Food and pharmaceutical preparations containing coumaric acid

Abstract

The invention relates to a food and pharmaceutical preparation containing coumaric acid. The preparation containing coumaric acid and / or its salts is, in a scheme, effective in inhibiting the cellular invasion of protozoa capable of causing coccidiosis and / or inhibiting the proliferation of protozoa in cells, effective in preventing, improving and treating coccidiosis in vivo, and significantly reducing the excretion of zygote cysts in feces, thus reducing secondary coccidiosis infection.

Description

Composition for anticoccidial purposes containing coumarin acid and use thereof

[0001] Cross-citation with related application(s)

[0002] This application claims the benefit of priority from Republic of Korea Patent Application No. 10-2021-0029733, dated March 5, 2021, the entire contents of which are incorporated herein by reference.

[0003] The present application relates to an anticoccidial composition comprising coumarin acid and / or a salt thereof and its use.

[0004] Coccidiosis is an intestinal disease caused by protozoan parasites belonging to the phylum apicomplexan, called Eimeria. Infection with coccidiosis causes symptoms such as indigestion, diarrhea, and weight loss, and can even lead to livestock death, and has a significant economic impact on farms worldwide (Williams RB. A compartmentalized model for the estimation of the cost of coccidiosis to the world's chicken production industry. Int J Parasitol. 1999; 29(8):1209-1229).

[0005] Over the past several years, numerous research teams have developed anticoccidial agents, such as ionophores or chemically synthetic compounds, that can inhibit oocyst cell wall formation or the asexual and sexual reproduction of protozoa as treatments for coccidiosis. However, long-term use of these "shuttle programs"—alternating between ionophores and chemically synthetic compounds—has resulted in adverse effects, such as the emergence of drug-resistant protozoa.

[0006] In particular, antibiotic overuse and misuse have led to the accumulation of antibiotics in animals, leading to human consumption of antibiotics through meat, posing a serious problem. Furthermore, countries around the world are banning antibiotic use due to the issue of antibiotic residues in livestock products. Therefore, there is an urgent need for research and development of alternatives to existing anticoccidial agents, which have side effects such as the emergence of drug-resistant strains and the potential for residual antibiotics in the body.

[0007] Prior art literature

[0008] Patent documents

[0009] U.S. Patent Publication No. 2003-0091589

[0010] One example of the present application provides a use of coumaric acid and / or its salts for preventing, ameliorating, and / or treating coccidiosis.

[0011] Another example of the present application provides a feed composition for preventing or improving coccidiosis, comprising coumarin acid and / or a salt thereof as an active ingredient.

[0012] Another example of the present application provides a pharmaceutical composition for preventing or treating coccidiosis, comprising coumarin acid and / or a pharmaceutically acceptable salt thereof as an active ingredient.

[0013] Another example of the present application provides the use of coumarin acid and / or its salts for the preparation of a composition (e.g., a feed composition, a pharmaceutical composition) for preventing, ameliorating, and / or treating coccidiosis.

[0014] Another example of the present application provides a method for preventing, ameliorating, and / or treating coccidiosis, comprising administering the composition (e.g., the feed composition, the pharmaceutical composition, and / or the antiprotozoal composition) to an animal other than a human.

[0015] Another example of the present application provides the use of coumaric acid and / or its salts for the treatment of protozoa of the genus Eimeria (e.g., killing Eimeria spp.; and / or inhibiting cell penetration and / or proliferation of Eimeria spp.).

[0016] Another example of the present application provides an antiprotozoal composition against protozoa of the genus Aemeria, comprising coumarin acid and / or a salt thereof as an active ingredient.

[0017] Another example of the present application provides the use of coumarin acid and / or its salts for the preparation of an antiprotozoal composition against protozoa of the genus Eimeria.

[0018] Another example of the present application provides a method for preventing, ameliorating, and / or treating coccidiosis, or a method for controlling protozoa of the genus Eimeria, comprising administering coumaric acid and / or a salt thereof to an animal (e.g., a subject in need of protozoal control, or an animal other than a human). In the present specification, controlling protozoa comprehensively refers to an anti-protozoal action, and may mean, for example, but not limited to, killing protozoa of the genus Eimeria, and / or inhibiting cell penetration and / or proliferation of protozoa of the genus Eimeria.

[0019] In one example, the coumarin acid may have a structure represented by the following chemical formula 1.

[0020] [Chemical Formula 1]

[0021]

[0022] A composition comprising coumaric acid and / or a salt thereof according to an example may have excellent anticoccidial activity and / or antiprotozoal activity against protozoa that induce coccidiosis.

[0023] In the present application, excellent anticoccidial efficacy (activity, effect) may mean one or more (e.g., one or more, two or more, three or more, four or more, or all five) selected from the group consisting of the following (1) to (5):

[0024] (1) Anticoccidial index (ACI) is higher than that of the control group;

[0025] (2) Administered to animals induced with coccidiosis to reduce mortality, lesion score, and / or fecal oocyst excretion compared to the control group;

[0026] (3) Inhibition of weight loss caused by coccidiosis;

[0027] (4) Higher insecticidal activity against protozoa that induce coccidiosis compared to the control group; and

[0028] (5) Higher inhibition effect on cell penetration and / or intracellular proliferation of protozoa that induce coccidiosis compared to the control group.

[0029] In the present application, the control group may mean a negative control group (a group treated with nothing, water, and / or a buffer) and / or a positive control group including a known anticoccidial agent (e.g., diclazuril, gallic acid, and / or salinomycin).

[0030] A composition according to an example may have one or more properties (e.g., one or more, two or more, three or more, four or more, five or more, or all six) selected from the group consisting of (1) to (6), and the properties may be superior to those of a control group:

[0031] (1) Excellent anticoccidial activity;

[0032] (2) Excellent antiprotozoal effect against protozoa that cause coccidiosis;

[0033] (3) Excellent acid resistance;

[0034] (4) Excellent heat resistance;

[0035] (5) Excellent in vivo stability and / or safety; and

[0036] (6) Excellent effect on improving weight gain.

[0037] A composition according to an example has excellent acid resistance and / or heat resistance, can be administered into the body and maintain excellent anticoccidial activity for a long period of time, has excellent in vivo stability, can maintain excellent anticoccidial activity even in environments with various temperature and / or pH ranges, can be applied to various products (e.g., feed additives), and can have excellent storage stability.

[0038] A composition according to an example may have excellent in vivo safety because it is not absorbed into tissues and organs other than the intestine (e.g., blood, liver, kidney, and / or spleen, etc.) when administered in the body, and thus has a small residual amount in the body.

[0039] In one example, an excellent effect on improving body weight gain may mean that the effect of administering the compound to an individual is excellent in increasing the body weight of the individual, and in one example, the weight gain may mean daily weight gain, and the individual may be an individual in which coccidiosis is induced.

[0040] A composition according to an example exhibits anticoccidial activity that is equivalent to or superior to that of conventionally known anticoccidial agents (e.g., sulfa agents such as sulfaquinoxaline, sulfachloropyrazine, and sulfamethazine, polyether ionophore antibiotics such as salinomycin and monensin sodium, ampurolium, diclazuril, and / or toltrazuril), and, since it contains coumaric acid and / or its salt as an active ingredient, which is a substance that naturally participates in the metabolic process, it does not cause side effects or drug resistance and / or is not absorbed into the body, so it is safe for long-term use. A composition according to an example can be used as a substance for preventing, improving, and / or treating coccidia in not only broilers but also laying hens because it does not cause resistance or remain in the body. A composition according to an example can significantly reduce the amount of oocysts discharged from an individual infected with a protozoan that causes anticoccidia, thereby reducing the rate of livestock house contamination and / or secondary infection.

[0041] In the present application, "prevention" means any act of inhibiting or delaying the onset of a disease by administering a composition according to an example, "treatment" means any act of improving or beneficially changing the symptoms of a suspected or affected individual by administering a composition according to an example, and "improvement" may mean any act of at least reducing a parameter related to a state in which a disease is treated, for example, the severity of a symptom, by administering a composition according to an example. The disease may refer to coccidiosis.

[0042]

[0043] One aspect can provide a feed composition for preventing or improving coccidiosis, comprising coumaric acid and / or a salt thereof (coumaric acid, a salt of coumaric acid, or a combination thereof).

[0044] The above 'coumaric acid' is a type of hydroxycinnamic acid, which is a hydroxy derivative of cinnamic acid. In one example, the coumaric acid may be at least one selected from the group consisting of p-coumaric acid, m-coumaric acid, and o-coumaric acid.

[0045] In one example, the coumaric acid may be in the trans form and / or the cis form. For example, the p-coumaric acid may be trans-p-coumaric acid and / or cis-p-coumaric acid, the m-coumaric acid may be trans-m-coumaric acid and / or cis-m-coumaric acid, and the o-coumaric acid may be trans-o-coumaric acid and / or cis-o-coumaric acid.

[0046] The above p-coumaric acid may be named '4-hydroxycinnamic acid', 'p-hydroxycinnamic acid', or '2-(4-hydroxyphenyl)acrylic acid', and may have a molecular formula of C9H8O3. In one example, the p-coumaric acid may be represented by the following chemical formula 1 or chemical formula 2, or may be a mixture thereof (a compound represented by chemical formula 1 and a compound represented by chemical formula 2). In one example, the Cas number of the p-coumaric acid may be Cas No. 501-98-4, Cas No. 7400-08-0, and / or Cas No. 4501-31-9.

[0047] [Chemical Formula 1]

[0048]

[0049] [Chemical Formula 2]

[0050]

[0051] The m-coumaric acid may be named '3-hydroxycinnamic acid', 'm-hydroxycinnamic acid', or '3-(3-hydroxyphenyl)acrylic acid', and may have a molecular formula of C9H8O3. In one example, the m-coumaric acid may be represented by the following chemical formula 3 or chemical formula 4, or may be a mixture thereof (a compound represented by chemical formula 3 and a compound represented by chemical formula 4). In one example, the Cas No. of the m-coumaric acid may be Cas No. 14755-02-3, Cas No. 25429-38-3, and / or Cas No. 588-30-7.

[0052] [Chemical Formula 3]

[0053]

[0054] [Chemical Formula 4]

[0055]

[0056] The above o-coumaric acid may be named '2-hydroxycinnamic acid' or '2-hydroxycinnamate' and may have a molecular formula of C9H8O3. In one example, the above o-coumaric acid may be represented by the following chemical formula 5 or chemical formula 6, or may be a mixture thereof (a compound represented by chemical formula 5 and a compound represented by chemical formula 6). In one example, the Cas No. of the above o-coumaric acid may be Cas No. 614-60-8 and / or Cas No. 495-79-4.

[0057] [Chemical Formula 5]

[0058]

[0059] [Chemical Formula 6]

[0060]

[0061] The above coumarin acid and / or its salt (the above coumarin acid salt) may be obtained by extraction and separation from a natural product (e.g., a plant) and / or a strain, manufactured by a conventional organic synthesis method, or obtained from a manufacturer in the art, but is not limited thereto.

[0062] In the present application, “salt of coumaric acid” may mean a physiologically acceptable salt among salts in which cations and anions are bonded by electrostatic attraction, and “pharmaceutically acceptable salt” may mean a salt in a form that can be used pharmaceutically, and may be, for example, a metal salt, a salt with an organic base, a salt with an inorganic acid, a salt with an organic acid, a salt with a basic or acidic amino acid, etc. In one example, the metal salt may be an alkali metal salt (sodium salt, potassium salt, etc.), an alkaline earth metal salt (calcium salt, magnesium salt, barium salt, etc.), an aluminum salt, etc.; and the salt with an organic base may be a salt with triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N,N-dibenzylethylenediamine, etc.; Salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, etc.; salts with organic acids include salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, etc.; salts with basic amino acids include salts with arginine, lysine, ornithine, etc.; salts with acidic amino acids include salts with aspartic acid, glutamic acid, etc.

[0063] In this application, "coccidiosis" is a disease in which coccidian protozoa (protozoa that can induce coccidiosis, for example, coccidian protozoa of the genus Aemeria) parasitize in the cytoplasm of the submucosal tissue of the digestive tract epithelium, destroying the epithelium and causing enteritis, and is a protozoal disease that causes economic damage in broiler farms, etc., due to reduced weight gain and extended slaughter days caused by loose stools, diarrhea, and bloody stools. Coccidiosis can occur not only in broiler chickens but also in birds, fish, reptiles, and mammals, and specifically, the coccidiosis can infect cattle, rabbits, goats, dogs, cats, and laboratory animals such as mice and rats, and in particular, can cause fatal damage to poultry such as chickens, ducks, geese, turkeys, quail, and pheasants. In one example, the coccidiosis may include acute coccidiosis, subacute coccidiosis, and chronic coccidiosis. The acute coccidiosis may present with bloody stool, lethargy, and anemia within 48 hours after infection, and the infected individual may die. The subacute coccidiosis may present with bloody diarrhea and / or anemia after infection, and the chronic coccidiosis may present with loose stools and / or weight loss after diarrhea for 1 to 2 days after infection.

[0064] When the oocysts (cysts, eggs) of the coccidium protozoan species mature into sporulated oocysts under high humidity and temperature, they become infectious. After going through a certain life cycle in the body of an organism, the oocysts are excreted in the feces, allowing easy transmission and repeating the oocyst life cycle. The oocysts (cysts) of the coccidium protozoan species are highly resistant to the external environment, and the cyst wall is known to be composed of two layers, inner and outer. The outer layer of the cyst wall is a gelatinous substance that strongly resists physical external pressure, and the inner layer is rich in nucleoproteins, making it highly resistant to chemical stimuli such as disinfectants. The oocyst of the Coccidia protozoan species may contain four sporocysts, each of which may contain two sporozoites. After infecting an animal in the form of an oocyst, the sporocysts and sporozoites are released to proliferate within the cell, and the sporozoites that have undergone sexual and / or asexual reproduction may form oocysts and be excreted in the feces. In one example, the sporozoites may be used in the same sense as the protozoan, and the sporozoites (protozoa) may cause a lesion.

[0065] In one example, the coccidiosis may be caused by a protozoan of the genus Eimeriasp. In one example, the protozoa of the genus Eimeria are Eimeria acervulina (sand spore), Eimeria tenella (chicken cecal spore), Eimeria maxima (Eimeria maxima), Eimeria necatrix (Eimeria necatrix), Eimeria brunetti (Eimeria brunetti), Eimeria hagani (Eimeria hagani), Eimeria mitis (Eimeria mitis), Eimeria praecox (Eimeria praecox), Eimeria mivati ​​(Eimeria mivati), Eimeria aurati, Eimeria baueri, Eimeria Eimeria lepidosirenis, Eimeria leucisci, Eimeria rutile, Eimeria vanasi, Eimeria amphisbaeniarum, Eimeria witchery, Eimeria yemenensae, Eimeria adenoeides, Eimeria colchici, Eimeria curvata, Eimeria dispersa, Eimeria duodenalis, Eimeria fraterculae, Eimeria gallopavonis, Eimeria innocua, Eimeria Eimeria meleagridis,Eimeria meleagrimitis, Eimeria phasiani, Eimeria procera, Eimeria purpureicephali, Eimeria ahsata, Eimeria alabamensis, Eimeria alijevi, Eimeria aspheronica, Eimeria arloingi, Eimeria arundeli, Eimeria bakuensis, Eimeria bovis, Eimeria cameli, Eimeria caprina, Eimeria caprovina, Eimeria Eimeria christenseni, Eimeria clethrionomyis, Eimeria coecicola, Eimeria contorta, Eimeria couesii, Eimeria crandallis, Eimeria dammahensis, Eimeria dowleri, Eimeria exigua, Eimeria falciformis, Eimeria farasanii, Eimeria ferrisi, Eimeria flavescens, Eimeria gallatii, Eimeria granulosa, Eimeria hirsi hirci),Eimeria intestinalis, Eimeria irresidua, Eimeria intricata, Eimeria jolchijevi, Eimeria krijgsmanni, Eimeria larimerensis, Eimeria macusaniensis, Eimeria magna, Eimeria marconii, Eimeria media, Eimeria melanuri, Eimeria myoxi, Eimeria nagpurensis, Eimeria nieschulzi, Eimeria ninakoljakimopae ninakohlyakimovae), Eimeria ovinoidalis, Eimeria pallida, Eimeria palustris, Eimeria papillata, Eimeria perforans, Eimeria phocae, Eimeria pileata, Eimeria pipistrellus, Eimeria piriformis, Eimeria prionotemni, Eimeria procyonis, Eimeria punctate, Eimeria roobroucki, Eimeria saudiensis, Eimeria sealanderi), Eimeria separata,It may be one or more species (e.g., one or more species, two or more species, three or more species, or four or more species) selected from the group consisting of Eimeria stiedae, Eimeria ursini, Eimeria vermiformis, Eimeria weybridgensis, Eimeria wobati, and Eimeria zuernii.

[0066] A composition according to an example may be excellent in the prevention, improvement, and / or treatment of coccidiosis induced by one or more (e.g., one or more, two or more, three or more, or four or more) protozoa selected from the group consisting of protozoa of the genus Aemeria described in Table 1 below, and each of the protozoa of the genus Aemeria described in Table 1 below may induce coccidiosis in an animal described in Table 1.

[0067] species host animal 1 Eimeria acervulina chicken (Gallus gallus domesticus) 2 Eimeria tenella chicken (Gallus gallus domesticus) 3 Eimeria maxima chicken (Gallus gallus domesticus) 4 Eimeria necatrix chicken (Gallus gallus domesticus) 5 Eimeria brunetti chicken (Gallus gallus domesticus) 6 Eimeria hagani chicken (Gallus gallus domesticus) 7 Eimeria mitis chicken (Gallus gallus domesticus) 8 Eimeria praecox chicken (Gallus gallus domesticus) 9 Eimeria mivati ​​chicken (Gallus gallus domesticus) 10 Eimeria Eimeria aurati, goldfish (Carassius auratus), 11 Eimeria baueri, crucian carp (Carassius carassius), 12 Eimeria lepidosirenis, South American lungfish (Lepidosiren paradoxa), 13 Eimeria leucisci, common barbel (Barbus barbus bocagei), 14 Eimeria rutile, European chub (Leuciscus cephalus cabeda), Iberian nase (Chondrostoma polylepis polylepis), 15 Eimeria vanasi, blue tilapia (bluetilapia (Oreochromis aureus))16 Eimeria amphisbaeniarum (Eimeria amphisbaeniarum)Mann's worm lizard (Amphisbaena manni))17 Eimeria witchery (Eimeria witchery)Worm lizard (Mann's worm lizard (A. manni))18 Eimeria yemenensae (Eimeria yemenensae)Rock agama (Agama yemenensis))19 Eimeria adenoeides (Eimeria adenoeides)Turkey (Meleagris gallopavo)20 Eimeria colchici (Eimeria colchici)Common pheasant (Phasianus colchicus)21 Eimeria curvata (Eimeria curvata)Ruddy ground dove (Columbina talpacoti)), scaled dove (Scardafella squammata)22Eimeria dispersaTurkey (M. gallopavo)), bobwhite quail (Colinus virginianus)23Eimeria duodenalisPheasant (Common pheasant (Phasianus colchicus)24Eimeria fraterculaeAtlantic puffin (Fratercula arctica)25Eimeria gallopavonisTurkey (M. gallopavo)26Eimeria innocuaTurkey (M. gallopavo)27Eimeria Eimeria meleagridis (turkey (M. gallopavo))28 Eimeria meleagrimitis (turkey)(turkey (M. gallopavo))29Eimeria phasianiPheasant (P. colchicus)30Eimeria proceraGrey partridges (Perdix perdix)31Eimeria purpureicephaliRed-capped parrot (Purpureicephalus spurius)32Eimeria ahsataGoat (Capra hircus)Sheep (Ovis aries)33Eimeria alabamensisCattle (Bos taurus)34Eimeria alijeviGoat (C. hircus)35Eimeria aspheronica)goat (C. hircus)36Eimeria arloingi)goat (C. hircus)37Eimeria arundeli)common wombat (Vombatus ursinus)38Eimeria bakuensis)sheep (O. aries)39Eimeria bovis)cattle (B. taurus)40Eimeria cameli)camels (Camelus bactrianus, Camelus dromedarius)41Eimeria caprina)goat (C. hircus)42Eimeria caprovina)goat (C. hircus))43 Eimeria christenseni goat (C. hircus))44 Eimeria clethrionomyis red-backed vole(Clethrionomys gapperi))45 Eimeria coecicola rabbit (Oryctolagus cuniculus))46 Eimeria contorta mouse (Mus musculus))47 Eimeria couesii rice rat (Oryzomys couesi))48 Eimeria crandallis sheep (O. aries))49 Eimeria dammahensis scimitar-homed oryx (Oryx dammah))50 Eimeria dowleri eastern red bat (Lasiurus borealis))51 Eimeria exigua rabbit (rabbit (O. cuniculus))52Eimeria falciformisMouse (M. musculus))53Eimeria farasaniiMountain gazelle (Gazella gazelle farasani))54Eimeria ferrisiMouse (M. musculus))55Eimeria flavescensRabbit (O. cuniculus))56Eimeria gallatiiRed-backed vole (Clethrionomys gapperi))57Eimeria granulosaGoat (C. hircus))58Eimeria hirciGoat (C. hircus))59Eimeria intestinalis rabbit (O. cuniculus))60Eimeria irresidua rabbit (rabbit(O. cuniculus))61 Eimeria intricata (Eimeria intricata) Goat (C. hircus))62 Eimeria jolchijevi (Eimeria jolchijevi) Goat (C. hircus))63 Eimeria krijgsmanni (Eimeria krijgsmanni) Mouse (M. musculus))64 Eimeria larimerensis (Eimeria larimerensis) Uinta ground squirrel (Spermophilus armatus))65 Eimeria macusaniensis (Eimeria macusaniensis) Llamas (Lama glama)), guanacos (Lama guanicoe)), alpacas (Vicugna pacos)), vicuñas (Vicugna vicugna))66 Eimeria Eimeria magna (rabbit (O. cuniculus)) 67 Eimeria marconii (red-backed vole (Clethrionomys gapperi)) 68 Eimeria media (rabbit (O. cuniculus)) 69 Eimeria melanuri (garden dormouse (Eliomys quercinus)) 70 Eimeria myoxi (garden dormouse (Eliomys quercinus)) 71 Eimeria nagpurensis (rabbit (O. cuniculus)) 72 Eimeria nieschulzi (brown rat (R. norvegicus)) 73 Eimeria Eimeria ninakohlyakimovae goat (C. hircus) 74 Eimeria ovinoidalis sheep (O.aries))75 Eimeria pallida Goat (C. hircus)76 Eimeria palustris Marsh rice rat (Oryzomys palustris)77 Eimeria papillata Mouse (M. musculus)78 Eimeria perforans Rabbit (O. cuniculus)79 Eimeria phocae Sable Island harbor seals (Phoca vitulina)80 Eimeria pileata Red-backed vole (Clethrionomys gapperi)81 Eimeria pipistrellus Cool's house bat (Kuhl's pipistrelle (Pipistrellus kuhlii))82 Eimeria piriformis (Eimeria piriformis)Rabbit (O. cuniculus))83 Eimeria prionotemni (Eimeria prionotemni)Bennett's wallaby (Macropus rufogriseus))84 Eimeria procyonis (Eimeria procyonis)Raccoon (Procyon lotor))85 Eimeria punctate (Eimeria punctate)Goat (C. hircus))86 Eimeria roobroucki (Eimeria roobroucki)Rabbit (O. cuniculus))87 Eimeria saudiensis (Eimeria saudiensis)Arabian oryx (Oryx leucoryx))88 Eimeria Eimeria sealanderi, eastern red bat (Lasiurus borealis), mouse (M.musculus), rat (Rattus rattus) 90 Eimeria stiedae rabbit (O. cuniculus) 91 Eimeria ursini southern hairy-nosed wombat (Lasiorhinus latifrons) 92 Eimeria vermiformis mouse (M. musculus) 93 Eimeria weybridgensis sheep (O. aries) 94 Eimeria wobati southern hairy-nosed wombat (L. latifrons) 95 Eimeria zuernii cattle (B. taurus)

[0068] A composition according to one example may be effective in preventing, ameliorating, and / or treating coccidiosis induced by Eimeria tenella, Eimeria acebulina, and / or Eimeria maxima.

[0069] In one example, the prevention or improvement of coccidiosis may mean one or more (e.g., one or more, two or more, three or more, or all four) selected from the group consisting of (1) to (4) below, and for example, one or more selected from the group consisting of (1) to (4) below may be reduced, inhibited, and / or increased compared to a control group (negative control group and / or positive control group):

[0070] (1) A decrease in at least one selected from the group consisting of lesion score (e.g., cecal lesion score), fecal oocyst excretion, and mortality;

[0071] (2) Inhibition of weight loss caused by coccidiosis;

[0072] (3) Increase in the anticoccidial index (ACI); and

[0073] (4) Reduction of cell penetration of protozoa of the genus Aemeria, proliferation of said protozoa within cells, or both.

[0074] In one example, the lesion scoring method for determining the lesion score may be performed with reference to the literature (Joyce Johnson, W.Malcolm Reid, Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens, Experimental parasitology, 1970) by Johnson JK & Reid WM, and the lesion score may be graded from 0 to 4. In one example, the lesion score may refer to a lesion score measured in the cecum, duodenum, and / or jejunum, and may be calculated as the sum of each lesion score measured in each organ (cecum, duodenum, and / or jejunum).

[0075] In one example, the amount of fecal oocysts shed can be measured by collecting feces shed from an individual and using a microscope or a counting chamber (e.g., a McMaster chamber).

[0076] In one example, the mortality rate may refer to the mortality rate of animals in which coccidiosis was induced, and a post-mortem examination may be performed to exclude the number of animals that died from causes other than coccidiosis.

[0077] In one example, an individual induced with coccidiosis may lose weight compared to an individual not induced with coccidiosis, and the composition according to one example may inhibit weight loss due to coccidiosis induction.

[0078] In one example, the anticoccidial composite index can be calculated using the following mathematical formula 1, and the lesion score in mathematical formula 1 can be calculated using the method described above.

[0079]

[0080] (Equation 1)

[0081] Anticoccidial composite index (ACI) = (Survival rate after challenge vaccination (%)) + (Daily weight gain compared to the negative control group (%)) - (Lesion score x 10) - (Fecal oocyst excretion index)

[0082]

[0083] The above challenge inoculation may refer to the administration of a protozoan capable of inducing coccidiosis (e.g., oral inoculation, etc.). In one example, the survival rate may be a survival rate measured on days 5 to 10, 7 to 10, 8 to 10, 7 to 9, 7 to 8, or 7 after the challenge inoculation, and the survival rate may be measured by excluding the number of individuals that died from causes other than coccidiosis by performing a postmortem.

[0084] In the above mathematical expression 1, the weight gain compared to the negative control group may be a value calculated as a percentage based on the value of the negative control group (e.g., a negative control group not infected with coccidium protozoa).

[0085] The lesion score in the above mathematical expression 1 is as described above.

[0086] In the above mathematical expression 1, the fecal oocyst excretion index may be a numerical value calculated as a percentage based on the value of a negative control group (e.g., a negative control group infected with protozoa), and if the calculated result is at the level of 0 to less than 1%, it may be 0; if it is 1% or more but less than 26%, it may be 5; if it is 26% or more but less than 51%, it may be 10; if it is 51% or more but less than 76%, it may be 20; and if it is 76% or more but less than 100%, it may be 40.

[0087] In one example, the coumarin acid and / or its salt is present in the feed composition at 1 w / w% or less, less than 1 w / w%, or 10 -1 w / w% or less, 5 x 10 -2 w / w% or less, 2.5 x 10 -2 w / w% or less, 2 x 10 -2 w / w% or less, 1.25 x 10 -2 w / w% or less, 10 -2 w / w% or less, 9 x 10 -3 w / w% or less, 8 x 10 -3 w / w% or less, 6.25 x 10 -3 w / w% or less, 7 x 10 -3 w / w% or less, 6 x 10 -3 w / w% or less, 5 x10 -3 w / w% or less, 4 x 10 -3 w / w% or less, 10 -7 w / w% or more, 10 -6 w / w% or more, 10 -5 w / w% or more, 10 -4 w / w% or more, 5 x 10 -4 w / w% or more, 10 -3 w / w% or more, 1.5 x 10 -3 w / w% or more, 2 x 10 -3 w / w% or more, 3 x 10 -3 w / w% or more, 4 x 10 -3 w / w% or more, 5 x 10 -3 w / w% or more, 6.25 x 10 -3 w / w% or more, 10 -7 1 w / w%, 10 -7 10 inland -1 w / w%, 10 -7 5 x 10 -2 w / w%, 10 -7 10 inland -2 w / w%, 10 -7 5 x 10 -3 w / w%, 10 -7 4 x 10 -3 w / w%, 10 -7 10 inland-3 w / w%, 10 -7 5 x 10 -4 w / w%, 10 -7 10 inland -4 w / w%, 10 -7 10 inland -5 w / w%, 10 -6 1 w / w%, 10 -6 10 inland -1 w / w%, 10 -6 5 x 10 -2 w / w%, 10 -6 10 inland -2 w / w%, 10 -6 5 x 10 -3 w / w%, 10 -6 4 x 10 -3 w / w%, 10 -6 10 inland -3 w / w%, 10 -6 5 x 10 -4 w / w%, 10 -6 10 inland -4 w / w%, 10 -6 10 inland -5 w / w%, 10 -5 1 w / w%, 10 -5 10 inland -1 w / w%, 10 -5 5 x 10 -2 w / w%, 10 -5 10 inland -2 w / w%, 10 -5 5 x 10 -3 w / w%, 10 -5 4 x 10 -3 w / w%, 10 -5 10 inland -3 w / w%, 10 -5 5 x 10 -4 w / w%, 10 -5 10 inland -4 w / w%, 10 -4 1 w / w%, 10 -4 10 inland -1 w / w%, 10 -4 5 x 10 -2 w / w%, 10-4 10 inland -2 w / w%, 10 -4 5 x 10 -3 w / w%, 10 -4 4 x 10 -3 w / w%, 10 -4 10 inland -3 w / w%, 10 -4 5 x 10 -4 w / w%, 10 -3 1 w / w%, 10 -3 10 inland -1 w / w%, 10 -3 5 x 10 -2 w / w%, 10 -3 10 inland -2 w / w%, 10 -3 5 x 10 -3 w / w%, 10 -3 4 x 10 -3 w / w%, 10 -3 2 x 10 -3 w / w%, or 10 -3 1.5 x 10 -3 It may be included in w / w%. In one example, the feed composition may be a feed (e.g., compound feed and / or single feed ultimately consumed by an animal) that includes the effective ingredient in the above range based on the total weight.

[0088] In one example, the coumaric acid and / or its salt is present in the feed composition at 1000 ppm or less, 500 ppm or less, 400 ppm or less, 300 ppm or less, 250 ppm or less, 200 ppm or less, 125 ppm or less, less than 125 ppm, 100 ppm or less, 90 ppm or less, 80 ppm or less, 70 ppm or less, 65 ppm or less, 62.5 ppm or less, 60 ppm or less, 50 ppm or less, 0.1 ppm or more, 1 ppm or more, 5 ppm or more, 10 ppm or more, 15 ppm or more, 20 ppm or more, 30 ppm or more, 40 ppm or more, 50 ppm or more, 62.5 ppm or more, 0.1 to 1000 ppm, 0.1 to 500 ppm, 0.1 to 400ppm, 0.1 to 300ppm, 0.1 to 250ppm, 0.1 to 200ppm, 0.1 to 125ppm, 0.1 to 100ppm, 0.1 to 90ppm, 0.1 to 80ppm, 0.1 to 70ppm, 0.1 to 65ppm, 0.1 to 60ppm, 0.1 to 50ppm, 1 to 1000ppm, 1 to 500ppm, 1 to 400ppm, 1 to 300ppm, 1 to 250ppm, 1 to 200ppm, 1 to 125ppm, 1 to 100ppm, 1 to 90ppm, 1 to 80ppm, 1 to 70ppm, 1 to 65ppm, 1 to 60ppm, 1 to 50ppm, 5 to 1000ppm, 5 to 500ppm, 5 to 400ppm, 5 to 300ppm, 5 to 250ppm, 5 to 200ppm, 5 to 125ppm, 5 to 100 ppm, 5 to 90ppm, 5 to 80ppm, 5 to 70ppm, 5 to 65ppm, 5 to 60ppm, 5 to 50ppm, 10 to 1000ppm, 10 to 500ppm, 10 to 400ppm, 10 to 300ppm, 10 to 250ppm, 10 to 200ppm, 10 to 125ppm, 10 to 100 ppm, 10 to 90 ppm,10 to 80 ppm, 10 to 70 ppm, 10 to 65 ppm, 10 to 60 ppm, 10 to 50 ppm, 20 to 1000 ppm, 20 to 500 ppm, 20 to 400 ppm, 20 to 300 ppm, 20 to 250 ppm, 20 to 200 ppm, 20 to 125 ppm, 20 to 100 ppm, 20 to 90 ppm, 20 to 80 ppm, 20 to 70 ppm, 20 to 65 ppm, 20 to 60 ppm, 20 to 50 ppm, 30 to 1000 ppm, 30 to 500 ppm, 30 to 400 ppm, 30 to 300ppm, 30 to 250ppm, 30 to 200ppm, 30 to 125ppm, 30 to 100ppm, 30 to 90ppm, 30 to 80ppm, 30 to 70ppm, 30 to 65ppm, 30 to 60ppm, 30 to 50ppm, 40 to 1000ppm, 40 to 500ppm, 40 to 400ppm, 40 to 300ppm, 40 to 250ppm, 40 to 200ppm, 40 to 125ppm, 40 to 100ppm, 40 to 90ppm, 40 to 80ppm, 40 to 70ppm, 40 to 65ppm, 40 to It may be included in a concentration of 60 ppm, 40 to 50 ppm, 50 to 1000 ppm, 50 to 500 ppm, 50 to 400 ppm, 50 to 300 ppm, 50 to 250 ppm, 50 to 200 ppm, 50 to 125 ppm, 50 to 100 ppm, 50 to 90 ppm, 50 to 80 ppm, 50 to 70 ppm, 50 to 65 ppm, or 50 to 60 ppm.

[0089] In this application, "feed" may mean any natural or artificial diet, meal, etc., or components of such meal, intended for or suitable for eating, ingesting, and digesting by an animal. A feed composition according to an example may additionally include a concentrate feed and / or a special feed. The above-mentioned concentrated feed may be seed and fruit products including grains such as wheat, oats, and corn; bran including rice bran, wheat bran, and barley bran as by-products obtained by refining grains; sesame cakes which are by-products obtained by extracting soybeans, sesame seeds, linseed, and coconut oil; residual starch which is the main component of starch residue remaining after removing starch from sweet potatoes, potatoes, etc.; animal feed such as fish meal, fish waste, fish soluble which is concentrated fresh liquid obtained from fish; meat meal, blood meal, feather meal, skim milk powder, dried whey which is the residue when manufacturing cheese from milk or casein from skim milk; yeast, chlorella, and / or seaweed, etc.

[0090] A feed composition according to an example may refer to feed in the form ultimately consumed by an animal, a dietary supplement that can be mixed into the feed, and / or a feed additive. The dietary supplement may refer to a composition containing a preparation that provides a therapeutic agent or a digestive agent to an animal, and although it is not usually a source of calorie intake for the body, i.e., an energy source, it may refer to a composition that is consumed in addition to a normal animal feed. The feed additive may refer to a substance added to the feed for various purposes, such as supplementing nutrients and preventing weight loss, increasing the digestibility and availability of fiber in the feed, improving milk quality, preventing reproductive disorders and improving conception rates, and preventing summer heat stress. In one example, it may refer to a substance added for the purpose of preventing, improving, or treating coccidiosis.

[0091] In one example, the feed composition may be a feed additive, and when the feed additive according to one example is mixed into feed (e.g., compound feed and / or single feed to be finally consumed by an animal), the feed additive may be present in an amount of 0.001% or more, 0.005% or more, 0.01% or more, 0.05% or more, 0.1% or more, 0.5% or more, 1% or less, 0.5% or less, 0.1% or less, 0.05% or less, 0.01% or less, 0.005% or less, 0.001 to 1%, 0.001 to 0.5%, 0.001 to 0.1%, 0.001 to 0.05%, 0.001 to 0.01%, 0.001 to 0.005%, 0.005 to 1%, based on the total feed weight. It may be added in an amount of 0.005 to 0.5%, 0.005 to 0.1%, 0.005 to 0.05%, 0.005 to 0.01%, 0.01 to 1%, 0.01 to 0.5%, 0.01 to 0.1%, 0.01 to 0.05%, 0.05 to 1%, 0.05 to 0.5%, 0.05 to 0.1%, 0.1 to 1%, 0.1 to 0.5%, or 0.5 to 1% by weight and mixed with feed raw materials, supplementary feed, supplements, and / or other types of additives other than effective ingredients according to an example.

[0092]

[0093] Another aspect may provide a pharmaceutical composition for preventing or treating coccidiosis, comprising coumaric acid and / or a salt thereof, wherein the coumaric acid and / or a salt of coumaric acid included in the pharmaceutical composition is as described above.

[0094] A pharmaceutical composition according to an example may be used as a single agent, or may be manufactured and used as a combined preparation by additionally including a pharmaceutical composition known to have an approved coccidiosis prevention or treatment effect. The pharmaceutical composition may be formulated into a pharmaceutical unit dosage form by adding a pharmaceutically acceptable carrier, excipient, or diluent.

[0095] In the present application, "pharmaceutically acceptable" means not significantly irritating to a living organism and not inhibiting the biological activity and properties of the administered active substance. In one example, the pharmaceutical composition comprising a pharmaceutically acceptable carrier may have any one dosage form selected from the group consisting of tablets, pills, powders, granules, capsules, suspensions, oral solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories.

[0096] The above pharmaceutical composition may be administered orally or parenterally in various dosage forms. When formulated, it may be prepared using commonly used diluents or excipients, such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.

[0097] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations can be prepared by mixing one or more compounds with at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc., and in addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives can be included.

[0098] Formulations for parenteral administration may include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solutions and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases may include witepsol, macrogol, Tween 61, cocoa butter, laurin butter, and glycerogelatin.

[0099] In one example, the pharmaceutical composition may be formulated and used in various forms, such as oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, and injections of sterile injectable solutions, according to conventional methods according to each intended use, and may be administered orally or through various routes, including intravenous, intraperitoneal, subcutaneous, rectal, and topical administration.

[0100] In one example, the pharmaceutical composition may further include a carrier, excipient, or diluent, and examples of suitable carriers, excipients, or diluents that may be included include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, amorphous cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition, the pharmaceutical composition may further include a filler, an anticoagulant, a lubricant, a wetting agent, a fragrance, an emulsifier, a preservative, and the like.

[0101] According to one example, the effective amount of the active ingredient (coumaric acid and / or its salt) in the pharmaceutical composition may vary depending on the age, sex, and weight of the patient (subject), and is generally 0.0001 to 0.001 mg / kg, 0.0001 to 0.01 mg / kg, 0.0001 to 0.1 mg / kg, 0.0001 to 1 mg / kg, 0.0001 to 10 mg / kg, 0.0001 to 100 mg / kg, 0.0001 to 231 mg / kg, 0.0001 to 250 mg / kg, 0.0001 to 500 mg / kg, 0.0001 to 1000 mg / kg, 0.001 to 0.01 mg / kg, 0.001 to 0.1 mg / kg, 0.001 to 1mg / kg, 0.001 to 10mg / kg, 0.001 to 100mg / kg, 0.001 to 231mg / kg, 0.001 to 250mg / kg, 0.001 to 500mg / kg, 0.001 to 1000mg / kg, 0.01 to 0.1mg / kg, 0.01 to 1mg / kg, 0.01 to 10mg / kg, 0.01 to 100mg / kg, 0.01 to 250mg / kg, 0.01 to 500mg / kg, 0.01 to 1000mg / kg, 0.1 to 1mg / kg, 0.1 to 10mg / kg, 0.1 to 100mg / kg, 0.1 to 231mg / kg, 0.1 to 250mg / kg, 0.1 to 500mg / kg, 0.1 to 1000 mg / kg, 1 to 10 mg / kg, 1 to 100 mg / kg, 1 to 231 mg / kg, 1 to 250 mg / kg, 1 to 500 mg / kg, 1 to 1000 mg / kg, 10 to 100 mg / kg, 10 to 231 mg / kg, 10 to 250 mg / kg, 10 to 500 mg / kg, 10 to 1000 mg / kg, 100 to 231 mg / kg, 100 to 250 mg / kg, 100 to 500 mg / kg, 100 to 1000 mg / kg, 250 to 500 mg / kg, or 250 to 1000 mg / kg may be administered daily or every other day or divided into 1 to 3 times a day. However, the dosage may vary depending on the route of administration, severity of the disease, gender, weight, age, etc., and thus does not limit the scope of the present invention in any way. In one example, when the composition is administered intraperitoneally, it may be administered in an amount of 0.001 to 250 mg / kg or 0.001 to 231 mg / kg.

[0102] In one example, the dosage of the pharmaceutical composition may vary depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of the disease.

[0103] In one example, the coumarin acid and / or its salt is present in the pharmaceutical composition in an amount of 1 w / w% or less, less than 1 w / w%, or 10 -1 w / w% or less, 5 x 10 -2 w / w% or less, 2.5 x 10 -2 w / w% or less, 2 x 10 -2 w / w% or less, 1.25 x 10 -2 w / w% or less, 10 -2 w / w% or less, 9 x 10 -3 w / w% or less, 8 x 10 -3 w / w% or less, 6.25 x 10 -3 w / w% or less, 7 x 10 -3 w / w% or less, 6 x 10-3 w / w% or less, 5 x10 -3 w / w% or less, 4 x 10 -3 w / w% or less, 10 -7 w / w% or more, 10 -6 w / w% or more, 10 -5 w / w% or more, 10 -4 w / w% or more, 5 x 10 -4 w / w% or more, 10 -3 w / w% or more, 1.5 x 10 -3 w / w% or more, 2 x 10 -3 w / w% or more, 3 x 10 -3 w / w% or more, 4 x 10 -3 w / w% or more, 5 x 10 -3 w / w% or more, 6.25 x 10 -3 w / w% or more, 10 -7 1 w / w%, 10 -7 10 inland -1 w / w%, 10 -7 5 x 10 -2 w / w%, 10 -7 10 inland -2 w / w%, 10 -7 5 x 10 -3 w / w%, 10 -7 4 x 10 -3 w / w%, 10 -7 10 inland -3 w / w%, 10 -7 5 x 10 -4 w / w%, 10 -7 10 inland -4 w / w%, 10 -7 10 inland -5 w / w%, 10 -6 1 w / w%, 10 -6 10 inland -1 w / w%, 10 -6 5 x 10 -2 w / w%, 10 -6 10 inland -2 w / w%, 10 -6 5 x 10 -3 w / w%, 10 -64 x 10 -3 w / w%, 10 -6 10 inland -3 w / w%, 10 -6 5 x 10 -4 w / w%, 10 -6 10 inland -4 w / w%, 10 -6 10 inland -5 w / w%, 10 -5 1 w / w%, 10 -5 10 inland -1 w / w%, 10 -5 5 x 10 -2 w / w%, 10 -5 10 inland -2 w / w%, 10 -5 5 x 10 -3 w / w%, 10 -5 4 x 10 -3 w / w%, 10 -5 10 inland -3 w / w%, 10 -5 5 x 10 -4 w / w%, 10 -5 10 inland -4 w / w%, 10 -4 1 w / w%, 10 -4 10 inland -1 w / w%, 10 -4 5 x 10 -2 w / w%, 10 -4 10 inland -2 w / w%, 10 -4 5 x 10 -3 w / w%, 10 -4 4 x 10 -3 w / w%, 10 -4 10 inland -3 w / w%, 10 -4 5 x 10 -4 w / w%, 10 -3 1 w / w%, 10 -3 10 inland -1 w / w%, 10 -3 5 x 10 -2 w / w%, 10 -3 10 inland -2w / w%, 10 -3 5 x 10 -3 w / w%, 10 -3 4 x 10 -3 w / w%, 10 -3 2 x 10 -3 w / w%, or 10 -3 1.5 x 10 -3 It can be included as w / w%.

[0104] In one example, the coumaric acid and / or its salt is present in the pharmaceutical composition at 1000 ppm or less, 500 ppm or less, 400 ppm or less, 300 ppm or less, 250 ppm or less, 200 ppm or less, 125 ppm or less, less than 125 ppm, 100 ppm or less, 90 ppm or less, 80 ppm or less, 70 ppm or less, 65 ppm or less, 60 ppm or less, 62.5 ppm or less, 50 ppm or less, 0.1 ppm or more, 1 ppm or more, 5 ppm or more, 10 ppm or more, 15 ppm or more, 20 ppm or more, 30 ppm or more, 40 ppm or more, 50 ppm or more, 62.5 ppm or more, 0.1 to 1000 ppm, 0.1 to 500 ppm, 0.1 to 400 ppm, 0.1 to 300 ppm, 0.1 to 250 ppm, 0.1 to 200 ppm, 0.1 to 125 ppm, 0.1 to 100 ppm, 0.1 to 90 ppm, 0.1 to 80 ppm, 0.1 to 70 ppm, 0.1 to 65 ppm, 0.1 to 60 ppm, 0.1 to 50 ppm, 1 to 1000 ppm, 1 to 500 ppm, 1 to 400 ppm, 1 to 300 ppm, 1 to 250 ppm, 1 to 200 ppm, 1 to 125 ppm, 1 to 100 ppm, 1 to 90 ppm, 1 to 80 ppm, 1 to 70 ppm, 1 to 65 ppm, 1 to 60 ppm, 1 to 50 ppm, 5 to 1000 ppm, 5 to 500 ppm, 5 to 400 ppm, 5 to 300 ppm, 5 to 250 ppm, 5 to 200 ppm, 5 to 125 ppm, 5 to 100 ppm, 5 to 90 ppm, 5 to 80 ppm, 5 to 70 ppm, 5 to 65 ppm, 5 to 60 ppm, 5 to 50 ppm, 10 to 1000 ppm, 10 to 500 ppm, 10 to 400 ppm, 10 to 300 ppm, 10 to 250 ppm, 10 to 200 ppm, 10 to 125 ppm, 10 to 100 ppm, 10 to 90 ppm,10 to 80 ppm, 10 to 70 ppm, 10 to 65 ppm, 10 to 60 ppm, 10 to 50 ppm, 20 to 1000 ppm, 20 to 500 ppm, 20 to 400 ppm, 20 to 300 ppm, 20 to 250 ppm, 20 to 200 ppm, 20 to 125 ppm, 20 to 100 ppm, 20 to 90 ppm, 20 to 80 ppm, 20 to 70 ppm, 20 to 65 ppm, 20 to 60 ppm, 20 to 50 ppm, 30 to 1000 ppm, 30 to 500 ppm, 30 to 400 ppm, 30 to 300ppm, 30 to 250ppm, 30 to 200ppm, 30 to 125ppm, 30 to 100ppm, 30 to 90ppm, 30 to 80ppm, 30 to 70ppm, 30 to 65ppm, 30 to 60ppm, 30 to 50ppm, 40 to 1000ppm, 40 to 500ppm, 40 to 400ppm, 40 to 300ppm, 40 to 250ppm, 40 to 200ppm, 40 to 125ppm, 40 to 100ppm, 40 to 90ppm, 40 to 80ppm, 40 to 70ppm, 40 to 65ppm, 40 to It may be included in a concentration of 60 ppm, 40 to 50 ppm, 50 to 1000 ppm, 50 to 500 ppm, 50 to 400 ppm, 50 to 300 ppm, 50 to 250 ppm, 50 to 200 ppm, 50 to 125 ppm, 50 to 100 ppm, 50 to 90 ppm, 50 to 80 ppm, 50 to 70 ppm, 50 to 65 ppm, or 50 to 60 ppm.

[0105] In one example, the pharmaceutical composition may be administered to a subject via various routes. Administration may refer to providing a given substance to a subject (patient) by any suitable method, and the route of administration of the pharmaceutical composition may be oral and / or parenteral, as long as it can reach the target tissue. Parenteral administration may include topical application to the skin, intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, and / or intrathoracic injection. Furthermore, the composition according to one example may be administered using any device capable of delivering the active ingredient to target cells.

[0106]

[0107] Another aspect may provide an antiprotozoal composition for protozoa of the genus Eimeria, comprising coumaric acid and / or a salt thereof. Another aspect provides a method for preventing, ameliorating, and / or treating coccidiosis, or a method for controlling protozoa of the genus Eimeria, comprising administering coumaric acid and / or a salt thereof to an animal (e.g., a subject in need of protozoal control, or an animal other than a human). In the present specification, controlling protozoa comprehensively refers to an antiprotozoal action, and may mean, for example, killing protozoa of the genus Eimeria, and / or inhibiting cell penetration and / or proliferation of protozoa of the genus Eimeria, but is not limited thereto. The coumaric acid, the salt of coumaric acid, and / or the protozoa of the genus Eimeria are as described above.

[0108] In one example, the superior antiprotozoal activity (effect, efficacy) against the protozoan of the genus Aemeria may mean the following characteristics (1) and / or (2), and for example, may mean exhibiting the following characteristics (1) and / or (2) compared to a control group (negative control group and / or positive control group):

[0109] (1) Excellent effect in killing protozoa of the genus Aimeria; and / or

[0110] (2) Inhibition of the cell penetration effect of the protozoan of the genus Aemeria and / or the proliferation effect of the protozoan within the cell.

[0111] In one example, the coumarin acid and / or a salt of coumarin acid may be included in the antiprotozoal composition in the concentration ranges described above in the feed composition and / or pharmaceutical composition. In one example, a composition comprising the active ingredient in the concentration range described above may have superior antiprotozoal activity than a composition comprising the active ingredient in a range outside the concentration range.

[0112]

[0113] Another aspect may provide a method for preventing, ameliorating, or treating coccidiosis, comprising administering the composition (e.g., the feed composition, the feed additive, the pharmaceutical composition, and / or the antiprotozoal composition) to an animal (e.g., an animal other than a human). In one example, the method may further comprise a step of identifying (selecting) an individual (patient) in need of preventing, ameliorating, or treating coccidiosis prior to the step of administering the composition. The composition and coccidiosis are as described above. In one example, the step of identifying the individual may comprise a step of detecting an oocyst of a protozoan capable of inducing coccidia in feces isolated from the individual. In the method for preventing, ameliorating, or treating coccidiosis according to one example, the method, route of administration, and / or dosage of the composition are as described above.

[0114] In one example, the composition may be administered in a pharmaceutically effective amount. In the present application, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dosage level may be determined based on the type and severity of the patient's disease, the activity and sensitivity of the drug to the drug, the time of administration, the route of administration and the excretion rate, the duration of treatment, concomitant drugs, and other factors well known in the medical field. In one example, the composition may be administered as an individual treatment or in combination with other anticoccidial agents, and may be administered simultaneously, separately, or sequentially with conventional treatments, and may be administered singly or in multiple doses. It is important to administer an amount that can achieve the maximum effect with the minimum amount without causing side effects by taking all of the above factors into consideration, and this can be easily determined by those skilled in the art.

[0115] In one example, the subject to which the above method for preventing, improving, or treating coccidiosis is applied means an animal that has developed or may develop coccidiosis, and the animal may be a mammal including a human, a horse, a cow, a mouse, a rat, a dog, a cat, etc., a bird including a poultry (e.g., a breeding chicken, a broiler, and / or a laying hens), a fish, an amphibian, and / or a reptile.

[0116] In one example, the animal to which the above method for preventing, improving, or treating coccidiosis is applied may be one or more species (e.g., one or more species, two or more species, or three or more species) selected from the group consisting of animals listed in Table 1, and may be one or more species (e.g., one or more species, two or more species, or three or more species) selected from the group consisting of humans, chickens, ducks, geese, turkeys, quails, pheasants, pigeons, parrots, cattle, pigs, goats, sheep, horses, antelopes, oryxes, monkeys, cats, dogs, mice, rats, rabbits, raccoons, squirrels, bats, guinea pigs, camels, lizards, alpacas, wombats, lizards, goldfishes, carp, tilapias, barbels, lungfishes, and European chub. In one example, the animal may be an animal other than a human.

[0117]

[0118] A composition comprising coumarin acid and / or a salt thereof according to an example has an excellent effect of inhibiting cell penetration of protozoa capable of inducing coccidiosis and / or an effect of inhibiting intracellular proliferation of said protozoa, has an excellent effect of preventing, improving, and treating coccidiosis in vivo, and can significantly reduce the amount of oocysts discharged in feces, thereby reducing secondary coccidiosis infection.

[0119]

[0120] Figure 1 shows the anticoccidial composite index (ACI) of coumarin acid when inoculated with protozoa that can cause coccidiosis.

[0121]

[0122] The present invention will be described in more detail below with reference to the following examples. However, these examples are provided solely to illustrate the present invention, and the scope of the present invention is not limited by these examples.

[0123]

[0124] Example 1. In vivo anticoccidial activity of coumarin acid

[0125]

[0126] Example 1-1. Experimental facility and research design

[0127]

[0128] In vivo efficacy evaluation trials were conducted at a dedicated broiler animal testing facility located in the United States. One-day-old female Ross broilers were individually weighed and randomly divided into groups for use in the experiment.

[0129] Details and conditions regarding the experimental design are listed in Table 2.

[0130] Category Experimental Variables Rearing Type Cage Broiler Age at Entry 1 day old Total Experimental Period 30 days Sex Female Number of Broilers per Cage 6 Number of Repetitions per Treatment 3 Number of Repetitions per Treatment 5 Total Number of Broilers 90 Type of Protozoa Inoculated Eimeria tenella Number of Oocysts Inoculated 10,000 Oral Oocysts Inoculated / Bird

[0131] Example 1-2. Experimental design

[0132] The general feed used was Daehan Feed A1-Choi product, and each ingredient (salinomycin (Jeil Bio Jeil Salino-60 product), VantiPEAL (Kemin, Cozante, main ingredient: gallic acid), p-coumaric acid (p-coumaric acid, CAS No. 501-98-4; sigma)) was added to the feed at the concentrations shown in Table 3 below and self-mixed. No antibiotics or supplements were used in the general feed and mixed feed, and no anticoccidial agent was added other than each ingredient. The broilers were allowed to consume the feed ad libitum throughout the experimental period.

[0133] Coccidiosis was induced by orally inoculating 21-day-old broilers with oocysts (eggs) of Eimeria tenella that were more than 90% mature (sporulated) at a rate of 10,000 oocysts per bird via oral tube (challenge inoculation).

[0134] The feed formulations administered to the control group (negative control group or positive control group) and the test group and the induction of coccidiosis by Eimeria tenella are shown in Table 3 below. Six 1-day-old broilers were housed in cages randomly assigned to the control group or test group, and after feeding them regular feed for 14 days, the compound feed prepared above was separately administered to the control group or test group.

[0135]

[0136] Group treatment: Non-infected negative control group (NC) Regular feed Infected negative control group (PC) Eimeria tenella infection + regular feed Positive control group 1 Eimeria tenella infection + compound feed containing 60 ppm of salinomycin Positive control group 2 Eimeria tenella infection + compound feed containing 125 ppm of VantiPEAL (Kemin) Coumaric acid intake group 1 Eimeria tenella infection + compound feed containing 125 ppm of p-coumaric acid (Sigma)

[0137] Example 1-3. Measurement of the anticoccidial activity of coumarin acid.

[0138] The anticoccidial efficacy of each test group designed in the above Examples 1-2 was expressed as an anticoccidial composite index (ACI), and the anticoccidial composite index was calculated by the following mathematical formula 2. The ACI score is out of 200 points, and a higher ACI score means a better anticoccidial activity. If the ACI score is 120 or more but less than 140, it is judged to be effective as an anticoccidial material, if it is 140 or more but less than 160, it is judged to be excellent as an anticoccidial material, and if it is 160 or more, it is judged to be very excellent in anticoccidial effect (Luis Miguel De Pablos et al., Anticoccidial activity of maslinic acid against infection with Eimeria tenella in chickens, Parasitol Res, 2010).

[0139]

[0140] (Equation 2)

[0141] Anticoccidial composite index (ACI) = (Survival rate after challenge vaccination (%)) + (Daily weight gain (RWG, %) compared to the negative control group) - (Lesion score x 10) - (Fecal oocyst excretion index)

[0142]

[0143] 1) Survival rate: The number of dead animals was recorded daily, and postmortem examinations were performed to determine the cause of death. Animals that died from causes other than coccidiosis were excluded. The survival rate (%) up to 8 days after challenge inoculation was used to calculate the anticoccidial composite index.

[0144] 2) Daily weight gain: The body weights of each cage before and 8 days after the protozoan challenge were measured, and the difference was divided by the number of days to calculate the daily weight gain (ADG, g / d). The daily weight gain (ADG, average daily gain; g / d) of each experimental group was divided by the weight gain (ADG, g / d) of the non-infected negative control group and multiplied by 100 to calculate the 'daily weight gain (RWG, %) compared to the negative control group', which was used to calculate the anticoccidial composite index.

[0145] The daily weight gain (ADG, g / d) and daily weight gain (RWG, %) compared to the negative control group in each control and test group are shown in Table 4 below.

[0146] 3) Lesion Scoring: On the 9th day after challenge vaccination, four broilers per cage were necropsied, and their intestines were incised. Each coccidial lesion in the cecum of the broilers was scored. The lesion scoring method was performed with reference to the literature of Johnson JK & Reid WM (1970) (Joyce Johnson, W.Malcolm Reid, Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens, Experimental parasitology, 1970). The lesion score is graded from 0 to 4, where 0 points correspond to a normal cecum, 1 point corresponds to mild infection symptoms, 2 points correspond to moderate infection symptoms, 3 points correspond to severe infection symptoms, and 4 points correspond to very severe infection symptoms or death. The cecal lesion scores measured in each control and test group are shown in Table 4 below. The measured cecal lesion score was multiplied by 10 to obtain a lesion index, which was used to calculate the anticoccidial composite index.

[0147] 4) Fecal Oocyst Excretion: All feces collected from 6 to 9 days after challenge vaccination were evenly mixed and randomly sampled three times (1 g each). Oocysts in each 1 g of feces were suspended in salt water, and the amount of oocyst excreted was measured using a McMaster chamber. The results are shown in Table 4 below.

[0148] The oocyst discharge amount for each group was divided by the oocyst discharge amount of the infected negative control group and multiplied by 100 to calculate the oocyst discharge amount (%) compared to the infected negative control group. If the calculated oocyst discharge amount compared to the infected negative control group was 0 to less than 1%, it was 5 for 1% to less than 26%, 10 for 26% to less than 51%, 20 for 51% to less than 76%, and 40 for 76% to less than 100%. The oocyst discharge index was calculated and used to calculate the anticoccidial composite index.

[0149]

[0150] Group Control group Test group Compounds NCPCSalinomycinVantiPEARLp-coumaric acidconc(ppm)60125125Number of broilers181818181818ADG after challenge(g / d)5537454952RWG(%)10067.381.889.194.5Survival rate(%)100100100100100Cecal lesion score03.372.272.172.5Cecal lesion index-33.722.721.725Oocyst discharge(Oocyst / chicken)01.3x10 8 6.3x10 7 8x10 7 5.7x10 7 Oocyst index040102010ACI20094149147160

[0151] As shown in Table 4, the negative control group (PC) infected with Eimeria tenella developed coccidiosis, which resulted in decreased weight gain, increased lesion scores, and increased oocyst (egg) discharge compared to the non-infected negative control group (NC). The salinomycin-administered group, which served as an anticoccidial control, showed increased weight gain, decreased lesion scores, and decreased oocyst discharge compared to the infected negative control group (PC). The VantiPEARL-administered group, which served as a natural anticoccidial control, also showed increased weight gain, decreased egg discharge, and decreased lesion scores compared to the PC group.

[0152] The p-coumaric acid-administered group showed increased weight gain and decreased lesion scores and oocyst discharge compared to the PC group. As a result of calculating and comparing the anticoccidial composite index, the p-coumaric acid 125 ppm-administered group had a score of 160, which was superior to the positive control group, salinomycin (149 points) and VantiPEAL (147 points).

[0153]

[0154] Example 3. Inhibitory effect of coumaric acid on cell penetration and proliferation of Eimeria parasites.

[0155]

[0156] In this example, the MDBK cell line, a representative animal cell line known to be susceptible to Eimeria infection and proliferation, was used to examine the ability of coumaric acid to inhibit intracellular protozoan penetration and intracellular proliferation.

[0157]

[0158] Example 3-1. Acquisition of protozoa

[0159] A certain amount of oocysts of each Eimeria tenella and Eimeria tenella were placed in a tube containing glass beads and crushed. To remove the crushed oocyst cell walls and other debris, the internal sporocysts were purified using the Percoll density gradient principle and washed with PBS solution. For excystation of the internal protozoa, the sporocysts of Eimeria tenella and Eimeria tenella were treated with a reagent containing sodium taurocholic acid (Sigma Aldrich, USA) and trypsin (Gibco, USA), respectively, and after incubation, washed once with PBS solution to obtain the protozoa.

[0160]

[0161] Example 3-2. Inhibitory effect of coumarin acid treatment on cell penetration and intracellular proliferation of protozoa.

[0162]

[0163] The protozoa of Aemeria tenella and Aemeria acebulina were obtained by the method of Example 3-1 above. 2x10 per well 5 The sporozoites of the dogs were added to the wells on which MDBK cells (purchased from ATCC) were laid as a monolayer, and the cells were treated with each material (p-coumaric acid; sigma, CAS No. 501-98-4, and gallic acid, an anticoccidial agent; sigma, CAS No. 149-91-7, salinomycin; CAS No. sigma, 53003-10-4, diclazuril; sigma, CAS No. 101831-37-2, p-coumaric acid, gallic acid, and salinomycin were treated at 10 ppm, and diclazuril was treated at 1 ppm) and incubated at 40°C for 24 hours. The negative control group is MDBK cells infected with protozoa, and the positive control group means the group incubated with gallic acid, salinomycin, or diclazuril solutions and protozoa together. To remove protozoa that had not invaded the cells, the cells were washed twice with PBS solution. After removing the cells and protozoa inside the cells by pipetting, DNA was extracted from the cells using a DNA extract kit (Intron Biotechnology). Real-time PCR was performed using primers specific for the E. tenella ITS-1 (Internal transcribed spacer-1) gene or the E. acervulina ACE gene. The sequences of the primers used are listed in Table 5 below.

[0164] Primer base sequence (5'->3') Sequence number E. tenella ITS-1 Forward TGGAGGGGATTATGAGAGGA Sequence number 1 Reverse CAAGCAGCATGTAACGGAGA Sequence number 2 E. acervulina ACE Forward GCAGTCCGATGAAAGGTATTTG Sequence number 3 Reverse GAAGCGAAATGTTAGGCCATCT Sequence number 4

[0165] By comparing the Ct values ​​before and after washing for each material and correcting them with the △Ct value of the negative control group, the fold change (2) for each time point compared to the control group was calculated. -△Ct ) was calculated to calculate the cell invasion inhibition rate (invasion inhibition or cell invasion inhibition rate; %) through material treatment, and the results are shown in Tables 6 and 7. Table 6 shows the results for Eimeria tenella, and Table 7 shows the results for Eimeria acebulina.

[0166] sampleInvasion inhibition%Propagation inhibition%NC0.00.0Diclazuril6.352.9Salinomycin56.434.8Gallic acid90.10.0p-coumaric acid54.343.9

[0167] sampleInvasion inhibition%NC0.0Diclazuril42.7Salinomycin59.4Gallic acid60.6p-coumaric acid82.6

[0168] Similar to the method of Example 3-1 above, protozoa of Aemeria tenella were obtained. 2x10 per well 5 The sporozoites of the dog were added to wells containing a monolayer of MDBK cells (purchased from ATCC) and cultured at 40°C for 24 hours. The cells were washed twice with PBS to remove any parasites not attached to the cells. Each material (p-coumaric acid, and the anticoccidial agent gallic acid, salinomycin: 10 ppm, and diclazuril: 1 ppm) was treated to the cells and cultured at 40°C for an additional 24 hours.

[0169] The negative control group is MDBK cells infected with protozoa, and the positive control group is a group incubated with protozoa and salinomycin, gallic acid, or diclazuril solution. After removing cells and protozoa proliferating in cells by pipetting, DNA was extracted from cells using a DNA extract kit (Intron Biotechnology), and PCR was performed using E. tenella ITS-1-specific primers. The primer sequences used are listed in Table 5 above. The Ct values ​​of the material treatment groups were compared with those of the negative control group, and the fold change (2-) at each time point compared with the control group was calculated. △Ct ) was calculated to calculate the rate of inhibition of intracellular protozoan (sporozoite) proliferation through material treatment (Propagation inhibition; %), and the results are shown in Table 6 above.

[0170]

[0171] As shown in Table 6 above, diclazuril was effective in inhibiting intracellular parasite proliferation, and gallic acid was effective only in cell invasion of parasites, whereas coumaric acid inhibited both cell invasion of Eimeria tenella parasites and intracellular parasite propagation, and the degree of inhibition was superior to that of the positive control group. In addition, as shown in Table 7 above, the cell invasion inhibition efficacy against Eimeria acevulina in the coumaric acid-treated group was superior to that of all positive control groups (diclazuril, gallic acid, and salinomycin).

[0172]

[0173] Example 4. Anticoccidial effects of various coumarin acid isomers

[0174] In this example, the direct killing ability of various coumaric acid isomers on protozoa (sporozoites) was evaluated for Eimeria tenella, which is the most common and severely infected protozoan worldwide, and the inhibition ability of various coumaric acid isomers on intracellular protozoan penetration was examined using the representative animal cell line MDBK, which is known to be infected with Eimeria.

[0175]

[0176] Example 4-1. Direct killing effect on Eimeria parasites

[0177] A certain amount of protozoan oocysts were placed in a tube containing glass beads and crushed. To remove the crushed oocyst cell walls and other debris, the internal sporocysts were purified using the Percoll density gradient principle and washed with phosphate-buffered saline (PBS). To excyst the internal sporozoites, Eimeria tenella sporangia were treated with a reagent containing sodium taurocholic acid (Sigma Aldirich, USA) and trypsin (Ginco, USA), respectively, and after incubation, washed once with PBS to obtain the protozoa.

[0178] 0.1% DMSO, m-coumaric acid (sigma, 14755-02-3), caffeic acid (sigma, 331-39-5), and ferulic acid (sigma, 1135-24-6) were reacted with Eimeria tenella parasites at a concentration of 10 ppm each, and only live parasites (sporozoites) were counted through microscopic observation. The mortality rate (%) of parasites was measured for each material treatment compared to the negative control group treated with PBS, and the results are shown in Table 8 below.

[0179]

[0180] sampleDose(ppm)Killed sporozoites %Cell only00.1% DMSO0m-coumaric acid1010.7Caffeic acid100Ferulic acid100

[0181] As shown in Table 8, at the same concentration, m-coumaric acid showed a significantly better direct killing effect on protozoa of the genus Aemeria than caffeic acid and ferulic acid.

[0182]

[0183] Example 4-2. Confirmation of the ability to inhibit intracellular protozoan penetration

[0184] In a similar manner to Example 3-2, 0.1% DMSO, p-coumaric acid (sigma, CAS No. 501-98-4), m-coumaric acid (sigma, 14755-02-3), and o-coumaric acid (sigma, 614-60-8) were each treated at a concentration of 10 ppm, and the cell invasion inhibition rate against the Eimeria tenella protozoa was measured, and the results are shown in Table 9.

[0185] sampleDose(ppm)Invasion inhibition%Cell only00.1% DMSO0p-coumaric acid107.98m-coumaric acid1029.78o-coumaric acid1039.57

[0186] As shown in Table 9, it was confirmed that p-coumaric acid, m-coumaric acid, and o-coumaric acid all exhibited an inhibitory effect on intracellular protozoan penetration of the Eimeria tenella protozoan.

[0187]

[0188] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. A feed composition for preventing or improving coccidiosis, comprising coumaric acid or a salt thereof as an active ingredient.

2. A feed composition according to claim 1, wherein the coccidiosis is induced by a protozoan of the genus Eimeria (Eimeria sp.).

3. A feed composition in paragraph 1, wherein the coumaric acid is at least one selected from the group consisting of p-coumaric acid, m-coumaric acid, and o-coumaric acid.

4. In paragraph 1, the feed composition for preventing or improving coccidiosis is at least one selected from the group consisting of (1) to (4): (1) A decrease in at least one selected from the group consisting of lesion score, fecal oocyst discharge, and mortality rate; (2) Inhibition of weight loss caused by coccidiosis; (3) Increase in the anticoccidial index (ACI); and (4) Reduction of cell penetration by protozoa of the genus Aemeria, intracellular proliferation of said protozoa, or both.

5. In the first paragraph, the feed composition is a feed containing the effective ingredient at a concentration of 1% (w / w) or less based on the total weight.

6. A feed composition according to any one of claims 1 to 4, wherein the feed composition is a feed additive.

7. A pharmaceutical composition for preventing or treating coccidiosis, comprising coumaric acid or a pharmaceutically acceptable salt thereof as an active ingredient.

8. An antigen composition for protozoa of the genus Aemeria, comprising coumaric acid or a salt thereof as an active ingredient.

9. A method for preventing, improving, or treating coccidiosis, comprising administering to an animal other than a human a composition selected from the group consisting of a feed composition according to any one of claims 1 to 5, a pharmaceutical composition according to claim 7, and an antigen-protozoal composition according to claim 8.

Images