Messenger RNA (mRNA) contains the unnatural 3' non-translational region, the DNA that codes for this mRNA, and the component containing it.

Abstract

The invention proposes mRNA containing an unnatural 3'UTR that is active in increasing the mRNA synthesis efficiency of a gene; a component containing mRNA; a component, containing mRNA, for delivering mRNA or polypeptide to an individual; and DNA encoding mRNA.

Description

Non-Native 3'Untranslated Regions and Their Uses

[0001] It relates to non-natural 3'untranslated regions and their uses.

[0002] Messenger RNA (MRNA) is frequently used as an alternative to plasmid DNA as a gene delivery molecule in cancer immunotherapy and stem cell-based biomedical research. As a direct source of gene product, mRNA offers several advantages, including the absence of nuclear entry, which represents a significant barrier to DNA delivery, particularly in non-dividing cells. Furthermore, mRNA is highly unlikely to integrate into the host genome, avoiding the expression of oncogenes through aberrant transcription and insertional mutagenesis.

[0003] For a given gene, the untranslated region (UTR), including the 5'UTR and 3'UTR, is the region involved in expression regulation. The 5'UTR is a regulatory region of DNA located at the 5' end of all protein-coding sequences that are transcribed into mRNA but not translated into protein. The 5'UTR can contain various regulatory elements, such as a 5' cap structure, a G-quadruplex structure (G4), a stem-loop structure, and an internal ribosome entry site (IRES), which play a crucial role in controlling translation initiation. The 3'UTR, located downstream of the protein-coding sequence, is known to be involved in many regulatory processes, including transcript cleavage, stability, polyadenylation, translation, and mRNA localization. The 3'UTR serves as a binding site for many regulatory proteins and small noncoding RNAs (e.g., microRNAs).

[0004] Current mRNA therapies typically rely on native or standard UTR sequences, which are often non-tissue-specific or provide low-level protein expression. There is a need for novel 3'UTRs and their combinations that can stabilize therapeutic mRNAs and increase protein synthesis.

[0005] One aspect provides an mRNA comprising a non-native 3'untranslated region (3'UTR).

[0006] Another aspect provides DNA encoding the mRNA.

[0007] Another aspect provides a method of obtaining mRNA, comprising the step of transcribing mRNA using the DNA as a template.

[0008] Another aspect provides a method of obtaining a polypeptide, comprising the step of translating said mRNA.

[0009] Another aspect provides a composition comprising the mRNA.

[0010] Another aspect provides a method of utilizing said mRNA comprising the step of introducing said mRNA into a host cell.

[0011] As used herein, “5’untranslated region (5’UTR)” refers to a region of an mRNA that is directly upstream (i.e., 5’) from the initiation codon, i.e., the first codon of an mRNA transcript translated by the ribosome, that does not encode a polypeptide.

[0012] In this specification, "3' untranslated region (3'UTR)" refers to a region of an mRNA that is directly downstream (i.e., 3') from a stop codon, i.e., a codon of an mRNA transcript that signals translation termination, that does not encode a polypeptide.

[0013] As used herein, an "open reading frame (ORF)" or "sequence encoding a polypeptide" refers to a contiguous region of DNA that begins with an initiation codon, for example, a methionine codon (ATG), and ends with a stop codon, for example, TAA, TAG, or TGA, and encodes a polypeptide.

[0014] As used herein, "polyadenylate sequence", "polyA", or "polyA tail" refers to a region of an mRNA downstream, for example directly downstream (i.e., 3') from a 3'UTR, that comprises a plurality of consecutive adenine nucleotides. The polyA tail may comprise no more than 1,000, 500, 400, or 300 adenine nucleotides. For example, the polyA tail may comprise from 10 to 300 adenine nucleotides. For example, the polyA tail can comprise 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 adenine nucleotides. The polyA tail can comprise, for example, 50 to 250 adenine nucleotides. In a living organism, such as a cell or an organism, the polyA tail can protect mRNA from attack by enzymes, for example, enzymes in the cytoplasm, and can assist in transcription termination, export of mRNA from the nucleus, and translation. The 3' polyA tail is a stretch of adenine nucleotides that is typically added to transcribed or immature mRNA during mRNA processing.

[0015] As used herein, the term "operably linked" refers to nucleotide sequences on a single nucleic acid fragment being linked such that one function is influenced by the other. For example, a promoter is operably linked to a coding sequence (e.g., an open reading frame (ORF)) if it can influence the expression of the coding sequence (i.e., if the coding sequence is under the transcriptional control of the promoter). The coding sequence may be operably linked to a regulatory sequence in either the sense or antisense orientation. Unless otherwise stated herein, each nucleic acid sequence included in a claimed mRNA or DNA is considered operably linked.

[0016] In this specification, unless otherwise stated with respect to the position of the nucleotide sequence, it refers to being connected or positioned in the direction from the 5' end to the 3' end.

[0017] As used herein, the term "vector" or "nucleic acid construct" refers to any nucleic acid capable of transporting a gene or ORF or DNA fragment into a cell. The vector may, for example, be capable of replicating in a cell. The vector may be a virus, a bacteriophage, a provirus, a plasmid, a phagemid, a transposon, or an artificial chromosome such as a yeast artificial chromosome (YAC), a bacterial artificial chromosome (BAC), a plant artificial chromosome (PLAC), etc.

[0018] The first aspect is an mRNA containing a non-native 3'untranslated region (3'UTR).

[0019] The above 3'UTR has a secondary structure indicated by the dot-bracket notation below, or

[0020] .(((((...........(((...((((.((((.((((....))).))))))...)))..((((((..((((....((((((.(((((.......))))))..))))))))))))...) ...

[0021] or has a secondary structure indicated by the dot-bracket notation below,

[0022] (((((((((...(((((.((........(((((((((.........)))))))))))))))))).....((((...)))).....))))))))))))))..(((((((((((((....)))))))...))))))).....((((((...)))))))))))..........

[0023] Here, the dot indicates that the bases in the sequence are unpaired, and "(" and ")" indicate that they are paired. As used herein, the term "secondary structure" refers to the bond between base pairs.

[0024] The mRNA containing the above 3'UTR has an average free energy for RNA folding of -0.1 to -0.3 kcal / mol,

[0025] (a) The secondary structure of the mRNA including the above 3'UTR

[0026] .(((((...........(((...((((.((((.((((....))).))))))...)))..((((((..(((((....((((((.((((.......))))))..)))))))))))))...) ...

[0027] (b) The secondary structure of the mRNA including the above 3'UTR

[0028] ((((((((((...((((((.((........(((((((((.........))))))))))))))))))).....((((...)))).....))))))))))))))..(((((((((((((....))))))))...))))))).....((((((...) ...

[0029] The mRNA including the above 3'UTR may include a sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 1 to 8.

[0030] The 3'UTR having the secondary structure of (a) above may include any one of the nucleotide sequences of SEQ ID NOs: 1 to 5. The 3'UTR having the secondary structure of (b) above may include any one of the nucleotide sequences of SEQ ID NOs: 6 to 8.

[0031] The mRNA may be comprised of any one of the nucleotide sequences of SEQ ID NOs: 1 to 8. The mRNA may be an isolated nucleic acid, for example, a transcript, comprising any one of the nucleotide sequences of SEQ ID NOs: 1 to 8. The transcript may comprise a coding sequence for a target protein.

[0032] The mRNA may further comprise a sequence encoding a polypeptide. The sequence encoding the polypeptide may be operably linked to the 3'UTR at an upstream position of the 3'UTR.

[0033] The above polypeptide may be an antigenic or therapeutic polypeptide. The antigenic polypeptide may be a viral antigenic polypeptide.

[0034] The therapeutic polypeptide may be any polypeptide having disease-treating activity, for example, anticancer activity. The polypeptide having anticancer activity may be a tumor suppressor, an immune stimulating protein, a radiation enhancing protein, or a chemotherapy enhancing protein. An example of a tumor suppressor may be a protein that participates in the cell cycle regulation of cancer cells themselves and thus has anticancer activity. Immune cells involved in the immune stimulation may include B cells, NK cells, T cells, or mast cells. The polypeptide having anticancer activity may not be antigenic to the host cell or the organism containing the same. The polypeptide having anticancer activity may be an antibody, a hormone, a cytokine, an enzyme, a derivative thereof, or a combination thereof. Furthermore, the polypeptide having anticancer activity may inhibit the proliferation of cancer cells. The polypeptide may be a recombinant polypeptide comprising a fusion protein.

[0035] The sequence encoding the polypeptide may be codon-optimized. The codon optimization may vary depending on the host cell into which the mRNA molecule is introduced. Furthermore, the sequence encoding the polypeptide may include a degenerate sequence.

[0036] The mRNA may further comprise an expression regulatory sequence. The expression regulatory sequence may be involved in translational regulation or mRNA stability. The expression regulatory sequence may be a Kozak sequence, a 5'UTR, or a polyA sequence.

[0037] The above 3'UTR, the sequence encoding the polypeptide, and the expression control sequence may be transcribed in vitro or in vivo and may be a common transcript.

[0038] The above 5'UTR may be operably linked upstream to a sequence encoding the polypeptide.

[0039] The above 5'UTR may be derived from any gene. The above 5'UTR may synergistically increase the expression efficiency of RNA when combined with the above 3'UTR.

[0040] The above polyA sequence may be operably linked downstream of the 3'UTR.

[0041] The above 3'UTR may have an activity that increases translation efficiency, stability of the RNA, or a combination thereof, compared to when a natural 3'UTR is used.

[0042] In one embodiment, the mRNA comprises a "5' cap", such as Cap0, Cap1, and Cap2. The term "5' cap" refers to a cap structure found at the 5' end of an mRNA molecule. The 5' cap is typically a 7-methylguanine ribonucleotide linked to the mRNA via a 5'-triphosphate at the 5' position of the first nucleotide of the 5'-to-3' chain of the mRNA. In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both contain a 2'-hydroxyl group. In Cap1, the riboses of the first and second cap-proximal nucleotides of the mRNA each contain a 2'-methoxyl group and a 2'-hydroxyl group, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA each contain a 2'-methoxyl group. The above 7-methylguanine ribonucleotide may be further modified. For example, the modified 7-methylguanine ribonucleotide may be 7-methylguanine 3'-methoxy (7mG(3'OMe)) or one in which the 2'-hydroxyl and 3'-hydroxyl are independently substituted with a sulfonyl-containing group, for example, a sulfonyl-containing group selected from the group consisting of a mesyl group, an esyl group, a triflyl group, a tresyl group, a tosyl group, a brosyl group, a nosyl group, and a dansyl group. A modified 7-methylguanine ribonucleotide substituted with a sulfonyl-containing group may be, for example, 7-methylguanine 3'-mesyl (7mG(3'OMs)). Most endogenous higher eukaryotic mRNAs, including mammalian mRNAs such as human mRNA, contain either a cap1 or a cap2. Cap0, and other cap structures different from Cap1 and Cap2, may be immunogenic in mammals such as humans.

[0043] The cap may be introduced co-transcriptionally. For example, the 5' cap or 5' cap analog may be introduced into a transcript produced by in vitro transcription of a DNA template in the presence of the 5' cap or 5' cap analog.

[0044] Additionally, the cap may be introduced into the RNA post-transcriptionally. A 5' cap or a 5' cap analogue may be introduced into the RNA post-transcriptionally by a capping enzyme, for example, a capping enzyme of vaccinia virus. The 5' terminal sequence at which the 5' terminal cap structure is formed may include, for example, 7mG(5')ppp(5')ApG, m7G(3'OMe)(5')ppp(5')ApG, m7G(3'OMe)(5')ppp(5')(2'OMeA)pG, m7G(3'OMs)(5')ppp(5')(2'OMeA)pG, or m7G(5')ppp(5')(2'OMeA)pG.

[0045] In one embodiment, the mRNA may comprise modified nucleotides. In one embodiment, the mRNA may have one or more Us substituted with N1-methyl-pseudouridine. In the mRNA, the 5'-terminal sequence with a 5' cap may have a cap structure of m7(3'OMeG)(5')ppp(5')(2'OMeA)pG or m7(3'OMsG)(5')ppp(5')(2'OMeA)pG. In the mRNA, all Us may be substituted with N1-methyl-pseudouridine. The above mRNA may have a 5' terminal sequence in which all U's are substituted with N1-methyl-pseudouridine and a 5' cap is formed, which may have a cap structure of m7(3'OMeG)(5')ppp(5')(2'OMeA)pG or m7(3'OMsG)(5')ppp(5')(2'OMeA)pG.

[0046] The mRNA may comprise a nucleotide sequence of any one of SEQ ID NOs: 1 to 8, wherein at least one U in the sequence may be substituted with N1-methyl-pseudouridine. The mRNA may be wherein all U in the sequence are substituted with N1-methyl-pseudouridine.

[0047] A second aspect provides a method of obtaining a polypeptide, comprising the step of translating said mRNA comprising a sequence encoding a polypeptide.

[0048] A third aspect provides a composition comprising the mRNA as an active ingredient. The composition may be for delivering the mRNA or a product expressed thereby to a subject.

[0049] The fourth aspect provides a composition for inducing a therapeutic response or an immune response to a polypeptide comprising mRNA or a product expressed thereby, comprising said mRNA as an active ingredient.

[0050] In the third and fourth aspects, the composition may be immunogenic or may be used to treat a disease. The disease may vary depending on the selected polypeptide. The disease may be, for example, an infection caused by a virus or foreign cell, cancer, a metabolic disease, inflammation, a gastrointestinal disease, an endocrine disease, sepsis, or an autoimmune disease. In the above diseases, the foreign cell may be a prokaryotic or eukaryotic cell. The foreign cell may be a bacterium.

[0051] The mRNA may comprise a nucleotide sequence encoding a polypeptide. The polypeptide may be an antigenic or therapeutic polypeptide. The antigenic polypeptide may be a viral antigenic polypeptide. The polypeptide is as described in the first aspect.

[0052] Additionally, the mRNA may have anticancer activity by regulating the expression of other genes, such as siRNA or miRNA.

[0053] The composition may be contacted with a cell, tissue or organism in an “effective amount” of the mRNA.

[0054] The effective amount can be determined based on the target tissue, target cells, administration method, physical characteristics of the mRNA (e.g., size and content of modified nucleosides), and other components of the composition. Generally, an effective amount of the composition can elicit an induced or boosted immune response as a function of antigen production in the cell.

[0055] The composition may be administered intramuscularly, subcutaneously, intradermally, nasally or pulmonary.

[0056] The composition may include one or more pharmaceutically acceptable carriers or excipients. The mRNA in the composition may be formulated or complexed with the carriers or excipients. The carriers or excipients may be those known in the art.

[0057] The relative amounts of the active ingredient, pharmaceutically acceptable carrier or excipient, and / or other additional ingredients included in the composition may vary depending on the identity, size, and / or condition of the subject to be treated and the route of administration. For example, the composition may comprise from 0.1% to 100%, for example, from 0.5% to 50%, from 1.0% to 30%, from 5.0% to 80%, or greater than 80% (w / w) of the active ingredient.

[0058] The composition may be formulated as a nanoparticle. The nanoparticle may be known to be used for delivering a polynucleotide, such as mRNA, to a cell. For example, the nanoparticle may be a known nanoparticle used in an RNA vaccine. The nanoparticle may be a lipid nanoparticle (LNP). The composition may be formulated as a lipid nanoparticle (LNP) or may be bound to an LNP. The binding may include binding within or to the surface of an LNP. For example, the composition may be formulated within a lipid polycation complex or may be bound to a lipid polycation complex. The lipid polycation complex is also referred to as a cationic lipid nanoparticle. The polycation may comprise a cationic polypeptide such as MC3, Lipid 319, C12-200, 5A2-SC8, 306Oi10, Moderna Lipid 5, Acuitas A9, SM-102, ALC-0315, Arcturus Lipid 2,2(8,8) 4C CH3, Genevant CL1, polylysine, polyornithine, and / or polyarginine. Additionally, the composition may be formulated or bound to lipid nanoparticles comprising a sterol such as 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC), dipalmitoyl phosphatidylcholine (DPPC), cholesterol, or a non-cationic lipid such as dioleoyl phosphatidylethanolamine (DOPE).Additionally, the composition may be formulated or bound to lipid nanoparticles comprising PEG-lipids such as 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (PEG2000-DMG), 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159), and polyethylene glycol dimethacrylate (PEG-DMA).

[0059] The lipid nanoparticle formulation can include a cationic lipid, a phospholipid, a sterol such as cholesterol, a PEG-lipid, or a combination thereof. The lipid nanoparticle formulation can include, for example, a cationic lipid, a phospholipid, a sterol such as cholesterol, and a PEG-lipid. Additionally, the lipid nanoparticle can include a PEG-modified lipid, a non-cationic lipid, a sterol, and an ionizable lipid, or a combination thereof. The lipid nanoparticle can include 0.5 to 15 mol % PEG-modified lipid, 5 to 25 mol % non-cationic lipid, 25 to 55 mol % sterol, and 20 to 60 mol % ionizable lipid. The PEG-modified lipid may be 1,2 dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG2000-DMG), the non-cationic lipid may be 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol may be cholesterol, and the ionizable cationic lipid may be compound 1 having the following structure.

[0060]

[0061] (Compound 1)

[0062] The PEG-modified lipid may be compound 2 (ALC-0159) having the following structure, the non-cationic lipid may be 1,2 distearoyl-sn-glycero-3-phosphocholine (DSPC), the sterol may be cholesterol, and the ionizable cationic lipid may be compound 3 (ALC-0315) having the following structure.

[0063]

[0064] (Compound 2)

[0065]

[0066] (Compound 3)

[0067] A fifth aspect provides a method of utilizing mRNA, comprising the step of introducing said mRNA into a host cell.

[0068] In the above method, the host cell may be any cell derived from an individual. The individual may be a mammal, including a human. The cell may be, for example, a stem cell, a germ cell, or a somatic cell. In the above method, the host cell may be an antigen-presenting cell, including a dendritic cell, a monocyte, or a macrophage.

[0069] The method may comprise administering the mRNA to a subject. The administration may be parenteral or oral. The administration may be intramuscular, subcutaneous, intradermal, nasal, or intrapulmonary. The subject may be a mammal, including a human.

[0070] The method may be to immunize an individual against a polypeptide or to induce a therapeutic response by a therapeutic polypeptide. The method may also be to treat a disease in an individual.

[0071] The sixth aspect provides DNA encoding the mRNA.

[0072] The DNA may further comprise a sequence for introducing a transcribable nucleotide sequence. The sequence for introducing the transcribable nucleotide sequence may be operably linked to the 3'UTR at an upstream position from a nucleotide encoding the 3'UTR. The sequence for introducing the transcribable nucleotide sequence may be a cloning site. The cloning site may be a multiple cloning site. The cloning site may include a recognition site for a restriction enzyme, a cleavage site, or a combination thereof.

[0073] The above DNA may further comprise a promoter sequence. The promoter may be operably linked to the nucleotide sequence encoding the 5'UTR at an upstream location.

[0074] The above promoter, the nucleotide sequence encoding the 5'UTR, the sequence encoding the polypeptide or the sequence for introducing the transcribable nucleotide sequence, and the 3'UTR may be linked to form a common transcript when transcribed in vitro or in vivo.

[0075] The above DNA may be a vector. The vector may be an expression vector or a transcription vector for expressing a target protein or mRNA.

[0076] A seventh aspect provides a method for obtaining RNA, comprising the step of transcribing RNA using the DNA as a template. The transcription may include in vitro, ex vivo, or in vivo transcription. The in vivo transcription may include transcription within a subject.

[0077] The term "in vitro transcription" or "RNA in vitro transcription" refers to the process by which RNA, including mRNA, is synthesized in a cell-free system, i.e., in vitro. Cloning vector DNA, including plasmid DNA vectors, can be used as templates for the production of RNA transcripts. These cloning vectors are also commonly referred to as transcription vectors. RNA can be obtained by DNA-dependent in vitro transcription of an appropriate DNA template. The DNA template may be a linearized plasmid DNA template. The promoter controlling RNA in vitro transcription may be any promoter for a DNA-dependent RNA polymerase. The DNA-dependent RNA polymerase may be T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, or a combination thereof. The DNA template for RNA in vitro transcription can be obtained by cloning a nucleic acid and introducing it into a vector for RNA in vitro transcription. The DNA may include a cDNA corresponding to each RNA to be transcribed in vitro. The vector for the above RNA in vitro transcription may be a circular plasmid DNA. The cDNA may be obtained by reverse transcription of mRNA or chemical synthesis.

[0078] The transcription vector may comprise a promoter, a nucleotide sequence encoding a 5'UTR, a sequence encoding a polypeptide, for example, an open reading frame (ORF), a nucleotide sequence encoding a 3'UTR, and polyA. The nucleotide sequence encoding the 3'UTR may comprise one or more of the nucleotide sequences of SEQ ID NOs: 1 to 8. The nucleotide sequence encoding the 5'UTR may comprise any known 5'UTR. The transcription vector may also comprise an origin of replication, for example, the E. coli origin of replication ColE1 ori, a selectable marker gene, or a combination thereof. The promoter may be a T7 promoter. The selectable marker may be an antibiotic, for example, a kanamycin resistance enzyme.

[0079] The in vitro transcription may include a step of introducing the transcription vector into a host cell, for example, Escherichia coli, to obtain a transformed host cell, and culturing the obtained host cell to proliferate the host cell containing the plasmid DNA that serves as a template for mRNA. The in vitro transcription may include a step of isolating the plasmid DNA from the proliferated host cell, for example, Escherichia coli. The step of isolating the plasmid DNA may include separating a cell layer from the culture and isolating the plasmid DNA from the cells. The cell layer separation may be accomplished by centrifugation, separation, precipitation, or a combination thereof. The plasmid DNA separation from the cells may be accomplished by a known method, for example, alkaline extraction, affinity chromatography, HPLC, electrophoresis, or a combination thereof.

[0080] The method of obtaining the above RNA may include a step of culturing a cell containing the DNA to produce an RNA transcript of the DNA.

[0081] mRNA according to the daily pattern is relatively stable and has a high production yield, so it can be used to efficiently transcribe and translate mRNA.

[0082] According to a method for obtaining a polypeptide according to another aspect, a polypeptide can be obtained efficiently.

[0083] A composition for delivering mRNA or a product expressed thereby to a subject according to another aspect can be used to deliver mRNA or a product expressed thereby to a subject.

[0084] Compositions for inducing a therapeutic response or an immune response to a polypeptide according to different aspects can be used to induce a therapeutic response or an immune response to a polypeptide in a subject.

[0085] DNA of different types can be used to obtain mRNA.

[0086] According to a method of obtaining RNA according to different aspects, RNA can be obtained efficiently.

[0087] The present invention will be described in more detail below through examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.

[0088] Example 1: Formation of a specific structure that increases the yield of a gene 3'UTR non-natural sequence

[0089] A non-natural 3'UTR sequence was selected that forms a structure similar to a natural 3'UTR structure with excellent activity in increasing gene yield, and has an activity in increasing gene yield compared to the natural 3'UTR structure.

[0090] The above natural 3'UTR was used as the 3'UTR of human complement component 3 (C3) (SEQ ID NO: 9) or the 3'UTR of human cytochrome P450 2E1 (SEQ ID NO: 10), which is known to have excellent activity in increasing gene yield. Specifically, a random sequence combination having the same length as the 3'UTR of human C3 or the 3'UTR of human cytochrome P450 2E1 was constructed, and then a sequence whose secondary structure is similar to the 3'UTR of human C3 or the 3'UTR of cytochrome P450 2E1 was selected.

[0091] A process of removing potential AU-rich element (ARE) sequences that may cause mRNA instability from the selected mRNA sequences was performed, and a final eight non-natural 3'UTR sequences were selected (Table 1).

[0092] 3'UTR sequence of native human C3 (SEQ ID NO: 9 - length 178 nt):

[0093] CCACACCCCCAUUCCCCCACUCCAGAUAAAGCUUCAGUUAUAUCUCACGUGUCUGGAGUUCUUUGCCAAGAGGGAGAGGCUGAAAUCCCCAGCCGCCUCACCUGCAGCUCAGCUCCAUCCUACUUGAAACCUCACCUGUUCCCACCGCAUUUUCUCCUGGCGUUCGCCUGCUAGUGUG

[0094] Secondary structure of the 3'UTR sequence of native C3 (in dot-bracket notation):

[0095] .(((((...........(((...((((.((((.((((....))).))))))...)))..((((((..((((....((((((.(((((.......))))))..))))))))))))...) ...

[0096] Unnatural sequences (SEQ ID NOs: 1-5) with structures similar to those of the natural C3 sequence were designed to have a GC% of 40-50% and an average free energy of RNA folding of -0.1 to -0.3 kcal / mol.

[0097] 3'UTR sequence of native human cytochrome P450 2E1 (SEQ ID NO: 10, length 158 nt):

[0098] GUGUGUGGAGGACACCCUGAACCCCCCGCUUUCAAACAAGUUUUCAAAUUGUUUGAGGUCAGGAUUUCUCAAACUGAUUCCUUUCUUUGCAUAUGAGUAUUUGAAAAUAAAUAUUUUCCCAGAAUAUAAAUAAAUCAUCACAUGAUUAUUUUAACUAU

[0099] Secondary structure of the 3'UTR sequence of native cytochrome P450 2E1:

[0100] (((((((((...(((((.((........(((((((((.........)))))))))))))))))).....((((...)))).....))))))))))))))..(((((((((((((....)))))))...))))))).....((((((...)))))))))))..........

[0101] Non-natural sequences (SEQ ID NOs: 6-8) similar to the secondary structure of the 3'UTR sequence of natural cytochrome P450 2E1 were designed to have a GC% of 30 to 40% and an average free energy of RNA folding of -0.1 to -0.3 kcal / mol.

[0102]

[0103] RNA folding energy provides insight into secondary structure and its stability. For example, minimum free energy can be used to predict the secondary structure and stability of 3'UTRs, which can influence translation efficiency.

[0104] Example 2: Construction of a template vector using a non-natural 3'UTR sequence.

[0105] A vector was prepared by operably linking at least one of the sequences encoding a non-natural 3'UTR nucleotide sequence comprising the nucleotide sequences of SEQ ID NOs: 1 to 8 obtained in Example 1 with a sequence encoding a natural C3 3'UTR nucleotide sequence and a gene encoding a polypeptide. The polypeptide is a wild-type p53 protein having an amino acid sequence of SEQ ID NO: 11.

[0106] Specifically, the vector is linked to a promoter, a nucleotide sequence encoding a 5'UTR, an open reading frame (ORF) encoding a polypeptide, a nucleotide sequence encoding a 3'UTR, and polyA.

[0107] The vector may also include an E. coli replication origin ColE1 ori and a selectable marker gene. The promoter may be a T7 promoter. The selectable marker may be a kanamycin resistance enzyme.

[0108] 2-1. Construction of a template vector for p53 mRNA transcription

[0109] A vector for producing native p53 mRNA and / or its protein product was constructed, comprising a nucleotide sequence encoding a native C3 5'UTR sequence, a nucleotide sequence encoding a native p53 protein as an ORF, a nucleotide sequence encoding one of the designed non-native 3'UTRs of any one of SEQ ID NOs: 1 to 8, and polyA. The vector was introduced into a microbial cell, and the resulting microbial cell was cultured to produce a cloning vector. mRNA was produced through in vitro transcription using the produced vector as a template.

[0110] Specifically, first, pUC57-Amp R Vector pUC57-Kan, in which the antibiotic resistance gene was replaced with a kanamycin resistance gene from a vector (Addgene) R was produced. The produced vector was digested by restriction enzymes HindIII and EcoRI, and the digested vector was ligated to a polynucleotide encoding a synthetically produced native p53 protein using ligase, thereby inserting a sequence encoding a native p53 protein. The inserted polynucleotide encoding a native p53 protein contains a nucleotide sequence encoding a 5'UTR and a sequence encoding a native p53 protein, and since a restriction enzyme recognition sequence exists at the 3' end of the native p53 nucleotide sequence, it was digested and used to introduce a nucleotide sequence encoding a non-native 3'UTR.

[0111] Template vector gene sequence for native p53 mRNA transcription (DNA) 12 TAATACGACTCACTATA 13 AGTCCTCCCCATCCTCTCCCTCTGTCCCTCTGTCCCTCTGACCCTGCACTGTCCCAGCACC 14 TCCGCGAATTGAACGAGGCCCTGGAGTTGAAAGACGCTCAAGCCGGAAAGGAACCAGGTGGGTCTAGGGCCCACTCAAGCCATCTGAAGAGTAAGAAAGGCCAGTCCACTTCCAGGCACAAAAAGTTAATGTTCAAGACGGAGGGTCCTGACTCTGAC 15 GTGT GTGGAGGACACCCTGAACCCCCCGCTTTCAAACAAGTTTTCAAATTGTTTGAGGTCAGGATTTCTCAAAACTGATTCCTTTCTTTGCATATGAGTATTTGAAAATAAATATTTTCCCAGAATATAAATAAATCATCACATGATTATTTTAACTAT16AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0112] Table 2 shows the constructed pUC57-Kan RThe promoter (SEQ ID NO: 12), the polynucleotide encoding the 5'UTR (SEQ ID NO: 13), the polynucleotide encoding the native p53 protein (SEQ ID NO: 14), the polynucleotide encoding the 3'UTR (SEQ ID NO: 15), and the polyA sequence (SEQ ID NO: 16) included in the vector are shown. In Table 2, the underlined nucleotides in SEQ ID NO: 12 represent the T7 promoter portion involved in the initiation of mRNA transcription. In addition, the bold nucleotides in SEQ ID NO: 13 are the native 5'UTR sequence of human C3. In addition, SEQ ID NO: 14 is the nucleotide sequence encoding the native p53 protein as a sequence of nucleotides downstream of the 5'UTR. The native p53 protein has the amino acid sequence of SEQ ID NO: 11. In addition, SEQ ID NO: 15 is the native 3'UTR sequence of the human cytochrome P450 2E1 gene.

[0113] 2-2. Linkage and cloning of the nucleotide sequence encoding the non-native 3'UTR sequence and the native p53 protein.

[0114] The 3'UTR sequence of the above-constructed template vector was cloned to replace a nucleotide sequence encoding a non-natural 3'UTR sequence. The 3'UTR may include XhoI and NheI restriction enzyme sequences at the 5'-end upstream of the sequence and the 3'-end downstream of the sequence, respectively, thereby enabling it to be used for recombining a nucleic acid such as the transcribable nucleic acid sequence or polyA sequence. The transcribable nucleic acid sequence may be an open reading frame (ORF). The 3'UTR sequence may be linked to the 5'-end present in the sequence.

[0115] A recombinant 3'UTR sequence comprising an XhoI restriction enzyme sequence, a non-native 3'UTR sequence, and a NheI restriction enzyme sequence was synthesized by in vitro nucleic acid synthesis. The recombinant 3'UTR sequence and the template vector were digested by treating them with XhoI and NheI restriction enzymes, respectively, and the two sequences were then ligated using DNA ligase. The template vector used was the vector prepared in Example 2-1.

[0116] As a result, pUC57-Kan R A vector was prepared in which the structure of a T7 promoter, a nucleotide sequence encoding a 5'UTR, a sequence encoding a p53 protein, a nucleotide sequence encoding one of the non-natural 3'UTR sequences of SEQ ID NOs: 1 to 8, and polyA was introduced into the backbone of the vector.

[0117] Example 3: Production and yield of gene products using non-natural 3'UTR sequences

[0118] In Example 2, a vector containing the structure of 5'UTR sequence-p53 protein encoding sequence-unnatural 3'UTR sequence-polyA was introduced into Escherichia coli, and the vector was cultured to proliferate E. coli containing plasmid DNA that serves as a template for mRNA. The proliferated E. coli was separated from the culture medium by high-speed centrifugation, and then cell-derived template DNA was obtained using an alkaline extraction method. The obtained template DNA was linearized using a restriction enzyme recognition sequence located at the end of polyA. Using the linearized cell-derived template DNA, mRNA having the nucleotide sequence of 5'UTR sequence-p53 protein encoding sequence-unnatural 3'UTR sequence-polyA was produced through in vitro transcription. Here, the 5'UTR has a natural C3 sequence (SEQ ID NO: 17), the non-natural 3'UTR has one of the sequences of SEQ ID NOs: 1 to 8, and the sequence encoding polyA and p53 protein is as described above.

[0119] Specifically, 5 U / μL of T7 RNA polymerase was added to an aqueous solution containing 10 ng / μL of linearized plasmid DNA, 4 mM of capping reagent, 5 mM of ATP, 5 mM of CTP, 5 mM of GTP, 5 mM of N1-methylpseudoridine 5'-triphosphate, 20 mM of magnesium ion salt, 10 mM of DTT, 0.01 U / μL of inorganic pyrophosphatase (PPase), and 1 U / μL of RNase inhibitor, and the resulting reaction mixture was incubated at 37°C for more than one hour to allow the in vitro transcription reaction to proceed. The capping reagent used was the cap analog compound m7G(3'OMs)pppA(2'OMe)pG of Example 8 described in Korean Patent Publication No. 10-2023-0141482 published on October 10, 2023. The capping reagent is a reagent for co-transcriptional capping of mRNA, and forms a 5'cap structure m7G(3'OMs)pppA(2'OMe)pG. Here, m7G represents 7-methylguanosine, A represents adenosine, G represents guanosine, p represents -P(=O)(OH)O-, Ms represents mesyl, and Me represents methyl. The reactants were treated with a DNA-degrading enzyme, and the mRNAs (SEQ ID NOs: 18 to 26) of substances 1 to 9 were obtained using the Monarch® RNA Cleanup Kit (New England Biolabs). The relative synthetic yields according to the nucleotide sequence composition and UTR combination of the 5'UTR, p53 protein sequence, and non-natural 3'UTR contained in these mRNAs are as shown in Table 3 below. These mRNAs may additionally include a 5' cap structure and a poly A sequence structure (SEQ ID NOs: 27 to 35). The above relative synthetic yields represent the mRNA relative synthetic yields according to in vitro transcription, and were calculated based on the synthetic yield of substance 1 (100%).

[0120] Relative synthetic yield (%) = (synthetic yield of each substance / synthetic yield of substance 1) × 100

[0121] Substance number 5'UTR sequence ORF sequence 3'UTR sequence Yield (mg / mL) Relative synthetic yield (%) 1 Native C3 Native p53 Native CYP2E 16.88 100.02 Native C3 Native p53 Sequence number 17.20 104.73 Native C3 Native p53 Sequence number 27.48 108.74 Native C3 Native p53 Sequence number 36.96 101.25 Native C3 Native p53 Sequence number 47.44 108.16 Native C3 Native p53 Sequence number 57.00 101.87 Native C3 Native p53 Sequence number 67.36 107.08 Native C3 Native p53 Sequence number 77.32106.49Natural C3Natural p53Sequence number 87.80113.4

[0122] As shown in Table 3, structural changes in the UTR sequence can alter transcription efficiency, leading to improved synthesis yields of p53 mRNA via IVT depending on the non-native 3'UTR. Furthermore, increased translation yields were observed in translation reactions using substances 2 to 9.

Claims

1. An mRNA containing a non-natural 3'untranslated region (3'UTR), The above 3'UTR has a secondary structure indicated by the dot-bracket notation below, or .(((((...........(((...((((.((((.((((....))).))))))...)))..((((((..((((....((((((.(((((.......))))))..))))))))))))...) ... or has a secondary structure indicated by the dot-bracket notation below, (((((((((...(((((.((........(((((((((.........)))))))))))))))))).....((((...)))).....))))))))))))))..(((((((((((((....)))))))...))))))).....((((((...))))))))))).......... Here, the dots indicate that the bases in the sequence are unpaired, and "(" and ")" indicate that they are paired.

2. In claim 1, the mRNA including the 3'UTR has an average free energy for RNA folding of -0.1 to -0.3 kcal / mol, (a) The secondary structure of the mRNA including the above 3'UTR .(((((...........(((...((((.((((.((((....))).))))))...)))..((((((..(((((....((((((.((((.......))))))..)))))))))))))...) ... (b) The secondary structure of the mRNA including the above 3'UTR ((((((((((...(((((.((........((((((((((.........)))))))))))))))))).....((((...)))).....))))))))))))))..(((((((((((((....))))))))...))))))).....((((((...)))))))))))))))))........... is an mRNA with a length of 158 nt and a GC% of 30 to 50%.

3. In claim 2, the mRNA including the 3'UTR comprises a sequence selected from the group consisting of nucleotide sequences of SEQ ID NOs: 1 to 8.

4. In claim 1, the mRNA further comprises a sequence encoding a polypeptide.

5. In claim 4, the mRNA further comprises a Kozak sequence, a 5'UTR sequence, or a polyA sequence.

6. An mRNA according to claim 1, comprising a 5' cap selected from cap0, cap1, and cap2.

7. In claim 1, the mRNA comprises one or more modified nucleotides.

8. DNA encoding the mRNA of any one of claims 1 to 7.

9. A composition comprising the mRNA or DNA of any one of claims 1 to 8 as an active ingredient.