Use of cotton ghpme36 gene in regulating and controlling resistance of cotton to liriomyza sativae

Abstract

A use of cotton GhPME36 gene in regulating and controlling resistance of cotton to Liriomyza sativae. By studying the expression trend of the GhPME36 gene in a cotton leaf development process and the protein subcellular localization of GhPME36, a GhPME36 gene overexpression cotton material and the insect pest situation index and PME enzyme activity level of material leaves, the methylesterification degree of pectin in material leaf epidermal cells and cell wall thicknesses, and total soluble sugar content in the material leaves and the content of various monosaccharides / disaccharides such as glucose and sucrose, the specific function of the GhPME36 gene in regulating and controlling the resistance of cotton to Liriomyza sativae is provided, and the GhPME36 gene overexpression cotton material is created. A GhPME36 gene knockout cotton material is also created, and the material shows obvious resistance to Liriomyza sativae. The present invention can be used in regulating and controlling the resistance of cotton to Liriomyza sativae and cultivating a new cotton variety resistant to Liriomyza sativae.

Description

Application of cotton GhPME36 gene in regulating cotton resistance to Liriomyza sativae leafminer Technical Field

[0001] The invention belongs to the field of genetic engineering, and particularly relates to application of the GhPME36 gene in regulating cotton resistance to the leafminer Liriomyza sativae. Background Art

[0002] Cotton is an important economic crop worldwide. The occurrence of insect pests can affect its growth and development, as well as fiber yield and quality, reducing the economic value of cotton. The American leafminer (Liriomyza sativae) is a polyphagous leafminer that feeds on the stems and leaves of various plants, including cotton, soybeans, rice, and tomatoes (Bragard C, K Dehnen-Chmutz, Serio FD, et al. Pest categorisation of Liriomyza sativae [J]. EFSA Journal, 2020, 18(3): e06037; Zhang Xueli. Occurrence characteristics and control of American leafminer [J]. Modern Agriculture, 2020(1): 1). Since the first outbreak of the American leafminer in my country in 1993 (Xie Qionghua, He Tanlian, Cai Dejiang, Huang Heqing. Occurrence, damage and prevention of American leafminer [J]. Plant Protection, 1997(01):20-22), there have been reports of cotton being damaged by American leafminer pests, and the affected areas have been expanding, and the pests have occurred in all major cotton-growing areas (Lu Yanhui, Jian Guiliang, Wu Kongming. Simple Identification Manual of Major Cotton Pests and Diseases [M]. China Agriculture Press, 2013). my country listed it as a quarantine pest in 1995 (Zhang Huijie, Li Jianshe. Damage of American leafminer to cotton [J]. China Cotton, 1997, (07):35), and included it in the "List of Key Alien Invasive Species under Management" in 2022 (Tang Jiacheng, Zhou Xiaoran. Six departments release the list of key alien invasive species under management [J]. Greening and Life, 2023(01):61). Currently, the common control methods for Liriomyza sativae are as follows: spatial isolation, chemical insecticides, biological control, and resistant plant breeding (Bragard C, K Dehnen-Chmutz, Serio FD, et al. Pest categorisation of Liriomyza sativae [J]. EFSA Journal, 2020, 18(3): e06037). Due to the increasing resistance of Liriomyza sativae to pesticides and the long-term harm caused by pesticide pollution to the environment, the importance of breeding resistant plant varieties has become increasingly prominent. However, functional genes related to resistance to Liriomyza sativae have not yet been found in cotton.

[0003] As the extracellular matrix of plants, the cell wall plays an important role in plant responses to biotic stresses (Silva-Sanzana C, Celiz-Balboa J, Garzo E, et al. Pectin Methylesterases Modulate Plant Homogalacturonan Status in Defenses against the Aphid Myzus persicae[J]. Plant Cell, 2019, 31(8): 1913-1929; Gesteiro N, Butrón A, Estévez S, et al. Unraveling the role of maize(Zea mays L.) cell-wall phenylpropanoids in stem-borer resistance[J]. Phytochemistry, 2021, 185: 112683) and abiotic stresses (Wu HC, Huang YC, Stracovsky L, et al. Pectin methylesterase is required for guard cell function in response to heat[J]. Plant Signaling&Behavior,2017,12(6):e1338227;Jia H,Wang X,Wei T,et al.Exogenous salicylic acid regulates cell wall polysaccharides synthesis and pectin methylation to reduce Cd accumulation of tomato[J].Ecotoxicology and Environmental Safety,2021,207:111550).Pectin is an important component of plant cell walls (Somerville C, Bauer S, Brininstool G, et al. Toward a systems approach to understanding plant cell walls[J]. Science, 2004, 306(5705): 2206-2211), plays a role in cell adhesion and separation (Daher FB, Braybrook SA. How to let go: pectin and plant cell adhesion[J]. Frontiers in Plant Science, 2015, 6: 523), and helps maintain cell integrity (Lionetti V, Fabri E, De Caroli M, et al. Three Pectin Methylesterase Inhibitors Protect Cell Wall Integrity for Arabidopsis Immunity to Botrytis[J]. Plant Physiology, 2017, 173(3): 1844-1863). Pectin methylesterase (PME, EC 3.1.1.11) is a pectin demethylesterase encoded by a multigene family (Li W, Shang H, Ge Q, et al. Genome-wide identification, phylogeny, and expression analysis of pectin methylesterases reveal their major role in cotton fiber development[J]. BMC Genomics, 2016, 7; 17(1): 1000).Previous studies have shown that the modification of pectin by PME plays an important role in plant growth and development. For example, the mechanical strength of the stem of the Arabidopsis pme35 mutant is reduced (Hongo S, Sato K, Yokoyama R, et al. Demethylesterification of the primary wall by PECTIN METHYLESTERASE35 provides mechanical support to the Arabidopsis stem[J]. Plant Cell, 2012, 24(6): 2624-2634), the seeds of the Arabidopsis pme31 mutant are highly sensitive to salt stress (Yan J, He H, Fang L, Zhang A. Pectin methylesterase31 positively regulates salt stress tolerance in Arabidopsis[J]. Biochemical and Biophysical Research Communications, 2018, 496(2): 497-501), and heterologous expression of the poplar PtPME35 gene improves the drought resistance of Arabidopsis (Yang W, Ruan M, Xiang M, et al. Overexpression of a pectin methylesterase gene PtoPME35 from Populus tomentosa influences stomatal function and drought tolerance in Arabidopsis thaliana[J]. Biochemical and Biophysical Research Communications, 2020, 523(2):416-422), etc.In addition, some studies have shown that PME may play a negative regulatory role in the response of plants to biotic stresses. For example, PME activity in Arabidopsis is positively correlated with the feeding preference of aphids (Silva-Sanzana C, Celiz-Balboa J, Garzo E, et al. Pectin Methylesterases Modulate Plant Homogalacturonan Status in Defenses against the Aphid Myzus persicae[J]. Plant Cell, 2019, 31(8): 1913-1929), and the Arabidopsis pme18 mutant has enhanced resistance to Brassicae root knot fungus (Stefanowicz K, Szymanska-Chargot M, Truman W, et al. Plasmodiophora brassicae-Triggered Cell Enlargement and Loss of Cellular Integrity in Root Systems Are Mediated by Pectin Demethylation[J]. Frontiers in Plant Science, 2021, 12: 711838), overexpression of PME3 in Arabidopsis enhances its attractiveness to beet cyst nematodes (Hewezi T, Howe P, Maier TR, et al. Cellulose binding protein from the parasitic nematode Heterodera schachtii interacts with Arabidopsis pectin methylesterase: cooperative cell wall modification during parasitism[J]. Plant Cell, 2008, 20(11): 3080-3093), etc.In recent years, there have been a few studies on PME in cotton, such as the close correlation between PME activity level and cotton fiber quality (Liu Q, Talbot M, Llewellyn DJ. Pectin Methylesterase and Pectin Remodelling Differ in the Fiber Walls of Two Gossypium Species with Very Different Fiber Properties[J]. PLoS One, 2013, 8(6): e65131), and PMEI3 regulating cotton pectin methylesterification and enhancing cotton resistance to Verticillium wilt by inhibiting the activity of PME2 and PME31 (Liu N, Sun Y, Pei Y, et al. A Pectin Methylesterase Inhibitor Enhances Resistance to Verticillium Wilt[J]. Plant Physiology, 2018, 176(3): 2202-2220). However, the role of PME in cotton insect resistance is still unclear.

[0004] Summary of the Invention

[0005] The present invention clarifies the application of the GhPME36 gene in regulating the resistance of cotton to the American leafminer, creates a cotton material overexpressing the GhPME36 gene, and significantly enhances the susceptibility of the material to the American leafminer pest; the present invention explores the genetic function of the GhPME36 gene in regulating the resistance of cotton to the American leafminer. The GhPME36 gene causes a significant decrease in the content of highly methylated pectin in the epidermal cells of the leaves of the material, a decrease in cell wall thickness, and an increase in the content of soluble sugars such as glucose and sucrose in the cell walls, making the leaves of the material susceptible to being eaten by the American leafminer.

[0006] First, the present invention provides the application of the GhPME36 gene in regulating the resistance of cotton to the leafminer Liriomyza sativae.

[0007] The application is used for breeding cotton varieties that are sensitive to the American leafminer to serve as control varieties.

[0008] The application is achieved by overexpressing the GhPME36 gene in cotton.

[0009] The application is used for breeding cotton varieties resistant to the American leafminer to serve as resistant varieties.

[0010] The application is achieved by inactivating the GhPME36 gene in cotton or reducing its expression level or activity of the encoded protein through genetic engineering.

[0011] The application is achieved by knocking out the GhPME36 gene in cotton through a gene editing method.

[0012] In the above application, the nucleotide sequence of the GhPME36 gene is shown in SEQ ID NO: 1.

[0013] A person skilled in the art can use known methods to mutate the nucleotide sequence of the GhPME36 gene of the present invention. Those nucleotide sequences obtained after artificial modification and having 75% or higher identity with the nucleotide sequence of the GhPME36 gene of the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention, as long as they encode the GhPME36 gene and have the function of the GhPME36 gene.

[0014] The present invention has the following beneficial effects

[0015] The present invention provides a detailed description of the function of the GhPME36 gene in regulating cotton resistance to the leafminer by studying: (1) the expression trend of the GhPME36 gene during cotton leaf development and the subcellular localization of the GhPME36 protein; (2) the insect infestation index and PME enzyme activity level of GhPME36 gene-overexpressing cotton materials and leaves of such materials; (3) the degree of pectin methylation and cell wall thickness in the leaf epidermal cells of such materials; and (4) the total soluble sugar content and the content of various monosaccharides / disaccharides such as glucose and sucrose in the leaves of such materials. Furthermore, a GhPME36 gene-overexpressing cotton material was created. The content of highly methylated pectin in the leaf epidermal cells of such materials was significantly reduced, the cell wall thickness was reduced by 13%-15%, and the total soluble sugar content in the cell wall was increased by 20%-30%, among which the content of monosaccharides / disaccharides such as glucose and sucrose was generally increased. Furthermore, a GhPME36 gene-knockout cotton material was created, which exhibited significant resistance to the leafminer. The results of the invention can be applied to regulating the resistance of cotton to the leafminer and breeding new cotton varieties resistant to the leafminer. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 shows the relative expression levels of the GhPME36 gene in cotton leaves at different developmental stages. 7D, 14D, 21D, 28D, and 35D refer to 7-, 14-, 21-, 28-, and 35-day-old cotton leaves. Error bars represent the standard deviation of at least three technical replicates for each sample.

[0017] Figure 2 shows the subcellular localization of GhPME36 in onion epidermal cells without and after plasmolysis. Scale bar: 1 mm.

[0018] Figure 3 shows the PME enzyme activity in leaves of wild-type Zhong24, three GhPME36 gene-overexpressing cotton lines (abbreviated as GhPME36-OE), wild-type Jin668, and three GhPME36 gene-edited cotton lines (abbreviated as GhPME36-KO). The error bars represent the standard deviation of at least three technical replicates for each sample. ** indicates P less than 0.05, and * indicates P greater than 0.05 and less than 0.01.

[0019] Figure 4 shows the leaf characteristics of wild-type Zhong 24 and GhPME36-OE line 3 (abbreviated as GhPME36-OE#3) infested with Liriomyza sativae when planted in the field (A), and the insect infestation index of Liriomyza sativae infestation on the leaves of wild-type Zhong 24, three GhPME36-OE lines, wild-type Jin668, and three GhPME36-KO lines (B).

[0020] Figure 5 shows the thickness of the upper and lower epidermal cell walls of leaves of the wild type Zhong24 and GhPME36-OE#3. Error bars represent the standard deviation of at least three technical replicates for each sample. ** indicates P less than 0.05, and * indicates P greater than 0.05 and less than 0.01.

[0021] Figure 6 shows the microscopic structure of leaf cells in the wild type 24 and GhPME36-OE#3, with a scale bar of 5 nm.

[0022] Figure 7 shows the total soluble sugar content in leaves of the wild type Zhong24 and three GhPME36-OE lines, the wild type Jin668, and three GhPME36-KO lines. Error bars represent the standard deviation of at least three technical replicates for each sample. ** indicates P less than 0.05, and * indicates P greater than 0.05 and less than 0.01.

[0023] Figure 8 shows the contents of common monosaccharides and disaccharides in leaves of wild type 24 and GhPME36-OE#3. Error bars represent the standard deviation of at least three technical replicates for each sample. ** indicates P less than 0.05, and * indicates P greater than 0.05 and less than 0.01. DETAILED DESCRIPTION

[0024] The present invention will be further described in detail below in conjunction with specific implementation methods. The examples given are only for illustrating the present invention and are not intended to limit the scope of the present invention.

[0025] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials and reagents used are commercially available unless otherwise specified. Quantitative experiments were performed with three replicates, and the results were averaged. The materials used were cotton leaves at 7, 14, 21, 28, and 35 days of age, referred to herein as 7D, 14D, 21D, 28D, and 35D. The GhPME36 gene-overexpressing cotton line is referred to as GhPME36-OE. GhPME36-OE line 3 is referred to as GhPME36-OE#3.

[0026] TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) and TransStart Tip Green qPCR SuperMix are products of Quanshijin Company; ClonExpress Ultra One Step Cloning Kit is a product of Vazyme Company; pMD-18T Vector and PrimeScript RT reagent kit with gDNA Eraser (Perfece Real Time) are products of Takara Company; the plant polysaccharide and polyphenol RNA extraction kit is a product of Tiangen Company; and the plant soluble sugar determination kit is a product of Beijing Solebeau Technology Co., Ltd.

[0027] Among the cotton varieties, 24 were obtained from the Cotton Research Institute of the Chinese Academy of Agricultural Sciences. This biological material was only used to repeat the relevant experiments of the present invention and could not be used for other purposes.

[0028] Example 1. Expression analysis of the GhPME36 gene during cotton leaf development

[0029] 1. RNA was extracted from 24 leaves at different developmental stages (7D, 14D, 21D, 28D, and 35D) and reverse transcribed into first-strand cDNA. Primers were designed based on the GhPME36 gene sequence (shown in SEQ ID NO: 1). The primer sequences were GhPME36-F: CGCGGATCCGCGGGCATTGGCACGTCTTCAAAT (the underlined sequence is the recognition sequence for the restriction endonuclease BamHI, SEQ ID NO: 2) and GhPME36-R: CGAGCTCGTAAAGCCCTGAAGTGAAAGGC (the underlined sequence is the recognition sequence for the restriction endonuclease SacI, SEQ ID NO: 3), and qPCR amplification was performed.

[0030] 2. The qPCR program was as follows: pre-denaturation at 95°C for 15 s; denaturation at 95°C for 5 s, annealing at 60°C for 34 s, and extension at 72°C for 40 s; for a total of 40 cycles.

[0031] 3. The internal reference gene used in the above experiment is Histon-3, and the primer sequences are Histon-F: GAAGCCTCATCGATACCGTC, Histon-R: CTACCACTACCATCATGGC.

[0032] 4. The above experiment was repeated 3 times biologically and 3 times technically, and the relative quantitative differential expression analysis was performed using 2 -ΔΔCT The method is described in the following literature (Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2 -ΔΔCT Method. Livak and Schmittgen, 2001: 25, 402-408.).

[0033] 5. The test results are shown in Figure 1. The results show that the expression level of GhPME36 is highest in 7-day-old leaves. As the leaves develop, its expression level gradually decreases, dropping by about 10 times on the 28th day, and finally increasing as the leaves approach maturity.

[0034] Example 2: Subcellular localization of GhPME36

[0035] 1. The GhPME36 gene and pCAMBIA2300 plasmid were double-digested with restriction endonucleases BamHI and SacI, respectively, to construct the recombinant vector pCAMBIA2300-35S-GhPME36-eGFP for subcellular localization.

[0036] 2. Select the inner epidermis of the 3rd or 4th layer of onion, cut off the central square area with a sterilized blade, spread it on MS agar medium containing 100 mg / L ampicillin, and culture it in the dark at 25°C for 4 hours.

[0037] 3. Weigh 3 mg of gold powder and place it in a 1.5 mL centrifuge tube. Sterilize it with 75% ethanol for 15 min and wash it three times with double distilled water.

[0038] 4. Use 50 μL of 50% glycerol solution to resuspend the gold powder pellet, and add a mixture containing 5 μL of plasmid (concentration is about 1 μg / μL), 50 μL of CaCl2 (concentration is 2.5m / L) and 20 μL of spermidine (concentration is about 0.1m / L) to the resuspension solution several times. Shake for 2-3 seconds after each addition, resuspend and precipitate 10 times, and place the centrifuge tube on ice immediately after each resuspension.

[0039] 5. Wash the plasmid-encapsulated gold powder with anhydrous ethanol and resuspend it. Inject the gold powder into the onion epidermal cells using a gene gun. Select a 1350 psi splitting membrane, set the vacuum to 26-28 Hg, and adjust the bombardment distance to 6 cm.

[0040] 6. The onion inner epidermis that has completed transient transformation was cultured in the dark at 25°C for 24-48 hours, and GFP images were obtained using a laser confocal scanning microscope. The onion inner epidermis was treated with 0.3 g / ml sucrose solution to achieve plasmolysis.

[0041] 7. The experimental results are shown in Figure 2, which show that GhPME36 is localized in the cell wall.

[0042] Example 3: Obtaining GhPME36-OE cotton plants

[0043] The Cotton Research Institute of the Chinese Academy of Agricultural Sciences was commissioned to transform the pBI121-GhPME36 recombinant vector into the upland cotton variety CCRI24 via Agrobacterium-mediated transfection, generating GhPME36-OE cotton plants. After subculture and identification, three homozygous lines were selected for subsequent experiments.

[0044] Example 4: Obtaining GhPME36-KO cotton plants

[0045] Based on the sequence information of the GhPME36 gene, two gene editing target sites were designed: ATGATGTGAGATCATGGTGC and GTGCGGCACGCTCTAGAGCG. Fragments containing the target sites were amplified using overlap extension PCR and cloned into the pCAS9 / gRNA3 vector using the ClonExpress Ultra One-Step Cloning Kit to generate the GhPME36 gene editing vector. Wuhan Tianwen Biotechnology Co., Ltd. was commissioned to generate GhPME36 knockout cotton plants using the upland cotton material Jin668 as the recipient. After subculture and identification, three homozygous lines (GhPME36-KO#1, GhPME36-KO#2, and GhPME36-KO#3) were selected for subsequent experiments.

[0046] Example 5, determination of total PME enzyme activity

[0047] 1. The total PME enzyme activity was determined according to the Hagerman test method, which is described in the following literature: Hagerman, AEA, PJ (1986). Continuous spectrophotometric assay for plant pectin methylesterase. J. Agr. Food. Chem. 34, 440-444.

[0048] 2. The experimental results are shown in Figure 3. The results show that compared with the wild type, the PME activity in the leaves of GhPME36-OE cotton increased by 15%-18% (Figure 3A), and the PME activity in the leaves of GhPME36-KO cotton decreased by 11%-27% (Figure 3B).

[0049] Example 6: Field investigation of GhPME36-OE#3 affected by Liriomyza sativae

[0050] 1. The field pest situation was counted in August 2021, referring to Jin Hui's experimental method, which is recorded in the following literature: Jin Hui, Wei Changhai, Wang Yingli. Research on the determination of yield loss and control indicators of greenhouse cucumbers damaged by leafminers [J]. Modern Agricultural Science and Technology, 2009, (03): 111-113.

[0051] 2. The experimental results are shown in Figure 4. Taking GhPME36-OE#3 as an example, during field cultivation, GhPME36-OE cotton leaves were subjected to intense attack by the leafminer, resulting in extensive burrows of the fly. Over time, the affected leaves withered and even fell off (Figure 4A). Field surveys revealed that the insect infestation index (I) for GhPME36-OE cotton leaves was significantly increased, nearly 30-fold, compared to the wild-type (24). GhPME36-KO cotton leaves were virtually unaffected by the fly, demonstrating significant resistance to the leafminer compared to the wild-type Jin668 (Figure 4B).

[0052] Example 7: Observation of the degree of pectin methylation in the cell walls of GhPME36-OE#3 leaves

[0053] 1. Prepare 4% paraformaldehyde solution in 0.2M PBS buffer and adjust the pH to 7.4. Prepare it 1-2 hours before each use as the fixative.

[0054] 2. Take a cotton leaf at its mature stage, collect a slice (10 mm × 40 mm) on the right side of the middle of the leaf vein and immerse it in the fixative solution. Fix it at room temperature for 12-24 hours.

[0055] 3. Antibodies LM19 and LM20 were diluted 1:50, aliquoted and stored at -20°C until use. Wuhan Kangyisheng Biotechnology Co., Ltd. was entrusted with sample embedding, sectioning, immunofluorescence labeling, and scanning and photography.

[0056] 4. Immunohistochemistry was performed on the leaves using two monoclonal antibodies, LM19 and LM20, which respectively labeled pectin with low and high methylation levels. The experimental results showed that compared with the wild type 24, the high methylation pectin in the epidermal cells of GhPME36-OE#3 cotton leaves was significantly reduced, while the low methylation pectin had almost no difference, which was more conducive to feeding by the American leafminer.

[0057] Example 8: Observation and determination of GhPME36-OE#3 leaf epidermal cell wall thickness

[0058] 1. Prepare 2.5% glutaraldehyde solution in 0.2 M PBS buffer, adjust the pH to 7.4, seal and store in the dark at 4°C for future use as the fixative.

[0059] 2. Take cotton leaves at 7D, 14D, 21D and 28D, collect slices (5mm×20mm) from the right side of the middle of the leaf vein, immerse them in the fixative, place them in a vacuum dish for 1 hour, and then let them stand at room temperature for 24 hours.

[0060] 3. Wash the sections three times in 0.2 M PBS buffer (pH 7.4) and fix with 1% osmium tetroxide for 1 h.

[0061] 4. Wash the sections again three times in 0.2 M PBS buffer (pH 7.4), dehydrate them with 50%-100% acetone gradient, and embed them in EPON 812 resin.

[0062] 5. Cut the sample into ultrathin sections, collect them on a copper grid with a fragrance support film, and negatively stain with 2% uranyl acetate.

[0063] 6. Observe the samples using a transmission electron microscope at 80 kV, and obtain images and specific data using Image-Pro Plus 6.0.

[0064] 7. The test results are shown in Figures 5 and 6. The results show that the cell wall thickness of the upper and lower epidermis of GhPME36-OE cotton leaves was reduced to a certain extent compared with the wild type. Among them, the cell wall thickness of the upper epidermis decreased by about 13%, while the cell wall thickness of the lower epidermis decreased by about 15%.

[0065] Example 9: Determination of total soluble sugar content in leaves of GhPME36-OE and GhPME36-KO

[0066] 1. Take a 28-day-old cotton leaf, cut a 0.1 g sample from the right side of the middle vein, grind it in liquid nitrogen, and collect it in a 2 mL centrifuge tube.

[0067] 2. Use the plant soluble sugar determination kit BC0035 to determine the soluble sugar content in cotton leaves by the anthrone colorimetric method.

[0068] 3. The test results are shown in FIG7 , which show that the soluble sugar content in the leaves of GhPME36-OE increased by 20%-30% compared with the wild type, and the soluble sugar content in the leaves of GhPME36-KO decreased by 20%-30% compared with the wild type.

[0069] Example 10: Determination of Common Monosaccharide / Disaccharide Contents in GhPME36-OE#3 Leaves

[0070] 1. Mature leaves of wild-type Zhong 24 and GhPME36-OE#3 cotton from the same period were quickly frozen in liquid nitrogen, ground, and stored at -80°C. Targeted sugar metabolomics analysis was commissioned to Wuhan Metrowell Biotechnology Co., Ltd.

[0071] 2. The test results are shown in FIG8 , which show that compared with the wild type, the contents of 13 tested sugars in GhPME36-OE#3 increased, especially D-fructose and glucose, whose contents increased significantly by 94%-96%.

Claims

1. Application of GhPME36 gene in regulating cotton resistance to Liriomyza sativae leafminer.

2. The use according to claim 1, characterized in that It is used to breed cotton varieties that are susceptible to the American leafminer to serve as control varieties.

3. The use according to claim 1, characterized in that This was achieved by overexpressing the GhPME36 gene in cotton.

4. The use according to claim 1, characterized in that It is used to breed cotton varieties that are resistant to the American leafminer as resistant varieties.

5. The use according to claim 4, characterized in that The method is achieved by inactivating the GhPME36 gene in cotton or reducing the expression level or the activity of the encoded protein expressed by means of genetic engineering.

6. The use according to claim 5, characterized in that This is achieved by knocking out the GhPME36 gene in cotton using a gene editing method.

7. The use according to claim 5, characterized in that The gene editing target sites for gene editing are: ATGATGTGAGATCATGGTGC or GTGCGGCACGCTCTAGAGCG.

8. The use according to any one of claims 1 to 6, characterized in that The nucleotide sequence of the GhPME36 gene is shown in SEQ ID NO:1.

Images