RECOMBINANT BACTERIAL STRAIN WITH GENE BBD29_11265 MODIFIED TO PRODUCE L-GLUTAMIC ACID AND METHOD FOR PRODUCING THIS ACID

Abstract

The invention relates to a recombinant bacterial strain with the gene BBD29_11265 modified to produce L-glutamic acid, and a method for constructing the recombinant microorganism and a method for producing L-glutamic acid. The recombinant bacterial strain is a bacterium that produces L-glutamic acid, and has an improved expression of the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 or its homologous sequence; the improved expression may be a point mutation in the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 or its homologous sequence, and an increased expression of this polynucleotide.Genetically engineered bacteria in which the base at position 70 in the BBD29_112665 ​​gene sequence is mutated from guanine to adenine, causing the alanine at position 24 in the corresponding encoded amino acid sequence to be replaced by threonine, and bacteria designed to overexpress the BBD29_112665 ​​gene or the BBD29_11265G70A gene are constituted according to the invention to facilitate increased yield and conversion rate of L-glutamic acid.

Description

A recombinant strain with modified gene BBD29_11265 producing L-glutamic acid, and its construction method and application Technical Field

[0001] The present invention belongs to the field of genetic engineering and microbial technology, and particularly relates to a recombinant strain producing L-glutamic acid, a construction method and an application thereof. Background Art

[0002] L-glutamic acid is an important amino acid used in food, clinical medicine, and other applications. Traditionally, L-glutamic acid is produced primarily through fermentation using L-glutamic acid-producing bacteria or their mutants belonging to genera such as Brevibacterium, Corynebacterium, or Microbacterium.

[0003] L-glutamate is biosynthesized from α-ketoglutarate, an intermediate in the citric acid cycle, within microbial cells. There are two biosynthetic pathways for the formation of L-glutamate from α-ketoglutarate through the assimilation of ammonium ions. One pathway involves the synthesis of L-glutamate catalyzed by glutamate dehydrogenase (GDH) in the presence of high ammonium ion concentrations. The other pathway (the GS / GOGAT pathway) involves the synthesis of L-glutamate by glutamine synthetase and glutamine-ketoglutarate aminotransferase. Glutamine synthetase (GS) catalyzes the reaction in which L-glutamate and ammonium ions are converted into glutamine. Glutamine-oxoglutaric acid amino transferase (GOGAT), also known as "glutamate synthase," catalyzes the L-glutamate synthesis reaction, in which two molecules of L-glutamate are synthesized from one molecule of glutamine synthesized by GS and one molecule of α-ketoglutarate.

[0004] Improvements to the fermentation process for producing L-amino acids may relate to the fermentation technology, such as stirring and oxygen supply; or to the composition of the nutrient medium, such as the sugar concentration during fermentation; or to processing the fermentation broth into a suitable product form, such as by drying and granulating the fermentation broth or ion exchange chromatography; or may relate to the inherent performance properties of the relevant microorganisms themselves.

[0005] Methods for improving the performance properties of these microorganisms include mutagenesis, selection of mutants and screening. The strains obtained in this way are resistant to antimetabolites or are auxotrophic for metabolites of regulatory importance and produce L-amino acids, etc.

[0006] Although there are a number of methods for increasing the production capacity of L-glutamic acid, there is still a need to develop methods for producing L-glutamic acid in order to meet the increasing demand.

[0007] Invention Disclosure

[0008] The object of the present invention is to develop a new technology for improving the L-glutamic acid-producing ability of bacteria, thereby providing a method for efficiently producing L-glutamic acid.

[0009] To achieve the above objectives, the inventors of the present invention have discovered through research that the bacterial gene BBD29_11265 or its homologous genes can be modified or their expression improved to improve the bacterial L-glutamic acid production capacity. Based on these findings, the present invention was completed.

[0010] The present invention provides a bacterium that produces L-glutamic acid, wherein the expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 (SEQ ID NO: 3 in the sequence listing) or a homologous sequence thereof is improved. The present invention also provides a method for producing L-glutamic acid by using the microorganism.

[0011] A first aspect of the present invention provides an L-glutamic acid-producing bacterium having improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof. According to the present invention, the improved expression is enhanced expression of the polynucleotide, or a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof has a point mutation, or a polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 or a homologous sequence thereof has a point mutation and expression is enhanced.

[0012] The amino acid sequence of SEQ ID NO: 3 or its homologous sequence is a protein encoded by gene BBD29_11265 or its homologous gene.

[0013] The bacteria have enhanced L-glutamic acid-producing ability compared to unmodified strains.

[0014] In the present invention, the term "bacteria having L-glutamic acid-producing ability" refers to bacteria that have the ability to produce and accumulate the desired L-glutamic acid in a culture medium and / or in bacterial cells to such an extent that L-glutamic acid can be collected when the bacteria are cultured in a culture medium. Bacteria having L-glutamic acid-producing ability can be bacteria that can accumulate the desired L-glutamic acid in a culture medium and / or in bacterial cells in an amount greater than that obtainable by unmodified strains.

[0015] The term "unmodified strain" refers to a control strain that has not been modified in a manner such that it has specific characteristics. That is, examples of unmodified strains include wild-type strains and parent strains.

[0016] The bacteria having L-glutamic acid-producing ability may be bacteria capable of accumulating the target L-glutamic acid in a culture medium in an amount of preferably 0.5 g / L or more, more preferably 1.0 g / L or more.

[0017] In the present invention, unless otherwise specified, the term "L-glutamic acid" refers to free form of L-glutamic acid, a salt thereof, or a mixture thereof.

[0018] The polynucleotide can encode an amino acid sequence having about 90% or more, about 92% or more, about 95% or more, about 97% or more, about 98% or more, or about 99% or more sequence identity to the amino acid sequence of SEQ ID NO: 3. As used herein, the term "homology" refers to the percent identity between two polynucleotide or two polypeptide modules. The sequence homology between one module and another module can be determined using methods known in the art. For example, such sequence homology can be determined by the BLAST algorithm.

[0019] Expression of a polynucleotide can be enhanced by replacing or mutating expression regulatory sequences, introducing mutations into the polynucleotide sequence, increasing the copy number of the polynucleotide by chromosomal insertion or vector introduction, or a combination thereof.

[0020] The expression regulatory sequence of the polynucleotide can be modified. The expression regulatory sequence controls the expression of the polynucleotide operably linked thereto and can, for example, include a promoter, a terminator, an enhancer, a silencer, etc. The polynucleotide can have a variation of the start codon. The polynucleotide can be incorporated into a specific site on the chromosome to increase the copy number. In this article, the specific site can include, for example, a transposon site or an intergenic site. In addition, the polynucleotide can be incorporated into an expression vector, which is then introduced into a host cell to increase the copy number.

[0021] In one embodiment of the present invention, the copy number is increased by incorporating a polynucleotide or a polynucleotide having a point mutation into a specific site of the chromosome of a microorganism.

[0022] In one embodiment of the present invention, the nucleic acid sequence is overexpressed by incorporating a polynucleotide carrying a promoter sequence or a polynucleotide carrying a promoter sequence with a point mutation into a specific site of the chromosome of the microorganism.

[0023] In one embodiment of the present invention, the polynucleotide or the polynucleotide having a point mutation is incorporated into an expression vector, and the expression vector is introduced into a host cell, thereby increasing the copy number.

[0024] In one embodiment of the present invention, a polynucleotide carrying a promoter sequence or a polynucleotide carrying a promoter sequence with a point mutation is incorporated into an expression vector, and the expression vector is introduced into a host cell, thereby overexpressing the amino acid sequence.

[0025] In a specific embodiment of the present invention, the polynucleotide may comprise the nucleotide sequence of SEQ ID NO: 1.

[0026] In one embodiment of the present invention, the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 has a point mutation, such that alanine at position 24 of the amino acid sequence of SEQ ID NO: 3 is replaced by a different amino acid.

[0027] According to the present invention, it is preferred that the alanine at position 24 is substituted by threonine.

[0028] According to the present invention, the amino acid sequence shown in SEQ ID NO: 3, wherein the 24th alanine is replaced by threonine, is shown in SEQ ID NO: 4.

[0029] In one embodiment of the present invention, the polynucleotide sequence having a point mutation is formed by a mutation at base 70 of the polynucleotide sequence shown in SEQ ID NO: 1.

[0030] According to the present invention, the mutation includes a mutation of the 70th base of the polynucleotide sequence shown in SEQ ID NO: 1 from guanine (G) to adenine (A).

[0031] In one embodiment of the present invention, the polynucleotide sequence having a point mutation includes the polynucleotide sequence shown in SEQ ID NO:2.

[0032] As used in this article, term " operably connected " refers to the functional connection between regulating sequence and the polynucleotide sequence, regulates transcription and / or translation of sequence control polynucleotide sequence thus.Regulating sequence can be the strong promoter that can improve the expression level of polynucleotide.Regulating sequence can be the promotor that is derived from the microorganism that belongs to Corynebacterium or can be the promotor that is derived from other microorganisms.For example, promotor can be trc promotor, gap promotor, tac promotor, T7 promotor, lac promotor, trp promotor, araBAD promotor or cj7 promotor.

[0033] In a specific embodiment of the present invention, the promoter is the promoter of the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 (BBD29_11265 gene).

[0034] As used herein, the term "vector" refers to a polynucleotide construct containing the regulatory sequence and gene sequence of a gene and configured to express a target gene in a suitable host cell. Alternatively, a vector may refer to a polynucleotide construct containing a sequence that can be used for homologous recombination, so that due to the vector introduced into the host cell, the regulatory sequence of the endogenous gene in the genome of the host cell can be changed, or the target gene that can be expressed can be inserted into the specific site of the host's genome. In this regard, the vector used in the present invention may further include a selection marker to determine the introduction of the vector into the host cell or the insertion of the vector into the chromosome of the host cell. The selection marker may include markers that confer selectable phenotypes, such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface proteins. In an environment treated with such selection agents, since only cells expressing the selection marker can survive or show different phenotypic traits, transformed cells can be selected. Vectors described herein are well known to those skilled in the art, and include but are not limited to: plasmids, phages (such as lambda phages or M13 filamentous phages, etc.), clays (i.e., cosmids), or viral vectors.

[0035] In some specific embodiments of the present invention, the vector used is pK18mobsacB plasmid or pXMJ19 plasmid.

[0036] As used herein, the term "transformation" refers to the introduction of a polynucleotide into a host cell, whereby the polynucleotide can replicate as an extragenomic element or by being inserted into the host cell's genome. Methods for transforming the vectors used in the present invention may include methods for introducing nucleic acids into cells. Additionally, as disclosed in the related art, electric pulse methods may be employed depending on the host cell.

[0037] Herein, the microorganism may be yeast, bacteria, algae or fungi.

[0038] According to the present invention, the bacterium can be a microorganism belonging to the genus Corynebacterium, such as Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium callunae, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium ammoniagenes, Corynebacterium pekinense, Brevibacterium saccharolyticum, Brevibacterium roseum, Brevibacterium thiogenitalis, etc.

[0039] In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is Corynebacterium glutamicum ATCC 13869.

[0040] In one embodiment of the present invention, the microorganism belonging to the genus Corynebacterium is Corynebacterium glutamicum YPGLU001, which is highly glutamic acid-producing. The deposit information is as follows: Species Name: Corynebacterium glutamicum; Latin Name: Corynebacterium glutamicum; Strain Number: YPGLU001; Depository: General Microbiology Center, China Culture Collection Administration; Depository Abbreviation: CGMCC; Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; Deposit Date: November 23, 2020; Depository Registration Number: CGMCC No. 21220.

[0041] According to the present invention, the bacterium may also have other improvements related to increasing L-glutamic acid production, for example, the activity of enzymes such as glutamate dehydrogenase, glutamine synthetase, glutamine-ketoglutarate aminotransferase, or the enhanced or reduced expression of genes, or the genes may be replaced by foreign genes.

[0042] The second aspect of the present invention provides a polynucleotide sequence, an amino acid sequence encoded by the polynucleotide sequence, a recombinant vector containing the polynucleotide sequence, and a recombinant strain containing the polynucleotide sequence.

[0043] According to the present invention, the polynucleotide sequence includes a polynucleotide encoding a polypeptide containing the amino acid sequence shown in SEQ ID NO: 3, wherein the 24th alanine in the sequence is replaced by a different amino acid.

[0044] According to the present invention, it is preferred that the alanine at position 24 is substituted by threonine.

[0045] According to the present invention, the amino acid sequence shown in SEQ ID NO: 3, wherein the 24th alanine is replaced by threonine, is shown in SEQ ID NO: 4.

[0046] According to the present invention, preferably, the polynucleotide sequence encoding the polypeptide comprising the amino acid sequence shown in SEQ ID NO: 3 comprises the polynucleotide sequence shown in SEQ ID NO: 1.

[0047] In one embodiment of the present invention, the polynucleotide sequence is formed by a mutation at base 70 of the polynucleotide sequence shown in SEQ ID NO: 1.

[0048] According to the present invention, the mutation refers to a change in the base / nucleotide at the site, and the mutation method can be selected from at least one of mutagenesis, PCR site-directed mutagenesis, and / or homologous recombination. In the present invention, PCR site-directed mutagenesis and / or homologous recombination are preferably used.

[0049] According to the present invention, the mutation includes the mutation of guanine (G) at position 70 of the polynucleotide sequence shown in SEQ ID NO: 1 to adenine (A).

[0050] In one embodiment of the present invention, the polynucleotide sequence includes the polynucleotide sequence shown in SEQ ID NO: 2.

[0051] According to the present invention, the amino acid sequence includes the amino acid sequence shown in SEQ ID NO:4.

[0052] According to the present invention, the recombinant vector is constructed by introducing the polynucleotide sequence into a plasmid.

[0053] In one embodiment of the present invention, the plasmid is pK18mobsacB plasmid.

[0054] In another embodiment of the present invention, the plasmid is pXMJ19 plasmid.

[0055] Specifically, the polynucleotide sequence and the plasmid can be constructed into a recombinant vector through the NEBuider recombination system.

[0056] According to the present invention, the recombinant strain contains the polynucleotide sequence.

[0057] As one embodiment of the present invention, the starting bacteria of the recombinant strain is Corynebacterium glutamicum CGMCC No.21220.

[0058] As an embodiment of the present invention, the starting strain of the recombinant strain is ATCC 13869.

[0059] The third aspect of the present invention also provides a method for constructing a recombinant strain that produces L-glutamic acid.

[0060] According to the present invention, the construction method comprises the following steps:

[0061] The polynucleotide sequence of the wild-type BBD29_11265 gene shown in SEQ ID NO: 1 in the host strain was modified to mutate the 70th base, thereby obtaining a recombinant strain comprising a mutant BBD29_11265 encoding gene.

[0062] According to the construction method of the present invention, the transformation includes at least one of mutagenesis, PCR site-directed mutagenesis, and / or homologous recombination.

[0063] According to the construction method of the present invention, the mutation refers to the mutation of the 70th base in SEQ ID NO: 1 from guanine (G) to adenine (A); specifically, the polynucleotide sequence comprising the mutant BBD29_11265 encoding gene is shown in SEQ ID NO: 2.

[0064] Furthermore, the construction method comprises the following steps:

[0065] (1) modifying the nucleotide sequence of the wild-type BBD29_11265 gene as shown in SEQ ID NO: 1 to mutate the 70th base to obtain a mutated BBD29_11265 gene polynucleotide sequence;

[0066] (2) connecting the mutated polynucleotide sequence to a plasmid to construct a recombinant vector;

[0067] (3) Introducing the recombinant vector into a host strain to obtain the recombinant strain containing the mutant BBD29_11265 encoding gene.

[0068] According to the construction method of the present invention, the step (1) comprises: constructing a point-mutated BBD29_11265 gene: synthesizing two pairs of primers P1 and P2 and P3 and P4 for amplifying BBD29_11265 gene fragments based on the genome sequence of the unmodified strain, introducing a point mutation into the wild-type BBD29_11265 gene SEQ ID NO: 1 by PCR site-directed mutagenesis, and obtaining a point-mutated BBD29_11265 gene nucleotide sequence SEQ ID NO: 2, recorded as BBD29_11265 G70A .

[0069] In one embodiment of the present invention, the genome of the unmodified strain may be derived from the ATCC13869 strain, and its genome sequence may be obtained from the NCBI website.

[0070] In one embodiment of the present invention, in step (1), the primer is:

[0071] P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGGTGCCAGACACTGTCAAG3'(SEQ ID NO:5)

[0072] P2:5'ACGATGACAATCGTTGCGATCCCGCCCATG 3'(SEQ ID NO:6)

[0073] P3:5'CATGGGCGGG ATCGCAACGA TTGTCATCGT 3'(SEQ ID NO:7)

[0074] P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CGTCAGCCCC TGACCGTTCT 3'(SEQ ID NO:8)

[0075] In one embodiment of the present invention, the PCR amplification is performed as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 45 s (30 cycles), and over-extension at 72°C for 10 min.

[0076] In one embodiment of the present invention, the overlapping PCR amplification is performed as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 90 s (30 cycles), and over-extension at 72°C for 10 min.

[0077] According to the construction method of the present invention, the step (2) includes the construction of a recombinant plasmid, comprising: separating and purifying the BBD29_11265 G70A and pK18mobsacB plasmids were assembled using the NEBuider recombination system to obtain the recombinant plasmid.

[0078] According to the construction method of the present invention, the step (3) includes the construction of a recombinant strain, transforming the recombinant plasmid into a host strain to obtain a recombinant strain.

[0079] In one embodiment of the present invention, the conversion in step (3) is performed by electrotransformation.

[0080] In one embodiment of the present invention, the host strain is ATCC 13869.

[0081] In one embodiment of the present invention, the host strain is Corynebacterium glutamicum CGMCC No.21220.

[0082] In one embodiment of the present invention, the recombination is achieved by homologous recombination.

[0083] The fourth aspect of the present invention also provides a method for constructing a recombinant strain that produces L-glutamic acid.

[0084] According to the present invention, the construction method comprises the following steps:

[0085] Amplify the upstream and downstream homology arm fragments of BBD29_11265, the BBD29_11265 gene coding region and its promoter region sequence, and introduce BBD29_11265 or BBD29_11265 into the genome of the host strain by homologous recombination G70A Gene, so as to achieve overexpression of BBD29_11265 or BBD29_11265 G70A Gene.

[0086] In one embodiment of the present invention, the primers for amplifying the upstream homology arm fragment are:

[0087] P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GACCCGCTTG CCATACGAAG 3'(SEQ ID NO:11)

[0088] P8:5'CCCAGAACAC GACAAAAGGT ATCTACTCAT CTGAAGAATC 3'(SEQ ID NO:12)

[0089] In one embodiment of the present invention, the primers for amplifying the downstream homology arm fragment are:

[0090] P11:5'ACTGGCCTCCTACGCAATAA TTCGTGGGCA CTCTGGTTTG 3'(SEQ ID NO:15)

[0091] P12:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATAAGAAAC AACCACTTCC 3'(SEQ ID NO:16)

[0092] In one embodiment of the present invention, the primers for amplifying the gene coding region and its promoter region sequence are:

[0093] P9:5'GATTCTTCAG ATGAGTAGAT ACCTTTTGTC GTGTTCTGGG 3'(SEQ ID NO:13)

[0094] P10:5'CAAACCAGAGTGCCCACGAATTATTGCGTAGGAGGCCAGT 3'(SEQ ID NO:14)

[0095] In one embodiment of the present invention, the aforementioned P7 / P12 is used as primers, and the three fragments of the amplified upstream homology arm fragment, downstream homology arm fragment, gene coding region and promoter region sequence fragment are mixed as templates for amplification to obtain the integrated homology arm fragment.

[0096] In one embodiment of the present invention, the PCR system used is: 10×Ex Taq Buffer 5 μL, dNTP Mixture (each 2.5 mM) 4 μL, Mg 2+ (25mM) 4μL, primers (10pM) 2μL each, Ex Taq (5U / μL) 0.25μL, total volume 50μL; PCR amplification was performed as follows: 94℃ pre-denaturation for 5min, 94℃ denaturation for 30s, 52℃ annealing for 30s, 72℃ extension for 120s (30 cycles), 72℃ over-extension for 10min.

[0097] In one embodiment of the present invention, the NEBuider recombination system is used to assemble the shuttle plasmid PK18mobsacB and the integration homology arm fragment to obtain the integration plasmid.

[0098] In one embodiment of the present invention, the integration plasmid is transfected into the host strain, and BBD29_11265 or BBD29_11265 is introduced into the genome of the host strain by homologous recombination. G70A Gene.

[0099] In one embodiment of the present invention, the host strain is Corynebacterium glutamicum CGMCC No.21220.

[0100] In one embodiment of the present invention, the host strain is ATCC 13869.

[0101] In one embodiment of the present invention, the host strain is a strain carrying the polynucleotide sequence shown in SEQ ID NO: 2.

[0102] The fifth aspect of the present invention also provides a method for constructing a recombinant strain for producing L-glutamic acid.

[0103] According to the present invention, the construction method comprises the following steps:

[0104] Amplify the coding region and promoter region of BBD29_11265 gene, or BBD29_11265 G70A Gene coding region and promoter region sequence, construct an overexpression plasmid vector, and transfer the vector into the host strain to achieve overexpression of BBD29_11265 or BBD29_11265 G70A Gene.

[0105] In one embodiment of the present invention, the primers for amplifying the gene coding region and its promoter region sequence are:

[0106] P17:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACCTTTTGTC GTGTTCTGGG 3'(SEQ ID NO:21)

[0107] P18: 5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTTATTGCGTAGGAGGCCAGT 3' (SEQ ID NO: 22).

[0108] In one embodiment of the present invention, the PCR system includes 10×Ex Taq Buffer 5 μL, dNTP Mixture (2.5 mM each) 4 μL, Mg 2+ (25mM) 4μL, primers (10pM) 2μL each, Ex Taq (5U / μL) 0.25μL, total volume 50μL; the PCR amplification was performed as follows: 94°C pre-denaturation for 5min, 94°C denaturation for 30s, 52°C annealing for 30s, 72°C extension for 45s (30 cycles), 72°C overextension for 10min.

[0109] In one embodiment of the present invention, the shuttle plasmid pXMJ19 and BBD29_11265 or BBD29_11265 with its own promoter are recombined using the NEBuider recombination system. G70A The fragments were assembled to obtain the overexpression plasmid.

[0110] In one embodiment of the present invention, the host strain is Corynebacterium glutamicum CGMCC No.21220.

[0111] In one embodiment of the present invention, the host strain is ATCC 13869.

[0112] In one embodiment of the present invention, the host strain is a strain carrying the polynucleotide sequence shown in SEQ ID NO: 2.

[0113] The recombinant strain obtained by the present invention can be used alone in the fermentation production of L-glutamic acid, or can be mixed with other L-glutamic acid-producing bacteria for fermentation production of L-glutamic acid.

[0114] Another aspect of the present invention provides a method for producing L-glutamic acid, the method comprising culturing the bacterium; and obtaining L-glutamic acid from the culture.

[0115] The bacteria can be cultured in a suitable culture medium under culture conditions known in the art. The culture medium may contain: a carbon source, a nitrogen source, trace elements, and combinations thereof. During the culture, the pH of the culture may be adjusted. In addition, the culture may include preventing the generation of bubbles, for example, by using a defoaming agent to prevent the generation of bubbles. In addition, the culture may include injecting a gas into the culture. The gas may include any gas that can maintain aerobic conditions for the culture. During the culture, the temperature of the culture may be 20 to 45°C. The generated L-glutamic acid can be recovered from the culture by treating the culture with sulfuric acid or hydrochloric acid, followed by a combination of methods such as anion exchange chromatography, concentration, crystallization, and isoelectric precipitation.

[0116] In the present invention:

[0117] SEQ ID NO: 1: BBD29_11265 wild-type ORF sequence

[0118]

[0119] SEQ ID NO: 2: BBD29_11265 G70A ORF sequence

[0120]

[0121]

[0122] SEQ ID NO: 3: Amino acid sequence of wild-type protein encoded by BBD29_11265

[0123]

[0124] SEQ ID NO: 4: Amino acid sequence of BBD29_11265A24T encoded protein

[0125]

[0126] BBD29_11265 A24T That is, BBD29_11265A24T.

[0127] The present invention also provides a protein named protein BBD29_11265 A24T , the protein may be any of the following:

[0128] A1) a protein having an amino acid sequence of SEQ ID No. 4;

[0129] A2) a protein having at least 80% identity with the protein of A1) and having the same function as the protein of A1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence of SEQ ID No. 4;

[0130] A3) A fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

[0131] The present invention also provides a nucleic acid molecule named BBD29_11265 G70A , the nucleic acid molecule BBD29_11265 G70A Can be any of the following:

[0132] B1) Encoding the protein BBD29_11265 A24T nucleic acid molecules;

[0133] B2) the coding sequence is the DNA molecule shown in SEQ ID No. 2;

[0134] B3) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 2.

[0135] The DNA molecule shown in SEQ ID No. 2 is BBD29_11265 of the present invention. G70A Gene.

[0136] The DNA molecule shown in SEQ ID No. 2 (BBD29_11265 G70AGene) encodes the protein BBD29_11265 shown in SEQ ID No.4 A24T .

[0137] The protein BBD29_11265 A24T The threonine (T) at position 24 in the amino acid sequence (SEQ ID No. 4) was mutated from alanine (A).

[0138] The present invention also provides a biomaterial, which may be any of the following:

[0139] C1) contains the nucleic acid molecule BBD29_11265 G70A expression cassette;

[0140] C2) contains the nucleic acid molecule BBD29_11265 G70A or a recombinant vector containing the expression cassette described in C1);

[0141] C3) contains the nucleic acid molecule BBD29_11265 G70A or a recombinant microorganism containing the expression cassette described in C1), or a recombinant microorganism containing the recombinant vector described in C2).

[0142] The present invention also provides any of the following uses of any one of D1) to D8):

[0143] F1) Use of any one of D1) to D8) in regulating the production of L-glutamic acid in a microorganism;

[0144] F2) Use of any one of D1) to D8) in constructing a genetically engineered bacterium that produces L-glutamic acid;

[0145] F3) Use of any one of D1) to D8) in the preparation of L-glutamic acid;

[0146] Wherein, said D1)-D8) are:

[0147] D1) The protein BBD29_11265 A24T ;

[0148] D2) the nucleic acid molecule BBD29_11265 G70A ;

[0149] D3) the biological material;

[0150] D4) a DNA molecule having a nucleotide sequence of SEQ ID No. 1;

[0151] D5) A DNA molecule having more than 90% identity to the DNA molecule shown in SEQ ID No. 1 and having the same function as that of the DNA molecule shown in SEQ ID No. 1 obtained by modification and / or substitution and / or deletion and / or addition of one or more nucleotides of the nucleotide sequence shown in SEQ ID No. 1;

[0152] D6) an expression cassette containing the DNA molecule described in D4) or D5);

[0153] D7) a recombinant vector containing the DNA molecule described in D4) or D5), or a recombinant vector containing the expression cassette described in D6);

[0154] D8) A recombinant microorganism containing the DNA molecule described in D4) or D5), or a recombinant microorganism containing the expression cassette described in D6), or a recombinant microorganism containing the recombinant vector described in D7).

[0155] The DNA molecule shown in SEQ ID No. 1 is the BBD29_11265 gene of the present invention.

[0156] The DNA molecule shown in SEQ ID No. 1 (BBD29_11265 gene) encodes the protein shown in SEQ ID No. 3.

[0157] As used herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. Amino acid sequence identity can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, the identity of a pair of amino acid sequences can be calculated by searching in Advanced BLAST 2.1 using blastp as the program, setting the Expect value to 10, all filters to OFF, BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity value (%) can then be obtained.

[0158] Herein, the greater than 80% identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0159] Herein, the 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0160] The regulation of L-glutamic acid production in a microorganism as described herein may be increasing or decreasing the accumulation of L-glutamic acid in the microorganism (ie, promoting or inhibiting the biosynthesis of L-glutamic acid).

[0161] The present invention also provides a method for increasing the yield of L-glutamic acid in a microorganism, the method comprising any one of the following:

[0162] E1) increasing the nucleic acid molecule BBD29_11265 in the target microorganism G70A The expression level or content of the target microorganism is obtained by obtaining a microorganism having a higher L-glutamic acid production than the target microorganism;

[0163] E2) increasing the expression level or content of the DNA molecule described in D4) or D5) in the target microorganism to obtain a microorganism having a higher L-glutamic acid production than the target microorganism;

[0164] E3) mutating the DNA molecule having the nucleotide sequence of SEQ ID No. 1 in the target microorganism to obtain a microorganism having a higher L-glutamic acid production than that of the target microorganism.

[0165] In the above method, the mutation may be a point mutation, ie, a mutation of a single nucleotide.

[0166] In the above method, the point mutation may be a mutation of the 24th alanine residue in the amino acid sequence encoded by the DNA molecule shown in SEQ ID No. 1 to another amino acid residue.

[0167] In the above method, the point mutation can be to mutate the 24th alanine of the amino acid sequence encoded by the DNA molecule shown in SEQ ID No. 1 to threonine, thereby obtaining a mutant protein BBD29_11265 with an amino acid sequence of SEQ ID No. 4. A24T .

[0168] Mutation refers to the alteration of one or more bases in a gene through site-directed mutagenesis, resulting in a change in the amino acid composition of the corresponding protein, producing a new protein or imparting new functions to the original protein. Site-directed mutagenesis techniques, such as oligonucleotide primer-mediated mutagenesis, PCR-mediated mutagenesis, or cassette mutagenesis, are well known to those skilled in the art.

[0169] The point mutation described herein may be a single base substitution, a single base insertion, or a single base deletion, and specifically may be a single base substitution. The single base substitution may be an allele substitution.

[0170] The point mutation may be nucleic acid modification of the 70th guanine (G) of the BBD29_11265 gene (SEQ ID No. 1).

[0171] Specifically, the point mutation may be to mutate guanine (G) at position 70 of the BBD29_11265 gene (SEQ ID No. 1) to adenine (A), to obtain the DNA molecule shown in SEQ ID No. 2.

[0172] Herein, the recombinant vector may specifically be the recombinant vector pK18-BBD29_11265 G70A , PK18mobsacB-BBD29_11265, PK18mobsacB-BBD29_11265 G70A , pXMJ19-BBD29_11265, or pXMJ19-BBD29_11265 G70A .

[0173] The recombinant vector pK18-BBD29_11265 G70A The recombinant vector is obtained by replacing the fragment (small fragment) between the Xbal I and BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown at positions 37-1495 of SEQ ID No. 29 in the sequence list, while keeping the other sequences of the pK18mobsacB vector unchanged. The recombinant vector pK18-BBD29_11265 G70A Gene BBD29_11265 containing the mutation shown in SEQ ID No. 2 G70A The DNA molecule shown at positions 1-273 of .

[0174] The recombinant vector PK18mobsacB-BBD29_11265 is used to integrate the exogenous gene BBD29_11265 into the host chromosome and overexpress the wild-type BBD29_11265 gene in the production bacteria. The recombinant vector PK18mobsacB-BBD29_11265 is a recombinant vector obtained by replacing the fragment (small fragment) between the Xbal I and / BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown at positions 37-1966 of SEQ ID No.30 in the sequence list, while keeping the other sequences of the pK18mobsacB vector unchanged.

[0175] The recombinant vector PK18mobsacB-BBD29_11265 G70A For the exogenous gene BBD29_11265 G70A Integrates into the host chromosome and overexpresses the mutant gene BBD29_11265 in the production bacteria G70A The recombinant vector PK18mobsacB-BBD29_11265 G70AThe recombinant vector is obtained by replacing the fragment (small fragment) between the Xbal I and BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown in positions 37-1966 of SEQ ID No. 31 in the sequence listing, while keeping the other sequences of the pK18mobsacB vector unchanged.

[0176] The recombinant vector pXMJ19-BBD29_11265 is used to express the exogenous gene BBD29_11265 extrachromosomally through a plasmid, thereby overexpressing the wild-type BBD29_11265 gene in the production bacteria. The recombinant vector pXMJ19-BBD29_11265 is a recombinant vector obtained by replacing the fragment (small fragment) between the EcoR I and Kpn I recognition sites of the pXMJ19 vector with the DNA fragment shown at positions 37-486 of SEQ ID No.32 in the sequence list, while keeping the other sequences of the pXMJ19 vector unchanged.

[0177] The recombinant vector pXMJ19-BBD29_11265 G70A For the exogenous gene BBD29_11265 G70A Overexpression of the mutant gene BBD29_11265 in the production bacteria through extrachromosomal expression via plasmid G70A The recombinant vector pXMJ19-BBD29_11265 G70A The recombinant vector is obtained by replacing the fragment (small fragment) between the EcoR I and Kpn I recognition sites of the pXMJ19 vector with the DNA fragment shown in positions 37-486 of SEQ ID No. 33 in the sequence table, while keeping the other sequences of the pXMJ19 vector unchanged.

[0178] The recombinant vector pK18-BBD29_11265 G70A , PK18mobsacB-BBD29_11265, PK18mobsacB-BBD29_11265 G70A , pXMJ19-BBD29_11265, and pXMJ19-BBD29_11265 G70A All are within the protection scope of the present invention.

[0179] Herein, the recombinant microorganism may specifically be the recombinant bacteria YPG-013, YPG-014, YPG-015, YPG-016 or YPG-017.

[0180] The recombinant bacteria YPG-013 is the recombinant vector pK18-BBD29_11265 G70AThe recombinant bacteria YPG-013 obtained by transformation into Corynebacterium glutamicum CGMCC No. 21220 contains the mutated gene BBD29_11265 shown in SEQ ID No. 2 G70A .

[0181] The recombinant strain YPG-014 contains two copies of the BBD29_11265 gene shown in SEQ ID No. 1. Recombinant strains containing two copies of the BBD29_11265 gene can significantly and stably increase the expression level of the BBD29_11265 gene. Recombinant strain YPG-014 is an engineered strain that overexpresses the wild-type BBD29_11265 gene in its genome.

[0182] The recombinant bacteria YPG-015 contains the mutant BBD29_11265 shown in SEQ ID No.2 G70A Gene; Recombinant strain YPG-015 overexpresses mutant BBD29_11265 on the genome G70A Genetically engineered bacteria.

[0183] The recombinant bacterium YPG-016 contains two copies of the BBD29_11265 gene shown in SEQ ID No. 1; the recombinant bacterium YPG-016 is an engineered bacterium that overexpresses the wild-type BBD29_11265 gene on a plasmid, that is, it is overexpressed outside the chromosome by the plasmid pXMJ19-BBD29_11265.

[0184] The recombinant bacterium YPG-017 contains the mutated BBD29_11265 shown in SEQ ID No. 2 G70A Gene; Recombinant strain YPG-017 overexpresses mutant BBD29_11265 on a plasmid G70A Genetic engineering bacteria, namely plasmid pXMJ19-BBD29_11265 G70A Overexpressed extrachromosomally.

[0185] The recombinant bacteria YPG-013, YPG-014, YPG-015, YPG-016 and YPG-017 are all within the scope of protection of the present invention.

[0186] The present invention also provides a method for constructing the recombinant microorganism, the method comprising at least any one of the following:

[0187] F1) the nucleic acid molecule BBD29_11265 G70A introducing a target microorganism to obtain the recombinant microorganism;

[0188] F2) introducing the DNA molecule represented by SEQ ID No. 1 into the target microorganism to obtain the recombinant microorganism;

[0189] F3) Editing the DNA molecule represented by SEQ ID No. 1 using gene editing techniques (such as single-base gene editing) so that the target microorganism contains the DNA molecule represented by SEQ ID No. 2.

[0190] The introduction can be carried out by transforming the host bacteria with a vector carrying the DNA molecule of the present invention by any known transformation method such as chemical transformation or electroporation. The introduced DNA molecule can be a single copy or multiple copies. The introduction can be carried out by integrating the exogenous gene into the host chromosome or by expressing it extrachromosomally from a plasmid.

[0191] The present invention also provides a method for preparing L-glutamic acid, which comprises producing L-glutamic acid using any of the recombinant microorganisms described herein.

[0192] In the above method, the method can be a fermentation method for preparing L-glutamic acid, and the recombinant microorganism can be Corynebacterium, specifically Corynebacterium glutamicum and its variants.

[0193] Preservation information: Strain name: Corynebacterium glutamicum; Latin name: Corynebacterium glutamicum; strain number: YPGLU001; preservation institution: General Microbiology Center of China Culture Collection Administration; Abbreviation of preservation institution: CGMCC; Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; Preservation date: November 23, 2020; Registration number of the preservation center: CGMCC No.21220.

[0194] Best Mode for Carrying Out the Invention

[0195] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0196] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0197] The basal culture medium used to culture the strains in the following examples has the same composition, to which sucrose, kanamycin or chloramphenicol, etc. as required are added. The basal culture medium composition is shown in Table 1:

[0198] Table 1 Basic culture medium composition

[0199] Ingredients: sucrose 10g / L, polypeptone 10g / L, beef extract 10g / L, yeast powder 5g / L, urea 2g / L, sodium chloride 2.5g / L, agar powder 20g / L, pH 7.0, culture temperature 32 degrees

[0200] Corynebacterium glutamicum YPGLU001 CGMCC No. 21220 in the following examples was deposited on November 23, 2020 at the China Culture Collection Center for General Microorganisms (CGMCC, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing), with a deposit registration number of CGMCC No. 21220. Corynebacterium glutamicum YPGLU001, also known as Corynebacterium glutamicum CGMCC No. 21220.

[0201] Example 1 Construction of the transformation vector pK18-BBD29_11265 containing the point mutation of the BBD29_11265 gene coding region G70A

[0202] Based on the genome sequence of Corynebacterium glutamicum ATCC13869 published by NCBI, two pairs of primers for amplifying the coding region sequence of the BBD29_11265 gene were designed and synthesized. A point mutation was introduced into the strain Corynebacterium glutamicum CGMCC No. 21220 (sequencing confirmed that the BBD29_11265 gene coding region on the chromosome of the strain was consistent with that of ATCC13869) by allelic replacement. The amino acid sequence of the corresponding encoded protein is SEQ ID NO: 3. The guanine (G) at position 70 of the nucleotide sequence of the BBD29_11265 gene was changed to adenine (A) (SEQ ID NO: 2: BBD29_11265). G70A ), the amino acid sequence of the corresponding encoded protein is changed from alanine (A) to threonine (T) (SEQ ID NO: 4: BBD29_11265A24T).

[0203] The point mutation is to mutate the 70th guanine (G) in the nucleotide sequence of the BBD29_11265 gene (SEQ ID No. 1) to an adenine (A), thereby obtaining a DNA molecule shown in SEQ ID No. 2 (the mutated BBD29_11265 gene, named BBD29_11265). G70A ).

[0204] Among them, the DNA molecule shown in SEQ ID No. 1 encodes a protein with an amino acid sequence of SEQ ID No. 3 (the name of the protein is protein BBD29_11265).

[0205] The DNA molecule shown in SEQ ID No. 2 encodes a mutant protein having an amino acid sequence of SEQ ID No. 4 (the mutant protein is named BBD29_11265 A24T ). The mutant protein BBD29_11265 A24T The threonine (T) at position 24 in the amino acid sequence (SEQ ID No. 4) was mutated from alanine (A).

[0206] Overlap PCR was used for site-directed mutagenesis. The primers were designed as follows (synthesized by Shanghai Invitrogen). The bases in bold indicate the mutation positions:

[0207] P1:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAGCGGTGCCAGACACTGTCAAG3'(SEQ ID NO:5)

[0208] P2:5'ACGATGACAATCGTTGCGATCCCGCCCATG 3'(SEQ ID NO:6)

[0209] P3:5'CATGGGCGGG ATCGCAACGA TTGTCATCGT 3'(SEQ ID NO:7)

[0210] P4:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC CGTCAGCCCC TGACCGTTCT 3'(SEQ ID NO:8)

[0211] Construction method: Using Corynebacterium glutamicum ATCC13869 as a template, PCR amplification was performed with primers P1 and P2, and P3 and P4, respectively, to obtain two DNA fragments (BBD29_11265Up and BBD29_11265Down) of the BBD29_11265 gene coding region with mutant bases, each with a size of 775 bp and 788 bp, respectively.

[0212] PCR system: 10×Ex Taq Buffer 5μL, dNTP Mixture (2.5mM each) 4μL, Mg 2+ (25mM) 4μL, primers (10pM) 2μL each, Ex Taq (5U / μL) 0.25μL, total volume 50μL.

[0213] The PCR amplification was performed as follows: pre-denaturation at 94°C for 5 min, 30 cycles of denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 45 s, followed by overextension at 72°C for 10 min, to obtain two DNA fragments (BBD29_11265Up and BBD29_11265Down) of 775 bp and 788 bp, respectively, containing the BBD29_11265 gene coding region.

[0214] After the two DNA fragments (BBD29_11265Up and BBD29_11265Down) were separated and purified by agarose gel electrophoresis, the target band was recovered and then amplified by overlapping PCR using the two DNA fragments as templates and primers P1 and P4 to obtain a 1533 bp fragment named BBD29_11265Up-Down (sequence shown in SEQ ID No. 29). In the DNA fragment shown in SEQ ID No. 29, positions 693-965 are the BBD29_11265 fragment containing the mutation site. G70A Gene fragment (i.e., positions 1-273 of SEQ ID No. 2).

[0215] Overlap PCR system: 10×Ex Taq Buffer 5μL, dNTP Mixture (2.5mM each) 4μL, Mg 2+ (25mM) 4μL, primers (10pM) 2μL each, Ex Taq (5U / μL) 0.25μL, total volume 50μL.

[0216] The overlapping PCR amplification was performed as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 90 s, 30 cycles, and over-extension at 72°C for 10 min.

[0217] This DNA fragment BBD29_11265Up-Down (SEQ ID No.29) contains a mutation site, for introducing nucleic acid modification at the 70th position of the BBD29_11265 gene coding region in Corynebacterium glutamicum CGMCC No.21220, specifically for changing the 70th guanine (G) of the BBD29_11265 gene coding region in the strain Corynebacterium glutamicum CGMCC No.21220 to an adenine (A), ultimately causing the 24th amino acid of the encoded protein to be changed from alanine (A) to threonine (T). After pK18mobsacB plasmid (purchased from Addgene company) was digested with Xba I / BamH I, BBD29_11265 was separated and purified by agarose gel electrophoresis. G70A and linearized pK18mobsacB plasmid, and then assembled by NEBuider recombination system to obtain vector pK18-BBD29_11265 G70A The plasmid contains a kanamycin resistance marker. G70A The vector pK18-BBD29_11265 containing the correct point mutation (GA) was sent to a sequencing company for sequencing identification. G70A Save for later use.

[0218] Specifically, the DNA fragment (BBD29_11265Up-Down) was separated by agarose gel electrophoresis and purified, and then ligated with the pK18mobsacB plasmid (purchased from Addgene, digested with Xbal I / BamH I) and purified by enzyme digestion (Xbal I / BamH I) using NEBuilder enzyme (purchased from NEB) at 50°C for 30 minutes. The ligation product was transformed into DH5a (purchased from TAKARA) and the resulting monoclonal clone was identified by PCR to obtain the positive recombinant vector pK18-BBD29_11265. G70A The recombinant vector contains kanamycin resistance (Kan r ) marker. The recombinant vector pK18-BBD29_11265 was cut correctly G70A The recombinant vector pK18-BBD29_11265 containing the correct point mutation (GA) was sent to a sequencing company for sequencing identification. G70A Save for later use.

[0219] The recombinant vector pK18-BBD29_11265 G70AThe recombinant vector is obtained by replacing the fragment (small fragment) between the Xbal I and BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown in positions 37-1495 of SEQ ID No. 29 in the sequence listing, while keeping the other sequences of the pK18mobsacB vector unchanged.

[0220] The recombinant vector pK18-BBD29_11265 G70A Gene BBD29_11265 containing the mutation shown in SEQ ID No. 2 G70A The DNA molecule shown at positions 1-273 of .

[0221] Example 2 Construction of BBD29_11265 containing point mutations G70A Engineered strains

[0222] Construction method: The allelic replacement plasmid pK18-BBD29_11265 in Example 1 was G70A The strains were transformed into Corynebacterium glutamicum CGMCC No. 21220 by electroporation and cultured in a culture medium. The culture medium components and culture conditions are shown in Table 1. Single colonies produced by the culture were identified using primers P1 and universal primer M13R, respectively. Strains that amplified a band of approximately 1560 bp were considered positive. The positive strains were cultured on a culture medium containing 15% sucrose. Single colonies produced by the culture were cultured on cultures containing kanamycin and on cultures that did not contain kanamycin. The strains that grew on the culture medium that did not contain kanamycin were selected for PCR identification using the following primers (synthesized by Shanghai Invitrogen Co., Ltd.):

[0223] P5:5'TTTTCTGACT GCTCTGAACC 3'(SEQ ID NO:9)

[0224] P6:5'GACCGTTAAC CACGCTAGAC 3'(SEQ ID NO:10)

[0225] The PCR amplification products were denatured at high temperature and then ice-bathed before SSCP electrophoresis (using plasmid pK18-BBD29_11265 G70AThe amplified fragment served as a positive control, the ATCC13869 amplified fragment served as a negative control, and water served as a blank control. See Table 2 for the PAGE preparation and electrophoresis conditions for SSCP electrophoresis. Due to different fragment structures and electrophoretic positions, strains with fragments that were inconsistent with the negative control fragment but consistent with the positive control fragment were considered to have successfully undergone allelic substitution. The target fragments of strains with successful allelic substitution were amplified again by PCR using primers P5 and P6. These fragments were then ligated into the pMD19-T vector for sequencing. Sequence alignment confirmed that the strain with the mutated base sequence had successfully undergone allelic substitution and was designated YPG-013.

[0226] The recombinant strain YPG-013 contains the mutated gene BBD29_11265 shown in SEQ ID No. 2 G70A .

[0227] Table 2 Preparation and conditions of SSCP electrophoresis PAGE

[0228]

[0229] Example 3 Construction of genome-wide overexpression of BBD29_11265 or BBD29_11265 G70A Genetically engineered strains

[0230] To further study and verify the overexpression of wild-type BBD29_11265 gene or its mutant gene BBD29_11265 in the production bacteria G70A The production of L-glutamic acid can be increased by integrating the exogenous gene into the host chromosome to construct a genome-wide overexpression of the BBD29_11265 gene or BBD29_11265 G70A Genetically engineered strains.

[0231] Based on the genome sequence of Corynebacterium glutamicum ATCC13869 published by NCBI, three pairs of primers were designed and synthesized to amplify upstream and downstream homology arm fragments and the coding region and promoter region sequences of the BBD29_11265 gene. BBD29_11265 or BBD29_11265 was introduced into the strain Corynebacterium glutamicum CGMCC No. 21220 by homologous recombination. G70A Gene.

[0232] The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0233] P7:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GACCCGCTTG CCATACGAAG 3'(SEQ ID NO:11)

[0234] P8:5'CCCAGAACAC GACAAAAGGT ATCTACTCAT CTGAAGAATC 3'(SEQ ID NO:12)

[0235] P9:5'GATTCTTCAG ATGAGTAGAT ACCTTTTGTC GTGTTCTGGG 3'(SEQ ID NO:13)

[0236] P10:5'CAAACCAGAGTGCCCACGAATTATTGCGTAGGAGGCCAGT 3'(SEQ ID NO:14)

[0237] P11:5'ACTGGCCTCCTACGCAATAA TTCGTGGGCA CTCTGGTTTG 3'(SEQ ID NO:15)

[0238] P12:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCATAAGAAAC AACCACTTCC 3'(SEQ ID NO:16)

[0239] Construction method: Corynebacterium glutamicum ATCC13869 or YPG-013 were used as templates, and primers P7 / P8, P9 / P10, and P11 / P12 were used to perform PCR amplification to obtain an upstream homology arm fragment of about 806 bp, a BBD29_11265 gene coding region and promoter region fragment of 490 bp or BBD29_11265. G70A The gene coding region and promoter region fragments are approximately 490 bp, and the downstream homology arm fragment is approximately 788 bp. Using P7 / P12 as primers, the three amplified fragments were mixed as templates for amplification to obtain integrated homology arm fragments 1 and 2 (integrated homology arm fragment 1 is 2004 bp in size, and the sequence is shown in SEQ ID No. 30; integrated homology arm fragment 2 is 2004 bp in size, and the sequence is shown in SEQ ID No. 31). After the PCR reaction, the amplified products were recovered by electrophoresis, and the required DNA fragment of approximately 2004 bp was recovered using a column DNA gel recovery kit (TIANGEN). The NEBuider recombination system was used to connect the shuttle plasmid PK18mobsacB recovered by Xba I digestion to obtain the integrated plasmid (i.e., recombinant vector) PK18mobsacB-BBD29_11265 or PK18mobsacB-BBD29_11265. G70A The plasmid contains a kanamycin resistance marker, and recombinants with the plasmid integrated into the genome can be obtained through kanamycin screening.

[0240] The recombinant vector PK18mobsacB-BBD29_11265 is obtained by replacing the fragment (small fragment) between the Xbal I and / BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown in positions 37-1966 of SEQ ID No. 30 in the sequence list, while keeping the other sequences of the pK18mobsacB vector unchanged.

[0241] The recombinant vector PK18mobsacB-BBD29_11265 G70A The recombinant vector is obtained by replacing the fragment (small fragment) between the Xbal I and BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown in positions 37-1966 of SEQ ID No. 31 in the sequence listing, while keeping the other sequences of the pK18mobsacB vector unchanged.

[0242] PCR system: 10×Ex Taq Buffer 5μL, dNTP Mixture (2.5mM each) 4μL, Mg 2+ (25mM) 4μL, primers (10pM) 2μL each, Ex Taq (5U / μL) 0.25μL, total volume 50μL.

[0243] The PCR amplification was performed as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 120 s (30 cycles), and over-extension at 72°C for 10 min.

[0244] The two integration plasmids (PK18mobsacB-BBD29_11265 and PK18mobsacB-BBD29_11265 G70A ) were electroporated into the Corynebacterium glutamicum CGMCC No. 21220 strain. Single colonies resulting from the culture were identified by PCR using primers P13 / P14. Strains that amplified a fragment of approximately 1190 bp were identified as positive strains, while those that failed to amplify a fragment were identified as parent strains. Positive strains were screened with 15% sucrose and cultured on media containing and without kanamycin. Strains that grew on media without kanamycin but did not grow on media containing kanamycin were further identified by PCR using primers P15 / P16. Strains that amplified a fragment of approximately 1200 bp were identified as BBD29_11265 or BBD29_11265. G70A The strains in which the gene was integrated into the genome of Corynebacterium glutamicum CGMCC No. 21220 were named YPG-014 (without the mutation point) and YPG-015 (with the mutation point).

[0245] Recombinant strain YPG-014 contains two copies of the BBD29_11265 gene (SEQ ID No. 1). Recombinant strains containing two copies of the BBD29_11265 gene can significantly and stably increase the expression of the BBD29_11265 gene. Recombinant strain YPG-014 is engineered to overexpress the wild-type BBD29_11265 gene in its genome.

[0246] The recombinant strain YPG-015 contains the mutant BBD29_11265 shown in SEQ ID No.2 G70A Gene; Recombinant strain YPG-015 overexpresses mutant BBD29_11265 on the genome G70A Genetically engineered bacteria.

[0247] PCR identification primers are as follows:

[0248] P13:5'GTCCAAGGTG ACGGCCGCAC 3'(SEQ ID NO:17)

[0249] P14:5'TGCGATCTCTGTCAATGCAG 3'(SEQ ID NO:18)

[0250] P15:5'CTGGGATAGTTTCAAGCCTT 3'(SEQ ID NO:19)

[0251] P16:5'ATATTCGGCCCAGCAGCAGC 3'(SEQ ID NO:20)

[0252] Example 4 Construction of plasmids to overexpress BBD29_11265 or BBD29_11265 G70A Genetically engineered strains

[0253] Based on the genome sequence of Corynebacterium glutamicum ATCC13869 published by NCBI, a pair of primers for amplifying the coding region and promoter region of the BBD29_11265 gene were designed and synthesized. The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0254] P17:5'GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCACCTTTTGTC GTGTTCTGGG 3'(SEQ ID NO:21)

[0255] P18:5'ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAACTTATTGCGTAGGAGGCCAGT 3'(SEQ ID NO:22)

[0256] Construction method: YPG-0014 or YPG-0013 were used as templates, primers P17 / P18 were used for PCR amplification, and the BBD29_11265 gene and its promoter fragment 520 bp (SEQ ID No. 32) or BBD29_11265 were obtained. G70A The gene and its promoter fragment of 520 bp (SEQ ID No. 33) were amplified, and the amplified product was recovered by electrophoresis. The required 520 bp DNA fragment was recovered using a column DNA gel recovery kit and ligated with the shuttle plasmid pXMJ19 recovered by EcoR I digestion using the NEBuider recombination system to obtain the overexpression plasmid (i.e., recombinant vector) pXMJ19-BBD29_11265 or pXMJ19-BBD29_11265 G70A The plasmid contains a chloramphenicol resistance marker, which can be obtained through chloramphenicol screening and transformed into the strain.

[0257] The recombinant vector pXMJ19-BBD29_11265 is obtained by replacing the fragment (small fragment) between the EcoR I and Kpn I recognition sites of the pXMJ19 vector with the DNA fragment shown in positions 37-486 of SEQ ID No. 32 in the sequence table, while keeping the other sequences of the pXMJ19 vector unchanged.

[0258] The recombinant vector pXMJ19-BBD29_11265 G70A The recombinant vector is obtained by replacing the fragment (small fragment) between the EcoR I and Kpn I recognition sites of the pXMJ19 vector with the DNA fragment shown in positions 37-486 of SEQ ID No. 33 in the sequence table, while keeping the other sequences of the pXMJ19 vector unchanged.

[0259] PCR system: 10×Ex Taq Buffer 5μL, dNTP Mixture (2.5mM each) 4μL, Mg 2+ (25mM) 4μL, primers (10pM) 2μL each, Ex Taq (5U / μL) 0.25μL, total volume 50μL.

[0260] The PCR amplification was performed as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 52°C for 30 s, extension at 72°C for 45 s (30 cycles), and over-extension at 72°C for 10 min.

[0261] The two plasmids (pXMJ19-BBD29_11265 and pXMJ19-BBD29_11265 G70A ) were electroporated into the Corynebacterium glutamicum CGMCC No. 21220, and the single colonies produced by culture were identified by PCR using primers M13R(-48) and P18. The transformed strains containing a fragment of approximately 569 bp amplified by PCR were designated as YPG-016 (without the point mutation) and YPG-017 (with the point mutation).

[0262] The recombinant bacterium YPG-016 contains two copies of the BBD29_11265 gene shown in SEQ ID No. 1; the recombinant bacterium YPG-016 is an engineered bacterium that overexpresses the wild-type BBD29_11265 gene on a plasmid, that is, the gene is overexpressed outside the chromosome by the plasmid pXMJ19-BBD29_11265.

[0263] The recombinant strain YPG-017 contains the mutant BBD29_11265 shown in SEQ ID No.2 G70A Gene; Recombinant strain YPG-017 overexpresses mutant BBD29_11265 on a plasmid G70A Genetic engineering bacteria, namely plasmid pXMJ19-BBD29_11265 G70A Overexpressed extrachromosomally.

[0264] Example 5 Construction of an engineered strain with a BBD29_11265 gene deleted from the genome

[0265] Based on the genome sequence of Corynebacterium glutamicum ATCC13869 published by NCBI, two pairs of primers were synthesized to amplify the fragments at both ends of the BBD29_11265 gene coding region as upstream and downstream homology arm fragments. The primers were designed as follows (Shanghai Yingjun Company synthesis):

[0266] P19:5'CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GATTTCGCCA CGCCATCTAC 3'(SEQ ID NO:23)

[0267] P20:5'AGCCCCTTTTAGATGGGGTGGTTTTCTCCTTAAATAACGG 3'(SEQ ID NO:24)

[0268] P21:5'CCGTTATTTAAGGAGAAAACCACCCCATCTAAAAGGGGCT 3'(SEQ ID NO:25)

[0269] P22:5'CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCCGAGGGTGAG CCGGTGCAT 3'(SEQ ID NO:26)

[0270] Construction method: Using Corynebacterium glutamicum ATCC13869 as a template, PCR amplification was performed with primers P19 / P20 and P21 / P22, respectively, to obtain a 773-bp upstream homology arm fragment and a 778-bp downstream homology arm fragment. Overlapping PCR was then performed with primers P19 / P22 to obtain the entire 1511-bp homology arm fragment. After the PCR reaction, the amplified products were recovered by electrophoresis and the desired 1511-bp DNA fragment was recovered using a column-based DNA gel recovery kit. The fragment was then ligated with the shuttle plasmid pk18mobsacB, recovered by digestion with Xba I / Bam HI, using the NEBuider recombination system to obtain a knockout plasmid. This plasmid contains a kanamycin resistance marker.

[0271] The knockout plasmid was electroporated into the strain Corynebacterium glutamicum CGMCC No. 21220, and the resulting single colonies were identified by PCR using the following primers (synthesized by Shanghai Yingjun Company):

[0272] P23:5'GATTTCGCCA CGCCATCTAC 3'(SEQ ID NO:27)

[0273] P24:5'CGAGGGTGAG CCGGTGCAT 3'(SEQ ID NO:28)

[0274] The strains that amplified bands of 1437 bp and 1710 bp by PCR were identified as positive strains, and the strain that amplified only the 1710 bp band was identified as the original strain. The positive strains were screened on 15% sucrose medium and then cultured on media containing and not containing kanamycin. Strains that grew on media containing no kanamycin but did not grow on media containing kanamycin were selected for further PCR identification using P23 / P24 primers. The strain that amplified a band of 1437 bp was a genetically engineered strain in which the BBD29_11265 gene coding region was knocked out, and was named YPG-018 (the BBD29_11265 gene on the genome of Corynebacterium glutamicum CGMCC No. 21220 was knocked out).

[0275] Example 6 L-glutamic acid fermentation experiment

[0276] The bacterial strains (YPG-013, YPG-014, YPG-015, YPG-016, YPG-017, YPG-018) constructed in above-mentioned Examples 2-5 and the original bacterial strain Corynebacterium glutamicum CGMCC No.21220 were fermented in a fermenter of BLBIO-5GC-4-H model (available from Shanghai Bailun Biotechnology Co., Ltd.) using the culture medium shown in Table 3 and the control process shown in Table 4. Each bacterial strain was repeated three times, and the results are shown in Table 5.

[0277] Table 3 Fermentation medium formula (the rest is water)

[0278] Reagent Name Ratio Glucose 5.0g / L Phosphoric acid 0.38g / L Magnesium sulfate 1.85g / L Potassium chloride 1.6g / L Biotin 550μg / L Vitamin B1 300μg / L Ferrous sulfate 10mg / L Manganese sulfate 10g / dL KH2PO4 2.8g / L Vitamin C 0.75mg / L Vitamin B12 2.5μg / L Para-aminobenzoic acid 0.75mg / L Defoaming agent 0.0015mL / dL Betaine 1.5g / L Cane molasses 7mL / L Corn steep liquor 77mL / L Aspartic acid 1.7g / L Hair powder 2g / L

[0279] Table 4 Fermentation control process

[0280]

[0281]

[0282] Table 5 L-glutamic acid fermentation experimental results

[0283]

[0284] The results are shown in Table 5. The BBD29_11265 gene was overexpressed in Corynebacterium glutamicum, or the coding region of the BBD29_11265 gene was subjected to point mutation. G70A and / or overexpression of BBD29_11265 gene or its mutant gene BBD29_11265 G70A , which helps to increase the production of L-glutamic acid, while weakening or knocking out the BBD29_11265 gene is not conducive to the accumulation of L-glutamic acid.

[0285] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

[0286] Industrial Applications

[0287] The present invention weakens or knocks out the BBD29_11265 gene, discovering that the product encoded by the gene affects the L-glutamic acid production capacity. By introducing a point mutation in the coding sequence, or increasing the copy number of the gene or overexpressing it, a recombinant strain is obtained. Compared with an unmodified strain, the obtained strain is more conducive to producing high-concentration glutamic acid.

[0288] Specifically, the present invention first introduced a point mutation in the BBD29_11265 gene coding region (SEQ ID No. 1) of Corynebacterium glutamicum CGMCC No. 21220 by allele replacement, and constructed a genetically engineered bacterium YPG-013 containing a point mutation (GA). In order to further study and verify the overexpression of the wild-type BBD29_11265 gene or its mutant gene BBD29_11265 in the production bacterium, the present invention first introduced a point mutation in the BBD29_11265 gene coding region (SEQ ID No. 1) of Corynebacterium glutamicum CGMCC No. 21220 by allele replacement, and constructed a genetically engineered bacterium YPG-013 containing a point mutation (GA). G70A The production of L-glutamic acid can be increased by integrating the exogenous gene into the host chromosome or expressing it outside the chromosome by the plasmid, and constructing a genome-wide and plasmid-based overexpression of the BBD29_11265 gene or BBD29_11265 G70A The experiments showed that the BBD29_11265 gene and its variants were involved in the biosynthesis of L-glutamic acid. The accumulation of L-glutamic acid in microorganisms can be regulated by overexpressing or knocking out the BBD29_11265 gene or by site-directed mutagenesis (such as point mutation). Point mutations in the coding region of the BBD29_11265 gene or overexpression of the BBD29_11265 gene or its mutant gene BBD29_11265 in the production bacteria were performed. G70A , which is conducive to the improvement of L-glutamic acid production and conversion rate, while knocking out or weakening the BBD29_11265 gene is not conducive to the accumulation of L-glutamic acid. The BBD29_11265 gene and its variants (such as BBD29_11265 G70AGene) is used to construct genetically engineered strains for producing L-glutamic acid, so as to promote the increase of L-glutamic acid production and cultivate high-yield, high-quality strains that are suitable for industrial production, which has wide application value and important economic significance for the industrial production of L-glutamic acid.

Claims

1. A bacterium for producing L-glutamic acid, characterized in that, it has improved expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO:3 or its homologous sequence; Preferably, the improved expression is enhanced expression of a polynucleotide encoding the amino acid sequence of SEQ ID NO:3 or its homologous sequence, or the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 or its homologous sequence has a point mutation, or the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 or its homologous sequence has a point mutation and the expression is enhanced.

2. The bacterium according to claim 1, characterized in that, the point mutation of the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 causes the alanine at position 24 of the amino acid sequence of SEQ ID NO:3 to be replaced by a different amino acid; preferably, the alanine at position 24 is replaced by threonine.

3. The bacterium according to any one of claims 1-2, characterized in that, the polynucleotide encoding the amino acid sequence of SEQ ID NO:3 contains the nucleotide sequence of SEQ ID NO:

1.

4. The bacterium according to any one of claims 1-3, characterized in that, the polynucleotide sequence with the point mutation is formed by mutation of the base at position 70 of the polynucleotide sequence shown in SEQ ID NO:1; Preferably, the mutation includes the mutation of the base at position 70 of the polynucleotide sequence shown in SEQ ID NO:1 from guanine (G) to adenine (A); Preferably, the polynucleotide sequence with the point mutation includes the polynucleotide sequence shown in SEQ ID NO:

2.

5. The bacterium according to any one of claims 1-4, characterized in that, the bacterium is a bacterium of the genus Corynebacterium, preferably Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium callunae, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium ammoniagenes, Corynebacterium pekinense, Brevibacterium saccharolyticum, Brevibacterium roseum, Brevibacterium thiogenitalis; more preferably Corynebacterium glutamicum CGMCC No.21220 or ATCC 13869.

6. A polynucleotide sequence, characterized in that, it comprises a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO:3, wherein alanine at position 24 is replaced by a different amino acid; preferably alanine at position 24 is replaced by threonine; preferably, the polynucleotide sequence comprises a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO:4; preferably, the polynucleotide sequence is formed by a mutation at the 70th base of the polynucleotide sequence shown in SEQ ID NO:1; preferably, the mutation is that the 70th base of the polynucleotide sequence shown in SEQ ID NO:1 is mutated from guanine (G) to adenine (A); preferably, the polynucleotide sequence comprises the polynucleotide sequence shown in SEQ ID NO:

2.

7. An amino acid sequence, characterized in that, the sequence is as shown in SEQ ID NO:

4.

8. A recombinant vector, characterized in that, it contains the polynucleotide sequence as claimed in claim 6.

9. A recombinant strain, characterized in that, it contains the polynucleotide sequence as claimed in claim 6.

10. A method for producing L-glutamic acid, the method comprises: culturing the bacterium as claimed in any one of claims 1-5, and recovering L-glutamic acid from the culture.

11. A protein, characterized in that, the protein is any one of the following: A1) a protein having the amino acid sequence of SEQ ID No.4; A2) a protein having more than 80% identity with the protein shown in A1) and having the same function, which is obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in SEQ ID No.4; A3) a fusion protein having the same function, which is obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2).

12. A nucleic acid molecule, characterized in that, the nucleic acid molecule is any one of the following: B1) a nucleic acid molecule encoding the protein as claimed in claim 11; B2) a DNA molecule having the coding sequence shown in SEQ ID No.2; B3) a DNA molecule having the nucleotide sequence shown in SEQ ID No.

2.

13. A biological material, characterized in that, the biological material is any one of the following: C1) an expression cassette containing the nucleic acid molecule as claimed in claim 12; C2) a recombinant vector containing the nucleic acid molecule as claimed in claim 12, or a recombinant vector containing the expression cassette as described in C1); C3) a recombinant microorganism containing the nucleic acid molecule as claimed in claim 12, or a recombinant microorganism containing the expression cassette as described in C1), or a recombinant microorganism containing the recombinant vector as described in C2).

14. Any one of the following applications of any one of D1)-D8): F1) The application of any one of D1)-D8) in regulating the yield of L-glutamic acid in microorganisms; F2) The application of any one of D1)-D8) in constructing a genetically engineered bacterium for producing L-glutamic acid; F3) The application of any one of D1)-D8) in preparing L-glutamic acid; wherein, the D1)-D8) are: D1) the protein as claimed in claim 11; D2) the nucleic acid molecule as claimed in claim 12; D3) The biological material according to claim 13; D4) A DNA molecule having the nucleotide sequence of SEQ ID No.1; D5) A DNA molecule having more than 90% identity with the DNA molecule shown in SEQ ID No.1 and having the same function, which is obtained by modifying the nucleotide sequence shown in SEQ ID No.1 and / or substituting and / or deleting and / or adding one or several nucleotides; D6) An expression cassette containing the DNA molecule described in D4) or D5); D7) A recombinant vector containing the DNA molecule described in D4) or D5), or a recombinant vector containing the expression cassette described in D6); D8) A recombinant microorganism containing the DNA molecule described in D4) or D5), or a recombinant microorganism containing the expression cassette described in D6), or a recombinant microorganism containing the recombinant vector described in D7).

15. A method for increasing the production of L-glutamic acid in a microorganism, characterized in that, the method includes any one of the following: E1) Increasing the expression level or content of the nucleic acid molecule described in claim 12 in the target microorganism to obtain a microorganism with a higher L-glutamic acid production than the target microorganism; E2) Increasing the expression level or content of the DNA molecule described in D4) or D5) of claim 14 in the target microorganism to obtain a microorganism with a higher L-glutamic acid production than the target microorganism; E3) Mutating the DNA molecule having the nucleotide sequence of SEQ ID No.1 in the target microorganism to obtain a microorganism with a higher L-glutamic acid production than the target microorganism.

16. The method according to claim 15, characterized in that, the mutation is a point mutation.

17. The method according to claim 16, characterized in that, the point mutation is mutating the alanine residue at the 24th position of the amino acid sequence encoded by the DNA molecule shown in SEQ ID No.1 into another amino acid residue.

18. The method according to claim 16 or 17, characterized in that, the point mutation is mutating the alanine at the 24th position of the amino acid sequence encoded by the DNA molecule shown in SEQ ID No.1 into threonine to obtain a mutant protein having the amino acid sequence of SEQ ID No.

4.

19. A method for constructing the recombinant microorganism described in claim 13 or 14, characterized in that, the method includes at least any one of the following: F1) Introducing the nucleic acid molecule described in claim 12 into the target microorganism to obtain the recombinant microorganism; F2) Introducing the DNA molecule shown in SEQ ID No.1 into the target microorganism to obtain the recombinant microorganism; F3) Editing the DNA molecule shown in SEQ ID No.1 by means of gene editing so that the target microorganism contains the DNA molecule shown in SEQ ID No.

2.

20. A method for preparing L-glutamic acid, characterized in that, the method includes producing L-glutamic acid using the recombinant microorganism described in claim 13 or 14.