two conditions compared to determine statistical significance (p). For FIG. 7I expanded AT2-like organoids from the 105 day female line lost AT2 markers in the presence of FGF10 but did not upregulate MUC5AC and were excluded from statistical analysis for MUC5AC. For FIG. 3E AUs were normalized to AUs of expression in progenitor media for each biological replicate to obtain fold change. Repeated measures one-way ANOVA was performed with Dunnett's correction on linearized (log-transformed) fold change values comparing all experimental conditions to progenitor medium to determine p.Data Availability

[0187] Single Cell Sequencing data used in this study is available at EMBL-EBI ArrayExpress, Gene Expression Omnibus or Synapse.org. EMBL-EBI ArrayExpress: Single-cell RNA sequencing of human fetal lung (E-MTAB-8221)21, human cananicular stage lung ALI explants (E-MTAB-12959) (this study), and human lung organoids (E-MTAB-12960) (this study). Gene Expression Omnibus: Single-cell RNA sequencing of micro-dissected human distal airways (GSE178360)45, Synapse.org: Human Lung Cell Atlas (syn21041850)29.TABLE 3199 genes enriched in primary alveolar type 2 organoidsrelative to bud tip progenitor organoids.GeneSymbolSFTPCALPLARPC1BCA2ALDH2SFTPA1RASGRF1C1orf116MT-ND4DGKDSFTPA2SLC22A31FTH1HIF1AZMAT3SFTPBS100A14CSTBTMEM238CD9NAPSAHOPXMT-ND3UQCR10GALNT10SPINK5SFTA1PLPCAT1MT-ATP6MEG3SLC34A2PHLDA2DRAM1SCNN1AIFI16SERPIND1CYB5AETV1HHIP-AS1CREG1HPGDCTSDNFICSTC1HLA-ASCGB3A1LMO3NNMTCBR1SELENBP1PIGRCD59NQO1MTUS1DHCR24AQP1C19orf33NPC2ACSL4ARHGDIBLRRK2SLC39A8ITGB6RAB27BTSTSFTA2C2RAB27ASNHG7STOMHLA-DRAMT-CO2HSPH1LY6EACSL1HHIPCACNA2D2EPHX1MEGF9SLC66A1LCEACAM6LGI3LGALS3CEBPACTSSCD74SDR16C5MSMO1SLC6A20FAHAQP5HLA-DRB1FBP1SNX25PARM1VEPH1MICAL2GPX4ANXA1COX17NUPR1TFPIBCL2L1CYP1B1TMEM125FTLTNCNFIXSDC1HLA-DOASFTPDS100A6HLA-CTGFBR2MCUR1SERPINA1POLR2LBRI3ADIPOR1MFSD2AKRT7ICAM1DCXRHLA-BSNX30SCDCAPN2LAMP3HIP1HLA-DMAMMP28MT-ND4LSFRP5C16orf89TSTD1ADGRF5ABCA3FGGYACSS2HLA-DPA1CATAK1MT-CO1HLA-DPB1MYO1BFOLR1GGTLC1SLPIIL18MSNDCBLD2S100A9MT-ND5ISCUTGM2CD36MPZL2HPCAL1HSPB8SUSD2CHI3L1LIPHCPMDBIDUOX1MGST1PID1XISTCDC25BCAPN8RHOBTB2TMEM213SDC4IL1R1EPDR1FASNAP000357.2PLXND1QPRTALOX15BSFNMEGF6SULT1A1CTSHRPS26MBNL1ADGRF1CCND2SELENOWGGT5TAOK3C3B2MPDXKMID1IP1MALLSELENOPCXCL17AQP4TABLE 3199 genes enriched in primary alveolar type 2 cells relativeto all other lung cell types. List from reference 27.Gene SymbolSFTPCTMEM163MSMO1PID1HLA-DMBNPC2CXCL2KIAA1324LAQP1CYP51A1SFTPA1SFTA3SNX30HSD17B4CHP1NAPSAHHIP-AS1ETV1SNX25CREB3L1SFTPA2CD74PARM1PEBP1GSPT1CTSHETV5ZNF385BFGGCD83PGCSLC34A2FASNC1orf21BRI3SFTPDDMBT1FBP1SPTSSAHMGCS1LAMP3FGGYHMOX1IDI1PTP4A3ABCA3HLA-DRB1CITED2CXCL17SOCS3CHI3L2RASGRF1PLD3AKAP13SERPINB1CA2NECAB1PMM1BTG1AZGP1DBISELENBP1CDC42EP1FMO5PNRC1SERPINA1SDR16C5ODC1FDPSSOD2WIF1TFPIORM1RAB27AXBP1LRRK2HOPXHLA-DMATMSB4XGADD45GC11orf96RND1SPRY4ASAH1CSF3NRGNCD36SMAGPBLVRBNFKBIZSFTA2FABP5ACADLFLRT3TXNIPPLA2G1BMUC1B3GNT8SECISBP2LCXCL3HHIPRGS16AGPAT2CDK2AP2PLIN2PEBP4ALPLESAMRBPMS-AS1SEC61GCPB2ALOX15BASRGL1TSC22D1MED24NNMTLRRC36EPHX1MRPL14MFSD2AKCNJ15LPLCHCHD7SFTPBCSF3RQDPRSTC1HLA-DPB1SCDCISHADI1CRTAC1LGALSLMTRRATP6V0E1C2LANCL1-AS1CHI3L1NTN4MALLPPP1R1BLGMNLDHAMID1IP1SLC46A2CD44TIFASLC22A31DCXRHLA-DQB1GEMFTLC3S100A14SAT2P3H2NFKBIAMSNSTEAP4HLA-DPA1BMP2MLPHSLC25A5AK1DUSP6GADD45BTMEM41ALHFPL3-AS2SLC6A14MBIPPOLR2CC4BPAHLA-DRB5SOCS2IFITM2C16orf89AREGGSTA4LTA4HCACNA2D2GKN2EP300-AS1TPD52L1HLA-DRACATTTNZFP36TMEM243EDNRBACSL4ENO1DRAM1CEBPDZDHHC3SCP2LPCAT1KCNJ8HPCKS2Having now fully described the invention, it will be understood by those of skill in the art that the same can be performed within a wide and equivalent range of conditions, formulations, and other parameters without affecting the scope of the invention or any embodiment thereof. All patents, patent applications and publications cited herein are fully incorporated by reference herein in their entirety.EQUIVALENTS

[0189] The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting the invention described herein. Scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.INCORPORATION BY REFERENCE

[0190] The entire disclosure of each of the patent documents and scientific articles referred to herein is incorporated by reference for all purposes. Complete citations for the references cited within the application are provided within the following reference list. Indeed, each of the following references are herein incorporated by reference in their entireties:

[0191] 1. Rawlins, E. L., Clark, C. P., Xue, Y. & Hogan, B. L. M. The Id2+ distal tip lung epithelium contains individual multipotent embryonic progenitor cells. Development 136, 3741-3745 (2009).

[0192] 2. Nikolié, M. Z. et al. Human embryonic lung epithelial tips are multipotent progenitors that can be expanded in vitro as long-term self-renewing organoids. Elife 6, 4139 (2017).

[0193] 3. Miller, A. J. et al. In vitro induction and in vivo engraftment of lung bud tip progenitor cells derived from human pluripotent stem cells. Stem Cell Rep. 10, 101-119 (2018).

[0194] 4. Chang, D. R. et al. Lung epithelial branching program antagonizes alveolar differentiation. Proc. Natl. Acad. Sci. USA 110, 18042-18051 (2013).

[0195] 5. Lim, K. et al. Organoid modeling of human fetal lung alveolar development reveals mechanisms of cell fate patterning and neonatal respiratory disease. Cell Stem Cell 30, 20-37.e9 (2023).

[0196] 6. He, P. et al. A human fetal lung cell atlas uncovers proximal-distal gradients of differentiation and key regulators of epithelial fates. Cell 185, 4841-4860.e25 (2022).

[0197] 7. Morrisey, E. E. & Hogan, B. L. M. Preparing for the First Breath: Genetic and Cellular Mechanisms in Lung Development. Dev. Cell 18, 8-23 (2010).

[0198] 8. Nikolié, M. Z., Sun, D. & Rawlins, E. L. Human lung development: recent progress and new challenges. Development 145, dev163485 (2018).

[0199] 9. Conway, R. F., Frum, T., Conchola, A. S. & Spence, J. R. Understanding human lung development through in vitro model systems. Bioessays N. Rev. Mol. Cell Dev. Biol. 42, e2000006-e2000006 (2020).

[0200] 10. Ballard, P. L. et al. Fetal sex and prenatal betamethasone therapy. J. Pediatr. 97, 451-454 (1980).

[0201] 11. Papageorgiou, A. N., Colle, E., Farri-Kostopoulos, E. & Gelfand, M. M. Incidence of respiratory distress syndrome following antenatal betamethasone: role of sex, type of delivery, and prolonged rupture of membranes. Pediatrics 67, 614-617 (1981).

[0202] 12. Collaborative Group on Antenatal Steroid Therapy. Effect of antenatal dexamethasone administration on the prevention of respiratory distress syndrome. Am. J. Obstet. Gynecol. 141, 276-287 (1981).

[0203] 13. Gonzales, L. W., Ballard, P. L., Ertsey, R. & Williams, M. C. Glucocorticoids and thyroid hormones stimulate biochemical and morphological differentiation of human fetal lung in organ culture*. J. Clin. Endocrinol. Metab. 62, 678-691 (1986).

[0204] 14. Odom, J., Snyder, J. M., Boggaram, V. & Mendelson, C. R. β-adrenergic agonists and camp analogues markedly increase the levels of surfactant apoprotein and its mrna and induce dramatic morphologic changes in human fetal lung in vitro. Pediatr. Res. 21, 219-219 (1987).

[0205] 15. Gonzales, L. W., Guttentag, S. H., Wade, K. C., Postle, A. D. & Ballard, P. L. Differentiation of human pulmonary type II cells in vitro by glucocorticoid plus cAMP. Am. J. Physiol. 283, L940-L951 (2002).

[0206] 16. Gotoh, S. et al. Generation of alveolar epithelial spheroids via isolated progenitor cells from human pluripotent stem cells. Stem Cell Rep. 3, 394-403 (2014).

[0207] 17. Jacob, A. et al. Differentiation of human pluripotent stem cells into functional lung alveolar epithelial cells. Cell Stem Cell 21, 472-488.e10 (2017).

[0208] 18. Cole, T. J. et al. Altered epithelial cell proportions in the fetal lung of glucocorticoid receptor null mice. Am. J. Respir. Cell Mol. Biol. 30, 613-619 (2004).

[0209] 19. Alanis, D. M., Chang, D. R., Akiyama, H., Krasnow, M. A. & Chen, J. Two nested developmental waves demarcate a compartment boundary in the mouse lung. Nat. Commun. 5, 3923 (2014).

[0210] 20. Bird, A. D. et al. cAMP response element binding protein is required for differentiation of respiratory epithelium during murine development. PLoS ONE 6, e17843 (2011).

[0211] 21. Miller, A. J. et al. In vitro and in vivo development of the human airway at single-cell resolution. Develop. Cell 53, 117-128.e6 (2020).

[0212] 22. Hein, R. F. C. et al. R-SPONDIN2 mesenchymal cells form the bud tip progenitor niche during human lung development. Dev. Cell https: / / doi.org / 10.1016 / j.devcel.2022.05.010 (2022).

[0213] 23. Hein, R. F. C. et al. Stable iPSC-derived NKX2-1+ lung bud tip progenitor organoids give rise to airway and alveolar cell types. Development 149, dev200693 (2022).

[0214] 24. Jacob, A. et al. Derivation of self-renewing lung alveolar epithelial type II cells from human pluripotent stem cells. Nat. Protoc. 14, 3303-3332 (2019).

[0215] 25. Hurley, K. et al. Reconstructed single-cell fate trajectories define lineage plasticity windows during differentiation of human PSC-derived distal lung progenitors. Cell Stem Cell 26, 593-608.e8 (2020).

[0216] 26. Jin, S. et al. Inference and analysis of cell-cell communication using CellChat. Nat. Commun. 12, 1088 (2021).

[0217] 27. Danopoulos, S., Bhattacharya, S., Mariani, T. J. & Alam, D. A. Transcriptional characterisation of human lung cells identifies novel mesenchymal lineage markers. Eur. Respir. J. 55, 1900746 (2020).

[0218] 28. Danopoulos, S. et al. Rac1 modulates mammalian lung branching morphogenesis in part through canonical Wnt signaling. Am. J. Physiol. 311, L1036-L1049 (2016).

[0219] 29. Travaglini, K. J. et al. A molecular cell atlas of the human lung from single-cell RNA sequencing. Nature 587, 619-625 (2020).

[0220] 30. Habermann, A. C. et al. Single-cell RNA sequencing reveals profibrotic roles of distinct epithelial and mesenchymal lineages in pulmonary fibrosis. Sci. Adv. 6, eaba1972 (2020).

[0221] 31.Sountoulidis, A. et al. A topographic atlas defines developmental origins of cell heterogeneity in the human embryonic lung. Nat. Cell Biol. 25, 351-365 (2023).

[0222] 32. Conchola, A. S. et al. Regionally distinct progenitor cells in the lower airway give rise to neuroendocrine and multiciliated cells in the developing human lung. Proc. Natl. Acad. Sci. USA 120, e2210113120 (2023).

[0223] 33. McCauley, K. B. et al. Efficient derivation of functional human airway epithelium from pluripotent stem cells via temporal regulation of Wnt signaling. Cell Stem Cell 20, 844-857.e6 (2017).

[0224] 34. Basil, M. C. et al. Human distal airways contain a multipotent secretory cell that can regenerate alveoli. Nature https: / / doi.org / 10.1038 / s41586-022-04552-0 (2022).

[0225] 35. Liberti, D. C. et al. Alveolar epithelial cell fate is maintained in a spatially restricted manner to promote lung regeneration after acute injury. Cell Rep. 35, 109092 (2021).

[0226] 36. Hind, M. & Maden, M. Retinoic acid induces alveolar regeneration in the adult mouse lung. Eur. Respir. J. 23, 20-27 (2004).

[0227] 37. Shmarakov, I. O. et al. Retinoids stored locally in the lung are required to attenuate the severity of acute lung injury in male mice. Nat. Commun. 14, 851 (2023).

[0228] 38. Gonzalez, R. F., Allen, L., Gonzales, L., Ballard, P. L. & Dobbs, L. G. HTII-280, a biomarker specific to the apical plasma membrane of human lung alveolar type II cells. J. Histochem. Cytochem. 58, 891-901 (2010).

[0229] 39. Weibel, E. R., Kistler, G. S. & Töndury, G. A stereologic electron microscope study of “tubular myelin figures” in alveolar fluids of rat lungs. Z. Zellforsch. Mikrosk. Anat. 69, 418-427 (1966).

[0230] 40. Williams, M. C. Conversion of lamellar body membranes into tubular myelin in alveoli of fetal rat lungs. J. Cell Biol. 72, 260-277 (1977).

[0231] 41. Street, K. et al. Slingshot: cell lineage and pseudotime inference for single-cell transcriptomics. BMC Genom. 19, 477 (2018).

[0232] 42. Tirosh, I. et al. Dissecting the multicellular ecosystem of metastatic melanoma by single-cell RNA-seq. Science 352, 189-196 (2016).

[0233] 43. Katsura, H. et al. Human lung stem cell-based alveolospheres provide insights into SARS-COV-2-mediated interferon responses and pneumocyte dysfunction. Cell Stem Cell 27, 890-904.e8 (2020).

[0234] 44. Salahudeen, A. A. et al. Progenitor identification and SARS-COV-2 infection in human distal lung organoids. Nature 588, 670-675 (2020).

[0235] 45. Murthy, P. K. L. et al. Human distal lung maps and lineage hierarchies reveal a bipotent progenitor. Nature 604, 111-119 (2022).

[0236] 46. Hao, Y. et al. Integrated analysis of multimodal single-cell data. Cell 184, 3573-3587.e29 (2021).

[0237] 47. Alysandratos, K.-D. et al. Culture impact on the transcriptomic programs of primary and iPSC-derived human alveolar type 2 cells. JCI Insight 8, e158937 (2022).

[0238] 48. Heine, U. I., Munoz, E. F., Flanders, K. C., Roberts, A. B. & Sporn, M. B. Colocalization of TGF-beta 1 and collagen I and III, fibronectin and glycosaminoglycans during lung branching morphogenesis*. Development 109, 29-36 (1990).

[0239] 49. Mahoney, J. E., Mori, M., Szymaniak, A. D., Varelas, X. & Cardoso, W. V. The hippo pathway effector yap controls patterning and differentiation of airway epithelial progenitors. Develop. Cell 30, 137-150 (2014).

[0240] 50. Bellusci, S., Henderson, R., Winnier, G., Oikawa, T. & Hogan, B. L. Evidence from normal expression and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse embryonic lung morphogenesis. Development 122, 1693-1702 (1996).

[0241] 51. Zhou, L., Dey, C. R., Wert, S. E. & Whitsett, J. A. Arrested lung morphogenesis in transgenic mice bearing an SP-C-TGF-β1 Chimeric Gene. Dev. Biol. 175, 227-238 (1996).

[0242] 52. Weaver, M., Yingling, J. M., Dunn, N. R., Bellusci, S. & Hogan, B. L. Bmp signaling regulates proximal-distal differentiation of endoderm in mouse lung development. Development 126, 4005-4015 (1999).

[0243] 53. Lu, M. M. et al. The bone morphogenic protein antagonist gremlin regulates proximal-distal patterning of the lung. Dev. Dynam. 222, 667-680 (2001).

[0244] 54. Serra, R., Pelton, R. W. & Moses, H. L. TGF beta 1 inhibits branching morphogenesis and N-myc expression in lung bud organ cultures. Development 120, 2153-2161 (1994).

[0245] 55. Liu, J., Tseu, I., Wang, J., Tanswell, K. & Post, M. Transforming growth factor β2, but not β1 and B3, is critical for early rat lung branching. Dev. Dynam. 217, 343-360 (2000).

[0246] 56. Mou, H. et al. Dual SMAD Signaling inhibition enables long-term expansion of diverse epithelial basal cells. Cell Stem Cell 19, 217-231 (2016).

[0247] 57. Kiyokawa, H. et al. Airway basal stem cells reutilize the embryonic proliferation regulator, Tgfβ-Id2 axis, for tissue regeneration. Dev. Cell 56, 1917-1929.e9 (2021).

[0248] 58. Ahlfeld, S. K., Wang, J., Gao, Y., Snider, P. & Conway, S. J. Initial suppression of transforming growth factor-β signaling and loss of TGFBI causes early alveolar structural defects resulting in bronchopulmonary dysplasia. Am. J. Pathol. 186, 777-793 (2016).

[0249] 59. Dabovic, B. et al. Dual functions for LTBP in lung development: LTBP-4 independently modulates elastogenesis and TGF-β activity. J. Cell Physiol. 219, 14-22 (2009).

[0250] 60. Koli, K. et al. Disruption of LTBP-4 function reduces TGF-β activation and enhances BMP-4 signaling in the lung. J. Cell Biol. 167, 123-133 (2004).

[0251] 61. Alejandre-Alcázar, M. A. et al. Temporal and spatial regulation of bone morphogenetic protein signaling in late lung development. Dev. Dyn. 236, 2825-2835 (2007).

[0252] 62. Eblaghie, M. C., Reedy, M., Oliver, T., Mishina, Y. & Hogan, B. L. M. Evidence that autocrine signaling through Bmprla regulates the proliferation, survival and morphogenetic behavior of distal lung epithelial cells. Dev. Biol. 291, 67-82 (2006).

[0253] 63. Kompass, K. S., Deslee, G., Moore, C., McCurnin, D. & Pierce, R. A. Highly conserved transcriptional responses to mechanical ventilation of the lung. Physiol. Genom. 42, 384-396 (2010).

[0254] 64. Calthorpe, R. J. et al. Complex roles of TGF-β signaling pathways in lung development and bronchopulmonary dysplasia. Am. J. Physiol. 324, L285-L296 (2023).

[0255] 65. Chanda, D. et al. Developmental pathways in the pathogenesis of lung fibrosis. Mol. Aspects Med. 65, 56-69 (2019).

[0256] 66. Ye, Z. & Hu, Y. TGF-β1: gentlemanly orchestrator in idiopathic pulmonary fibrosis (Review). Int. J. Mol. Med. 48, 132 (2021).

[0257] 67. Halwani, R., Al-Muhsen, S., Al-Jahdali, H. & Hamid, Q. Role of transforming growth factor-β in Airway Remodeling in Asthma. Am. J. Resp. Cell Mol. 44, 127-133 (2011).

[0258] 68. Panek, M., Stawiski, K., Kaszkowiak, M. & Kuna, P. Cytokine TGFβ gene polymorphism in asthma: TGF-related SNP analysis enhances the prediction of disease diagnosis (a case-control study with multivariable data-Mining model development). Front. Immunol. 13, 746360 (2022).

[0259] 69. Caldeira, I., Fernandes-Silva, H., Machado-Costa, D., Correia-Pinto, J. & Moura, R. S. Developmental pathways underlying lung development and congenital lung disorders. Cells 10, 2987 (2021).

[0260] 70. Ursini, W. P. & Ponce, C. C. Congenital pulmonary airway malformation. Autopsy Case Rep. 8, e2018022 (2018).

[0261] 71. Sakaki-Yumoto, M., Katsuno, Y. & Derynck, R. TGF-β family signaling in stem cells. Biochim. Biophys. Acta 1830, 2280-2296 (2013).

[0262] 72. Oshimori, N. & Fuchs, E. Paracrine TGF-β signaling counterbalances BMP-mediated repression in hair follicle stem cell activation. Cell Stem Cell 10, 63-75 (2012).

[0263] 73. He, X. C. et al. BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wnt-β-catenin signaling. Nat. Genet. 36, 1117-1121 (2004).

[0264] 74. Guasch, G. et al. Loss of TGFβ signaling destabilizes homeostasis and promotes squamous cell carcinomas in stratified epithelia. Cancer Cell 12, 313-327 (2007).

[0265] 75. Heldin, C.-H. & Moustakas, A. Signaling receptors for TGF-β family members. CSH Perspect. Biol. 8, a022053 (2016).

[0266] 76. Candia, A. F. et al. Cellular interpretation of multiple TGF-β signals: intracellular antagonism between activin / BVg1 and BMP-2 / 4 signaling mediated by Smads. Development 124, 4467-4480 (1997).

[0267] 77. Sartori, R. et al. BMP signaling controls muscle mass. Nat. Genet. 45, 1309-1318 (2013).

[0268] 78. Yuan, G., Zhan, Y., Gou, X., Chen, Y. & Yang, G. TGF-β signaling inhibits canonical BMP signaling pathway during palate development. Cell Tissue Res. 371, 283-291 (2018).

[0269] 79. Dituri, F., Cossu, C., Mancarella, S. & Giannelli, G. The Interactivity between TGFβ and BMP signaling in organogenesis, fibrosis, and cancer. Cells 8, 1130 (2019).

[0270] 80. Luo, K. Signaling cross talk between TGF-β / Smad and other signaling pathways. CSH Perspect. Biol. 9, a022137 (2017).

[0271] 81. McDevitt, T. M., Gonzales, L. W., Savani, R. C. & Ballard, P. L. Role of endogenous TGF-β in glucocorticoid-induced lung type II cell differentiation. Am. J. Physiol. Lung Cell Mol. Physiol. 292, L249-L257 (2007).

[0272] 82. Schwartze, J. T. et al. Glucocorticoids recruit Tgfbr3 and Smad1 to shift transforming growth factor-β signaling from the Tgfbr1 / Smad2 / 3 axis to the Acvrll / Smad1 axis in lung fibroblasts*. J. Biol. Chem. 289, 3262-3275 (2014).

[0273] 83. Sun, D. et al. A functional genetic toolbox for human tissue-derived organoids. Elife 10, e67886 (2021).

[0274] 84. Nyeng, P., Norgaard, G. A., Kobberup, S. & Jensen, J. FGF10 maintains distal lung bud epithelium and excessive signaling leads to progenitor state arrest, distalization, and goblet cell metaplasia. BMC Dev. Biol. 8, 2-15 (2008).

[0275] 85. Strunz, M. et al. Alveolar regeneration through a Krt8+ transitional stem cell state that persists in human lung fibrosis. Nat. Commun. 11, 3559 (2020).

[0276] 86. Kobayashi, Y. et al. Persistence of a regeneration-associated, transitional alveolar epithelial cell state in pulmonary fibrosis. Nat. Cell Biol. 22, 934-946 (2020).

[0277] 87. Choi, J. et al. Inflammatory signals induce AT2 Cell-Derived Damage-Associated Transient Progenitors that Mediate Alveolar Regeneration. Cell Stem Cell 27, 366-382.e7 (2020).

[0278] 88. Tajima, S. et al. Extensive goblet cell metaplasia of the peripheral lung may harbor precancerous molecular changes: comparison of two cases. Pathol. Int. 64, 533-538 (2014).

[0279] 89. Nazarian, G., Gross, B. & Buono, E. D. Goblet cell metaplasia causing alveolar disease of the lung: radiographic and pathologic findings. Am. J. Roentgenol. 152, 1195-1196 (1989).

[0280] 90. Whitsett, J. A. Airway epithelial differentiation and mucociliary clearance. Ann. Am. Thorac. Soc. 15, S143-S148 (2018).

[0281] 91. Bingle, C. D. MUCking about in IPF: identification of a novel goblet cell phenotype in pulmonary fibrosis. Thorax 66, 647 (2011).

[0282] 92. Nagai, H. Goblet cell metaplasia in the pulmonary alveolar epithelium in a rat. Toxicol. Pathol. 22, 555-558 (1994).

[0283] 93. Miller, A. J. et al. Generation of lung organoids from human pluripotent stem cells in vitro. Nat. Protoc. 25, 1 (2019).

[0284] 94. Haghverdi, L., Lun, A. T. L., Morgan, M. D. &Marioni, J. C. Batch effects in single-cell RNA-sequencing data are corrected by matching mutual nearest neighbors. Nat. Biotechnol. 36, 421-427 (2018).

Claims

1. A method, comprising:culturing one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue in vitro; wherein the culturing results in differentiation of the one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue into alveolar cells; wherein the culturing comprises simultaneous modulation of TGF-β pathway signaling and BMP pathway signaling; andobtaining alveolar cells from the cultured one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue.

2. The method of claim 1,wherein the iPSC-derived lung tissue comprises iPSC-derived bud tip progenitor cells;wherein the bud tip progenitor cells derived from human tissue are derived from human lung tissue.

3. The method of claim 1, wherein the bud tip progenitor cells express SOX9.

4. The method of claim 1, wherein the iPSC-derived tissue expresses SOX9.

5. The method of claim 1, wherein the obtained alveolar cells are alveolar type 2 (AT2)-like cells and / or alveolar cell organoid tissue.

6. The method of claim 5, wherein the alveolar organoid tissue comprises AT2-like cell organoid tissue.

7. The method of claim 5, wherein the obtained AT2-like cells and / or alveolar cell organoid tissue express mature AT2 markers.

8. The method of claim 5, wherein the obtained AT2-like cells and / or alveolar cell organoid tissue do not express SOX9.

9. The method of claim 5, wherein the obtained AT2-like cells and / or alveolar cell organoid tissue express lower amounts of SOX9 than the amount of SOX9 expressed in the one or both of iPSC-derived tissue and bud tip progenitor cells.

10. The method of claim 1, wherein the culturing further comprises exposure to a progenitor media along with the simultaneous modulation of TGF-β pathway signaling and BMP pathway signaling.

11. The method of claim 10, wherein the progenitor media comprises FGF7 and / or CHIR99021.

12. The method of claim 11, wherein the progenitor media further comprises all-trans retinoic acid.

13. The method of claim 1, wherein the culturing is for between seven and fourteen days.

14. The method of claim 1, wherein the culturing is for between approximately seven and approximately fourteen days.

15. The method of claim 1, wherein the obtained alveolar cells are capable of expansion in media optimized for the expansion of primary adult alveolar cell organoids.

16. The method of claim 15, wherein the media optimized for the expansion of primary adult alveolar cell organoids does not contain FGF10.

17. The method of claim 1, wherein the obtained alveolar cells are capable of expansion for >100 days in media optimized for the expansion of primary adult alveolar cell organoids.

18. The method of claim 1, wherein the obtained alveolar cells secrete lamellar bodies.

19. The method of claim 1, wherein the obtained alveolar cells have surfactant processing capabilities.

20. The method of claim 1, wherein the obtained alveolar cells have secretion capabilities.

21. The method of claim 1, wherein the simultaneous modulation of TGF-β signaling pathway and BMP pathway signaling comprises simultaneous TGF-β signaling pathway inhibition and BMP pathway signaling activation.

22. The method of claim 21, wherein TGF-β signaling pathway inhibition comprises culturing the one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue with an agent that inhibits the TGF-β signaling pathway.

23. The method of claim 22, wherein the agent that inhibits the TGF-β signaling pathway is selected from the group consisting of:a small molecule that inhibits the TGF-β pathway,a protein that inhibits the TGF-β pathway,an ALK5 inhibitor (e.g., A83-01 (CAS number: 909910-43-6), GW788388, RepSox, and SB-431542 (CAS number: 301836-41-9)),SB-505124 (CAS number: 694433-59-5),SB-525334 (CAS number: 356559-20-1),LY364947 (CAS number: 396129-53-6),SD-208 (CAS number: 627536-09-8), andSJN2511 (CAS number: 446859-33-2).

24. The method of claim 21, wherein BMP signaling pathway activation comprises culturing one or both of iPSC-derived tissue and bud tip progenitor cells derived from human tissue in vitro with an agent that activates the BMP signaling pathway.

25. The method of claim 24, wherein the agent that activates the BMP signaling pathway is selected from the group consisting of: BMP1, BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8a, BMP8b, BMP10, BMP11, BMP15, IDE1, IDE2, derivatives thereof, and mixtures thereof, small molecules that activate the BMP pathway, and proteins that activate the BMP pathway, and additionally may include ventromophins, 4′-hydroxy chalcone, apigenin, and combinations thereof.

26. The method of claim 1, wherein the culturing and obtaining steps are conducted in vitro.

27. A composition comprising alveolar cells obtained with the method of claim 1.

28. A method of treating a mammalian subject having a damaged lung tissue with reduced function, comprisingengrafting alveolar cells obtained with the method of claim 1 at the site of damaged lung tissue with reduced function, wherein the engrafted alveolar cells at the site of injury repopulate at least a portion of the site with the engrafted alveolar cells, wherein the repopulated engrafted alveolar cells supplement the function of the damaged lung tissue with reduced function, thereby treating the mammalian subject.

29. The method of claim 28, wherein the damaged lung tissue with reduced function is associated with, but not limited to, a condition caused by one or more ofan injury that results in a loss of epithelial function,a post-lung transplant complication, and / ora genetic disorder.

30. The method of claim 29,wherein the injury that results in loss of epithelial function is bronchiolitis obliterans;wherein the post-lung transplant complication is bronchiolitis obliterans;wherein the genetic disorder is one or more mutations that cause an impairment or a loss of epithelial cell function, wherein the genetic disorder is cystic fibrosis.

31. A kit comprising alveolar cells obtained with the method of claim 1.

32. A kit comprising comprises lung bud tip progenitor cells, TGF-β inhibiting agents, and BMP activating agents.

33. The method of claim 5, wherein the obtained AT2-like cells and / or alveolar cell organoid tissue express one or more of: SFTPC, SFTPA1, LAMP3, HOPX, SFTPB, and HOPX.