RNA inhibitors for the inhibition of hepatitis B virus gene expression or its pharmaceutical salts, and pharmaceutical preparations containing such RNA inhibitors or their pharmaceutical salts.

VN104609AUndetermined Publication Date: 2024-08-26KYLONOVA (XIAMEN) BIOPHARMA CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
VN1202307846
Authority / Receiving Office
VN · VN
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-04-13
Filing Date
2022-03-31
Publication Date
2024-08-26

AI Technical Summary

Technical Problem

Existing hepatitis B treatment drugs are difficult to effectively reduce HBsAg levels, leading to viral resistance and side effects, unable to achieve long-term efficacy, and unable to functionally cure hepatitis B.

Method used

Develop an RNA inhibitor formed by base pairing of the sense strand and the antisense strand, containing 5'MVIP and 3'MVIP structures, with liver targeting specificity, enhanced stability through base pairing and modification, and capable of direct destruction HBV mRNA, prevents the synthesis of HBsAg, and is used in combination with nucleoside analogs and interferons.

Benefits of technology

The RNA inhibitor can significantly reduce the HBsAg expression level of HBV, produce surface antibody HBsAb, achieve functional cure of hepatitis B, and has a significant inhibitory effect on HBV types A, B, C, and D, and continuously and efficiently reduce HBsAg expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure VN1202307846_0
    Figure VN1202307846_0
Patent Text Reader

Abstract

The invention proposes an RNA inhibitor for the inhibition of hepatitis B virus (HBV) gene expression and its application. The RNA inhibitor is formed from a semantic and antisynthetic strand by base pairing; the semantic and antisynthetic strands are complementary to each other by at least 85%; and the -OH group at the 2' glycosyl position of some or all nucleotides is replaced by fluorine or methoxy group, and the phosphate between at least 3 consecutive nucleotides at the end is thio-dependent. The structure of the RNA inhibitor includes both 5'MVIP and 3'MVIP, such that the RNA inhibitor is liver-specific. RNA inhibitors can continuously inhibit the synthesis of HBV surface antigen (HBsAg), can promote the production of HBV surface antibody (HBsAb), are effective against the most common HBV strains, namely A, B, C, and D, and can be used in combination with nucleoside analogs or interferon to potentially cure functional hepatitis B.
Need to check novelty before this filing date? Find Prior Art

Description

RNA inhibitor for inhibiting hepatitis B virus gene expression and its application Technical Field

[0001] The present invention belongs to the field of biochemistry, and specifically relates to an RNA inhibitor for inhibiting hepatitis B virus gene expression and its application. The RNA inhibitor is formed by a sense chain and an antisense chain through base pairing. The sense chain and the antisense chain are at least 85% base complementary to each other, and the -OH at the 2' position of some or all nucleotide sugar groups is replaced by fluorine or methoxy, and the phosphates between at least three consecutive nucleotides at the end are thiolated. The structure of the RNA inhibitor of the present invention also contains 5'MVIP and 3'MVIP structures that give the RNA inhibitor liver-targeting specificity, wherein 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand of the RNA inhibitor, and 3'MVIP is coupled to the 3' end of the antisense strand and / or sense strand of the RNA inhibitor. Both 5'MVIP and 3'MVIP contain a liver-targeting specific ligand X, a branch L, a linker B, and a connecting chain D. 5'MVIP also contains a transfer point R1 connected to the 5' end of the sense strand or antisense strand of the RNA inhibitor, and 3'MVIP also contains a transfer point R2 connected to the 3' end of the sense strand or antisense strand of the RNA inhibitor. The liver-targeting specific ligand X, branch L, or linker B can be the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP. The RNA inhibitor provided by the present invention has efficacy that is not currently available in first-line clinical hepatitis B treatment drugs, and can directly destroy the function of HBV mRNA as a translation template, thereby preventing the synthesis of HBV surface antigen HBsAg. In addition, the RNA inhibitor of the present invention has a significant inhibitory effect on the most common HBV types A, B, C and D; can be used in combination with nucleoside analogs and interferon; can continuously and efficiently reduce the expression level of HBsAg in HBV mice and produce surface antibodies HBsAb, and can functionally cure hepatitis B. Background Art

[0002] RNAi

[0003] RNAi (RNA interference) was discovered in 1998 by Andrew Z. Fire and others while conducting antisense RNA inhibition experiments in Caenorhabditis elegans. This process was named RNAi. This discovery was named one of the top ten scientific advances of 2001 by Science magazine and ranked first among the top ten scientific advances of 2002. Since then, RNA inhibitors based on RNAi have garnered widespread attention as potential gene therapy drugs. In 2006, Andrew Z. Fire and Craig C. Mello were awarded the Nobel Prize in Physiology or Medicine for their contributions to the study of RNAi mechanisms. RNAi can be triggered by double-stranded RNA (dsRNA) in many organisms, including animals, plants, and fungi. During RNAi, an endonuclease called Dicer cuts or "dices" long dsRNA into smaller fragments of 21 to 25 nucleotides. These small fragments are called small interfering RNA (RNA inhibitors), and the antisense strand (Guide strand) of them is loaded onto the Argonaute protein (AGO2). AGO2 loading occurs in the RISC-loading complex, which is a ternary complex composed of Argonaute protein, Dicer and dsRNA binding protein (abbreviated as TRBP). During the loading process, the positive strand (Passenger strand) is cleaved and discharged by AGO2. Then, AGO2 uses the antisense strand to bind to mRNA containing a completely complementary sequence, and then catalyzes the cleavage of these mRNAs, causing the mRNA split to lose its translation template function, thereby preventing the synthesis of related proteins. After cleavage, the cleaved mRNA is released, and the RISC-loading complex loaded with the antisense strand is recycled for another round of cleavage.

[0004] Hepatitis B is a disease caused by persistent infection with the hepatitis B virus (HBV) for more than six months, resulting in varying degrees of liver inflammation, necrosis, or fibrosis. The World Health Organization estimates that approximately 2 billion people are infected worldwide, with approximately 4 million becoming acutely infected annually and approximately 350-400 million becoming infected. 68% of these cases occur in Africa and the Western Pacific. Approximately 1 million people die annually from HBV-related illnesses, of which 30% are from cirrhosis and 45% from primary hepatocellular carcinoma (HCC). In my country, 77% and 84% of cirrhosis and HCC cases are caused by HBV, respectively. Currently, first-line clinical treatments include nucleoside (NUC) drugs and interferons, with nucleoside drugs such as lamivudine, entecavir, adefovir, and telbivudine remaining the primary treatments. Tenofovir alafenamide is a newly launched NUC, but its use is limited by the potential for renal impairment. Nucleoside drugs offer the advantages of high bioavailability and relatively safe oral administration. However, while nucleoside drugs can effectively control the disease, long-term use can lead to drug resistance. Furthermore, varying degrees of rebound in HBV DNA, ALT, and liver histology can occur after discontinuation of treatment. Long-term use of nucleoside drugs can also cause significant side effects, such as kidney damage and fetal malformations. The emergence of resistant viral strains is another unavoidable side effect of long-term nucleoside drug use, significantly reducing cure rates or even rendering them ineffective. Because nucleoside drugs can reversibly inhibit viral replication, maximal efficacy in most patients requires treatment for at least one year. This can lead to the development of drug resistance and the desired effect. Nucleoside (NUC) drugs require daily administration, making patient compliance poor.

[0005] Hepatitis B surface antigen (HBsAg) is the outer coat protein of hepatitis B virus (HBV) and is the first detectable viral marker. HBsAg positivity is the gold standard for determining HBV infection. For hepatitis B patients, if HBsAg is cleared before cirrhosis, the incidence of cirrhosis and hepatocellular carcinoma will be reduced by 60 times. The guidelines of the American Association for the Study of Liver Diseases (AASLD), the Asia Pacific Association for the Study of the Liver (APASL), and the European Association for the Study of the Liver (EASL) all use HBsAg serum clearance as one of the criteria for determining treatment endpoints. In addition, high levels of antigen induce immune tolerance, and a reduction in the level of antigen HBsAg can restore the immunological control of HBV infection. Currently, first-line clinical drugs, including nucleoside (NUC) and interferon drugs, do not have the effect of reducing the level of antigen HBsAg, let alone clearing HBsAg.

[0006] The treatment of hepatitis B remains a global health challenge. Therefore, there is an urgent need to develop anti-HBV drugs with novel therapeutic mechanisms that can effectively and persistently reduce HBsAg levels, allowing hepatitis B patients to regenerate HBsAbs and ultimately achieve a functional cure.

[0007] Summary of the Invention

[0008] The present invention relates to an RNA inhibitor for inhibiting hepatitis B virus gene expression and its application. The RNA inhibitor is formed by a sense chain and an antisense chain through base pairing. The sense chain and the antisense chain are at least 85% base complementary to each other, and the -OH groups at the 2' positions of some or all nucleotide sugar groups are substituted with fluorine or methoxy groups. At least three consecutive phosphate esters at the ends are thiolated to enhance the stability of the RNA inhibitor in the body. The structure of the RNA inhibitor of the present invention also contains 5'MVIP and 3'MVIP, which give the RNA inhibitor a liver-targeting specific structure, wherein 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand of the RNA inhibitor, and 3'MVIP is coupled to the 3' end of the antisense strand and / or sense strand of the RNA inhibitor. Both 5'MVIP and 3'MVIP contain a liver-targeting specific ligand X, a branch L, a linker B, and a connecting chain D. 5'MVIP also contains a transfer point R1 connected to the 5' end of the sense strand or antisense strand of the RNA inhibitor, and 3'MVIP also contains a transfer point R2 connected to the 3' end of the sense strand or antisense strand of the RNA inhibitor. The liver-targeting specific ligand X, branch L, or linker B can be the same or different within each of the 5'MVIP and 3'MVIP or between the 5'MVIP and 3'MVIP. The RNA inhibitor provided by the present invention has an efficacy that is not possessed by current first-line clinical hepatitis B treatment drugs, and can directly destroy the function of HBV mRNA as a translation template, thereby preventing the formation of HBV surface antigen HBsAg. Furthermore, the RNA inhibitor of the present invention has significant inhibitory effects on the most common HBV types A, B, C, and D, and can be used in combination with nucleoside analogs and interferon. It can effectively and sustainably reduce HBsAg expression in HBV-positive mice and produce surface antibodies (HBsAb), potentially leading to a functional cure for hepatitis B. Compared to existing similar technologies, the RNA inhibitor of the present invention is primarily characterized by its ability to produce surface antibodies (HBsAb) in vivo, stimulating the body's ability to regenerate immunity against HBV and achieving a functional cure for hepatitis B.

[0009] In one aspect, the present invention provides an RNA inhibitor for inhibiting hepatitis B virus gene expression or a pharmaceutically acceptable salt thereof, wherein:

[0010] The RNA inhibitor is formed by base pairing of a sense strand and an antisense strand with a chain length of 15-30, wherein the chain length is preferably 19-23.

[0011] In the above technical solution, preferably, there is at least 85% base complementarity between the sense strand and the antisense strand;

[0012] The -OH at the 2' position of some or all nucleotide sugar groups of the sense chain or antisense chain may be substituted, wherein the substituent group is fluorine or methoxy;

[0013] Furthermore, at least three phosphate bonds between adjacent nucleotides at the ends of the sense strand or antisense strand can be thiolated.

[0014] More preferably, the sense strand is SEQ ID NO.1 as shown below, or a sequence that differs from SEQ ID NO.1 by one, two, or three nucleotides, and the antisense strand is SEQ ID NO.58 as shown below, or a sequence that differs from SEQ ID NO.58 by one, two, or three nucleotides:

[0015] Sense strand: 5'ggguuuuucucguugacaa 3' SEQ ID NO.: 1

[0016] Antisense strand: 5'uugucaacgagaaaaacccuu 3' SEQ ID NO.: 58

[0017] Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

[0018] Alternatively, more preferably, the sense strand is SEQ ID NO. 140 as shown below, or a sequence that differs from SEQ ID NO. 140 by one, two, or three nucleotides, and the antisense strand is SEQ ID NO. 141 as shown below, or a sequence that differs from SEQ ID NO. 141 by one, two, or three nucleotides:

[0019] Sense strand: 5'ggguuuuuucuuguugacaa 3' SEQ ID NO.: 140

[0020] Antisense strand: 5'uugucaacaagaaaaacccuu 3' SEQ ID NO.: 141

[0021] Wherein, g = guanylate, a = adenylate, u = uridylate, and c = cytidylate.

[0022] In order to enhance the stability of the above-mentioned RNA inhibitors in vivo, the sense and antisense chains of the above-mentioned RNA inhibitors can be modified without affecting their activity or even enhancing their activity. The nucleotides therein can have modified groups, and the entire chain or part of the chain can be modified.

[0023] In a preferred technical solution, the modified sense strand of the RNA inhibitor is SEQ ID NO. 2 as shown below, or a sequence that differs from SEQ ID NO. 2 by one, two, or three nucleotides, and the modified antisense strand is SEQ ID NO. 59 as shown below, or a sequence that differs from SEQ ID NO. 59 by one, two, or three nucleotides:

[0024] Justice strand: 5'Gs fGs GU fU U fU fU fC UCGUUGA Cs As A 3' SEQ ID NO.:2

[0025] Antisense strand: 5'Us Us GUCA fA CGAG fA A fA fA ACC Cs Us U 3' SEQ ID NO.:59

[0026] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenosine, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate; fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidylate.

[0027] In another preferred technical solution, the modified sense strand of the RNA inhibitor is SEQ ID NO. 142 as shown below, or a sequence that differs from SEQ ID NO. 142 by one, two, or three nucleotides, and the modified antisense strand is SEQ ID NO. 143 as shown below, or a sequence that differs from SEQ ID NO. 143 by one, two, or three nucleotides:

[0028] Justice chain: 5'Gs Gs GU fU U fU fU fC UUGUUGA Cs As A 3' SEQ ID NO.:142

[0029] Antisense strand: 5'Us Us GUCA fA CAAG fA A fA AACC Cs Us U 3' SEQ ID NO.:143

[0030] Wherein, G = 2'-O-methylguanylate, A = 2'-O-methyladenosine, U = 2'-O-methyluridylate, C = 2'-O-methylcytidylate; Gs = 2'-O-methyl-3'-thioguanylate, As = 2'-O-methyl-3'-thioadenylate, Us = 2'-O-methyl-3'-thiouridylate, Cs = 2'-O-methyl-3'-thiocytidylate; fG = 2'-fluoroguanylate, fA = 2'-fluoroadenylate, fU = 2'-fluorouridylate, fC = 2'-fluorocytidylate; fGs = 2'-fluoro-3'-thioguanylate, fAs = 2'-fluoro-3'-thioadenylate, fUs = 2'-fluoro-3'-thiouridylate, fCs = 2'-fluoro-3'-thiocytidylate.

[0031] In the above technical solution, preferably, the RNA inhibitor or a pharmaceutically acceptable salt thereof further contains a combination of 5'MVIP and 3'MVIP, wherein,

[0032] The 5'MVIP and 3'MVIP are ligand structures with liver-targeting specific ligand X, which also include a branch chain L, a linker B and a connecting chain D;

[0033] The 5'MVIP is coupled to the 5' end of the sense strand and / or antisense strand, and further comprises a transfer point R1 connected to the 5' end of the sense strand or antisense strand;

[0034] The 3'MVIP is coupled to the 3' end of the antisense strand and / or the sense strand, and comprises a transfer point R2 connected to the 3' end of the sense strand or the antisense strand;

[0035] The structure of the 5'MVIP is shown in Formula I, and the structure of the 3'MVIP is shown in Formula II.

[0036]

[0037] in,

[0038] n and m are each an integer from 0 to 4, preferably an integer from 1 to 3, and n+m=an integer from 2 to 6, preferably n+m=2, 3 or 4;

[0039] The transition points R1 and R2 have -NH-, sulfur atoms or oxygen atoms in their structures, and generally have at least one -NH-, sulfur atom or oxygen atom in their structures. R1 and R2 are connected to the connecting chain D of 5'MVIP and 3'MVIP and the 5' end and 3' end of the sense chain and / or antisense chain respectively through the -NH-, sulfur atom or oxygen atom in their structures, thereby introducing the liver-targeting specific ligand X. The transition points R1 and R2 can be straight chains; straight chains with branches or various cyclic structures, such as saturated or unsaturated aliphatic carbocyclic groups, or five-membered or six-membered heterocyclic groups or aromatic hydrocarbon groups containing sulfur, oxygen or nitrogen atoms, etc.

[0040] R1 is preferably -NH(CH2) x CH2O-, wherein x is an integer from 3 to 12, preferably an integer from 4 to 6;

[0041] R2 is preferably -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, wherein x1 is an integer from 1 to 4, and x2 is an integer from 0 to 4;

[0042] The liver-targeting specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine and its derivatives, preferably selected from N-acetylgalactosamine and its derivatives, and the liver-targeting specific ligand X can be the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP;

[0043] The branch chain L is a C4-C18 straight chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, a C4-C10 aliphatic carbocyclic group, a phenyl group, or a combination of these groups. The straight chain may have a side chain of ethyl alcohol or a carboxylic acid. The branch chain L is preferably a C7-C18 straight chain containing an amide group or a six-membered aliphatic carbocyclic group, and the branch chain L may be the same or different within each of the 5'MVIP and the 3'MVIP or between the 5'MVIP and the 3'MVIP;

[0044] The linker B is selected from the following structures:

[0045]

[0046] wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, r is an integer from 0 to 4, and the linker B may be the same or different between the 5'MVIP and the 3'MVIP;

[0047] The connecting chain D is a C3-C18 straight chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, an aromatic hydrocarbon group, a C4-C10 aliphatic carbocyclic group, a five-membered or six-membered heterocyclic group containing 1-3 nitrogen atoms, or a combination of these groups. The C3-C18 straight chain may also have a side chain of methyl alcohol, methyl tert-butyl group, methylphenol group, or C5-C6 aliphatic ring group. The connecting chain D is preferably a C3-C10 straight chain containing two C=O, a six-membered aliphatic carbocyclic group, or a phenyl group.

[0048] Specifically, in some embodiments, when n=0 (ie, there is no 5'MVIP), the structure of the MVIP can be:

[0049]

[0050] In some embodiments, when n=1, the structure of the MVIP may be:

[0051]

[0052] In some embodiments, when n=2, the structure of the MVIP may be:

[0053]

[0054] In some embodiments, when n=3, the structure of the MVIP may be:

[0055]

[0056] In some embodiments, when n=4, the structure of the MVIP may be:

[0057]

[0058] In some embodiments, the n refers to the sum of n's in the 5'MVIPs placed at the 5' ends of both the sense and antisense strands of the RNA inhibitor, and the m refers to the sum of m's in the 3'MVIPs placed at the 3' ends of both the sense and antisense strands of the RNA inhibitor.

[0059] The liver-targeting-specific ligand X is selected from structures used to enhance hepatocyte uptake of RNA inhibitors, and may include lipids, steroids, vitamins, sugars, proteins, peptides, polyamines, and peptide-mimicking structures. In the RNA inhibitors provided herein, the liver-targeting-specific ligands X introduced into the ends of the sense or antisense strands of the RNA inhibitors may be identical or different. For example, some may enhance liver targeting, some may regulate the in vivo pharmacokinetics of the RNA inhibitor, or some may possess in vivo lytic activity. In some embodiments, the liver-targeting-specific ligand X is selected from one or more monosaccharides and their derivatives found in the following structures:

[0060] The monosaccharide is selected from one or more of the following structures: mannose, galactose, D-arabinose, glucose, fructose, xylose, glucosamine, and ribose. Mannose is selected from one or more of the following structures: D-mannopyranose, L-mannopyranose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, and β-D-mannopyranose. Galactose is selected from one or more of the following structures: L-galactose, D-galactose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, and β-D-galactofuranose. Glucose is selected from one or more of the following structures: D-glucose, L-glucose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucopyranose, and β-D-glucopyranose. Fructose is selected from one or more of the following structures: α-D-fructofuranose and α-D-fructopyranose. Xylose is selected from one or more of the following structures: D-xylofuranose and L-xylofuranose. Ribose is selected from one or more of the following structures: ribose, D-ribose, and L-ribose. Monosaccharide derivatives are selected from mannose derivatives, galactose derivatives, glucose derivatives, ribose derivatives, and other derivatives. Galactose derivatives are selected from α-D-galactosamine, N-acetylgalactosamine, and 4-thio-β-D-galactopyranose. Glucose derivatives can be selected from 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, 5-thio-β-D-glucopyranose, and 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside methyl ester. The ribose derivative is selected from one or more of D-4-thioribose and L-4-thioribose.

[0061] In some preferred embodiments, the liver-targeting specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine and derivatives thereof, and its general structural formula is as follows:

[0062]

[0063] Wherein, W1 is hydrogen or a hydroxyl protecting group, which may be the same or different; W is -OH, -NHCOOH or -NHCO(CH2) q CH3, wherein q is an integer from 0 to 4; W2 is -NH-, O, S or C.

[0064] In some embodiments, the liver-targeting specific ligand X is preferably selected from one or more of the following structures:

[0065]

[0066] Wherein, W is selected from -OH, -NHCOOH or -NHCO(CH2) q One or two of CH3, wherein q is an integer of 0-4.

[0067] In some embodiments, the liver-targeting specific ligand X in the same 5'MVIP or 3'MVIP structure may be the same or different.

[0068] In some embodiments, X between 5'MVIP and 3'MVIP may be the same or different.

[0069] The side chain L is a C4-C18 straight chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, a C4-C10 aliphatic carbocyclic group, a phenyl group, or a combination of these groups. The straight chain may have a side chain of ethyl alcohol or a carboxylic acid. The side chain L is preferably a C7-C18 straight chain containing an amide group or a six-membered aliphatic carbocyclic group. The length or structure of the side chain L may affect the activity of the RNA inhibitor described in the present invention.

[0070] In some embodiments, the side chains L in the same 5'MVIP or 3'MVIP structure may be the same or different.

[0071] In some embodiments, the branch chains L between the 5'MVIP and the 3'MVIP may be the same or different.

[0072] In some embodiments, the branched chain L may be selected from one or more of the following structures:

[0073]

[0074] Wherein, r1 is a positive integer of 1-12, r2 is an integer of 0-20, and Z is H or an alkyl group or an amide group, such as a C1-C5 alkyl group, a C1-C5 amide group, such as formamide, etc.

[0075] The structure of the linker B is related to the number of specific ligands X that can be introduced. The linker B contains -NH-, C, O, S, amide, phosphoryl, and thiophosphoryl. When n or m is 1, it is a straight chain. When n or m is 2, 3, or 4, the number of branches is 2, 3, or 4, respectively. The linker B can be selected from the following structural formulas:

[0076]

[0077] wherein A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, and r is an integer of 0-4.

[0078] In some embodiments, when n or m is 1, 2, 3 or 4, the linker B is selected from the following structural formulas:

[0079]

[0080]

[0081] Here, r is an integer from 0 to 4.

[0082] In some embodiments, when n or m is 1, 2, 3 or 4, the linker B is selected from the following structural formulas:

[0083]

[0084]

[0085]

[0086] In some embodiments, the linker B is preferably selected from one or more of the following structures:

[0087]

[0088] The connecting chain D is a C3-C18 straight chain containing -NH-, C=O, O, S, an amide group, a phosphoryl group, a thiophosphoryl group, an aromatic hydrocarbon group, a C4-C10 aliphatic carbocyclic group, a five-membered or six-membered heterocyclic group containing 1-3 nitrogen atoms, or a combination of these groups. The C3-C18 straight chain may also have a side chain of methyl alcohol, methyl tert-butyl group, methylphenol group, or C5-C6 aliphatic ring group. The connecting chain D is preferably a C3-C10 straight chain containing two C=O, a six-membered aliphatic carbocyclic group, or a phenyl group.

[0089] In some embodiments, the connecting chain D is selected from one or more of the following structures:

[0090]

[0091]

[0092]

[0093] Wherein, each n is a positive integer of 1-20, and each n is the same or different integer; s is an integer of 2-13; Z1 and Z2 are the same or different substituent groups, such as C3-C10 alkyl.

[0094] In some embodiments, the connecting chain D is preferably selected from one of the following structures:

[0095]

[0096]

[0097]

[0098] In some embodiments, the connecting chain D is preferably selected from one or more of the following structures:

[0099]

[0100] In some most preferred embodiments, the connecting chain D is a C3-C10 straight chain containing two C=O groups.

[0101] In some embodiments, the (XL) in the 5'MVIP structure n -BD- and 3'MVIP structures (XL) m -BD- is selected from one or more of the following structures:

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116] In some preferred embodiments, (XL) in the 5'MVIP structure n -B- D- Select from the structures shown in Table 1:

[0117] Table 1: 5'MVIP (XL) n -BD-Structure

[0118]

[0119]

[0120]

[0121]

[0122] In some embodiments, 5'MVIP may not be present, in which case m may be an integer of 2-4.

[0123] In some preferred embodiments, (XL) in the 3'MVIP structure m -BD- is selected from the structures shown in Table 2:

[0124] Table 2: 3'MVIP (XL) m -BD-Structure

[0125]

[0126]

[0127]

[0128]

[0129] In the RNA inhibitor provided by the present invention, the 5'MVIP further comprises a transition point R1 connected or coupled to the 5' end of the sense strand or antisense strand. The transition point R1 structure contains -NH-, a sulfur atom, or an oxygen atom, and generally contains at least one -NH-, sulfur atom, or oxygen atom. R1 is connected to the connecting chain D of the 5'MVIP and the 5' end of the sense strand or antisense strand via the -NH-, sulfur atom, or oxygen atom in its structure, thereby introducing the liver-targeting specific ligand X. The transition point R1 can be a straight chain; a straight chain with an amide group, a carboxyl group, or an alkyl side chain; or various cyclic structures, such as a saturated or unsaturated aliphatic carbocyclic group, or a five-membered or six-membered heterocyclic group or aromatic hydrocarbon group containing a sulfur, oxygen, or nitrogen atom.

[0130] In some embodiments, R1 is -B1(CH2) x CH2B2-, wherein x is an integer of 3-10, preferably an integer of 4-6, and the groups B1 and B2 can be -NH-, a sulfur atom or an oxygen atom, respectively.

[0131] In some embodiments, R1 is -B1(CH2) x CH(B3CH3)B2-, wherein x is an integer of 3-10, B1 and B2 can be -NH-, a sulfur atom or an oxygen atom, respectively, and the group B3 is a functional group containing nitrogen, sulfur, oxygen or carboxyl or methyl alkyl.

[0132] In some preferred embodiments, R1 is -NH(CH2) x CH2O-, wherein x is an integer from 3 to 10, preferably an integer from 4 to 6, can be introduced by the following two phosphoramidite monomers:

[0133] i. One of the oxygen or sulfur atoms is used to synthesize the R1 phosphoramidite monomer, which is then attached to the 5' end of the RNA inhibitor single strand via solid-phase synthesis. The -NH-, sulfur, or oxygen atom in this structure is used to connect to the linker strand D in the 5'MVIP, thereby introducing the liver-targeting ligand X to the 5' end of the RNA inhibitor. An exemplary structure of the monomer introduced to the 5' end of the RNA inhibitor is as follows:

[0134]

[0135] In some embodiments, the following structures are preferred:

[0136]

[0137] ii. In the R1 structure, the -NH-, sulfur atom, or oxygen atom is first connected to the linker chain D. The other -NH-, sulfur atom, or oxygen atom is used to form an ester with the phosphoramidite in the synthesis of the 5'MVIP phosphoramidite monomer. Examples of the structures of the sense or antisense 5'MVIP phosphoramidite monomers are as follows:

[0138]

[0139] In some embodiments, R1 is a heterocyclic or carbocyclic structure containing a nitrogen, sulfur, or oxygen atom:

[0140]

[0141] In some preferred embodiments, the 5'MVIP phosphoramidite monomer of the sense chain or antisense chain preferably has the following structure:

[0142]

[0143] When n in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding monomer compound. With the help of the above monomer compound, the liver-targeting specific ligand X is introduced into the 5' end of the sense chain or antisense chain through solid phase synthesis.

[0144] In some preferred embodiments, the transition point R1 is preferably -NH(CH2) x CH2O-, wherein x can be an integer from 3 to 10, preferably an integer from 4 to 6, and the 5'MVIP phosphoramidite monomer structure is selected from the following structures:

[0145]

[0146]

[0147]

[0148] In the RNA inhibitor provided by the present invention, the 3'MVIP further comprises a transition point R2 connected or coupled to the 3' end of the sense strand or antisense strand. The transition point R2 structure contains -NH-, a sulfur atom, or an oxygen atom, and generally contains at least one -NH-, sulfur atom, or oxygen atom. R2 is connected to the connecting chain D of the 3'MVIP and the 3' end of the sense strand or antisense strand via the -NH-, sulfur atom, or oxygen atom in the structure, thereby introducing the liver-targeting specific ligand X. The transition point R2 can be a straight chain; a straight chain with an amide, carboxyl, or alkyl branch; or various cyclic structures, such as a saturated or unsaturated aliphatic carbocyclic group, or a five-membered or six-membered heterocyclic group or aromatic hydrocarbon group containing sulfur, oxygen, or nitrogen atoms.

[0149] In some embodiments, the transition point R2 containing a heterocyclic structure such as piperidinyl, pyrrolyl, thiazolyl or benzene ring has the following structure:

[0150]

[0151] The R2 of the present invention is formed by ester or amide formation between succinic anhydride and -NH-, sulfur atom or oxygen atom in the R2 structure, and is coupled with -NH- in the blank Solid Support to form a 3'MVIP solid support. Then, the 3'MVIP is introduced into the 3' end of the sense chain or antisense chain through the phosphoramidite solid phase synthesis method.

[0152] In some embodiments, the heterocyclic ring in the R2 structure is a pyrrole ring or a piperidine ring, which is connected to the connecting chain D of 3'MVIP through the nitrogen heteroatom in the ring. The exemplary structure of 3'MVIP solid state port is as follows:

[0153]

[0154] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0155] In some embodiments, R2 is -B4(CH2) x1 CH(OH)(CH2) x2 CH2B5-, wherein x1 is an integer of 1-4, x2 is an integer of 0-4, and B4 and B5 are respectively -NH-, a sulfur atom or an oxygen atom.

[0156]

[0157] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0158] In some preferred embodiments, R2 is -NHCH2CH(OH)CH2O-. The exemplary structure of the introduced 3'MVIP solid spport is as follows:

[0159]

[0160] When m in the general formula is 1-4, the linker B portion in the above monomer is branched 1 to 4 times to obtain the corresponding Solid Support.

[0161] In some embodiments, the 3'MVIP solid support structure is as follows:

[0162]

[0163]

[0164]

[0165]

[0166] In some preferred embodiments, (XL) in the 5'MVIP ligand structure n The combinations of -BD- and R1 are shown in Table 3.

[0167] Table 3: 5'MVIP Medium (XL) n -BD- and R1 combination

[0168]

[0169]

[0170] In some embodiments, 3'MVIP may not be present, in which case n may be 2-4.

[0171] In some embodiments, (XL) in the 3'MVIP ligand structure m The combinations of -BD- and R2 are shown in Table 4.

[0172] Table 4: 3'MVIP (XL) m -BD- combined with R2

[0173]

[0174]

[0175] The sense and antisense strands in the RNA inhibitor structure provided by the present invention have a chain length of 15-30, preferably 19-23, and are at least 85% base complementary to each other. In order to enhance the stability of the sense and antisense strands in vivo, the sense and antisense strands of the RNA inhibitor can be modified without affecting the activity or even enhancing the activity, wherein the nucleotides can have a modifying group, and the entire chain or part of the chain can be modified, preferably all modified. The modification is a technique that is easy for researchers in the field to understand, and can be selected from any one or more of the following in the sugar moiety: deoxyribonucleotides, nucleotide mimetics, abasic nucleotides, 2'-modified nucleotides, 3' to 3' linked (inverted) nucleotides, nucleotides containing non-natural bases, bridged nucleotides, peptide nucleic acids (PNAs), unlocked nucleobase analogs, locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabino nucleotides, 5'-Me / 2'-fluorinated nucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. Among them, 2'-modified nucleotides include but are not limited to: 2'-O-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy nucleotides, 2'-methoxyethyl nucleotides, 2'-amino nucleotides and 2'-alkyl nucleotides. In the RNA inhibitors provided by the present invention, both the sense strand and the antisense strand of the RNA inhibitor do not need to be uniformly modified, and more than one modification can be incorporated into a single nucleotide thereof. The modification can also occur in the base portion, and the modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2 / N-6 and O-6 substituted purines, 5-methylcytosine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl of adenine and guanine, 2-alkyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil , 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil, 4-thiouracil, 8-halogen, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenine and guanine, 5-halogen, 5-trifluoromethyl and other 5-substituted uracil and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0176] The sense and antisense strands of the RNA inhibitor of the present invention are partially or entirely 2'-O-methyl nucleotides and / or 2'-deoxy-2'-fluoro nucleotides, and at least two consecutive phosphorothioate bonds exist between the nucleotides at the 5' end of the sense strand and the 3' end of the antisense strand, and preferably the phosphate bonds between the three consecutive terminal nucleotides are phosphorothioated.

[0177] In the RNA inhibitors provided herein, when a single strand has 3'MVIP, the complementary strand may have 5'MVIP, 3'MVIP, or no 5'MVIP. When a single strand of the RNA inhibitor has 5'MVIP, the complementary strand may have 3'MVIP, 5'MVIP, or no 5'MVIP. 5'MVIP and 3'MVIP may also be simultaneously attached to the corresponding ends of the sense or antisense strands. That is, when the sense strand has 5'MVIP at its 5' end, it may also have 3'MVIP at its 3' end; and when the antisense strand has 5'MVIP at its 5' end, it may also have 3'MVIP at its 3' end. Alternatively, 5'MVIP may be placed at the 5' end of both the sense and antisense strands. Alternatively, 3'MVIP may be placed at the 3' end of both the sense and antisense strands.

[0178] In some embodiments, different 5'MVIP and 3'MVIP combinations shown in Table 5 below are preferably introduced into different positions of the sense strand and / or antisense strand of the RNA inhibitor to examine the effects on the HBV HBsAg level.

[0179] Table 5: Combinations of 5'MVIP and 3'MVIP

[0180]

[0181]

[0182] In some embodiments, the RNA inhibitor of the present invention or a pharmaceutically acceptable salt thereof is preferably prepared or synthesized in the form of a carboxylate salt, a sodium salt, a triethylamine salt or other pharmaceutically acceptable salts.

[0183] In some embodiments, the RNA inhibitor or a pharmaceutically acceptable salt thereof is more preferably a sodium salt or a triethylamine salt thereof.

[0184] In some embodiments, the sense strand of the RNA inhibitor is selected from Table 6 below:

[0185] Table 6: Sense Strands of RNA Inhibitors

[0186] SEQ ID NO. Single-stranded code sense strand sequence 5'→3' (19mer) 1 Ky-Sggguuuuucucguugacaa 2 Ky-S0Gs fGs G U fU U fU fU fC U C G U U G A Cs As A 3 Ky-S1Gs fGs G U fU U fU fU fC U C G U U G A Cs As A - 3' MVIP17 4 Ky-S2Gs fGs G U fU U fU fU fC U C G U U G A Cs As A - 3' MVIP01 5 Ky-S3Gs fGs G U fU U fU fU fC U C G U U G A Cs As A - 3' MVIP09 6 Ky-S4 5' MVIP17 - Gs fGs G U fU U fU fU fC U C G U U G A Cs As A 7 Ky-S5 5' MVIP01 - Gs fGs G U fU U fU fU fC U C G U U G A Cs As A 8 Ky-S6 5' MVIP09 - Gs fGs G U fU U fU fU fC U C G U U G A Cs As A 9 Ky-S7 5' MVIP01 - Gs fGs G U fU U fU fU fC U C G U U G A Cs As A - 3' MVIP01 10 Ky-S8 5' MVIP09 - Gs fGs G U fU U fU fU fC U C G U U G A Cs As A - 3' MVIP09 11 Ky-S9 5' MVIP17 - Gs fGs G U fU U fU fU fC U C G U U G A Cs As A - 3' MVIP17 12 Ky-S10 5' MVIP01 - Gs fGs G U fU U fU fU fC U C G U U G A Cs As A - 3' MVIP17 13 Ky-S11 5' MVIP17 - Gs fGs G U fU U fU fU fC U C G U U G A Cs As A - 3' MVIP01 14 Ky-S12 5' MVIP01 - Gs fGs G U fU U fU fU fC U C G U U G A Cs As A - 3' MVIP09 15 Ky-S13 5' MVIP09 - Gs fGs G U fU U fU fU fC U C G U U G A Cs As A - 3' MVIP01 16 Ky-S14 5' MVIP09 - Gs fGs G UfU U fU fU fC U C G U U G A Cs As A-3'MVIP1717Ky-S155'MVIP17-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3'MVIP0918Ky-S165'MVIP12-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A19Ky-S17Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3'MVIP1920Ky-S185'MVIP16-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3'MVIP1621Ky-S19Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3'MVIP1722Ky-S20Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3'MVIP1823Ky-S215'MVIP03-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A24Ky-S225'MVIP08-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A25Ky-S235'MVIP16-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A26Ky-S245'MVIP13-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3'MVIP0627Ky-S255'MVIP04-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3'MVIP0628Ky-S265'MVIP11-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A29Ky-S275'MVIP11-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3'MVIP1430Ky-S285'MVIP15-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A31Ky-S295'MVIP02-Gs fGs G UfU U fU fU fC U C G U U G A Cs As A32Ky-S305'MVIP05-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A33Ky-S315'MVIP06-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A34Ky-S325'MVIP07-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A35Ky-S335'MVIP10-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A36Ky-S345'MVIP14-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A37Ky-S355'MVIP18-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A38Ky-S36Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3'MVIP0239Ky-S37Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3'MVIP03

[0187] SEQ ID NO. Single-stranded code sense strand sequence 5'→3' (19mer) 40Ky-S38Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP0441Ky-S39 5' MVIP04-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP0442Ky-S40 5' MVIP03-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP1943Ky-S41 5' MVIP18-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP1844Ky-S42 5' MVIP08-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP1845Ky-S43Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP0546Ky-S44Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP0747Ky-S45Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP1048Ky-S46Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP1149Ky-S47 5' MVIP11-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP1150Ky-S48 5' MVIP15-Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP1551Ky-S49Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP0652Ky-S50Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP0853Ky-S51Gs fGs G U fU U fU fU fC U C G U U G A Cs As A-3' MVIP1254Ky-S52Gs fGs G U fU U fU fU fCUCGUUGA Cs As A-3'MVIP1355Ky-S53Gs fGs GU fU U fU fU fC UCGUUGA Cs As A-3'MVIP1456Ky-S54Gs fGs GU fU U fU fU fC UCGUUGA Cs As A-3'MVIP1557Ky-S55Gs fGs GU fU U fU fU fC UCGUUGA Cs As A-3'MVIP16

[0188] In some embodiments, the sense strand of the RNA inhibitors described herein differs from the sequences in Table 6 by one, two, or three nucleotides.

[0189] In some embodiments, the antisense strand of the RNA inhibitor is selected from Table 7 below:

[0190] Table 7: Antisense strands of RNA inhibitors

[0191] SEQ ID NO. Single-stranded code antisense strand sequence 5'→3' (21mer) 58Ky-AS uugucaacgagaaaaacccuu 59Ky-AS0 5' Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U 3' 60Ky-AS1 5' MVIP01-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U 61Ky-AS2 5' MVIP09-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U 62Ky-AS3 5' MVIP17-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U 63Ky-AS4 Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U - 3' MVIP01 64Ky-AS5 Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U - 3' MVIP09 65Ky-AS6 Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U - 3' MVIP17 66Ky-AS7 5' MVIP01-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U - 3' MVIP01 67Ky-AS8 5' MVIP09-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U - 3' MVIP09 68Ky-AS9 5' MVIP17-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U - 3' MVIP17 69Ky-AS10 5' MVIP01-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U - 3' MVIP17 70Ky-AS11 5' MVIP17-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U - 3' MVIP01 71Ky-AS12 5' MVIP01-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U - 3' MVIP09 72Ky-AS13 5' MVIP09-Us Us G U CA fA C G A G fA A fA fA A C C Cs Us U-3'MVIP0173Ky-AS145'MVIP09-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP1774Ky-AS155'MVIP17-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP0975Ky-AS165'MVIP12-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U76Ky-AS17Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP1977Ky-AS185'MVIP16-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP1678Ky-AS19Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP1779Ky-AS20Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP1880Ky-AS215'MVIP03-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U81Ky-AS225'MVIP08-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U82Ky-AS235'MVIP16-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U83Ky-AS245'MVIP13-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP0684Ky-AS255'MVIP04-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP0685Ky-AS265'MVIP11-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U86Ky-AS275'MVIP11-Us Us G U C A fA C GA G fA A fA fA A C C Cs Us U-3'MVIP1487Ky-AS285'MVIP15-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U

[0192] 88Ky-AS295'MVIP02-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U89Ky-AS305'MVIP05-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U90Ky-AS315'MVIP06-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U91Ky-AS325'MVIP07-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U92Ky-AS335'MVIP10-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U93Ky-AS345'MVIP14-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U94Ky-AS355'MVIP18-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U95Ky-AS36Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP0296Ky-AS37Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP0397Ky-AS38Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP0498Ky-AS395'MVIP04-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP0499Ky-AS405'MVIP03-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP19100Ky-AS415'MVIP18-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP18101Ky-AS425'MVIP08-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP18102Ky-AS43Us Us G U C AfA C G A G fA A fA fA A C C Cs Us U-3'MVIP05103Ky-AS44Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP07104Ky-AS45Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP10105Ky-AS46Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP11106Ky-AS475'MVIP11-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP11107Ky-AS485'MVIP15-Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP15108Ky-AS49Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP06109Ky-AS50Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP08110Ky-AS51Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP12111Ky-AS52Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP13112Ky-AS53Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP14113Ky-AS54Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP15114Ky-AS55Us Us G U C A fA C G A G fA A fA fA A C C Cs Us U-3'MVIP16

[0193] In some embodiments, the antisense strand of the RNA inhibitor of the present invention differs from each of the sequences in Table 7 by one, two or three nucleotides.

[0194] In some embodiments of in vitro and in vivo effect investigations, the sense strand or antisense strand of the RNA inhibitor is selected from the following Table 8:

[0195] Table 8: Sense or antisense strands of RNA inhibitors

[0196]

[0197]

[0198] In some embodiments, the sense strand or antisense strand of the RNA inhibitor described herein differs from each sequence in Table 8 by one, two, or three nucleotides.

[0199] In some embodiments, the HepG2.2.15 cell line was used to evaluate the effect of placing 5'MVIP and 3'MVIP at the corresponding ends of the sense strand (SEQ ID NO: 2) and / or antisense strand (SEQ ID NO: 59) on the reduction of HBsAg levels in HBV. The RNA inhibitor codes, the individual strands contained therein, and the SEQ ID NOs are shown in Table 9:

[0200] Table 9

[0201]

[0202]

[0203]

[0204]

[0205] In some embodiments, it is preferred that the combinations 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17, 5'MVIP09 / 3'MVIP09 are placed at the 5' end of the sense strand and the 3' end of the antisense strand.

[0206] In some embodiments, 5'MVIP01 / 3'MVIP09 and 5'MVIP09 / 3'MVIP01 are preferably placed at the 5' end and 3' end of the sense strand.

[0207] On the other hand, the present invention also provides a use of the above-mentioned RNA inhibitor or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating hepatic diseases, wherein the hepatic diseases include but are not limited to hepatitis, liver tumors, cirrhosis, jaundice, type 2 diabetes, fatty liver, coagulation diseases of the blood system, diseases related to blood albumin and globulin, hyperlipidemia, atherosclerosis, and essential hypertension.

[0208] In another aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned RNA inhibitor or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, wherein the pharmaceutical composition is in the form of an oral agent, an intravenous injection, or a subcutaneous or intramuscular injection, preferably a subcutaneous injection.

[0209] In another aspect, the present invention provides a pharmaceutical composition comprising the aforementioned RNA inhibitor or a pharmaceutically acceptable salt thereof and other drugs for treating hepatitis B. Other drugs for treating hepatitis B include, but are not limited to, clinically used nucleoside analogs or interferons, as well as candidate hepatitis B treatment drugs under development, such as immunomodulators. In one embodiment, the RNA inhibitor of the present invention was compared with tenofovir, a current first-line drug for the treatment of chronic hepatitis B, for their inhibitory effects on HBV HBsAg in a transgenic mouse model. The test results confirmed that the anti-hepatitis B drug nucleoside analog has no inhibitory effect on HBV HBsAg, and when used in combination, it does not affect the inhibitory effect of the RNA inhibitor of the present invention on HBsAg.

[0210] In some embodiments, the RNA inhibitors described herein are used in combination with entecavir or interferon, currently used as first-line treatments for chronic hepatitis B, to investigate their HBV inhibitory effects and any potential interactions. The study evaluated the HBV inhibitory effects of the RNA inhibitors described herein in combination with varying concentrations of entecavir or interferon in the widely used HepG2.2.15 cell line.

[0211] In some embodiments, a negative control siRNA having a positive strand of SEQ ID NO.: 146 and an antisense strand of SEQ ID NO.: 147 is used to investigate the inhibitory effects of the RNA inhibitor of the present invention on the four common HBV subtypes A, B, C, and D.

[0212] In some embodiments, the effect of different X, L, B, D, R1, and R2 in the 5'MVIP and / or 3'MVIP structures on the corresponding ends of the sense strand (SEQ ID NO: 2) and antisense strand (SEQ ID NO: 59) of the RNA inhibitor was investigated using the cell line HepG2.2.15 to evaluate the effect of the resulting RNA inhibitor on reducing HBsAg levels of HBV. When one of X, L, B, D, R1, and R2 is different, the other parts of the corresponding 5'MVIP and / or 3'MVIP are the same as those of 5'MVIP09 / 3'MVIP09.

[0213] In some embodiments, the cell line HepG2.2.15 was used to investigate the effects of different liver-targeting specific ligands X on the effect of the RNA inhibitor on reducing HBV HBsAg levels:

[0214] Table 10

[0215]

[0216] In some embodiments, the cell line HepG2.2.15 was used to investigate the effects of different branched chains L on the effects of the RNA inhibitors:

[0217] Table 11

[0218]

[0219]

[0220] Note: RNA inhibitors marked with * indicate that they are in the same 5'MVIP or 3'MVIP structure or that the L structures of 5'MVIP and 3'MVIP are different.

[0221] In some embodiments, the effect of linker B on the effect of the RNA inhibitor in reducing HBV HBsAg levels was investigated using the cell line HepG2.2.15:

[0222] Table 12

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230] Note: RNA inhibitors marked with * indicate that the linker B structures between 5'MVIP and 3'MVIP are different.

[0231] In some embodiments, the effect of connecting chain D on the effect of the RNA inhibitor on reducing HBV HBsAg levels was investigated using the cell line HepG2.2.15:

[0232] Table 13

[0233]

[0234]

[0235] Note: RNA inhibitors marked with * indicate that the connecting chain D structure between 5'MVIP and 3'MVIP is different.

[0236] In some embodiments, the cell line HepG2.2.15 was used to investigate the effects of different transfer points R1 on the effect of the RNA inhibitor on reducing the HBsAg level of HBV:

[0237] Table 14

[0238] R1 code RNA inhibitor code R1 structure R1-1Ky-22-NH(CH2)6O-R1-2Ky-22-R1-1-O(CH2)6O-R1-3Ky-22-R1-2-S(CH2)6O-R1-4Ky-22-R1-3-NH(CH2)8O-R1-5Ky-22-R1-4-NH(CH2)5CH(CH2CH3)O-R1-6Ky-22-R1-5-S(CH2)4CH(CH3)O-

[0239] In some embodiments, the cell line HepG2.2.15 was used to investigate the effects of different transfer points R2 on the effect of the RNA inhibitor on reducing the HBsAg level of HBV:

[0240] Table 15

[0241]

[0242]

[0243] In some embodiments, the sequence of the RNA inhibitor Ky-22 described in the present invention is further optimized and adjusted, including the examination of the sequence mer number, the allowed number of nucleotide differences, and the number of fluorinated and terminal thiolated groups. These adjustments affect the effect of the RNA inhibitor in reducing HBsAg levels and the duration of the effect. The sequence is shown in Table 16.

[0244] Table 16: Ky-22 sequence adjustment table

[0245]

[0246] The results of the implementation plan showed that compared with Ky-22, Ky-2201 with a sense chain length of 21-mer did not significantly improve the reduction of HBsAg levels and the duration of the effect, and even slightly reduced it. Therefore, the most preferred sense chain length of the RNA inhibitor provided by the present invention is 19-mer; compared with Ky-22, Ky-2203, which has one nucleotide change in both the sense chain and the antisense chain, had no significant effect on reducing HBsAg levels and the duration of the effect; based on the design of Ky-2203, there was no significant difference in the effect of Ky-2204 with a sense chain length of 21-mer and Ky-2203; Ky-2208, which has a relatively low number of fluorinated residues and modifies the number of fluorinated residues based on Ky-2203, showed slightly better efficacy than Ky-2203. The RNA inhibitors Ky-2205, obtained by modifying the two overhanging nucleotides at the 3' end of the sense strand of Ky-2204, Ky-2206, obtained by modifying the two overhanging nucleotides at the 3' end of the antisense strand of Ky-222, and Ky-2202, obtained by modifying the two overhanging nucleotides at the 3' end of the sense strand of Ky-2201, showed no significant difference in efficacy compared to the original inhibitors, indicating that the RNA inhibitors of the present invention tolerate differences of one to three nucleotides in either the sense or antisense strand. Compared to Ky-22, Ky-2207, obtained by eliminating the thiophosphates between the three consecutive nucleotides at the 5' end of the sense strand and the 3' end of the antisense strand, showed a significant effect on the reduction of HBsAg levels and the duration of the effect.

[0247] The present invention prefers sequences with a sense chain length of 19-mer and an antisense chain length of 21-mer, and allows differences of 1 to 3 nucleotides therein.

[0248] In some embodiments, the RNA inhibitor Ky-2208 was compared with the nucleoside analog tenofovir (TDF) for anti-HBV efficacy and combination therapy in a transgenic mouse model. The results showed that tenofovir (TDF) did not have the effect of reducing HBsAg, while Ky-2208 could effectively reduce HBsAg levels by up to 99.98%. The effect of the RNA inhibitor of the present invention was not affected when used in combination with tenofovir (TDF).

[0249] In some embodiments, the RNA inhibitors provided herein, including Ky-08, Ky-10, Ky-19, Ky-13, Ky-21, Ky-22, Ky-23, Ky-26, Ky-27, Ky-29, Ky-37, and Ky-39, were investigated for their inhibitory effects on HBsAg expression in HBV transgenic mouse models. The results showed that the RNA inhibitors Ky-19, Ky-26, Ky-37, and Ky-39 reduced HBsAg expression by 93.0% to 99.5% or greater in HBV transgenic mice for at least four consecutive weeks.

[0250] In some embodiments, the RNA inhibitor Ky-2208 provided by the present invention can reduce HBsAg levels by 98.2-99.6% in AAV-HBV mice for about 140 days and produce surface antibodies HBsAb in the body, indicating the possibility of functional cure of hepatitis B. BRIEF DESCRIPTION OF THE DRAWINGS

[0251] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings:

[0252] FIG1 is a high-resolution mass spectrum of ERCd-01-c2 synthesized in Example 1, 1.1.5;

[0253] FIG2 is a high-resolution mass spectrum of 3'MVIP17-c1 synthesized in Example 1, 1.2.6;

[0254] FIG3 is a high-resolution mass spectrum of 5'MVIP09-ERCd-PFP-c2 synthesized in Example 1, 2.1.2;

[0255] FIG4 is a graph showing the inhibitory effect of Ky-00 to Ky-26 on HBsAg levels in the cell line HepG2.2.15 in Example 2, Example 1;

[0256] Figure 5 is a graph showing the inhibitory effect of Ky-27 to Ky-44 on HBsAg levels in the cell line HepG2.2.15 in Example 2;

[0257] Figure 6 shows the effect of different X / L / D ratios on the effect of RNA inhibitors on reducing HBV HBsAg levels in Examples 3, 4, and 6 of Example 2;

[0258] FIG7 is a graph showing the effect of linker B on the effect of RNA inhibitors on reducing HBV HBsAg levels in Example 2, Example 5;

[0259] FIG8 is a diagram showing the effect of different transfer points R1 / R2 on the effect of RNA inhibitors in reducing HBV HBsAg levels in Examples 7 and 8 of Example 2;

[0260] Figure 9 is a graph showing the inhibitory effect of Ky-22 combined with entecavir or interferon on HBsAg in HepG2.2.15 cells in Example 9 of Example 2;

[0261] Figure 10 is a graph showing the inhibitory effect of Ky-22 combined with entecavir or interferon on HBeAg in HepG2.2.15 cells in Example 9 of Example 2;

[0262] Figure 11 is a graph showing the inhibitory effect of Ky-22 combined with entecavir or interferon on HBV DNA in HepG2.2.15 cells in Example 9 of Example 2;

[0263] Figure 12 is a graph showing the inhibitory effect of Ky-22 on four different genotypes (A, B, C, and D) of HBV cell lines in Example 2, Example 10;

[0264] FIG13 is a graph showing the HBsAg inhibitory effect of the RNA inhibitor in Example 1 of Example 3 on the HBV transgenic mouse model;

[0265] FIG14 is a diagram showing the inhibitory effect of Ky-22 sequence adjustment on HBsAg in HBV transgenic mice in Example 3, Example 2;

[0266] FIG15 is a graph showing the results of the dose-effect study of Ky-2208 in Example 3 of Example 3 on the AAV-HBV mouse model;

[0267] Figure 16 is a bar graph of HBsAb produced by Ky-2208 in Example 3 in the AAV-HBV mouse model;

[0268] FIG17 is a graph showing the results of the comparison and combination study of Ky-2208 and TDF in HBV-Tg mice in Example 3 and Example 4. DETAILED DESCRIPTION

[0269] The following examples illustrate some embodiments of the present disclosure, but are not intended to be limiting. Furthermore, when providing specific embodiments, the inventors contemplate the application of those specific embodiments. For example, RNA inhibitors with specific homologous or similar chemical structures may be used to treat various hepatic diseases.

[0270] illustrate:

[0271] The Chinese name of DMSO is dimethyl sulfoxide;

[0272] The Chinese name of DMF is N,N-dimethylformamide;

[0273] The Chinese name of HOBt is 1-hydroxybenzotriazole;

[0274] The Chinese name of HBTU is O-benzotriazole-tetramethyluronium hexafluorophosphate;

[0275] The Chinese name of DIPEA (DIEA) is N,N-diisopropylethylamine;

[0276] The Chinese name of DCM is dichloromethane;

[0277] The Chinese name of DMAP is 4-dimethylaminopyridine;

[0278] The Chinese name of DMT-CL is 4,4'-dimethoxytriphenylmethane;

[0279] The Chinese name for MEOH is methanol;

[0280] The Chinese name of TBTU is O-benzotriazole-N,N,N',N'-tetramethyluronium tetrafluoroborate;

[0281] The name of the solid phase carrier is macroporous aminomethyl resin (Resin).

[0282] Example 1. Synthesis of RNA inhibitors Ky-19, Ky-22, Ky-2208, Ky-26, Ky-37, and Ky-39

[0283] The RNA inhibitor described herein is prepared using the solid-phase phosphoramidite method to obtain the respective sense and antisense strands. The sense and antisense strands are then complementary annealed to yield the final product. The basic steps of the solid-phase phosphoramidite method include: 1) deprotection: removal of the hydroxyl protecting group (DMTr) of the starting monomer Solid Support; 2) coupling: addition of the first phosphoramidite monomer, and coupling reaction from the 3' to 5' direction; 3) oxidation: oxidation of the resulting nucleoside phosphite to a more stable nucleoside phosphate (i.e., oxidation of trivalent phosphorus to pentavalent phosphorus); and 4) blocking: blocking the 5'-OH group of the unreacted nucleotide monomer from the previous step to prevent further reaction. These steps are repeated until the last phosphoramidite monomer is added. Methylamine aqueous solution and ammonia are then used to cleave the ester bond between the Solid Support and the starting monomer, and the protecting groups (cyanoethyl (P), benzoyl (mA, fA), and acetyl (mC)) on the phosphate groups of the resulting oligonucleotides are removed. After HPLC separation and purification, filtration, sterilization, and lyophilization are performed to yield the corresponding sense or antisense strand.

[0284] After annealing, accurately determine the concentrations of the reconstituted solutions of the sense and antisense chains. Mix them at equimolar concentrations, then add 1 / 20 volume of 1M PBS solution and mix again. Heat the mixture to 95°C for 5 minutes, then cool it naturally for 3 hours to 40°C or room temperature. Perform HPLC detection. If the single-strand residue is <5%, the reaction is considered complete.

[0285] When the 3' end of the sense strand or antisense strand of the RNA inhibitor of the present invention has 3'MVIP, the solid support of 3'MVIP serves as the starting monomer for solid phase synthesis. The general formula of the solid support of 3'MVIP is as follows:

[0286]

[0287] When m is 1-4, the linker B in the general formula is branched 1 to 4 times to obtain the corresponding Solid Support of 3'MVIP.

[0288] When m is 1, the obtained Solid Support serves as the starting monomer for the solid-phase synthesis of the antisense chain of the RNA inhibitor Ky-26 and the sense chain of Ky-39; when m is 2, the obtained Solid Support serves as the starting monomer for the solid-phase synthesis of the sense chain of the RNA inhibitor Ky-37 and the antisense chains of Ky-22 and Ky-2208; when m is 3, the obtained Solid Support serves as the starting monomer for the solid-phase synthesis of the antisense chain of the RNA inhibitor Ky-19.

[0289] When the 5' end of the sense strand or antisense strand of the RNA inhibitor of the present invention has 5'MVIP, the 5'MVIP phosphoramidite monomer is the last phosphoramidite monomer in the solid phase synthesis of the sense strand or antisense strand. The general formula of the 5'MVIP phosphoramidite monomer is as follows:

[0290]

[0291] When n is 1-4, the linker B in the general formula is branched 1 to 4 times to obtain the corresponding 5'MVIP phosphoramidite monomer.

[0292] When n is 1, the resulting 5'MVIP phosphoramidite monomer serves as the last monomer in the solid-phase synthesis of the positive strands of the RNA inhibitors Ky-19, Ky-26, and Ky-37; when n is 2, the resulting 5'MVIP phosphoramidite monomer serves as the last monomer in the solid-phase synthesis of the positive strands of Ky-39, Ky-22, and Ky-2208.

[0293] Before the solid-phase phosphoramidite synthesis of the sense and antisense strands of the RNA inhibitors described in the present invention, the corresponding 3'MVIP solid support and 5'MVIP phosphoramidite monomers must be chemically synthesized. The chemical synthesis process is described as follows:

[0294] 1. Synthesis of 3'MVIP Solid Support

[0295] 1.1 Synthesis of the 3'MVIP09 Solid Support for the Sense Strand of the RNA Inhibitor Ky-37 and the Antisense Strands of Ky-22 and Ky-2208

[0296]

[0297] 3'MVIP09's Solid Support

[0298] Description of the synthesis process:

[0299] 1.1.1. Synthesis of ERC-01-c1

[0300]

[0301] Weigh 2-amino-1,3-propanediol (5.0 g, 54.9 mmol) and add 50 mL of DMSO and 5 mL of sodium hydroxide solution (1 g / mL). Cool to 0°C and add tert-butyl acrylate (20 mL, 137.8 mol) dropwise over 2 hours. Let react at room temperature for 48 hours. Add petroleum ether (100 mL), wash twice with saturated brine, and dry the organic layer. Pass the mixture through a chromatography column (eluent: ethyl acetate:petroleum ether = 25%-75%). Add 0.05% triethylamine to the column to obtain 6.2 g of a colorless oil.

[0302] 1.1.2. Synthesis of ERC-01-c2

[0303]

[0304] Weigh ERC-01-c1 (6.2 g, 17.9 mmol), add 50 mL of dichloromethane and 23 mL of sodium carbonate solution (25%), and add benzyl chloroformate (8.2 mL, 57.4 mmol) dropwise at room temperature for 2 hours. React at room temperature overnight, wash three times with saturated brine, dry over anhydrous sodium sulfate, evaporate the solvent, and pass through a chromatography column (ethyl acetate: petroleum ether = 5%-30%) to obtain 4.0 g of an oil.

[0305] 1.1.3. Synthesis of ERC-01-c3

[0306]

[0307] ERC-01-c2 (4.0 g, 8.3 mmol) was added with 12 mL of formic acid, and the mixture was reacted at room temperature overnight. The solvent was evaporated under reduced pressure to obtain 2.8 g of the product.

[0308] 1.1.4. Synthesis of ERCd-01-c1

[0309]

[0310] Compounds ERC-01-c3 (1.11 g, 3.0 mmol) and dlSANC-c4 (3.6 g, 8.04 mmol) were added to DMF (60 mL), followed by HOBt (2.24 g) and HBTU (3.36 g), and then DIEA (4.16 mL) was slowly added. The reaction mixture was stirred at room temperature for 3 hours. Water was then added, and the aqueous layer was extracted with dichloromethane (2 x 10 mL). The organic layers were combined and washed sequentially with saturated sodium bicarbonate (80 mL), water (2 x 60 mL), and saturated brine (60 mL). The mixture was dried over anhydrous sodium sulfate, evaporated to dryness under reduced pressure, and purified by silica gel column chromatography (eluent: 3-15% MeOH in DCM). 3.24 g of a pale yellow solid was obtained.

[0311] 1.1.5. Synthesis of ERCd-01-c2

[0312]

[0313] ERCd-01-c1 (3.24 g, 2.6 mmol) was dissolved in methanol (60 mL), and 10% palladium on carbon (0.3 g) and acetic acid (2.0 mL) were added. Hydrogenation was then added under normal pressure, and the reaction was allowed to proceed overnight. The reaction solution was filtered through celite, and the filtrate was evaporated to dryness under reduced pressure to obtain 22.9 g of ERCd-01-c as an oil. Its high-resolution mass spectrum is shown in Figure 1.

[0314] 1.1.6.3' Synthesis of MVIP09-c1

[0315]

[0316] SANCd-01-c0 (0.824 g, 1.5 mmol) and ERCd-01-c2 (1.09 g, 1.0 mmol) were added to the reaction flask in sequence, and then 10 mL of DCM was added and stirred to dissolve. TBTU (0.963 g) and DIPEA (0.517 g) were added in sequence, and the reaction was allowed to proceed overnight. Water was added and the mixture was extracted with DCM. The organic phase was washed with saturated brine, dried, filtered, concentrated, and finally purified by silica gel column to obtain 1.3 g of the product.

[0317] 1.1.7. Synthesis of 3'MVIP09-c2

[0318]

[0319] 3'MVIP09-c1 (1.62 g, 1 μmol) and 10 mL of DCM were added to the reaction flask in sequence, stirred at room temperature to dissolve, and then DMAP (0.366 g) and succinic anhydride (0.2 g, 3 μmol) were added in sequence. The reaction was stirred at room temperature and analyzed by TLC. If the reaction was qualified, DCM was concentrated and water was added. The mixture was extracted with DCM, and the organic phase was washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, filtered, concentrated, and finally purified by silica gel column to obtain 1.55 g of the product.

[0320] 1.1.8. Solid Support Synthesis of 3'MVIP09

[0321]

[0322] 3'MVIP09-c2 (0.86 g, 0.5 μmol) and 10 mL of DMF were added to the reaction flask in sequence and dissolved. HBTU (0.19 g), DIPEA (0.194 g), and macroporous aminomethyl resin (2.0 g) were then added in sequence. The mixture was shaken for 24 h and filtered. The resin was washed with 10% methanol / DCM and capped with 25% acetic acid / pyridine. The degree of substitution was 150 μmol / g.

[0323] 1.2 Synthesis of the Solid Support of 3'MVIP17 Antisense Strand of RNA Inhibitor Ky-19

[0324]

[0325] 3'MVIP17 Solid Support

[0326] 1.2.1. Synthesis of SANC-01-c1

[0327]

[0328] The synthesis steps were similar to those in 1.1.1. ERC-01-c1 in Example 1.

[0329] 1.2.2. Synthesis of SANC-01-c2

[0330]

[0331] The synthesis steps were similar to those in 1.1.2. Synthesis of ERC-01-c2 in Example 1.

[0332] Synthesis of SANC-01-c3

[0333]

[0334] The synthesis steps were similar to those in 1.1.3. ERC-01-c3 in Example 1.

[0335] 1.2.4. Synthesis of SANCd-01-c1

[0336]

[0337] The synthesis steps were similar to those in 1.1.4. ERCd-01-c1 in Example 1.

[0338] 1.2.5. Synthesis of SANCd-01-c2

[0339]

[0340] The synthesis steps were similar to those in 1.1.5. ERCd-01-c2 in Example 1.

[0341] 1.2.6. Synthesis of 3'MVIP17-c1

[0342]

[0343] The synthesis steps were similar to those described in 1.1.6.3'MVIP09-c1 in Example 1. The high-resolution mass spectrum of the synthesized 3'MVIP17-c1 is shown in FIG2 .

[0344] 1.2.7. Synthesis of 3'MVIP17-c2

[0345]

[0346] The synthesis steps were similar to those of 1.1.7.3'MVIP09-c2 in Example 1.

[0347] 1.2.8. Solid Support Synthesis of 3'MVIP17

[0348]

[0349] The synthesis steps were similar to those in Example 1, Section 1.1.8: Solid Support Synthesis of 3'MVIP09.

[0350] 1.3 Synthesis of the Solid Support of 3'MVIP01 of the Antisense Strand of RNA Inhibitor Ky-26 and the Sense Strand of Ky-39:

[0351]

[0352] 3'MVIP01 Solid Support

[0353] Description of the synthesis process:

[0354] Synthesis of 3'MVIP01-c1

[0355]

[0356] The synthesis steps were similar to those of 1.1.6.3'MVIP09-c1 in Example 1.

[0357] Synthesis of 3'MVIP01-c2

[0358]

[0359] The synthesis steps were similar to those of 1.1.7.3'MVIP09-c2 in Example 1.

[0360] 1.3.3. Solid Support Synthesis of 3'MVIP01

[0361]

[0362] The synthesis steps were similar to the Solid Support synthesis of 1.1.8.3'MVIP09 in Example 1.

[0363] 2. Synthesis of 5'MVIP Phosphoramidite Monomer

[0364] 2.1 When n is 2, the obtained 5'MVIP phosphoramidite monomer is used as the last monomer 5'MVIP09 phosphoramidite monomer in the solid phase synthesis of the positive chain of Ky-22, Ky-2208, and Ky-39:

[0365]

[0366] 5'MVIP09 phosphoramidite monomer

[0367] 2.1.1. Synthesis of 5'MVIP09-ERCd-PFP-c1

[0368]

[0369] ERCd-01-c2 (2.18 g, 2.0 mmol) was weighed and dissolved in DMF (50 mL). Benzyl glutarate (0.53 g, 2.4 mmol), DIPEA (0.78 g) and TBTU (0.84 g) were added and stirred at room temperature overnight. The mixture was quenched with water (50 mL) and extracted with DCM (30 mL*3). The mixture was washed with 10% citric acid (50 mL*3), saturated sodium bicarbonate (50 mL) and pyridine (100 mL). The mixture was dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain the product 5'MVIP09-ERCd-PFP-c1 (2.15 g).

[0370] 2.1.2. Synthesis of 5'MVIP09-ERCd-PFP-c2

[0371]

[0372] 5'MVIP09-ERCd-PFP-c1 (2.15 g, 1.66 mmol) and 10% palladium on carbon (0.21 g) were weighed, methanol (50 mL) was added, and hydrogenation was carried out at room temperature with stirring overnight. After the reaction, the palladium on carbon was filtered through celite and rotary evaporation was performed to obtain a crude product of 5'MVIP09-ERCd-PFP-c2 (1.9 g). Its high-resolution mass spectrum is shown in Figure 3.

[0373] 2.1.3. Synthesis of 5'MVIP09-ERCd-PFP

[0374]

[0375] The crude product of 5'MVIP09-ERCd-PFP-c2 (1.9 g, 1.58 mmol) was weighed and dissolved in DCM (60 mL). DIPEA (1.33 g) was added and cooled. Pentafluorophenol trifluoroacetate (2.21 g, 7.9 mmol) was added and stirred at room temperature for 2 h before rotary evaporation. The product was redissolved in DCM (60 mL) and washed with saturated sodium bicarbonate (30 mL*3), 10% citric acid (30 mL*1), and saturated brine (50 mL*1). The product was dried over anhydrous sodium sulfate, filtered, and rotary evaporation was performed to obtain the crude product of 5'MVIP09-ERCd-PFP (2.35 g). The product was dried and used directly in the next reaction without purification.

[0376] 2.1.4. Synthesis of 5'MVIP09 phosphoramidite monomer-c1

[0377]

[0378] The crude 5'MVIP09-ERCd-PFP product (2.35 g, 1.58 mmol) was dissolved in DCM (60 mL) and DIPEA (0.82 g, 6.32 mmol) and 6-amino-1-hexanol (0.37 g, 3.16 mmol) were added. The mixture was stirred at room temperature overnight. 10% citric acid (30 mL) was added and the mixture was extracted with DCM (30 mL x 3). The product was washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, rotary evaporated, and purified by column chromatography to obtain 5'MVIP09 monomer-c1 (1.73 g).

[0379] 2.1.5. 5'MVIP09 phosphoramidite monomer

[0380]

[0381] 5'MVIP09 phosphoramidite monomer-c1 (1.3 g, 1.0 mmol) was weighed and dissolved in acetonitrile (30 mL). Diisopropylamine triazole (0.22 g) was added, and bis-(diisopropylamino)(2-cyanoethoxy)phosphine (0.36 g, 1.2 mmol) was added dropwise under ice bath. The reaction was carried out at room temperature for 4 h. The reaction was controlled by HPLC. After the reaction was qualified, the product 5'MVIP09 monomer (1.2 g) was concentrated and purified by column.

[0382] 2.2 When n is 1, the obtained 5'MVIP phosphoramidite monomer is used as the last monomer 5'MVIP01 in the solid phase synthesis of the positive chain of Ky-19, Ky-26, and Ky-37:

[0383]

[0384] 5'MVIP01 phosphoramidite monomer

[0385] 5'MVIP01 phosphoramidite monomer YICd-01-c2 (1.12 g, 2.0 mmol) was weighed, and the remaining operations were carried out according to 2.1.1. to 2.1.5.

[0386] Example 2: In vitro test

[0387] Example 1: The cell line HepG2.2.15 was used to evaluate the effect of RNA inhibitors obtained by coupling 5'MVIP and 3'MVIP to different ends of the sense strand and antisense strand to reduce the HBsAg level of HBV.

[0388] Description of the experimental process: Prepare the corresponding RNA inhibitors Ky-00 to Ky-26 according to the method described in Example 1, prepare DMEM culture medium containing 10% fetal bovine serum. Use the culture medium to prepare culture medium containing 0.05, 0.5, and 5nM RNA inhibitor samples. 5HepG2.2.15 cells were inoculated with 10% fetal bovine serum DMEM culture medium at 37°C and 5% CO2 for 24 hours. Then, different concentrations of the above-mentioned RNA inhibitor samples were added for intervention. After incubation for 72 hours, the supernatant was collected and compared with the supernatant of HepG2.2.15 cells without intervention using an HBsAg detection kit (Shanghai Kehua, ELISA method) to calibrate the relative percentage of HBsAg in the sample intervention group.

[0389] The obtained test data are shown in Figure 4. As shown in Figure 4, Ky-19, Ky-22 and Ky-26 have better inhibitory effects on HBsAg than other compounds.

[0390] Example 2: Using the cell line HepG2.2.15, the effect of the RNA inhibitors obtained by placing 5'MVIP and 3'MVIP simultaneously at both ends of the sense or antisense strand of the RNA inhibitor or placing 5'MVIP or 3'MVIP simultaneously at the same end of the antisense and sense strands, such as the 3' end or the 5' end, on reducing the HBsAg level of HBV was evaluated.

[0391] Description of the experimental process: Prepare the corresponding RNA inhibitors Ky-27 to Ky-44 according to the method described in Example 1, prepare DMEM culture medium containing 10% fetal bovine serum. Use the culture medium to prepare culture medium containing 0.05, 0.5, and 5nM RNA inhibitor samples. 5 HepG2.2.15 cells were seeded at a low density in DMEM medium with 10% fetal bovine serum at 37°C and 5% CO2 for 24 hours. The cells were then treated with various concentrations of the aforementioned RNA inhibitors. After 72 hours of incubation, the supernatants were collected and compared using an HBsAg detection kit (Shanghai Kehua, ELISA) with the supernatants from untreated HepG2.2.15 cells to determine the relative percentage of HBsAg in the treated groups. The resulting experimental data are shown in Figure 5.

[0392] As shown in FIG5 , Ky-37 and Ky-39 have better inhibitory effects on HBsAg than other compounds.

[0393] Example 3: Using the cell line HepG2.2.15 to evaluate the effect of different liver-targeting specific ligands X on the effect of RNA inhibitors on reducing HBV HBsAg levels

[0394] The effects of different liver-targeting specific ligands X on the effect of RNA inhibitors in reducing HBV HBsAg levels were investigated. Among the RNA inhibitors obtained, Ky-22, Ky-22-X2 to Ky-22-X6 had the same L, B, D and R1 / R2 as those in the combination 5'MVIP09 / 3'MVIP09, except for the change in X structure.

[0395] The sense strand of the RNA inhibitor involved in the experiment is SEQ ID NO: 2, and the antisense strand is SEQ ID NO: 59. The 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0396] Description of the experimental process: Prepare the corresponding RNA inhibitor according to the method described in Example 1, prepare DMEM culture medium containing 10% fetal bovine serum. Use the culture medium to prepare a culture medium containing 10nM RNA inhibitor sample. 5 HepG2.2.15 cells were inoculated at a high cell density in 10% fetal bovine serum DMEM medium at 37°C and 5% CO2. After culturing for 24 hours, drug intervention was added. After incubation for 72 hours, the supernatant was collected and compared with the supernatant of HepG2.2.15 cells without intervention using an HBsAg detection kit (Shanghai Kehua, ELISA method) to calibrate the relative percentage of HBsAg in the sample intervention group.

[0397] The obtained experimental data are shown in Figure 6. The results show that when X is galactose, galactosamine, N-acetylgalactosamine and its derivatives, the obtained RNA inhibitor preferably uses N-acetylgalactosamine and its derivatives as ligands.

[0398] Example 4: Using the cell line HepG2.2.15 to evaluate the effect of different branched L on the effect of RNA inhibitors on reducing HBV HBsAg levels

[0399] The effects of different branched chains L on the effect of RNA inhibitors in reducing HBV HBsAg levels were investigated. The obtained RNA inhibitors Ky-22, Ky-22-L2 to Ky-22-L14 had the same X, B, D and R1 / R2 as those in the combination 5'MVIP09 / 3'MVIP09 except for the change in L structure.

[0400] The sense strand of the RNA inhibitor involved in the experiment is SEQ ID NO: 2, and the antisense strand is SEQ ID NO: 59. The 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0401] Description of the experimental process: Prepare the corresponding RNA inhibitor according to the method described in Example 1, prepare DMEM culture medium containing 10% fetal bovine serum. Use the culture medium to prepare a culture medium containing 10nM RNA inhibitor sample. 5 HepG2.2.15 cells were inoculated at a high cell density in 10% fetal bovine serum DMEM medium at 37°C and 5% CO2. After culturing for 24 hours, drug intervention was added. After incubation for 72 hours, the supernatant was collected and compared with the supernatant of HepG2.2.15 cells without intervention using an HBsAg detection kit (Shanghai Kehua, ELISA method) to calibrate the relative percentage of HBsAg in the sample intervention group.

[0402] The experimental data obtained are shown in Figure 6. The results show that the length of L significantly affects the efficacy of RNA inhibitors, and the L chain should be neither too short nor too long. When containing -NH-, C=O, O, S, amide, phosphoryl, thiophosphoryl, aliphatic carbocyclic groups such as cyclohexane, or combinations of these groups, or within the same 5'MVIP or 3'MVIP structure, or with different L structures between 5'MVIP and 3'MVIP, and within the chain length range of C7-C18, the resulting RNA inhibitors have similar effects on reducing HBsAg levels in HBV.

[0403] Example 5: Using the cell line HepG2.2.15 to evaluate the effect of linker B on the effect of RNA inhibitors on reducing HBV HBsAg levels

[0404] The effects of different linker Bs on the effectiveness of RNA inhibitors in reducing HBV HBsAg levels were investigated. The resulting RNA inhibitors Ky-22, Ky-22-B2 to Ky-22-B7, Ky-19, Ky-19-B2 to Ky-19-B12, Ky-26, Ky-26-B2 to Ky-26-B7, Ky-37, Ky-37-B2 to Ky-37-B6, Ky-39, Ky-39-B2 to Ky-39-B6, except for the structural changes in B, X, L, D, and R1 / R2 were consistent with those in the combination 5'MVIP09 / 3'MVIP09.

[0405] The sense strand of the RNA inhibitor involved in the experiment is SEQ ID NO: 2, and the antisense strand is SEQ ID NO: 59. The 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0406] Description of the experimental process: Prepare the corresponding RNA inhibitor according to the method described in Example 1, prepare DMEM culture medium containing 10% fetal bovine serum. Use the culture medium to prepare a culture medium containing 10nM RNA inhibitor sample. 5 HepG2.2.15 cells were inoculated at a high cell density in 10% fetal bovine serum DMEM medium at 37°C and 5% CO2. After culturing for 24 hours, drug intervention was added. After incubation for 72 hours, the supernatant was collected and compared with the supernatant of HepG2.2.15 cells without intervention using an HBsAg detection kit (Shanghai Kehua, ELISA method) to calibrate the relative percentage of HBsAg in the sample intervention group.

[0407] The resulting test data are shown in Figure 7. The results show that, except for the structural changes in Linker B, when X, L, D, and R1 / R2 are consistent with those in the 5'MVIP09 / 3'MVIP09 combination, A1 and A2 in the general formula of Linker B are independently C, O, S, -NH-, carbonyl, amide, phosphoryl, or thiophosphoryl, r is an integer from 0 to 4, and when Linker B is the same or different between 5'MVIP and 3'MVIP, the HBsAg-lowering effect is similar.

[0408] Example 6: Using the cell line HepG2.2.15 to evaluate the effect of linker D on the effect of RNA inhibitors on reducing HBV HBsAg levels

[0409] The effects of different connecting chains D on the effect of RNA inhibitors in reducing HBV HBsAg levels were investigated. The obtained RNA inhibitors Ky-22, Ky-22-D2 to Ky-22-D5 had the same X, L, B and R1 / R2 as the most preferred MVIP combination 5'MVIP09 / 3'MVIP09, except for the change in D structure.

[0410] The sense strand of the RNA inhibitor involved in the experiment is SEQ ID NO: 2, and the antisense strand is SEQ ID NO: 59. The 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0411] Description of the experimental process: Prepare the corresponding RNA inhibitor according to the method described in Example 1, prepare DMEM culture medium containing 10% fetal bovine serum. Use the culture medium to prepare a culture medium containing 10nM RNA inhibitor sample. 5 HepG2.2.15 cells were inoculated at a high cell density in 10% fetal bovine serum DMEM medium at 37°C and 5% CO2. After culturing for 24 hours, drug intervention was added. After incubation for 72 hours, the supernatant was collected and compared with the supernatant of HepG2.2.15 cells without intervention using an HBsAg detection kit (Shanghai Kehua, ELISA method) to calibrate the relative percentage of HBsAg in the sample intervention group.

[0412] The experimental data obtained are shown in Figure 6. The results show that when the MVIP structure and RNA inhibitor are the same, different connecting chains D will affect the HBsAg inhibition effect of the RNA inhibitor, among which D1, D2, and D4 have similar effects and are better than D3.

[0413] Example 7: Using the cell line HepG2.2.15 to evaluate the effect of different R1 on the effect of RNA inhibitors on reducing HBV HBsAg levels

[0414] The effects of different transfer points R1 on the effect of RNA inhibitors in reducing HBV HBsAg levels were investigated. The RNA inhibitors Ky-22, Ky-22-R1-1 to Ky-22-R1-5 obtained had X, L, B, D and R2 consistent with the most preferred MVIP combination 5'MVIP09 / 3'MVIP09 except for the structural change of R1.

[0415] The sense strand of the RNA inhibitor involved in the experiment is SEQ ID NO: 2, and the antisense strand is SEQ ID NO: 59. The 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0416] Description of the experimental process: Prepare the corresponding RNA inhibitor according to the method described in Example 1, prepare DMEM culture medium containing 10% fetal bovine serum. Use the culture medium to prepare a culture medium containing 10nM RNA inhibitor sample. 5 HepG2.2.15 cells were inoculated at a high cell density in 10% fetal bovine serum DMEM medium at 37°C and 5% CO2. After culturing for 24 hours, drug intervention was added. After incubation for 72 hours, the supernatant was collected and compared with the supernatant of HepG2.2.15 cells without intervention using an HBsAg detection kit (Shanghai Kehua, ELISA method) to calibrate the relative percentage of HBsAg in the sample intervention group.

[0417] The obtained experimental data are shown in Figure 8. The results show that different transfer points R1 will affect the effect of RNA inhibitors in inhibiting HBsAg, among which R1-1 as the transfer point has the best effect in reducing HBsAg levels.

[0418] Example 8: Using the cell line HepG2.2.15 to evaluate the effect of different R2 on the effect of RNA inhibitors on reducing HBV HBsAg levels

[0419] The effects of different transition sites (R2) on the effectiveness of RNA inhibitors in reducing HBV HBsAg levels were investigated. The resulting RNA inhibitors, Ky-22, Ky-22-R2-1, Ky-22-R2-11, and Ky-22-R2-2, except for the structural changes in R2, had X, L, B, D, and R1 identical to those in the optimal MVIP combination 5'MVIP09 / 3'MVIP09. The corresponding RNA inhibitors were prepared according to the method described in Example 1.

[0420] The sense strand of the RNA inhibitor involved in the experiment is SEQ ID NO: 2, and the antisense strand is SEQ ID NO: 59. The 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0421] Description of the experimental process: Prepare the corresponding RNA inhibitor according to the method described in Example 1, prepare DMEM culture medium containing 10% fetal bovine serum. Use the culture medium to prepare a culture medium containing 10nM RNA inhibitor sample. 5 HepG2.2.15 cells were inoculated at a high cell density in 10% fetal bovine serum DMEM medium at 37°C and 5% CO2. After culturing for 24 hours, drug intervention was added. After incubation for 72 hours, the supernatant was collected and compared with the supernatant of HepG2.2.15 cells without intervention using an HBsAg detection kit (Shanghai Kehua, ELISA method) to calibrate the relative percentage of HBsAg in the sample intervention group.

[0422] The obtained experimental data are shown in Figure 8. The results show that different transfer points R2 will affect the effect of RNA inhibitors in reducing HBsAg levels, among which R2-1 as the transfer point has the best effect in reducing HBsAg levels.

[0423] Example 9 Ky-22 is used in combination with entecavir or interferon, the current first-line drugs for the treatment of chronic hepatitis B, to investigate whether there is any mutual interference in the inhibitory effect on HBV

[0424] The experiment evaluated the inhibitory effect of the RNA of the present invention on HBV in combination with different concentrations of entecavir (ETV) or interferon (IFN-a) in the widely used HepG2.2.15 cell line.

[0425] The sense strand of the RNA inhibitor Ky-22 involved in the experiment is SEQ ID NO: 2, and the antisense strand is SEQ ID NO: 59. The 5' end of the sense strand is coupled to 5'MVIP, and the 3' end of the antisense strand is coupled to 3'MVIP.

[0426] Description of the experimental process: Prepare DMEM culture medium containing 10% fetal bovine serum. Use the culture medium to prepare culture medium containing 10nM RNA inhibitor Ky-22 sample. 5 HepG2.2.15 cells were inoculated at a high cell density in 10% fetal bovine serum DMEM medium at 37°C and 5% CO2. After culturing for 24 hours, drug intervention was added. After incubation for 72 hours, the supernatant was collected to detect HBsAg, HBeAg, and HBV DNA. The relative percentages of HBsAg, HBeAg, and HBV DNA in the intervention group were calibrated by comparing with those in the supernatant of HepG2.2.15 cells without intervention.

[0427] The dosing concentration is:

[0428] ETV: 10μM, 1μM, 0.1μM;

[0429] IFN-a: 1000IU / mL, 100IU / mL, 10IU / mL;

[0430] Ky-22: 0.125 μg / mL;

[0431] ETV+Ky-22: 10μM+0.125μg / mL, 1μM+0.125μg / mL, 0.1μM+0.125μg / mL;

[0432] IFN-a+Ky-22: 1000IU / mL+0.125μg / mL, 100IU / mL+0.125μg / mL, 10IU / mL+0.125μg / mL

[0433] The effects of the RNA inhibitor Ky-22 on HBsAg and HBeAg levels in HepG2.2.15 cells are shown in Figures 9 and 10, respectively. The results show that entecavir or interferon alone had no significant inhibitory effect on HBsAg and HBeAg, while the combination of entecavir or interferon with Ky-22 exhibited a significant inhibitory effect on HBsAg and HBeAg, with the degree of inhibition being unrelated to the concentration of entecavir or interferon. Entecavir or interferon did not affect the HBsAg and HBeAg effects of the RNA inhibitors of the present invention. The combined use of the RNA inhibitor Ky-22 with entecavir or interferon also did not affect the inhibitory effects of entecavir or interferon on HBV DNA and even enhanced the effects of interferon on HBV DNA. The data are shown in Figure 11. The RNA inhibitors of the present invention can be used in combination with entecavir and interferon.

[0434] Example 10 Study on the inhibitory effect of Ky-22 on four different genotypes (A, B, C, D) of HBV cell lines

[0435] Description of the test process:

[0436] Cell line construction: Based on HepG2 cells, HBV gene integration was performed using the Sleeping Beauty transposon system; cell culture conditions: DMEM + 10% FBS, 37°C, 5% CO2. HBV 1.3 ploid genes of four different genotypes (A, B, C, D) were cloned by Gibson. The master mix was linked to the PT2 / HB vector, along with a red fluorescent protein and puromycin resistance gene, to serve as markers for cell line screening. The constructed plasmids were co-transfected with pCMV(CAT)T7-SB100 and into HepG2 cells using X-tremeGENE HP DNA Transfection Reagent. The transfection protocol was as follows: The transfection system for a 10 cm dish was prepared according to the manufacturer's instructions. The cells were allowed to rest for 20 minutes. HepG2 cells reaching 70% confluence were digested into a cell suspension, added to the prepared transfection system, mixed thoroughly, and incubated in an incubator. 48 hours after transfection, 2 μg / mL puromycin resistance was used for selection. Cells that did not express puromycin resistance, i.e., cells that had not integrated HBV, died. Cells with HBV integration were then amplified and sorted by flow cytometry to identify cells with high red fluorescence intensity, indicating a high HBV copy number. Four cell lines with different genotypes harboring stable HBV integration were obtained.

[0437] HBV stably integrated cells of genotypes A, B, C, and D in the logarithmic growth phase were digested into a cell suspension and added to a 48-well plate (300 μl / well), with approximately 300,000 cells per well. When the cell confluence reached 70% (approximately 24 hours after plating), Ky-22 or negative control siRNA (sense chain SEQ ID NO.: 146, antisense chain SEQ ID NO.: 147) was added at the following concentrations:

[0438] 4.1μg / mL, 2.2μg / mL, 1.1μg / mL, 0.6μg / mL, 0.3μg / mL, 0.15μg / mL, 0.0725μg / mL, 0.03625μg / mL, 0.018125μg / mL, 0 .0090625μg / mL, 0.00453125μg / mL, 0.00226563μg / mL, 0.00113281μg / mL, 0.000566406μg / mL, 0.000283203μg / mL

[0439] The supernatant was collected at 24, 48, and 72 hours after incubation, stored at -20°C, and replaced with fresh medium without drug. The HBsAg content in the cell supernatant was determined.

[0440] The experimental data are shown in Figure 12. The results show that compared with the negative control siRNA treatment group (Control), Ky-22 has a significant inhibitory effect on HBV genotypes A, B, C, and D, with EC50 (ng / mL) of 22.72, 25.45, 29.06, and 23.35, respectively.

[0441] Example 3 In vivo efficacy study

[0442] Example 1: Study on the effect of RNA inhibitors on reducing HBsAg in HBV transgenic mouse models

[0443] The corresponding RNA inhibitors Ky-08, Ky-10, Ky-13, Ky-19, Ky-21, Ky-22, Ky-23, Ky-26, Ky-27, Ky-29, Ky-37 and Ky-39 were prepared according to the method described in Example 1. 65 male HBV transgenic mice weighing 25-35 g and aged 8-10 weeks were selected and housed in an SPF-grade animal room with a humidity of 16-26°C, a temperature of 40-70%, and a cyclic light cycle (12 hours of light and dark). Food and water were available freely.

[0444] HBV HBsAg was detected before the animals were grouped. The animals were randomly divided into groups according to the expression level of HBV HBsAg, and the average level of HBV HBsAg in each group was kept consistent as much as possible. The mice were divided into 13 groups, with 5 mice in each group, including a control group (normal saline), and treatment groups 1 to 12. The dosage was 3 mg / kg, a single dose, and the day of administration was set as d0. The mice in each group were subcutaneously injected with the corresponding test solution at 0.04 mL / 10 g on d0. The animal observation time ranged from 4 to 6 weeks, and blood was collected at d0, d7, d14, d21, d28, d35, and d42. Whole blood was collected from the orbital venous plexus of the mice at each blood collection time in each group, centrifuged at 3000×g for 5 minutes, and the supernatant was collected to detect the expression level of HBV HBsAg.

[0445] The HBsAg levels of the animals in each drug-treated group were normalized to those before drug administration and the control group. The experimental data are shown in FIG13 .

[0446] The results showed that the RNA inhibitors described herein all demonstrated significant reductions in HBV HBsAg levels within the first three weeks, with the best reduction rate reaching 99.8%. Due to the different locations of coupling with 5'MVIP and / or 3'MVIP, the duration of the HBsAg-lowering effect varied among the RNA inhibitors. Ky-19, Ky-22, Ky-26, Ky-29, Ky-37, and Ky-39 maintained a 93% or greater reduction in HBV HBsAg levels on day 28, with Ky-22 demonstrating the most sustained effect, maintaining a 91% or greater reduction in HBV HBsAg levels on day 35.

[0447] Example 2: Investigating the Effect of Ky-22 Sequence Adjustment on HBsAg Inhibition in HBV Transgenic Mice

[0448] The corresponding RNA inhibitors Ky-22, Ky-2201 to Ky-2208 were prepared according to the method described in Example 1. Fifty male HBV transgenic mice weighing 25-35 g and aged 8-13 weeks were selected and housed in an SPF-grade animal room with a humidity of 16-26°C, a temperature of 40-70%, and a cyclic lighting cycle (12 hours of light and dark). Food and water were available freely.

[0449] HBV HBsAg was detected before grouping the animals. The animals were randomly divided into groups based on HBV HBsAg expression, and the average HBV HBsAg level in each group was kept consistent as much as possible. The mice were divided into 10 groups, each with 5 mice, a control group (normal saline) and a treatment group (9 groups). The dosage was 3 mg / kg, a single dose, and the day of administration was designated as d0. Each group of mice was subcutaneously injected with the corresponding test solution at 0.04 mL / 10 g on d0. The animals were observed for 6 weeks, and blood was collected at d0, d7, d14, d21, d28, d35, and d42. Whole blood was collected from the orbital venous plexus of the mice in each group at each blood collection time, centrifuged at 3000 × g for 5 minutes, and the supernatant was collected for the detection of HBV HBsAg expression.

[0450]

[0451] The HBsAg levels of animals in each treatment group were normalized to those before treatment and the control group.

[0452] The experimental data are shown in Figure 14. The results show that compared with Ky-22, Ky-2201 with a sense chain length of 21-mer did not significantly improve the reduction of HBsAg levels and the duration of the effect, and even slightly reduced it. Therefore, the optimal sense chain length of the RNA inhibitor provided by the present invention is 19-mer; compared with Ky-22, Ky-2203 with one nucleotide change in both the sense chain and the antisense chain had no significant effect on the reduction of HBsAg levels and the duration of the effect; based on the design of Ky-2203 The efficacy of Ky-2204, a 21-mer sense strand, and Ky-2203 showed no significant difference. Ky-2208, a 21-mer construct with a relatively low number of fluorinated residues, showed slightly better efficacy than Ky-2203. The RNA inhibitors Ky-2205 and Ky-2206, obtained by modifying the two dangling nucleotides at the 3' end of the sense or antisense strands, showed no significant difference in efficacy compared to the original inhibitors. This suggests that the RNA inhibitors of the present invention tolerate a 1 to 3 nucleotide difference between the sense and antisense strands. Compared to Ky-22, Ky-2207, which eliminates the thiophosphates between three consecutive nucleotides at the 5' end of the sense strand and the 3' end of the antisense strand, showed a significant effect on the HBsAg-lowering effect and duration of effect.

[0453] The present invention prefers sequences with a sense chain length of 19-mer and an antisense chain length of 21-mer, and allows differences of 1 to 3 nucleotides therein.

[0454] Example 3: Investigating the dose-response of Ky-2208 in the AAV-HBV mouse model, the effect of repeated single-dose administration on HBsAg reduction, and whether it can produce surface antibodies HBsAb

[0455] Description of the experimental process: 36 mice of appropriate age were housed in a barrier facility for about 7 days and observed daily. The experiment was conducted after no obvious abnormalities were found. HBV virus was first thawed at 4°C and rAAV8-1.3HBV (Wujiahe Company, ayw, virus batch number: A2020051801) was injected into the tail vein of the mice using an insulin syringe. Each mouse was injected with 1×10 11 vg. Four weeks after modeling, blood was collected from the animals, centrifuged, and serum was collected and tested for HBsAg. Six weeks after modeling, blood was collected to test for HBsAg in the serum. Based on the HBsAg test results, 30 mice were randomly divided into five groups, with the average HBsAg level in each group being maintained as consistent as possible. Dosing began two weeks after grouping, and blood was collected on the day of dosing for HBsAg testing, designated as day 0. The dosing information and blood collection points for each group are shown in the following table:

[0456]

[0457] The HBsAg levels of the animals in each drug-treated group were normalized to those before drug administration and the control group. The obtained experimental data of HBsAg and HBsAb are shown in Figures 15 and 16, respectively.

[0458] The test results showed that during the entire 140-day observation period, the 9mg / kg group of Ky-2208 could reduce the HBsAg level in the AAV-HBV mouse model by 93.1%-99.6%. The repeated dosing group was observed up to 112 days, and the inhibitory effect remained above 95%. By the 98th day, the surface antibody HBsAb was detected in the HBV model mice with a single dose, generating new anti-HBV immunity in the mice.

[0459] Example 4: Comparative study and combined use of Ky-2208 with tenofovir (TDF), the current first-line drug for the treatment of chronic hepatitis B, to investigate the HBV HBsAg inhibitory effect and whether there is any interference effect in the HBV transgenic mouse model

[0460] Experimental Procedure Description: 48 male HBV-Tg mice, weighing 25-35g and aged 8-13 weeks, were housed in an SPF-compliant animal room with a humidity of 16-26°C, a temperature of 40-70%, and a cyclical lighting cycle (12 hours of light and dark). They had free access to food and water. The compounds were prepared in saline, with a working concentration of 0.75 mg / mL. HBV HBsAg expression was measured before grouping. The 48 male mice were randomly divided into six groups of eight mice each, aiming to maintain consistent average HBV HBsAg levels across groups. Six groups were included in the experiment, including one control group (0.9% saline) and five treatment groups. A single dose of the test compound was administered subcutaneously on day 0, with mice in each group receiving 0.04 mL / 10 g of the test solution. Whole blood was collected from the mouse orbital venous plexus on d0 before administration and on d7, d14, d21 and d28 after administration, and centrifuged at 3000×g for 5 min. The supernatant was collected and sent for HBV HBsAg detection on d0, d7, d14, d21 and d28.

[0461] The specific dosage regimen is shown in the table below:

[0462]

[0463] Note: sc means subcutaneous injection, po means oral administration.

[0464] The resulting test data are shown in Figure 17. These results confirm that the nucleoside analog anti-hepatitis B drug TDF has no inhibitory effect on HBV HBsAg, and when used in combination, it does not affect the inhibitory effect of the RNA inhibitor described herein on HBsAg. Ky-2208 alone or in combination with TDF can reduce HBsAg levels by up to 99.95% and 99.98%, respectively.

Claims

1. An RNA inhibitor for inhibiting hepatitis B virus gene expression or a pharmaceutically acceptable salt thereof, wherein, The RNA inhibitor is formed by base pairing of a sense strand and an antisense strand with a chain length of 15-30, wherein the chain length is preferably 19-23.

2. The RNA inhibitor according to claim 1, or a pharmaceutically acceptable salt thereof, wherein, The sense and antisense strands are at least 85% complementary in bases; The -OH group at the 2' position of some or all of the nucleotide glycosyl groups in the sense or antisense strand may be substituted, wherein the substituent group is fluorine or methoxy. Furthermore, the ends of the sense or antisense strands must have at least three adjacent phosphate ester bonds that can be thiolated.

3. The RNA inhibitor according to claim 2, or a pharmaceutically acceptable salt thereof, wherein, The sense strand is SEQ ID NO.1 or a sequence differing from it by one, two, or three nucleotides; the antisense strand is SEQ ID NO.58 or a sequence differing from it by one, two, or three nucleotides. Chain of Justice: 5'ggguuuuucucguugacaa 3' SEQ ID NO.:1 Antonym chain: 5'uugucaacgagaaaaacccuu 3' SEQ ID NO.:58 Where g = guanylic acid, a = adenosine acid, u = uridine acid, and c = cytidine acid.

4. The RNA inhibitor according to claim 3, or a pharmaceutically acceptable salt thereof, wherein, The sense strand is SEQ ID NO.2 or a sequence differing from it by one, two, or three nucleotides; the antisense strand is SEQ ID NO.59 or a sequence differing from it by one, two, or three nucleotides. Justice strand: 5'Gs fGs GU fU U fU fU fC UCGUUGA Cs As A 3' SEQ ID NO.:2 Antisense strand: 5'Us Us GUCA fA CGAG fA A fA fA ACC Cs Us U 3' SEQ ID NO.:59 Wherein, G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanosine, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanosine, fA = 2'-fluoroadenosine, fU = 2'-fluorouridine, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanosine, fAs = 2'-fluoro-3'-thioadenosine, fUs = 2'-fluoro-3'-thiouridine, fCs = 2'-fluoro-3'-thiocytidine.

5. The RNA inhibitor according to claim 2 or 3, or a pharmaceutically acceptable salt thereof, wherein, The sense strand is SEQ ID NO.140 or a sequence differing from it by one, two, or three nucleotides; the antisense strand is SEQ ID NO.141 or a sequence differing from it by one, two, or three nucleotides. Chain of Justice: 5'ggguuuuucuuguugacaa 3' SEQ ID NO.:140 Antonym chain: 5'uugucaacaagaaaaacccuu 3' SEQ ID NO.:141 Where g = guanylic acid, a = adenosine acid, u = uridine acid, and c = cytidine acid.

6. The RNA inhibitor according to claim 5, or a pharmaceutically acceptable salt thereof, wherein, The sense strand is SEQ ID NO.142 or a sequence differing from it by one, two, or three nucleotides; the antisense strand is SEQ ID NO.143 or a sequence differing from it by one, two, or three nucleotides. Justice chain: 5'Gs Gs GU fU U fU fU fC UUGUUGA Cs As A 3' SEQ ID NO.:142 Antisense strand: 5'Us Us GUCA fA CAAG fA A fA AACC Cs Us U 3' SEQ ID NO.:143 Wherein, G = 2'-O-methylguanosine, A = 2'-O-methyladenosine, U = 2'-O-methyluridine, C = 2'-O-methylcytidine; Gs = 2'-O-methyl-3'-thioguanosine, As = 2'-O-methyl-3'-thioadenosine, Us = 2'-O-methyl-3'-thiouridine, Cs = 2'-O-methyl-3'-thiocytidine; fG = 2'-fluoroguanosine, fA = 2'-fluoroadenosine, fU = 2'-fluorouridine, fC = 2'-fluorocytidine; fGs = 2'-fluoro-3'-thioguanosine, fAs = 2'-fluoro-3'-thioadenosine, fUs = 2'-fluoro-3'-thiouridine, fCs = 2'-fluoro-3'-thiocytidine.

7. The RNA inhibitor according to any one of claims 1-6, or a pharmaceutically acceptable salt thereof, wherein, The RNA inhibitor also contains a combination of 5'MVIP and 3'MVIP, wherein, The 5'MVIP and 3'MVIP are ligand structures with liver-targeting specific ligand X, and also include a branched chain L, a linker B, and a connecting chain D. The 5'MVIP is coupled to the end of the positive chain and / or negative chain 5', and it also includes a transition point R1 connected to the end of the positive chain or negative chain 5'; The 3'MVIP is coupled to the end of the antisense chain and / or the justice chain 3', and includes a transition point R2 connected to the end of the justice chain or antisense chain 3'. The structure of the 5' MVIP is shown in general formula I, and the structure of the 3' MVIP is shown in general formula II. in, n and m are integers from 0 to 4, preferably integers from 1 to 3, and n+m = integers from 2 to 6, preferably n+m = 2, 3 or 4, more preferably 4; The transition points R1 and R2 contain -NH-, sulfur, or oxygen atoms, and generally have at least one -NH-, sulfur, or oxygen atom. R1 and R2 are connected to the connecting chains D of 5'MVIP and 3'MVIP, as well as the 5' and 3' ends of the sense and / or antisense chains, respectively, through the -NH-, sulfur, or oxygen atoms in the structure. The transition points R1 and R2 can be straight chains; straight chains with amide, carboxyl, or alkyl branches; or various cyclic structures, such as saturated or unsaturated aliphatic carbocyclic groups, or five- or six-membered heterocyclic groups or aromatic hydrocarbon groups containing sulfur, oxygen, or nitrogen atoms. R1 is preferably -NH(CH2) x CH2O-, where x is an integer from 3 to 12, preferably an integer from 4 to 6; R2 is preferably -NH(CH2) x1 CH(OH)(CH2) x2 CH2O-, where x1 is an integer from 1 to 4, and x2 is an integer from 0 to 4; The liver-targeting specific ligand X is selected from galactose, galactosamine, N-acetylgalactosamine and its derivatives, preferably N-acetylgalactosamine and its derivatives, and the liver-targeting specific ligand X can be the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP; The branch L is a C4-C18 straight chain containing -NH-, C=O, O, S, amide group, phosphoryl group, thiophosphoryl group, C4-C10 aliphatic carbocyclic group, phenyl, or a combination of these groups. The C4-C18 straight chain may have ethyl alcohol or carboxylic acid side chains. The branch L is preferably a C7-C18 straight chain containing amide group or six-membered aliphatic carbocyclic group. The branch L may be the same or different within each of 5'MVIP and 3'MVIP or between 5'MVIP and 3'MVIP. The connector B is selected from the following structures: Wherein, A1 and A2 are each independently C, O, S, -NH-, carbonyl, amide, phosphoryl or thiophosphoryl, r is an integer from 0 to 4, and the connector B can be the same or different between 5'MVIP and 3'MVIP; The linking chain D is a C3-C18 straight chain containing -NH-, C=O, O, S, amide group, phosphoryl group, thiophosphoryl group, aromatic hydrocarbon group, C4-C10 aliphatic carbocyclic group, five- or six-membered heterocyclic group containing 1-3 nitrogen atoms, or a combination of these groups. The C3-C18 straight chain may have side chains of methyl alcohol, methyl tert-butyl, methylphenol, or C5-C6 aliphatic cyclic group. The linking chain D is preferably a C3-C10 straight chain containing two C=O atoms, a six-membered aliphatic carbocyclic group, or a phenyl group, and most preferably a C3-C10 straight chain containing two C=O atoms.

8. The RNA inhibitor according to claim 7, or a pharmaceutically acceptable salt thereof, wherein, The 5'MVIP is 5'MVIP01 or 5'MVIP09 as shown below, and the 3'MVIP is 3'MVIP01, 3'MVIP09 or 3'MVIP17 as shown below:

9. The RNA inhibitor according to claim 8, or a pharmaceutically acceptable salt thereof, wherein, The combination of the justice chain 5'MVIP and the antisense chain 3'MVIP is 5'MVIP01 / 3'MVIP01, 5'MVIP01 / 3'MVIP17, or 5'MVIP09 / 3'MVIP09, or the combination of the justice chain 5'MVIP and the justice chain 3'MVIP is 5'MVIP01 / 3'MVIP09 or 5'MVIP09 / 3'MVIP01.

10. The use of the RNA inhibitor or a pharmaceutically acceptable salt thereof as described in any one of claims 1-9 in the preparation of a medicament for treating hepatogenic diseases, wherein, The liver-related diseases include, but are not limited to, hepatitis, liver tumors, cirrhosis, jaundice, type 2 diabetes, fatty liver, coagulation disorders of the blood system, albumin and globulin-related diseases, hyperlipidemia, atherosclerosis, and essential hypertension.

11. A pharmaceutical composition comprising any one of claims 1-9 of an RNA inhibitor or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient, wherein the dosage form is an oral, intravenous, or subcutaneous or intramuscular injection, preferably a subcutaneous injection.

12. A pharmaceutical composition comprising an RNA inhibitor as described in any one of claims 1-9 or a pharmaceutically acceptable salt thereof and a nucleoside analog or interferon for treating chronic hepatitis B.