Deoxyribozyme and method for detecting mRNA capping efficiency

Abstract

Provided herein is a method for detecting RNA capping efficiency. The method comprises the following steps: 1) treating RNA by means of using deoxyribozyme DNAzyme (10-23) to generate an RNA fragment with a cap structure and a corresponding RNA fragment without a cap structure; and 2) detecting a proportional relationship between the RNA fragment with the cap structure and the corresponding RNA fragment by means of capillary electrophoresis, so as to determine the capping efficiency, wherein the lengths of two binding arms of the deoxyribozyme DNAzyme (10-23) are not less than 11 nt. Provided herein are the deoxyribozyme DNAzyme (10-23), and an RNA capping efficiency detection kit comprising the deoxyribozyme DNAzyme (10-23).

Description

A deoxyribozyme and a method for detecting mRNA capping rate

[0001] This application claims priority to Chinese patent application number CN 2023111590463, filed on September 9, 2023, which is hereby incorporated by reference in its entirety. Technical Field

[0002] The present invention relates to the field of biotechnology, and in particular to a deoxyribozyme and a method for detecting an mRNA capping rate. Background Art

[0003] Ribonucleic acid (RNA) is a crucial macromolecule in the transmission of genetic information in all organisms, and it also plays a variety of regulatory roles within the body. In recent years, RNA research has become one of the hottest areas in biological research. For example, mRNA-based therapeutic approaches are more precise and can be used for personalized treatment in practical applications, avoiding complex production issues compared to producing therapeutic proteins in the patient's body. As a drug, mRNA also has significantly fewer side effects than gene therapy, which permanently and irreversibly alters DNA. Therefore, mRNA therapy has gradually become one of the most popular drug research directions, promising promising development prospects as an effective approach to addressing a variety of diseases.

[0004] Effective mRNA therapy requires the effective delivery of mRNA to the patient's body and the effective synthesis of the corresponding protein in the body. In order to optimize mRNA delivery and protein production in vivo, appropriate capping is usually required at the 5' end of the construct to prevent mRNA degradation while promoting protein translation. Therefore, effective detection of capping efficiency is crucial. The earliest capping detection method is to use radioactive isotopes to label the cap structure and then perform qualitative or quantitative analysis. The radioactive labeling method has high sensitivity, but requires the use of isotopes, has certain safety hazards and isotope contamination risks, requires special protection measures, and is not easy to promote. Therefore, researchers have also begun to develop detection methods that do not rely on isotope labeling.

[0005] CN114894916A discloses a method for quantitatively detecting RNA capping efficiency. A DNAzyme is designed based on the sequence of the RNA to be tested, and the DNAzyme is used to cleave the RNA molecule to be tested. The molecular weight and relative proportion of the cleaved RNA are then measured to determine the capping efficiency. DNAzymes are single-stranded DNA molecules with catalytic activity. A well-known family of DNAzymes is the "10-23" DNAzyme (DNAzyme (10-23)), which uses its catalytic activity to specifically recognize, complementarily bind, and cleave target sequences in RNA molecules, thereby deactivating or reducing the activity of the cleaved RNA molecule. DNAzyme (10-23) has a 15-nucleotide core catalytic domain flanked by two substrate-binding domains (I and II). According to the Watson-Crick rule, 10-23 DNAzyme binds to the RNA substrate through base pairing via substrate-binding domains I and II. DNAzymes are used to cleave the RNA to be tested, and the molecular weight is measured to determine whether capping is successful. RNA capping efficiency can also be quantitatively determined by calculating the abundance of different molecular weights. This method has high sensitivity and does not require the use of radioactive labels, so there is no need to worry about radioactive contamination. However, this existing method does not further optimize and screen DNAzyme (10-23), and often encounters low cutting efficiency in actual use. Some methods also use RNaseH for cutting, but the site-directed cutting of RNaseH has more stringent requirements on the target sequence and is less versatile. In addition, some methods use RNA-based ribozymes (Ribozymes), but relative to DNAzyme, Ribozyme and protein nucleases (such as RNaseH) are more unstable, and the preparation cost is much higher than DNAzyme, and other impurities are easily introduced. For example, Ribozyme is prone to degradation, resulting in the production of invalid RNA small fragments, and RNaseH often contains other non-specific nuclease residues during the preparation process. In addition, this type of mass spectrometry-based method requires the use of expensive equipment such as eHPLC-MS or LC-MS to detect the RNA after cutting, and the cost of its use and maintenance is very high. Therefore, how to design a detection method that is simpler to operate and less expensive remains a problem that needs to be solved in this field.

[0006] The contents of all articles and references cited herein are incorporated by reference in their entirety.

[0007] Summary of the Invention

[0008] In one aspect, the present invention provides a method for detecting RNA capping efficiency, comprising the following steps:

[0009] 1) treating the RNA with a deoxyribozyme DNAzyme (10-23) to generate an RNA fragment with a cap structure and a corresponding RNA fragment without the cap structure; and

[0010] 2) detecting the ratio between the RNA fragments with the cap structure and the corresponding RNA fragments without the cap structure by capillary electrophoresis to determine the capping efficiency,

[0011] The length of the two binding arms of the deoxyribozyme DNAzyme (10-23) is not less than 11 nt, and preferably, can be independently selected from 11, 12, 13, 14 and 15 nt.

[0012] In some embodiments, the RNA is mRNA.

[0013] In some embodiments, the two binding arms of the DNAzyme (10-23) are of equal length.

[0014] In some embodiments, the RNA fragment is 26 nt in length.

[0015] In some embodiments, whether the RNA fragment has the cap structure is determined by molecular weight differences.

[0016] In some embodiments, the cap structure is located at the 5' end of the RNA.

[0017] In some embodiments, the cap structure is selected from Cap O, Cap I, and Cap II type structures.

[0018] In some embodiments, the mRNA comprises the sequence shown in SEQ ID NO: 1, and the deoxyribozyme DNAzyme (10-23) comprises the sequence shown in any one of SEQ ID NOs: 7, 8, 9, 10, and 11.

[0019] In some embodiments, step 1) comprises mixing the RNA with the deoxyribozyme DNAzyme (10-23) and pre-denaturing the mixture at 85° C. for 1 minute, followed by reacting the mixture at 37° C. for 3 hours.

[0020] In one aspect, the present invention provides a deoxyribozyme DNAzyme (10-23), wherein the length of both binding arms is not less than 11 nt, preferably, can be independently selected from 11, 12, 13, 14 and 15 nt, more preferably, including the sequence shown in any one of SEQ ID NOs: 7, 8, 9, 10 and 11.

[0021] In one aspect, the present invention provides an mRNA capping efficiency detection kit, which comprises the above-mentioned deoxyribozyme DNAzyme (10-23). BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to better understand the present invention and more clearly show how to implement the present invention, the features of the embodiments according to the present invention are now described by way of example with reference to the accompanying drawings, in which:

[0023] Figure 1: Schematic diagram of the principle of 10-23 DNAzyme cleavage of mRNA;

[0024] Figure 2: Capillary electrophoresis profiles of mRNA 5'-UTR cleavage at different cleavage sites by DNAzyme (10-23)x-35;

[0025] Figure 3: Capillary electrophoresis patterns of mRNA 5'-UTR cleavage by DNAzyme (10-23)26-y with different arm lengths;

[0026] Figure 4: Capillary electrophoresis detection of mRNA cleavage by DNAzyme (10-23)26-43 after different reaction times of mRNA enzymatic capping;

[0027] Figure 5: Capillary electrophoresis detection of mRNA cleavage using DNAzyme (10-23)26-43 after transcription and co-capping with mRNA cap analogs at different concentrations. DETAILED DESCRIPTION

[0028] In order to provide a clear and consistent understanding of the terms used in the specification of the present invention, some definitions are provided below. In addition, unless otherwise specified, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention belongs.

[0029] When used in conjunction with the term "comprising" in the claims and / or the specification, the use of the word "a" can mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." Similarly, the word "another" can mean at least a second or many.

[0030] As used in this specification and claims, the words "comprising" (and any form of comprising, such as "including" and "comprising"), "having" (and any form of having, "having", "including" and "containing") are inclusive and open-ended and do not exclude additional, unrecited elements or processing steps.

[0031] The term "about" or "approximately" is used to indicate that the value includes the error caused by the instruments and methods used in determining the value. As used herein, when used in reference to a specific recited value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0032] This specification refers to many terms and abbreviations used by those skilled in the art. However, for the sake of clarity and consistency, definitions of selected terms are provided.

[0033] "Deoxyribozymes," "deoxyribonucleases," "DNAzymes," or similar expressions are catalytic DNA sequences. They consist of a catalytic core of approximately 15 nucleotides, flanked by short binding arms located on either side of the core. While the sequence of the catalytic core is fixed, the binding arms can be modified to specifically match nearly any RNA target sequence. Non-limiting examples of DNAzymes are described in Usman et al., U.S. Patent No. 6,159,714, the entire contents of which are incorporated herein by reference; Chartrand et al., 1995, NAR 23, 4092; Breaker et al., 1995, Chem. Bio. 2, 655; Santoro et al., 1997, PNAS 94, 4262; Breaker, 1999, Nature Biotechnology, 17, 422-423; and Santoro et al., 2000, J. Am. Chem. Soc., 122, 2433-39. The "10-23" DNAzyme motif is a special type of DNAzyme that was evolved using in vitro selection, as generally described in Joyce et al., U.S. Patent No. 5,777,37. U.S. Patent No. 5,807,718 and Santoro et al., supra. Additional DNAzyme motifs can be selected using techniques similar to those described in these references and, therefore, are within the scope of the present invention.

[0034] Bases are the basic building blocks for the synthesis of nucleosides, nucleotides and nucleic acids. There are five common bases in organisms, namely adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). In 2019, four more bases were artificially synthesized. American scientist Steven A. Benner named these four new members "Z", "P", "S" and "B" respectively (As the name suggests, among the first five bases, adenine and guanine belong to the purine family (abbreviated as R), which have a double ring structure. Cytosine, uracil, thymine Belonging to the pyrimidine family (Y), their ring system is a six-membered heterocyclic ring. Also known as the primary or standard bases, they form the fundamental units of the genetic code. The bases A, G, C, and T are found in DNA, while A, G, C, and U are found in RNA. Each base pair contains a purine and a pyrimidine: A pairs with T through two hydrogen bonds, while C pairs with G, Z pairs with P, or S pairs with B through three hydrogen bonds. "nt" refers to the number of nucleotides, and can also refer to the number of bases corresponding to a nucleotide.

[0035] Purine-pyrimidine "complementarity" refers to the ability of a nucleic acid to form hydrogen bonds with another RNA sequence via traditional Watson-Crick or other non-traditional types. With respect to the nucleic acid molecules of the present invention, the binding free energy of the nucleic acid molecule to its target sequence or complementary sequence is sufficient to enable the relevant function of the nucleic acid, such as enzymatic nucleic acid cleavage, ligation, isomerization, phosphorylation, or dephosphorylation. "Complete complementarity" means that all consecutive residues of a nucleic acid sequence will form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence.

[0036] "RNA fragments" herein refer to fragments produced after RNA (especially mRNA) is cleaved by the deoxyribozyme DNAzyme (10-23), particularly fragments relevant to the capping efficiency of interest. For example, when the 5'-end capping efficiency is of interest, the RNA fragments referred to herein refer to the 5'-end fragments including the 5'-end bases. When capping is incomplete (capping efficiency is less than 100%), RNA fragments produced after treatment with the deoxyribozyme DNAzyme (10-23) in the same sample may or may not have a cap structure, i.e., RNA fragments with a cap structure and corresponding RNA fragments without a cap structure are produced (the two fragments are identical in nucleotide sequence, differing only in whether they have a cap structure).

[0037] "Binding arm", "substrate binding arm", "substrate binding domain", "substrate binding region", "homologous arm" or similar descriptions refer to the portion of the DNAzyme that is capable of binding to a portion of its substrate or reporter gene through complementarity. Preferably, this complementarity is 100%, but it can be lower if necessary. For example, as few as 10 of the 14 bases can base pair (see, for example, Werner and Uhlenbeck, 1995, Nucleic Acids Research, 23, 2092-2096; Hammann et al., 1999, Antisense and Nucleic Acid Drug Dev., 9, 25-31). In other words, the sequence of these arms contained within the DNAzyme is intended to bind the DNAzyme and substrate, such as RNA, together through complementary base pairing interactions. The DNAzyme of the present invention can have continuous or discontinuous binding arms and can have different lengths. The length of the binding arm is preferably greater than or equal to six nucleotides and is of sufficient length to stably interact with the target substrate. The lengths of the left and right binding arms of a DNAzyme are either symmetric (i.e., each binding arm has the same length; for example, five and five nucleotides, or six and six nucleotides, or seven and seven nucleotides long) or asymmetric (i.e., the binding arms are different lengths; for example, six and three nucleotides; three and six nucleotides long; four and five nucleotides long; four and six nucleotides long; four and seven nucleotides long).

[0038] "Cap" refers to a chemical modification at either end of an oligonucleotide (see, e.g., Wincott et al., WO 97 / 26270, incorporated herein by reference). These terminal modifications can protect the nucleic acid molecule from exonuclease degradation and aid in delivery and / or localization within the cell. The cap can be present at the 5'-end (5'-cap) or the 3'-end (3'-cap) or can be present at both ends. In non-limiting examples: the 5'-cap is selected from the group comprising an inverted abasic residue (part), a 4',5'-methylene nucleotide, 1-(β-D-erythrofuranosyl) nucleotide, 4'-thionucleotide, carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotide; α-nucleotide; modified base nucleotide; phosphorodithioate linkage; threofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3'-3'-inverted nucleotide portion; 3'-3'-inverted abasic portion; 3'-2'-inverted nucleotide portion; 3'-2'-inverted abasic portion; 1,4-butanediol phosphate; 3'-phosphoramidate; hexyl phosphate; aminohexyl phosphate; 3'-phosphate; 3'-phosphorothioate; phosphorodithioate; or a bridged or non-bridged methylphosphonate moiety (for further details, see Wincott et al., International PCT Publication No. WO 97 / 26270, incorporated herein by reference). In another preferred embodiment, the 3'-cap is selected from the group consisting of: 4',5'-methylene nucleotides; 1-(β-D-erythrofuranosyl) nucleotides; 4'-thionucleotides, carbocyclic nucleotides; 5'-aminoalkyl phosphates; 1,3-diamino-2-propyl phosphate, 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotides; L-nucleotides; α-nucleotides; modified base nucleotides; dithiophosphates; threofuranosyl nucleotides; No 3',4'-seco nucleotides; 3,4-dihydroxybutyl nucleotides; 3,5-dihydroxypentyl nucleotides, 5'-5'-inverted nucleotide moieties; 5'-5'-inverted abasic moieties; 5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate; 5'-amino; bridged and / or non-bridged 5'-phosphoramidate, phosphorothioate and / or phosphorodithioate, bridged or non-bridged methylphosphonate and 5'-sulfhydryl moieties (for further details, see Beaucage and Iyer, 1993, Tetrahedron 49, 1925; incorporated herein by reference). In some examples, the cap structure is 7-methylguanosine triphosphate m 7 Gppp (Cap O type); in other examples, the cap structure includes 7-methylguanosine triphosphate m 7Gppp and 2'-OH methylation of the first nucleobase or even 2'-OH methylation of the second nucleobase (referred to as Cap type I and Cap type II, respectively). Exemplary mRNA capping methods include enzymatic capping or cap analog transcriptional co-capping.

[0039] The present invention utilizes screening and improvement of deoxyribozyme DNAzyme (10-23) to improve its efficiency in cleaving mRNA molecules to be detected, thereby generating a sufficient number of cleaved RNA capped fragment products or uncapped fragments that can be clearly separated and detected by capillary electrophoresis, and quantified respectively. Thus, the mRNA capping rate can be quantitatively detected by a capillary electrophoresis instrument. This method is simpler, less costly, and detection equipment is more readily available.

[0040] Accordingly, in one aspect, the present invention provides a method for detecting mRNA capping efficiency, comprising: designing a deoxyribozyme DNAzyme (10-23) xy based on the sequence of an RNA to be detected; using the deoxyribozyme to cleave the RNA to be detected, whereby the cleaved RNA is separated into capped short fragments and uncapped short fragments; and using capillary electrophoresis to detect the molecular weight of the short fragments cleaved from the RNA to be detected and the relative ratio of the two short fragments to determine the capping efficiency, wherein x represents the number of nucleotides in the mRNA short fragment produced after cleavage, and y represents the number of nucleotides in the deoxyribozyme itself, and y is an integer greater than or equal to 37.

[0041] Since the RNA to be detected is generally long in length, has a large number of nucleotides, and a large molecular weight, and the increase in molecular weight when one end of the RNA is capped is negligible compared to the initial molecular weight, it is difficult to distinguish it with an instrument. Therefore, the capped end or the planned capped end is cut out to form a short fragment with a smaller molecular weight. The difference between the capped short fragment and the uncapped short fragment is increased, which is conducive to distinguishing and reading the capped or uncapped short fragments. In this application, DNAzyme (10-23) xy is used to cut the RNA to be detected, and a sufficient amount of capped or uncapped short fragments is obtained. The short fragments of the cap are then detected by capillary electrophoresis, which is highly sensitive and can perform high-precision single-base resolution. The short fragments cut from the RNA to be detected are then detected, and the peaks of the capped and uncapped short fragments are separated and detected by single-base difference. The peak integrated areas of the two short fragments are then calculated to determine the capping efficiency. Wherein, x represents the number of nucleotides in the mRNA short fragment produced after cleavage, and y represents the number of nucleotides in the deoxyribozyme itself, and y is an integer greater than or equal to 37, that is, the length of both binding arms is not less than 11 nt, and preferably can be any length between 11 and 20 nt. By adjusting the values ​​of x and y, a DNAzyme (10-23) that can distinguish between capped and uncapped short fragments by capillary electrophoresis can be designed.

[0042] Deoxyribozyme (DNAzyme) is a single-stranded DNA fragment with catalytic function, which has high catalytic activity and structural recognition ability. DNAzyme has the following advantages: (1) As a DNA molecule, it is more stable than ribozyme and not easily destroyed; (2) It has a relatively small molecular weight, is easy to synthesize and modify artificially, and its cost is much lower than that of protein nucleases (such as RNaseH) and ribozyme; (3) Its binding arm has high accuracy in pairing with the substrate. In addition to the core catalytic sequence, other recognition base sequence parts can be changed according to the substrate base sequence. The target cleavage sites that can be screened are more and more flexible than the cleavage scheme of RNaseH. It is superior to RNaseH and ribozyme in the comprehensive performance of RNA site-directed cleavage in mRNA capping test.

[0043] Furthermore, the cleavage position of the mRNA to be detected is selected to be located at the 5'-capped end of the mRNA. In some embodiments, the cleavage position of the mRNA to be detected is selected to be located within 100 bases of the 5'-capped end, such as the 5' end sequence of the cleavage range in the example of the present application is shown in SEQ ID NO: 1.

[0044] SEQ ID NO: 1:

[0045] 5'-AGGAGAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACCAUGAGGCUGGCAGUGGGCGAUGCCACCAUGGUGAGCAAGGGCGA-3'

[0046] This range generally encompasses the 100 bases of the 5'-terminal UTR region of the mRNA being tested. In vitro synthesized mRNAs typically utilize fixed 5'-UTR and 3'-UTR sequences that have been validated to aid in stable protein expression. As such, the UTR regions of these mRNAs are often identical. Therefore, the DNAzymes provided herein have good cleavage universality for mRNAs using the same UTR region. For mRNAs with other different UTRs, the design principles and screening strategies provided herein can also be used to rapidly obtain highly efficient and usable DNAzymes.

[0047] Furthermore, x is selected from any integer between 15 and 51. Specifically, x can be 15, 26, 47, or 51.

[0048] In some embodiments, an improved deoxyribozyme DNAzyme (10-23) is used to cut a certain site of the mRNA molecule to be detected, and the mRNA short fragment generated after cutting has a nucleotide length of 26 nt (x=26).

[0049] Furthermore, y is selected from any integer between 35 and 45. Specifically, y can be 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45.

[0050] In some embodiments, the two arms of the deoxyribozyme are of equal length, and y can be 35, 37, 39, 41, 43, or 45; in some embodiments, the two arms of the deoxyribozyme are of unequal length.

[0051] In some embodiments, an improved deoxyribozyme DNAzyme (10-23) is used to cut at a certain site of the mRNA molecule to be detected, and the nucleotide length of the deoxyribozyme itself is 43 nt (y=43).

[0052] In some embodiments, both arms of the DNAzyme are 11 nt in length. In some embodiments, both arms of the DNAzyme are 12 nt in length. In some embodiments, both arms of the DNAzyme are 13 nt in length. In some embodiments, both arms of the DNAzyme are 14 nt in length. In some embodiments, both arms of the DNAzyme are 15 nt in length.

[0053] In some embodiments, an improved DNAzyme (10-23) is used to cleave a specific site on the mRNA molecule to be detected. The resulting mRNA fragment has a nucleotide length of 26 nt (x=26), the DNAzyme itself has a nucleotide length of 41 nt (y=41), and both arms of the DNAzyme are 13 nt in length.

[0054] In some embodiments, an improved deoxyribozyme DNAzyme (10-23) is used to cut at a certain site of the mRNA molecule to be detected. The nucleotide length of the short mRNA fragment produced after cutting is 26 nt (x=26), the nucleotide length of the deoxyribozyme itself is 43 nt (y=43), and the length of both arms of the deoxyribozyme is 14 nt.

[0055] In some embodiments, an improved deoxyribozyme DNAzyme (10-23) is used to cut at a certain site of the mRNA molecule to be detected. The nucleotide length of the short mRNA fragment produced after cutting is 26 nt (x=26), the nucleotide length of the deoxyribozyme itself is 45 nt (y=45), and the length of both arms of the deoxyribozyme is 15 nt.

[0056] Furthermore, the capping method of the mRNA to be detected includes enzymatic capping or cap analog transcriptional co-capping.

[0057] In some embodiments, the capping method for the mRNA to be detected is enzymatic capping; in some embodiments, the capping method for the mRNA to be detected is cap analog transcriptional co-capping.

[0058] Furthermore, the present invention designs a series of deoxyribozymes, the sequences of which are shown in SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11. In some embodiments, the sequence of the deoxyribozyme is shown in SEQ ID NO: 10.

[0059] Furthermore, the cleavage method in the mRNA capping efficiency detection method is: the RNA to be detected is mixed with the DNA enzyme and annealed, and the annealing procedure is pre-denaturation at 85°C for 1 minute and reaction at 37°C for 3 hours.

[0060] In another aspect, the present invention further provides a deoxyribozyme, the sequence of which is shown in SEQ ID NO: 9, SEQ ID NO: 10 or SEQ ID NO: 11.

[0061] In another aspect, the present invention further provides an mRNA capping efficiency detection kit, which includes any one or more deoxyribozymes as shown in SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11.

[0062] The present invention designs a DNAzyme (10-23) based on the 5'-UTR region sequence of the mRNA to be detected; then, the DNAzyme (10-23) is used to cut the mRNA molecule at a specific point; finally, the reaction mixture is directly loaded onto an instrument, and the molecular weight and relative proportion of the sheared mRNA products are detected by capillary electrophoresis to determine the capping efficiency. When capping mRNA, due to differences in mRNA capping efficiency, capped and uncapped mRNAs will exist in the system. After the mRNA is sheared at a specific point using the DNAzyme (10-23), the capped mRNA and uncapped mRNA in the system will produce a molecular weight difference through capillary electrophoresis analysis, that is, the capped mRNA has an increased molecular weight. The capping efficiency is calculated based on the relative ratio of the capped mRNA to the total mRNA (capped and uncapped mRNA).

[0063] The present invention provides a method for detecting mRNA capping efficiency. A deoxyribozyme DNAzyme (10-23) xy is designed based on the RNA sequence to be detected. The deoxyribozyme is used to cleave the RNA molecule to be detected. The resulting 5'-end RNA capped fragment product can be clearly separated and quantified from other fragment products and the deoxyribozyme itself on capillary electrophoresis. The mRNA capping rate is then detected using a capillary electrophoresis instrument to determine the capping efficiency. Here, x represents the number of nucleotides in the mRNA short fragment produced after cleavage, and y represents the number of nucleotides in the deoxyribozyme itself, and y is an integer greater than or equal to 37. This method is simpler, less costly, and detection equipment is readily available.

[0064] Example

[0065] The present invention will be more readily understood by reference to the following examples, which are provided to illustrate the invention and are not to be construed as limiting the scope of the invention in any way.

[0066] Unless otherwise defined or the context clearly dictates otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. It should be understood that any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.

[0067] Unless otherwise defined or the context clearly dictates otherwise, all materials and instruments used herein were purchased from commercial sources.

[0068] Although the present invention has been described in detail with reference to the embodiments of the present invention, these embodiments are provided to illustrate rather than limit the present invention. Other embodiments that can be obtained according to the principles of the present invention all fall within the scope defined by the claims of the present invention.

[0069] The DNAzyme (10-23) enzyme active center consists of a 15-deoxyribonucleotide sequence, the "10-23 motif" (5'-GGCTAGCTACAACGA-3'). Flanking the active center are substrate-binding regions, typically 7 to 12 nt in length, that specifically bind to target mRNA through Watson-Crick base pairing. Its sequence can vary depending on the substrate mRNA. The cleavage site is located at the phosphodiester bond between an unpaired purine and a paired pyrimidine on the mRNA molecule. Due to the molecular weight difference between the capped mRNA and the small fragments contained in the 5'-end cleavage products of the uncapped mRNA, the capped mRNA and uncapped mRNA cleavage products exhibit different peaks at different times on capillary electrophoresis. The yield can be calculated based on the peak area. A schematic diagram of the cleavage principle is shown in Figure 1.

[0070] The experimental materials and instruments in the embodiment of the present invention include:

[0071] 1. T7 HighYield RNA Transcription Kit, Vazyme (Nanjing Novozyme Biotechnology Co., Ltd.);

[0072] 2. GTP, Vazyme;

[0073] 3. 10× Capping Buffer;

[0074] 4. Vaccinia Capping Enzyme, Vazyme;

[0075] 5. mRNA Cap 2'-O-Methyltransferase, Vazyme;

[0076] 6. SAM (S-adenosylmethionine), Vazyme;

[0077] 7. DNase I (deoxyribonuclease 1), Vazyme;

[0078] 8. Co-transcription capping T7 in vitro transcription reagent (Cap GAG) Wuhan Hanhai New Enzyme Biotechnology Co., Ltd.

[0079] 9. CleanCap@AG, TriLink;

[0080] 10. UltraPure TM DNase / RNase-free distilled water, Invitrogen TM ;

[0081] 11. Tris-HCl (Tris(hydroxymethyl)aminomethane), Invitrogen TM ;

[0082] 12. LiCl precipitation solution (7.5 M), Invitrogen TM ;

[0083] 13. MgCl2, Ambion TM ;

[0084] 14. High-resolution card holder (S1), product number C105202, Guangding Biotechnology (Jiangsu) Co., Ltd.

[0085] 15. Qsep1 Plus portable capillary electrophoresis instrument, Guangding Biotechnology (Jiangsu) Co., Ltd.

[0086] Materials and instruments involved in the present invention, unless otherwise specified, were purchased commercially. All DNAzymes and oligonucleotides were synthesized by General Biotechnology (Anhui) Co., Ltd.

[0087] Example 1: Synthesis of uncapped mRNA

[0088] In this example, uncapped mRNA was synthesized by in vitro transcription. After linearizing the transcription template plasmid using restriction endonucleases, in vitro transcription of RNA was initiated using T7 RNA polymerase to produce uncapped mRNA. The reaction system is shown in Table 1. Transcription was performed using the T7 High Yield RNA Transcription Kit, Vazyme (Nanjing Novozyme Biotechnology Co., Ltd.), catalog number: DD4201. For specific procedures, refer to the instructions.

[0089] Table 1 mRNA in vitro transcription system

[0090] After the reagents in Table 1 are evenly mixed, incubate at 37°C for 2 hours. After the reaction is completed, add 1 μL of DNase I provided by the kit and digest at 37°C for 30 minutes to remove the template.

[0091] Post-transcription purification was performed as follows;

[0092] (1) Add 7.5 M LiCl at a volume ratio of 1:3, mix well, let stand at -20°C for 30 min, centrifuge at 12,000 rpm for 10 min, and remove the supernatant after observing the precipitate at the bottom;

[0093] (2) Add 1 mL of pre-chilled 70% ethanol to resuspend the precipitate. Centrifuge at 12,000 rpm for 5 minutes and discard the supernatant.

[0094] (3) Repeat the previous step;

[0095] (4) Remove the supernatant completely, open the lid and dry at 37°C for 5 min. After the precipitate is dry, add RNase-free ddH2O to fully dissolve the precipitate to obtain uncapped mRNA.

[0096] Example 2: Preparation of capped mRNA using an enzymatic two-step capping method

[0097] In this example, capped mRNA was prepared using a two-step enzymatic capping method. Vaccinia Capping Enzyme (Vazyme, Catalog No.: 10615) and mRNA Cap 2'-O-Methyltransferase (Vazyme, Catalog No.: DD4110-PC-01) were used to co-cap the mRNA.

[0098] 10 μg of the purified mRNA from Example 1 was denatured at 65° C. for 5 min, and then immediately placed on ice for 5 min. The capping reaction system was then prepared according to Table 2.

[0099] Table 2 Enzymatic two-step capping reaction system

[0100] After the reagents in Table 2 above were mixed evenly, they were incubated at 37°C for 30 min, 60 min, and 120 min, respectively. Then, 1 μL of DNase I (Vazyme, catalog number: DD4104-PC-03) was added and digested at 37°C for 30 min to remove the template.

[0101] Then perform post-transcription purification as follows:

[0102] (1) Add 7.5 M LiCl at a volume ratio of 1:3, mix well, let stand at -20°C for 30 min, centrifuge at 12,000 rpm for 10 min, and remove the supernatant after observing the precipitate at the bottom;

[0103] (2) Add 1 mL of pre-chilled 70% ethanol to resuspend the precipitate. Centrifuge at 12,000 rpm for 5 minutes and discard the supernatant.

[0104] (3) Repeat the previous step;

[0105] (4) The supernatant was completely removed, and the tube was opened and dried at 37°C for 5 min. After the precipitate was dry, RNase-free ddH2O was added to fully dissolve the precipitate to obtain capped mRNA with different capping rates.

[0106] Example 3: Preparation of capped mRNA by co-transcriptional method

[0107] This example utilizes a co-transcription method to prepare capped mRNA. After linearizing the transcription template plasmid with a restriction endonuclease, in vitro transcription of the RNA was initiated using T7 RNA polymerase. The co-transcription reaction system in Table 3 was supplemented with a cap analog to obtain co-transcribed capped mRNA. Capping was performed using the Co-transcription Capping T7 In Vitro Transcription Reagent (Cap GAG) (Wuhan Hanhai New Enzyme Biotechnology Co., Ltd., Catalog No. HBP001510). For detailed instructions, see the instructions.

[0108] Table 3 Co-transcription reaction system

[0109] The final concentrations of Cap analog in the system were 1, 2, 4, and 8 mM, respectively.

[0110] After mixing the reagents in Table 3 above, incubate at 37°C for 2 hours. After the reaction is complete, digest with 2 μL of the kit's included DNase I at 37°C for 30 minutes to remove the DNA plasmid template. Then, perform post-transcription purification as follows:

[0111] (1) Add 7.5 M LiCl at a volume ratio of 1:3, mix well, let stand at -20°C for 30 min, centrifuge at 12,000 rpm for 10 min, and remove the supernatant after observing the precipitate at the bottom;

[0112] (2) Add 1 mL of pre-chilled 70% ethanol to resuspend the precipitate. Centrifuge at 12,000 rpm for 5 minutes and discard the supernatant.

[0113] (3) Repeat the previous step;

[0114] (4) Completely remove the supernatant, open the lid and dry at 37°C for 5 min. After the precipitate is dry, add RNase-free ddH2O to fully dissolve the precipitate to obtain mRNA samples with different capping rates.

[0115] Example 4: DNAzyme (10-23) cleavage site design

[0116] The cleavage position selected in this example is located within 100 bases of the 5'-end (SEQ ID NO: 1).

[0117] SEQ ID NO: 1:

[0118] 5'-AGGAGAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACCAUGAGGCUGGCAGUGGGCGAUGCCACCAUGGUGAGCAAGGGCGA-3'

[0119] The binding arms at both ends of the DNAzyme (10-23)xy were designed based on the different cleavage sites. To enable qualitative comparison of the differences between the different cleavage sites, y was fixed to 35 (y=35), i.e., the number of bases or nucleotides in the DNAzyme itself was fixed at 35. Since the DNAzyme (10-23) catalytic core is fixed at 15 nt, the total length of the arms at both ends of the DNAzyme (10-23)x-35 designed in this example is 20 nt. The specific sequence of the designed DNAzyme (10-23)x-35 is shown in Table 4.

[0120] Table 4 DNAzyme (10-23) x-35 sequence

[0121] The uncapped mRNA generated in Example 1 was cleaved using DNAzyme (10-23)x-35 as shown in Table 4. The specific annealing reaction system is shown in Table 5. The annealing procedure was 85°C pre-denaturation for 1 minute and 37°C reaction for 3 hours. After the reaction, the instrument was maintained at 4°C.

[0122] Table 5 Annealing reaction system

[0123] The results are shown in Figure 2 (capillary electrophoresis diagram). When the same mass of mRNA substrate and the same amount of DNAzyme (10-23) x-35 were used, only DNAzyme (10-23) 26-35 could detect a small amount of 5'-end cleavage product peak. However, since the peak of the 5'-end cleavage product was too close to the peak of the DNAzyme (10-23) 26-35 ribozyme itself, it was difficult to distinguish the 5'-end cleavage product peak from the peak of the DNAzyme (10-23) 26-35 ribozyme itself. The 5'-end cleavage product peak was difficult to read, which was not conducive to quantitative analysis. Therefore, further optimization was focused on it.

[0124] Example 5: Design of DNAzyme (10-23) 26-y

[0125] This embodiment further designs the two arms of the DNAzyme based on the determination of x=26. The design includes: DNAzyme (10-23) 26-35, i.e., the number of nucleotides in the mRNA short fragment produced after cleavage is 26, the number of nucleotides in the DNAzyme itself is 35, and the length of both arms is 10 nt; DNAzyme (10-23) 26-37, i.e., the number of nucleotides in the mRNA short fragment produced after cleavage is 26, the number of nucleotides in the DNAzyme itself is 37, and the length of both arms is 11 nt; DNAzyme (10-23) 26-39, i.e., the number of nucleotides in the mRNA short fragment produced after cleavage is 26, the number of nucleotides in the DNAzyme itself is 39, and the length of both arms is 12 nt. DNAzyme (10-23) 26-41, i.e., the short mRNA fragment produced after cleavage has 26 nucleotides, the deoxyribozyme itself has 41 nucleotides, and the arm lengths of both ends are 13 nt; DNAzyme (10-23) 26-43, i.e., the short mRNA fragment produced after cleavage has 26 nucleotides, the deoxyribozyme itself has 43 nucleotides, and the arm lengths of both ends are 14 nt; and DNAzyme (10-23) 26-45, i.e., the short mRNA fragment produced after cleavage has 26 nucleotides, the deoxyribozyme itself has 45 nucleotides, and the arm lengths of both ends are 15 nt. DNAzyme (10-23) x-35 shown in Table 6 was used to cleave the uncapped mRNA generated in Example 1, respectively. The experimental process refers to Example 4. The sequences of the ribozymes are shown in Table 6. The effects of each DNAzyme (10-23) 26-y on the mRNA cleavage efficiency are shown in FIG3 . The normalized detection peak area results of each DNAzyme (10-23) 26-y in FIG3 are shown in Table 7 .

[0126] Table 6 DNAzyme (10-23) 26-y sequence

[0127] Table 7 Detection peak area of ​​each DNAzyme (10-23) 26-y

[0128] As shown in Figure 3, when the amount of mRNA substrate and DNAzyme (10-23) added is the same, when y = 37, that is, when the length of the homologous arms at both ends of DNAzyme (10-23) is 11 nt, the 5'-end cleavage product peak is significantly separated from the DNAzyme (10-23) peak compared to y = 35. Within a certain range, as the length of the homologous arms at both ends of DNAzyme (10-23) further increases, the distance between the 5'-end cleavage product peak and the DNAzyme (10-23) peak becomes increasingly farther, which facilitates the distinction and reading of the 5'-end cleavage product peak. In addition, as the length of the homologous arms at both ends of DNAzyme (10-23) further increases, its primer dimers (byproducts) also gradually decrease. When the length of the homologous arms at both ends of DNAzyme (10-23) is 12 nt, its primer dimers can be basically ignored. As shown in Table 7, when y = 37, that is, when the length of the homologous arms at both ends of DNAzyme (10-23) is 11 nt, the integrated area of ​​the 5'-end cleavage product peak is significantly increased compared to y = 35, that is, the number of 5'-end cleavage products cut out is significantly increased. DNAzyme (10-23) 26-43 can not only be clearly separated on the capillary electrophoresis instrument and can be used for subsequent quantitative analysis, but also its 5'-end cleavage product peak area is the largest, indicating higher cleavage activity, so it was selected for further capping rate testing.

[0129] Example 6: Capping efficiency test of two-step enzymatic capping at different times

[0130] DNAzyme (10-23) 26-43 was used to cut the mRNA obtained in Example 2 after two-step enzymatic capping for different times. The cutting steps were referred to Example 4, and the capillary electrophoresis pattern was used for detection. The pattern is shown in Figure 4, indicating the DNAzyme (10-23) 26-43 peak, the short fragment product after cleavage of the 5'-UTR end of the uncapped mRNA after DNAzyme treatment (-Capped); the short fragment product after cleavage of the 5'-UTR end of the capped mRNA after DNAzyme treatment (+Capped); compared with the uncapped mRNA, the capped mRNA has an additional molecular weight of a Cap1 structure. As shown in Table 8 below, under the same mRNA substrate dosage, the capping efficiency increases with the capping time (0 min, 30 min, 60 min, 120 min).

[0131] Table 8 Two-step enzymatic capping efficiency test

[0132] Example 7: Co-transcriptional capping efficiency test with different cap analog concentrations

[0133] DNAzyme (10-23) 26-43 was used to cleave the mRNA obtained in Example 3 after co-transcriptional capping with different cap analog concentrations. The cleavage steps were referred to Example 4, and the capillary electrophoresis pattern was used for detection. When the mRNA start base used was GG, the capping efficiency was generally 50% when the AG cap analog was used for co-transcriptional capping. The spectrum is shown in Figure 5, indicating the DNAzyme (10-23) 26-43 peak. The short fragment products after 5'-UTR cleavage of uncapped mRNA after DNAzyme treatment (-Capped) and the short fragment products after 5'-UTR cleavage of capped mRNA after DNAzyme treatment (+Capped) are shown. As shown in Table 9 below, compared with uncapped mRNA, capped mRNA has an additional Cap1 structure. When the same mass of uncapped mRNA substrate is added, the capping efficiency increases with the increase of cap analog concentration (0mM, 1mM, 2mM, 4mM, 8mM). When the same mass of substrate and dosage are added, the capping efficiency is calculated based on the ratio of the peak area of ​​the short fragment products after 5'-end cleavage of capped mRNA to the peak area of ​​the short fragment products after 5'-end cleavage of the total mRNA (capped mRNA and uncapped mRNA). When the mRNA start base used is AG and the AG cap analog is used for co-transcriptional capping, as shown in Table 10 below, the capping efficiency reaches 100%.

[0134] Table 9 Co-transcription capping efficiency test (starting with GG)

[0135] Table 10 Co-transcription capping efficiency test (starting with AG)

[0136] In summary, the present invention designs and screens the optimal DNAzyme (10-23)xy according to the mRNA sequence to be detected, uses the DNAzyme (10-23)xy to efficiently cut the mRNA molecule at the 5'-UTR region, and uses capillary electrophoresis to detect the molecular weight of the short mRNA fragments at the 5' end after shearing and the relative ratio of the capped fragments to the uncapped fragments, thereby calculating the capping efficiency and realizing quantitative detection of the mRNA capping efficiency. This technology does not require the use of radioactive labels, has no radioactive pollution, and does not require the use of expensive mass spectrometry equipment. It is simple to operate, low in cost, and easy to implement.

[0137] Although the present invention has been described in detail with reference to the embodiments of the present invention, these embodiments are provided to illustrate rather than limit the present invention. Other embodiments that can be obtained according to the principles of the present invention all fall within the scope defined by the claims of the present invention.

Claims

1. A method for detecting RNA capping efficiency, comprising the following steps: 1) treating the RNA with a deoxyribozyme DNAzyme (10-23) to generate an RNA fragment with a cap structure and a corresponding RNA fragment without the cap structure; and 2) detecting the ratio between the RNA fragment with the cap structure and the corresponding RNA fragment without the cap structure by capillary electrophoresis to determine the capping efficiency, The lengths of the two binding arms of the deoxyribozyme DNAzyme (10-23) are not less than 11 nt.

2. The method of claim 1, wherein the RNA is mRNA.

3. The method according to claim 1 or 2, wherein the two binding arms of the deoxyribozyme DNAzyme (10-23) are of equal length.

4. The method according to any one of claims 1 to 3, wherein the lengths of the two binding arms of the deoxyribozyme DNAzyme (10-23) are arbitrarily selected from integers in the range of 11-15 nt.

5. The method according to any one of claims 1 to 4, wherein the cap structure is located at the 5' end of the RNA.

6. The method according to any one of claims 1 to 5, wherein the RNA comprises the sequence shown in SEQ ID NO: 1, and the deoxyribozyme 10-23 DNAzyme comprises the sequence shown in any one of SEQ ID NO: 7, 8, 9, 10 and 11.

7. The method according to any one of claims 1 to 6, wherein step 1) comprises pre-denaturing the RNA and the deoxyribozyme 10-23 DNAzyme at 85°C for 1 min, followed by reacting at 37°C for 3 h.

8. A deoxyribozyme DNAzyme (10-23), wherein the length of both binding arms of the DNAzyme (10-23) is not less than 11 nt.

9. The deoxyribozyme DNAzyme (10-23) according to claim 8, comprising the DNAzyme (10-23) shown in any one of SEQ ID NOs: 7, 8, 9, 10 and 11.

10. An RNA capping efficiency detection kit, wherein the detection kit comprises a DNAzyme (10-23) as shown in any one of SEQ ID NOs: 7, 8, 9, 10 and 11.

Images