Human embryonic kidney cell lines and use thereof in producing raav

Abstract

The present invention provides a human embryonic kidney (HEK) cell line or the progeny thereof, wherein the cell line is deposited under an accession number selected from the group consisting of CCTCC NO: C202372, CCTCC NO: C2023129, CCTCC NO: C2023130, CCTCC NO: C2023131, CCTCC NO: C2023132, CCTCC NO: C2023133, and CCTCC NO: C2023134. The present invention also provides a method of preparing rAAV with the cell line or the progeny thereof or a kit for preparing rAAV comprising the cell line or the progeny thereof.

Description

Human Embryonic Kidney Cell Lines and Use thereof in Producing rAAVTechnical Field

[0001] The present invention relates to cell biology and gene therapy. In particular, the present invention involves cell lines providing an improved production of rAAVs for gene therapy.Background

[0002] Adeno-associated virus (AAV) is a member of Parvoviridae family. It is a simple single-stranded DNA virus, and requires a helper virus (such as adenovirus) for replication. The genome of a wildtype AAV contains approximately 4.7 kilobases (kb) , comprising the cap and rep genes between two inverted terminal repeat (ITR) sequences, approximately 145 nucleotides in length, with interrupted palindromic sequences that can fold into hairpin structures that function as primers during initiation of DNA replication. The cap gene encodes the viral capsid protein, and the rep gene is involved in the replication and integration of AAV. AAV can infect a variety of cells, and the viral DNA can be integrated into human chromosome 19 in the presence of the rep product.

[0003] Recombination adeno-associated virus (rAAV) is a genetic vector derived from non-pathogenic wild-type AAV by replacing the rep and cap genes in the genome with artificial sequences such as expression cassette for expressing a desired / functional gene. rAAV has a low immunogenicity and high safety, can infect a wide range of host cells (including both dividing and non-dividing cells) , can spread throughout the body, and can provide a long-term expression in vivo, and thus, rAAV is considered as one of the most promising vectors for genetic studies and gene therapy. There are a great number of pending clinical trials employ rAAV-related technology.

[0004] As the need of rAAV is increasing, e.g., a high dose of rAAV-containing medicament is needed for gene therapy, especially for adult patients, there remain a need of a progress of producing rAAVs at a high yield.

[0005] At present, the rAAVs are generally produced by packaging in a mammal cell, such as transfecting the cell with a three-plasmid system. The production of rAAVs may depend on the performance of the cell, such as the growth performance and the packaging efficiency. Therefore, there is a need of a cell line that can package rAAV at a higher efficiency.Summary of the Invention

[0006] In the first aspect, the present invention provides a human embryonic kidney (HEK) cell line or the progeny thereof, wherein the cell line is deposited under an accession number selected from the group consisting of CCTCC NO: C202372, CCTCC NO: C2023129, CCTCC NO: C2023130, CCTCC NO: C2023131, CCTCC NO: C2023132, CCTCC NO: C2023133, and CCTCC NO: C2023134.

[0007] In the second aspect, the present invention provides the use of the HEK cell line or the progeny  thereof of the invention in the preparation of recombinant adeno-associated virus (rAAV) .

[0008] The present invention also provides a method of preparing rAAV comprising transfecting a cell from the HEK cell line or the progeny thereof of the invention with a system for preparing rAAV.

[0009] In some embodiments, the system comprises a plasmid comprising the genome of the rAAV, a plasmid encoding the CAP and / or REP polypeptides of AAV and a helper plasmid.

[0010] In some embodiments, the method further comprises culturing the transfected cell under a condition allowing the packaging of the rAAV.

[0011] In some embodiments, the method further comprises lysing the cell and harvesting the rAAV.

[0012] In the third aspect, the present invention provides a kit for preparing rAAV, comprising a cell derived from the cell line or the progeny thereof of the invention.

[0013] In some embodiments, the kit further comprises an agent comprising a packaging gene, and / or an agent for providing a helper virus function.

[0014] In some embodiments, the kit further comprises an agent for delivering the genome of the rAAV, such as the backbone of the transgene plasmid.

[0015] In some embodiments, the agent comprising a packaging gene comprises a packaging plasmid encoding a Rep polypeptide and / or a Cap polypeptide.

[0016] In some embodiments, the agent for providing a helper virus function comprises a helper virus or a polynucleotide encoding the function.Brief Description of the Drawings

[0017] Fig. 1 shows the maps of the helper plasmid (Fig. 1A) , packaging plasmid (Figs. 1B and 1C, encoding AAV8 and AAV9 capsids, respectively) and the transgene plasmid providing a genome encoding ZsGreen (Fig. 1D) or a genome comprising a functional gene (Fig. 1E, in which GOI is the nucleotide sequences between the ITRs) .

[0018] Fig. 2 shows the production of rAAVs comprising AAV8 or AAV9 capsid, and a genome encoding ZsGreen in the isolated cell lines.

[0019] Fig. 3 shows the production of rAAVs comprising AAV8 capsid, and a genome comprising F8V3 in the isolated cell lines in LV MAX (F8V3-LV MAX) or OPM293 CD05 (F8V3-CD 05) .

[0020] Fig. 4 shows the production of rAAVs comprising AAV9 capsid, and a genome comprising SPK9001 in the isolated cell lines in LV MAX (SPK9001-LV MAX) or OPM293 CD05 (SPK9001-CD 05) .

[0021] Fig. 5 shows the production of rAAVs comprising AAV8 capsid, and a genome comprising F8V3, in the isolated cell lines.

[0022] Fig. 6 shows the production of rAAVs comprising AAV9 capsid, and a genome comprising SPK9001 in the isolated cell lines.

[0023] Fig. 7 shows the growth performance of the isolated cells, including doubling time with culturing time (Fig. 7A) , viable cell density with culturing time (Fig. 7B) and viability with culturing time (Fig. 7C) .

[0024] Fig. 8 shows the production of rAAVs comprising AAV9 capsid and a genome comprising SEQ ID NO: 3 in the isolated cell lines after 15, 30, 60 and 90 passages.Detailed Description of the Invention

[0025] 1.Definition

[0026] Unless otherwise indicated, all terms used herein have the same meaning as they would to one skilled in the art, and the practice of the present invention will employ conventional techniques of microbiology and recombinant DNA technology, which are within the knowledge of those of skill in the art.

[0027] “AAV” is an abbreviation for adeno-associated virus, and may be used to refer to the virus itself or derivatives thereof. The term covers all subtypes and both naturally occurring and recombinant forms, except where required otherwise. The abbreviation “rAAV” refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or “rAAV vector” ) . The term “AAV” includes AAV type 1 (AAV-1) , AAV type 2 (AAV-2) , AAV type 3 (AAV-3) , AAV type 4 (AAV-4) , AAV type 5 (AAV-5) , AAV type 6 (AAV-6) , AAV type 7 (AAV-7) , AAV type 8 (AAV-8) , avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. “Primate AAV” refers to AAV that infect primates, “non-primate AAV” refers to AAV that infect non-primate mammals, “bovine AAV” refers to AAV that infect bovine mammals, etc.

[0028] The genomic sequences of various serotypes of AAV, as well as the sequences of the native terminal repeats (TRs) , Rep proteins, and capsid subunits are known in the art. Such sequences may be found in public databases such as GenBank. See, e.g., GenBank Accession Numbers NC_002077 (AAV-1) , AF063497 (AAV-1) , NC_001401 (AAV-2) , AF043303 (AAV-2) , NC_001729 (AAV-3) , NC_001829 (AAV-4) , U89790 (AAV-4) , NC_006152 (AAV-5) , AF513851 (AAV-7) , AF513852 (AAV-8) , and NC_006261 (AAV-8) ; the disclosures of which are incorporated by reference herein for teaching AAV nucleic acid and amino acid sequences.

[0029] An “rAAV vector” as used herein refers to an AAV vector comprising a polynucleotide sequence not of AAV origin (i.e., a polynucleotide heterologous to AAV) , typically a sequence of interest for the genetic transformation of a cell. In general, the heterologous polynucleotide is flanked by at least one, and generally by two, AAV inverted terminal repeat sequences (ITRs) . The term rAAV vector encompasses both rAAV vector particles and rAAV vector plasmids (also referred  to as transgene plasmid) . An rAAV vector may either be single-stranded (ssAAV) or self-complementary (scAAV) .

[0030] An “AAV virus” or “AAV viral particle” or “rAAV vector particle” refers to a viral particle composed of at least one AAV capsid protein (typically by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e. a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell) , it is typically referred to as an “rAAV vector particle” or simply an “rAAV vector” . Thus, production of rAAV particle necessarily includes production of rAAV vector, as such a vector is contained within an rAAV particle.

[0031] “Packaging” refers to a series of intracellular events that result in the assembly and encapsidation of an AAV particle.

[0032] AAV “rep” and “cap” genes refer to polynucleotide sequences encoding replication and encapsidation proteins of adeno-associated virus. AAV rep and cap are referred to herein as AAV “packaging genes” . A plasmid or other expression vector comprising rep and cap genes is referred herein to as “packaging plasmid” or “packaging vector” .

[0033] The cap gene encodes three structural proteins, VP1, VP2, and VP3, that self-assemble into a 60-mer icosahedral capsid at a ratio of approximately 1: 1: 10. These three proteins are transcribed from the same open reading frame and share a C-terminal domain but have different N-termini due to alternative start codons and alternative splicing (Esther J. Lee, et al., Adeno-Associated Virus (AAV) Vectors: Rational Design Strategies for Capsid Engineering, Curr Opin Biomed Eng. 2018; 7: 58–63) .

[0034] A “helper virus” for AAV refers to a virus that allows AAV (e.g. wild-type AAV) to be replicated and packaged by a mammalian cell. A variety of such helper viruses for AAV are known in the art, including adenoviruses, herpesviruses and poxviruses such as vaccinia. The adenoviruses encompass a number of different subgroups, although Adenovirus type 5 of subgroup C is most commonly used. Numerous adenoviruses of human, non-human mammalian and avian origin are known and available from depositories such as the ATCC. Viruses of the herpes family include, for example, herpes simplex viruses (HSV) and Epstein-Barr viruses (EBV) , as well as cytomegaloviruses (CMV) and pseudorabies viruses (PRV) ; which are also available from depositories such as ATCC.

[0035] “Helper virus function (s) ” refers to function (s) encoded in a helper virus genome which allow AAV replication and packaging (in conjunction with other requirements for replication and packaging described herein) . As described herein, “helper virus function” may be provided in a number of ways, including by providing helper virus or providing, for example, polynucleotide sequences encoding the requisite function (s) to a producer cell in trans. For example, a plasmid, which is referred herein to as “helper plasmid” , or other expression vector comprising nucleotide sequences encoding one or more adenoviral proteins is transfected into a producer cell along with an rAAV vector.

[0036] As used herein, the term “polynucleotide construct” refers to a single-stranded or double- stranded polynucleotide, which is isolated from a naturally occurring gene or modified to contain a nucleic acid segment that does not naturally occur. When the polynucleotide construct contains the control sequences required to express the coding sequence of the present invention, the polynucleotide construct comprises an “expression cassette” .

[0037] As used herein, the term “polynucleotide” usually refers to generally a nucleic acid molecule (e.g., 100 bases and up to 30 kilobases in length) and a sequence that is either complementary (antisense) or identical (sense) to the sequence of a messenger RNA (mRNA) or miRNA fragment or molecule. The term can also refer to DNA or RNA molecules that are either transcribed or non-transcribed.

[0038] The term “exogenous polynucleotide” refers to a nucleotide sequence that does not originate from the host in which it is placed. It may be identical to the host’s DNA or heterologous. An example is a sequence of interest inserted into a vector. Such exogenous DNA sequences may be derived from a variety of sources including DNA, cDNA, synthetic DNA, and RNA. Exogenous polynucleotides also encompass DNA sequences that encode antisense oligonucleotides.

[0039] “Heterologous” means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter. Thus, for example, an rAAV that includes a heterologous nucleic acid encoding a heterologous gene product is an rAAV that includes a nucleic acid not normally included in a naturally-occurring, wild-type AAV, and the encoded heterologous gene product is a gene product not normally encoded by a naturally-occurring, wild-type AAV.

[0040] As used herein, the term “expression cassette” refers to a polynucleotide segment comprising a polynucleotide encoding a polypeptide operably linked to additional nucleotides provided for the expression of the polynucleotide, for example, control sequence.

[0041] As used herein, the term “expression” includes any step involved in the production of a polypeptide, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0042] A “control sequence” includes all elements necessary or beneficial for the expression of the polynucleotide encoding the polypeptide of the present invention. Each control sequence may be natural or foreign to the nucleotide sequence encoding the polypeptide, or natural or foreign to each other. Such control sequences include, but are not limited to, leader sequence, polyadenylation sequence, propeptide sequence, promoter, enhancer, signal peptide sequence, and transcription terminator. At a minimum, control sequences include a promoter and signals for the termination of transcription and translation.

[0043] For example, the control sequence may be a suitable promoter sequence, a nucleotide sequence recognized by the host cell to express the polynucleotide encoding the polypeptide of the  present invention. The promoter sequence contains a transcription control sequence that mediates the expression of the polypeptide. The promoter may be any nucleotide sequence that exhibits transcriptional activity in the selected host cell, for example, lac operon of E. coli. The promoters also include mutant, truncated and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides, which are homologous or heterologous to the host cell.

[0044] As used herein, the term “operably linked” herein refers to a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of the polynucleotide sequence, whereby the control sequence directs the expression of the polypeptide coding sequence.

[0045] A “gene” refers to a polynucleotide containing at least one open reading frame encoding a polynucleotide or a polypeptide.

[0046] A “gene product” is a molecule resulting from the expression of a particular gene. Gene products include, e.g., a polypeptide, an aptamer, an interfering RNA, an mRNA, and the like.

[0047] A “small interfering RNA” or “short interfering RNA” or siRNA is a RNA duplex of nucleotides that is targeted to a gene interest (a “target gene” ) . An “RNA duplex” refers to the structure formed by the complementary pairing between two regions of a RNA molecule. siRNA is “targeted” to a gene in that the nucleotide sequence of the duplex portion of the siRNA is complementary to a nucleotide sequence of the targeted gene. In some embodiments, the length of the duplex of siRNAs is less than 30 nucleotides. In some embodiments, the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 nucleotides in length. In some embodiments, the length of the duplex is 19-25 nucleotides in length. The RNA duplex portion of the siRNA can be part of a hairpin structure. In addition to the duplex portion, the hairpin structure may contain a loop portion positioned between the two sequences that form the duplex. The loop can vary in length. In some embodiments the loop is 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucleotides in length. The hairpin structure can also contain 3' or 5' overhang portions. In some embodiments, the overhang is a 3' or a 5' overhang 0, 1, 2, 3, 4 or 5 nucleotides in length.

[0048] A “short hairpin RNA, ” or shRNA, is a polynucleotide construct that can be made to express an interfering RNA such as siRNA.

[0049] The term “recombinant” as used herein refers to nucleic acids, vectors, polypeptides, or proteins that have been generated using DNA recombination (cloning) methods and are distinguishable from native or wild-type nucleic acids, vectors, polypeptides, or proteins.

[0050] As used herein, the term “host cell” refers to, for example microorganisms, yeast cells, insect cells, and mammalian cells, that can be, or have been, used as recipients of rAAV vectors. The term includes the progeny of the original cell which has been transduced. Thus, a “host cell” as used herein generally refers to a cell which has been transduced with an exogenous DNA sequence. It is understood that the progeny of a single parental cell may not necessarily be completely identical in morphology or in genomic or total DNA complement to the original  parent, due to, e.g., natural or accidental mutation.

[0051] The term “pharmaceutically acceptable” as used herein refers to molecular entities and compositions that are physiologically tolerable and do not typically produce toxicity or an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.

[0052] The term “subject” as used herein includes, but is not limited to, humans, nonhuman primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs, and the like. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered.

[0053] The terms “polypeptide, ” “peptide, ” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling component. Polypeptides such as anti-angiogenic polypeptides, neuroprotective polypeptides, and the like, when discussed in the context of delivering a gene product to a mammalian subject, and compositions therefor, refer to the respective intact polypeptide, or any fragment or genetically engineered derivative thereof, which retains the desired biochemical function of the intact protein. Similarly, references to nucleic acids encoding anti-angiogenic polypeptides, nucleic acids encoding neuroprotective polypeptides, and other such nucleic acids for use in delivery of a gene product to a mammalian subject (which may be referred to as “transgenes” to be delivered to a recipient cell) , include polynucleotides encoding the intact polypeptide or any fragment or genetically engineered derivative possessing the desired biochemical function.

[0054] An “isolated” plasmid, nucleic acid, vector, virus, virion, host cell, or other substance refers to a preparation of the substance devoid of at least some of the other components that may also be present where the substance or a similar substance naturally occurs or is initially prepared from. Thus, for example, an isolated substance may be prepared by using a purification technique to enrich it from a source mixture. Enrichment can be measured on an absolute basis, such as weight per volume of solution, or it can be measured in relation to a second, potentially interfering substance present in the source mixture. Increasing enrichments of the embodiments of this disclosure are increasingly more isolated. An isolated plasmid, nucleic acid, vector, virus, host cell, or other substance is in some embodiments purified, e.g., from about 80%to about 90%pure, at least about 90%pure, at least about 95%pure, at least about 98%pure, or at least about 99%, or more, pure.

[0055] As used herein, the terms “treatment, ” “treating, ” and the like, refer to obtaining a desired pharmacologic and / or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or may be therapeutic in terms of a partial or complete cure for a disease and / or adverse effect attributable to the disease. “Treatment, ” as used herein, covers any treatment of a disease in a mammal, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be  predisposed to the disease or at risk of acquiring the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.

[0056] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0057] It must be noted that as used herein and in the appended claims, the singular forms “a” , “an” , and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “amodified AAV capsid” includes a plurality of such capsids. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely, ” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0058] 2. Isolated cell lines

[0059] The present invention provides an isolated human embryonic kidney (HEK) cell line that can package rAAV at a high efficiency. As demonstrated in the Examples, the isolated HEK cell line of the invention can package rAAV at a higher efficiency than the prior art cell line such as a commercially available HEK cell line (e.g., HEK293 VPC cells from Thermo, Catalog A35347) .

[0060] In some embodiments, the isolated HEK cell line is deposited under an accession number selected from the group consisting of CCTCC NO: C202372, CCTCC NO: C2023129, CCTCC NO: C2023130, CCTCC NO: C2023131, CCTCC NO: C2023132, CCTCC NO: C2023133, and CCTCC NO: C2023134.

[0061] In an embodiment, the isolated HEK cell line is the line 8F8 deposited under the accession number of CCTCC NO: C202372. In an embodiment, the isolated HEK cell line is the line 8F8-2F8 deposited under the accession number of CCTCC NO: C2023129. In an embodiment, the isolated HEK cell line is the line 8F8-4G1 deposited under the accession number of CCTCC NO: C2023130. In an embodiment, the isolated HEK cell line is the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131. In an embodiment, the isolated HEK cell line is the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132. In an embodiment, the isolated HEK cell line is the line 6F2-1C12 deposited under the accession number of CCTCC NO: C2023133. In an embodiment, the isolated HEK cell line is the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134.

[0062] The inventor found that the isolated cell lines of the invention can package rAAV at a high yield even after 90 passages. Therefore, the present invention also covers the progeny of each of the  deposits. The progeny comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of any of the deposits. Alternatively, the progeny comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of any of the deposits.

[0063] In an embodiment, the isolated HEK cell line is the progeny of the line 8F8 deposited under the accession number of CCTCC NO: C202372. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8 deposited under the accession number of CCTCC NO: C202372. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8 deposited under the accession number of CCTCC NO: C202372.

[0064] In an embodiment, the isolated HEK cell line is the progeny of the line 8F8-2F8 deposited under the accession number of CCTCC NO: C2023129. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-2F8 deposited under the accession number of CCTCC NO: C2023129. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-2F8 deposited under the accession number of CCTCC NO: C2023129.

[0065] In an embodiment, the isolated HEK cell line is the progeny of the line 8F8-4G1 deposited under the accession number of CCTCC NO: C2023130. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-4G1 deposited under the accession number of CCTCC NO: C2023130. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-4G1 deposited under the accession number of CCTCC NO: C2023130.

[0066] In an embodiment, the isolated HEK cell line is the progeny of the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131.

[0067] In an embodiment, the isolated HEK cell line is the progeny of the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132.

[0068] In an embodiment, the isolated HEK cell line is the progeny of the line 6F2-1C12 deposited  under the accession number of CCTCC NO: C2023133. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 6F2-1C12 deposited under the accession number of CCTCC NO: C2023133. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 6F2-1C12 deposited under the accession number of CCTCC NO: C2023133.

[0069] In an embodiment, the isolated HEK cell line is the progeny of the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134.

[0070] 3. Preparation of recombinant adeno-associated virus (rAAV) with the isolated cell lines

[0071] The present invention provides use of an isolated HEK cell line that can package rAAV at a high efficiency or the progeny thereof in the preparation of recombinant adeno-associated virus (rAAV) .

[0072] The present invention provides a method of preparing rAAV comprising transfecting a cell from an isolated HEK cell line that can package rAAV at a high efficiency or the progeny thereof with a system for preparing / packaging rAAV.

[0073] In some embodiments, the isolated HEK cell line is deposited under an accession number selected from the group consisting of CCTCC NO: C202372, CCTCC NO: C2023129, CCTCC NO: C2023130, CCTCC NO: C2023131, CCTCC NO: C2023132, CCTCC NO: C2023133, and CCTCC NO: C2023134.

[0074] In an embodiment, the isolated HEK cell line is the line 8F8 deposited under the accession number of CCTCC NO: C202372. In an embodiment, the isolated HEK cell line is the line 8F8-2F8 deposited under the accession number of CCTCC NO: C2023129. In an embodiment, the isolated HEK cell line is the line 8F8-4G1 deposited under the accession number of CCTCC NO: C2023130. In an embodiment, the isolated HEK cell line is the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131. In an embodiment, the isolated HEK cell line is the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132. In an embodiment, the isolated HEK cell line is the line 6F2-1C12 deposited under the accession number of CCTCC NO: C2023133. In an embodiment, the isolated HEK cell line is the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134.

[0075] In an embodiment, the cell to be transfected is the progeny of the line 8F8 deposited under the accession number of CCTCC NO: C202372. In some embodiments, the cell to be transfected is the progeny obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8 deposited under the accession number of CCTCC NO: C202372. In  some embodiments, the cell to be transfected is the progeny obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8 deposited under the accession number of CCTCC NO: C202372.

[0076] In an embodiment, the cell to be transfected is the progeny of the line 8F8-2F8 deposited under the accession number of CCTCC NO: C2023129. In some embodiments, the cell to be transfected is the progeny obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-2F8 deposited under the accession number of CCTCC NO:C2023129. In some embodiments, the cell to be transfected is the progeny obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-2F8 deposited under the accession number of CCTCC NO: C2023129.

[0077] In an embodiment, the cell to be transfected is the progeny of the line 8F8-4G1 deposited under the accession number of CCTCC NO: C2023130. In some embodiments, the cell to be transfected is the progeny obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-4G1 deposited under the accession number of CCTCC NO:C2023130. In some embodiments, the cell to be transfected is the progeny obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-4G1 deposited under the accession number of CCTCC NO: C2023130.

[0078] In an embodiment, the cell to be transfected is the progeny of the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131. In some embodiments, the cell to be transfected is the progeny obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131. In some embodiments, the cell to be transfected is the progeny obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131.

[0079] In an embodiment, the cell to be transfected is the progeny of the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132. In some embodiments, the cell to be transfected is the progeny obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132. In some embodiments, the cell to be transfected is the progeny obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132.

[0080] In an embodiment, the cell to be transfected is the progeny of the line 6F2-1C12 deposited under the accession number of CCTCC NO: C2023133. In some embodiments, the cell to be transfected is the progeny obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 6F2-1C12 deposited under the accession number of CCTCC NO: C2023133. In some embodiments, the cell to be transfected is the progeny obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 6F2-1C12 deposited under the accession number of CCTCC NO: C2023133.

[0081] In an embodiment, the cell to be transfected is the progeny of the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134. In some embodiments, the cell to be  transfected is the progeny obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134. In some embodiments, the cell to be transfected is the progeny obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134.

[0082] It is known in the art to package rAAV with a system comprising three plasmids, including i) a transgene plasmid comprising the genome of the rAAV encoding a desired gene product, ii) a packaging plasmid encoding the Rep and / or Cap proteins, and iii) a helper plasmid (see, e.g., Crosson SM et al., Helper-free Production of Laboratory Grade AAV and Purification by Iodixanol Density Gradient Centrifugation. Mol Ther Methods Clin Dev. 2018; 10: 1-7) . A method of producing rAAV is also described in, for example, U.S. Patent Publication No. 2005 / 0053922 and U.S. Patent Publication No. 2009 / 0202490.

[0083] Therefore, in some embodiments, the system comprises a plasmid comprising the genome of the rAAV, a plasmid encoding the Cap and / or Rep polypeptides of AAV and an agent providing the helper virus function (s) .

[0084] The plasmid comprising the genome of the rAAV, i.e., transgene plasmid, may be derived from a conventional plasmid for delivering heterogenous polynucleotide into a eukaryotic cell, such as a mammalian cell by inserting the genome with ITRs into the original plasmid. The original plasmid can be commercially available (see, e.g., https:  / / www. addgene. org / viral-service / aav-prep / ) or can be obtained by the design according to principles known in the art (see, e.g., Figs. 1D and 1E) .

[0085] The CAP and REP polypeptides can be encoded by separate plasmids or by a single plasmid, i.e., one or more packaging plasmids. For example, the CAP polypeptide can be from AAV8 or AAV9. As another example, the REP polypeptide can be from AAV2.

[0086] The agent providing the helper virus function (s) can be a helper virus, such as adenoviruses, herpesviruses and poxviruses such as vaccinia, or a helper plasmid or other expression vectors encoding one or more proteins essential for the packaging of rAAV, such as adenoviral E2A, VA, and E4 proteins (see, e.g., Fig. 1A) .

[0087] In some embodiments, the method further comprises culturing the transfected cell under a condition allowing the packaging of the rAAV. For example, the transfected cell can be cultured at 37℃, e.g., for 72 h.

[0088] The method can further comprises lysing the cell and harvesting the rAAV. The cell can be lysed and the rAAV can be recovered with any suitable method known in the art (see, e.g., Crosson SM et al., 2018) .

[0089] Optionally, the recovered rAAV can be further purified with, e.g., affinity chromatography, and ion-exchange chromatography such as anion-exchange chromatography.

[0090] 4. Kit for preparing rAAV

[0091] The present invention provides a kit for preparing rAAV, comprising a cell from an isolated HEK cell line that can package rAAV at a high efficiency or the progeny thereof.

[0092] In some embodiments, the isolated HEK cell line is deposited under an accession number selected from the group consisting of CCTCC NO: C202372, CCTCC NO: C2023129, CCTCC NO:C2023130, CCTCC NO: C2023131, CCTCC NO: C2023132, CCTCC NO: C2023133, and CCTCC NO: C2023134.

[0093] In an embodiment, the isolated HEK cell line is the line 8F8 deposited under the accession number of CCTCC NO: C202372. In an embodiment, the isolated HEK cell line is the line 8F8-2F8 deposited under the accession number of CCTCC NO: C2023129. In an embodiment, the isolated HEK cell line is the line 8F8-4G1 deposited under the accession number of CCTCC NO: C2023130. In an embodiment, the isolated HEK cell line is the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131. In an embodiment, the isolated HEK cell line is the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132. In an embodiment, the isolated HEK cell line is the line 6F2-1C12 deposited under the accession number of CCTCC NO: C2023133. In an embodiment, the isolated HEK cell line is the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134.

[0094] In an embodiment, the isolated HEK cell line is the progeny of the line 8F8 deposited under the accession number of CCTCC NO: C202372. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8 deposited under the accession number of CCTCC NO: C202372. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8 deposited under the accession number of CCTCC NO: C202372.

[0095] In an embodiment, the isolated HEK cell line is the progeny of the line 8F8-2F8 deposited under the accession number of CCTCC NO: C2023129. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-2F8 deposited under the accession number of CCTCC NO: C2023129. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-2F8 deposited under the accession number of CCTCC NO: C2023129.

[0096] In an embodiment, the isolated HEK cell line is the progeny of the line 8F8-4G1 deposited under the accession number of CCTCC NO: C2023130. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-4G1 deposited under the accession number of CCTCC NO: C2023130. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-4G1 deposited under the accession number of CCTCC NO: C2023130.

[0097] In an embodiment, the isolated HEK cell line is the progeny of the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131. In some embodiments, the isolated  HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-5A7 deposited under the accession number of CCTCC NO: C2023131.

[0098] In an embodiment, the isolated HEK cell line is the progeny of the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 8F8-5F9 deposited under the accession number of CCTCC NO: C2023132.

[0099] In an embodiment, the isolated HEK cell line is the progeny of the line 6F2-1C12 deposited under the accession number of CCTCC NO: C2023133. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 6F2-1C12 deposited under the accession number of CCTCC NO: C2023133. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 6F2-1C12 deposited under the accession number of CCTCC NO: C2023133.

[0100] In an embodiment, the isolated HEK cell line is the progeny of the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134. In some embodiments, the isolated HEK cell line comprises a cell obtained by 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, 1-40, 1-30, 1-20, 1-15, 1-10, 1-5 passages of the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134. In some embodiments, the isolated HEK cell line comprises a cell obtained by at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more passages of the line 6F2-2D12 deposited under the accession number of CCTCC NO: C2023134.

[0101] In some embodiments, the kit further comprises an agent comprising a packaging gene. In some embodiments, the agent comprising a packaging gene comprises an expression cassette encoding a Rep polypeptide and / or an expression cassette encoding a Cap polypeptide. The expression cassettes can be present in separate plasmids or in a single plasmid. For example, the CAP polypeptide can be from AAV8 or AAV9. As another example, the REP polypeptide can be from AAV2.

[0102] In some embodiments, the kit further comprises an agent for providing a helper virus function (s) . The agent providing the helper virus function (s) can be a helper virus, such as adenoviruses, herpesviruses and poxviruses such as vaccinia, or preferably, a helper plasmid or other expression vectors encoding one or more proteins essential for the packaging of rAAV, such as adenoviral E2A, VA, and E4 proteins.

[0103] In some embodiments, the kit further comprises an agent for delivering the genome of the rAAV, such as comprising the backbone of the transgene plasmid. The agent can comprise a  conventional plasmid for delivering heterogenous polynucleotide into a eukaryotic cell, such as a mammalian cell by inserting the genome into the original plasmid. The original plasmid can be commercially available or can be obtained by the design according to principles known in the art.

[0104] In some embodiments, the kit further comprises an agent for lysing the cell such as triton, e.g. at a concentration of 0.1% (w / w) .

[0105] In some embodiments, the kit further comprises an agent for purifying rAAV, including but not limited to columns and buffers for affinity chromatography, and ion-exchange chromatography such as anion-exchange chromatography.

[0106] 5. Deposition of the cell lines

[0107] Cell lines 8F8, 8F8-2F8, 8F8-4G1, 8F8-5A7, 8F8-5F9, 6F2-1C12, and 6F2-2D12 were deposited at China Center for Type Culture Collection (CCTCC, Wuhan University, Wuhan, China) on May 24, 2023 under the accession numbers of CCTCC NO: C202372 (for 8F8) , CCTCC NO: C2023129 (for 8F8-2F8) , CCTCC NO: C2023130 (for 8F8-4G1) , CCTCC NO: C2023131 (for 8F8-5A7) , CCTCC NO: C2023132 (for 8F8-5F9) , CCTCC NO: C2023133 (for 6F2-1C12) , and CCTCC NO: C2023134 (for 6F2-2D12) .

[0108] Examples

[0109] The following Examples are provided for illustration only, rather than for any limitation to the present application.

[0110] Example 1. Isolation of cell lines

[0111] The HEK293 cells were isolated by limited dilution. In particular, the POOL cells (HEK293 VPC cells from Thermo, Catalog A35347) were diluted with OPM-293 CD05 (Shanghai OPM Biosciences Co. Ltd. Catalog: 81075-001) to a concentration of 2 cells / mL, and were added to a flat 96-well plate (200μl / well) . The plate was incubated at 37℃, during which the medium was supplied to keep the growth of cells. After the observation of cell clusters, the cells were transferred to a flat 24-well plate for expansion, and then, to a shake flask for stable growth.

[0112] The cell lines 8F8, 8F8-1B2, 8F8-1G7, 8F8-2B1, 8F8-2E1, 8F8-2F8, 8F8-2G8, 8F8-3E12, 8F8-4G1, 8F8-4B8, 8F8-5A7, 8F8-5F9, 6F2-1C12, 6F2-2D12, 6F2-3D9, 6F2-3C10, 6F2-4E6, and 6F2-5E6 were obtained and employed for the following test.

[0113] Example 2. Packaging of rAAVs expressing ZsGreen with the isolated cell lines

[0114] This Example was carried out to show the packaging of rAAVs expressing ZsGreen in the isolated cell lines for preliminarily screening the high-performance cell lines.

[0115] The cell lines 8F8, 8F8-1B2, 8F8-1G7, 8F8-2B1, 8F8-2E1, 8F8-2F8, 8F8-2G8, 8F8-3E12, 8F8-4G1, 8F8-4B8, 8F8-5A7, 8F8-5F9, 6F2-1C12, 6F2-2D12, 6F2-3D9, 6F2-3C10, 6F2-4E6, and  6F2-5E6 were tested for the production of rAAVs comprising an AAV8 or AAV9 capsid and a genome encoding ZsGreen (n=3) . The POOL cells and the cell line 6F2 (CCTCC NO: C2020141, see CN114250193A) were used as reference.

[0116] The rAAVs were prepared with a method similar to that described in Crosson SM et al. 2018. Briefly, cells in serum free virus production medium OPM-293 CD05 at a concentration of 3E6 cells / ml were triple transfected, using polyethylenimine, with the helper plasmid, the packaging plasmid encoding rep / cap, and the transgene plasmid below:

[0117] -helper plasmid ( “pHelper” containing the Ad E2A, E4, and VA RNA helper genes as described in Crosson Sm et al., the map thereof is shown in Fig. 1A) ;

[0118] -packaging plasmid, the maps of the packaging plasmids for AAV8 and AAV9 are shown in Figs. 1B and 1C, respectively, encoding wildtype AAV2 Rep and AAV8 / AAV9 Cap;

[0119] -transgene plasmid, comprising the rAAV genome encoding ZsGreen (see Fig. 1D) .

[0120] Following 72 h incubation at 37℃, cells were harvested, and viral particles were purified through an iodixanol gradient (see Crosson SM et al. ) .

[0121] The rAAVs were tested for titers by ddPCR (n=3) , which were all at the level of 1013 viral genomes (vg)  / mL. In particular, the ddPCR was carried out with Bio-Rad’s QXDx AutoDG ddPCR System and QXDx Universal Kit for AutoDG ddPCR System according to the manufacturer’s instructions. The primers and probe for the ddPCR are as follows.

[0122] GFP-F ACTACAACAGCCACAACGTCTATATCA

[0123] GFP-R GGCGGATCTTGAAGTTCACC

[0124] GFP-P 5′-6-FAM-CCGACAAGC-ZEN-AGAAGAACGGCATCA-Iowa Black FQ-3′.

[0125] As shown in Fig. 2, the isolated cell lines except 6F2 showed a higher production of the rAAV with AAV9 capsid than the POOL; while the cell lines except 8F8-1B2, 8F8-2B1 and 8F8-2G8 showed a higher production of the rAAV with AAV8 capsid than the POOL. The cell line 8F8-4G1 showed the highest production of the rAAV with AAV9 capsid (more than 8 folds higher than the POOL) , and the cell lines 8F8-5F9, 6F2-1C12 and 6F2-2D12 showed the highest production of the rAAV with AAV8 capsid (about 3 folds higher than the POOL) .

[0126] Example 3. Packaging of rAAVs expressing functional polypeptide with the isolated cell lines

[0127] This example was carried out to show the packaging of rAAVs expressing functional polypeptide in the cell lines for screening the high-performance cell lines.

[0128] The cell lines 8F8, 8F8-1G7, 8F8-2E1, 8F8-2F8, 8F8-4G1, 8F8-4B8, 8F8-5A7, 8F8-5F9, 6F2-1C12, and 6F2-2D12 were tested for the production of rAAVs comprising i) an AAV8 capsid and a genome encoding a recombinant Factor VIII (GOI of SEQ ID NO: 1, referred to as F8V3 hereinafter) , or ii) an AAV9 capsid and a genome encoding a recombinant Factor IX (GOI of SEQ ID NO: 2, referred to as SPK9001 hereinafter) . The POOL cells and the cell line 6F2 were used as reference.

[0129] The rAAVs were prepared with the transgene plasmid as shown in Fig. 1E by a process as described in Example 2 or with the medium altered to LV-MAX (Thermo, Cat. A4817901) , and  tested for titers by ddPCR as described in Example 2 with the following primers and probe.

[0130] YH-bGH polyA-F: GCCAGCCATCTGTTGT

[0131] YH-bGH polyA-R: GGAGTGGCACCTTCCA

[0132] YH-bGH polyA-P: FAM-TCCCCCgTGCCTTCCTTGACC-TAMRA

[0133] Fig. 3 showed the production of rAAVs with AAV8 capsid. In particular, the cell lines 8F8, 6F2, 8F8-2E1, 8F8-2F8, 8F8-4G1, 8F8-4B8, 8F8-5A7, 8F8-5F9, 6F2-1C12, and 6F2-2D12 showed a higher production for rAAVs in OPM293 CD05 medium as compared to the POOL cells, while the cell line 6F2-2D12 showed the highest production, which is more than 3 times higher than the POOL cells, and the cell line 8F8-1G7 showed undetected production. It was also shown that 6F2, 8F8-1G7, 8F8-2F8, 8F8-4G1, 8F8-5F9, 6F2-1C12, and 6F2-2D12 showed a higher production for rAAVs in LV MAX as compared to the POOL cells, while the cell line 8F8-1G7 showed the highest production.

[0134] Fig. 4 showed the production of rAAVs with AAV8 capsid. In particular, the cell lines 8F8, 6F2, 8F8-2E1, 8F8-2F8, 8F8-4G1, 8F8-4B8, 8F8-5A7, 8F8-5F9, 6F2-1C12, and 6F2-2D12 showed a higher production for rAAVs in OPM293 CD05 medium as compared to the POOL cells, while the cell line 8F8-2E1, 8F8-2F8, 6F2-1C12, and 6F2-2D12 showed the highest productions, which are about 3 times higher than the POOL cells, and the cell line 8F8-1G7 showed undetected production. It was also shown that all the cell lines showed a higher production for rAAVs in LV MAX as compared to the POOL cells, while the cell line 8F8-1G7 showed the highest production.

[0135] As shown in Figs. 3 and 4, the POOL cells showed poor productions of rAAVs encoding F8V3-and SPK9001 in LV MAX, respectively.

[0136] The production of rAAVs comprising F8V3 or SPK9001 in OPM293 CD05 was repeated with the cell lines 8F8, 8F8-2F8, 8F8-4G1, 8F8-5A7, 8F8-5F9, 6F2-1C12, and 6F2-2D12, and the POOL cells and the cell line 6F2 were used as reference.

[0137] As shown in Figs. 5 and 6, the cell lines 8F8, 8F8-2F8, 8F8-4G1, 8F8-5A7, 8F8-5F9, 6F2-1C12, and 6F2-2D12 showed significantly a higher production of rAAVs of both AAV8 and AAV9 as compared to the references, among which the cell line 6F2-2D12 showed the highest production (about 4 times higher than the POOL cell, and about 3 times higher than the cell line 6F2) .

[0138] Example 4. Characterization of the cell lines

[0139] This Example was carried out to show the growth behavior of the cell lines 8F8, 8F8-1G7, 8F8-2E1, 8F8-2F8, 8F8-4G1, 8F8-4B8, 8F8-5A7, 8F8-5F9, 6F2-1C12, and 6F2-2D12 were tested, including doubling time, viable cell density and viability, along with time. The POOL cells and the cell line 6F2 were employed as reference.

[0140] 2×105 cells of each line were cultured in 30ml OPM-293 CD05 at 37℃, and were counted daily.

[0141] The doubling time (DT) of the cell lines were calculated with the following equation:

[0142] DT=t* [lg2 /  (lgNt-lgN0) ]

[0143] where t is the culture time, N0 is the number of cells at Day 0, Nt is the number of cells after a  culture time of t.

[0144] The viable cell density (VCD) and viability of the cells were tested by culturing the 2×105 cells of each line in 30ml OPM-293 CD05 at 37℃ for 8 days and sampling daily. The samples were Trypan blue (Trypan Blue Solution, 0.4%, Thermo, Cat. 15250061) stained (the volume ratio of sample to Trypan blue is 1: 1) at room temperature for 5-10 min, and the viable cells and total cells were counted for the calculation of VCD and viability (percentage of viable cells in the total cells) of the cells.

[0145] As shown in Fig. 7, the DT, VCD and viability of the cell lines 8F8, 8F8-1G7, 8F8-2E1, 8F8-2F8, 8F8-4G1, 8F8-4B8, 8F8-5A7, 8F8-5F9, 6F2-1C12, and 6F2-2D12 were at least comparable to the references.

[0146] Example 5. Stability of the production of rAAVs with the cell lines

[0147] This Example was carried out to show whether the cell lines can keep a stable productivity of rAAVs.

[0148] The cell lines 8F8, 8F8-2F8, 8F8-4G1, 8F8-5A7, 8F8-5F9, 6F2-1C12, and 6F2-2D12 were tested for packaging rAAVs of AAV9 after 15, 30, 60 and 90 passages, and the POOL cells and the cell line 6F2 were used as reference. The rAAVs were prepared as described in Example 2 with a transgene plasmid (see Fig. 1E) providing a genome comprising a GOI of SEQ ID NO: 3. The production of rAAV was measured by by ddPCR. In particular, the ddPCR was carried out with Bio-Rad’s QXDx AutoDG ddPCR System and QXDx Universal Kit for AutoDG ddPCR System according to the manufacturer’s instructions. The primers and probe for the ddPCR are as follows:

[0149] Forward primer: CCCACTTGGCAGTACATCAA

[0150] Reverse primer: GCCAAGTAGGAAAGTCCCATAA

[0151] Probe: CATAATGCCAGGCGGGCCATTTAC.

[0152] As shown in Fig. 8, the cell lines showed a relative higher production of rAAV after at least 30 passages, and the cell lines except 8F8 showed significantly higher production of rAAV after 90 passages. The cell lines 8F8-4G1 (production after 15 passages was not tested) and 6F2-2D12 showed the highest production of rAAV for all the passaged samples.

[0153] SEQUENCES

Claims

1.A human embryonic kidney (HEK) cell line or the progeny thereof, wherein the cell line is deposited under an accession number selected from the group consisting of CCTCC NO: C202372, CCTCC NO: C2023129, CCTCC NO: C2023130, CCTCC NO: C2023131, CCTCC NO: C2023132, CCTCC NO: C2023133, and CCTCC NO: C2023134.2.Use of the HEK cell line or the progeny thereof of claim 1 in the preparation of recombinant adeno-associated virus (rAAV) .3.A method of preparing rAAV comprising transfecting a cell from the HEK cell line or the progeny thereof of claim 1 with a system for preparing rAAV.4.The method of claim 3, wherein the system comprises a plasmid comprising the genome of the rAAV, a plasmid encoding the CAP and / or REP polypeptides of AAV and a helper plasmid.5.The method of claim 3 or 4, further comprising culturing the transfected cell under a condition allowing the packaging of the rAAV.6.The method of any one of claims 3-5, further comprising lysing the cell and harvesting the rAAV.7.A kit for preparing rAAV, comprising a cell derived from the cell line or the progeny thereof of claim 1.8.The kit of claim 7, further comprising an agent comprising a packaging gene, and / or an agent for providing a helper virus function.9.The kit of claim 7 or 8, further comprising an agent for delivering the genome of the rAAV.10.The kit of claim 8 or 9, wherein the agent comprising a packaging gene comprises a packaging plasmid encoding a Rep polypeptide and / or a Cap polypeptide.11.The kit of any one of claims 8-10, wherein the agent for providing a helper virus function comprises a helper virus or a polynucleotide encoding the function.

Images