RNA-protein complex as novel biomarker for lung cancer

Abstract

The present invention relates to a method of diagnosing lung cancer in a patient. The present invention further relates to a kit for carrying out this method.

Description

[0001] RNA-PROTEIN COMPLEX AS NOVEL BIOMARKER FOR LUNG CANCER

[0002] The present invention relates to a method of diagnosing lung cancer in a patient. The present invention further relates to a kit for carrying out this method.

[0003] BACKGROUND OF THE INVENTION

[0004] Cancer is the uncontrolled growth of abnormal cells anywhere in a body. The abnormal cells are termed cancer cells, malignant cells, or tumor cells. Cancer cells can proliferate uncontrollably and form a mass of cancer cells.

[0005] Lung cancer or bronchogenic carcinoma refers to tumors originating in the lung parenchyma or within the bronchi. It is one of the leading causes of cancer-related deaths in Europe and in the United States. Since 1987, lung cancer has been responsible for more deaths in women than breast cancer. It is estimated that there are 225,000 new cases of lung cancer in the United States annually, and approximately 160,000 die because of lung cancer. It is interesting to note that lung cancer was a relatively rare disease at the beginning of the 20th century. Its dramatic rise in later decades is attributable primarily to the increase in smoking among both males and females.

[0006] Historically, markers such as age, performance status and disease stage have been used to risk-stratify lung cancer patients and guide therapeutic decisions. These parameters provide some useful information, but more sensitive markers are clearly needed. Molecular and genetic studies have identified several such markers, which appear to play critical roles in carcinogenesis and affect patient outcomes. However, their prognostic and predictive value for lung cancer medicine has been low so far.

[0007] Small non-coding RNAs, typically with a length of 18 to 50 nucleotides (nt), are a subgroup of short non-coding RNAs (18 to 200 nt). These RNAs can be found intracellularly and in extracellular environments, including body fluids such as blood. A subclass of small non-coding RNAs, so called microRNAs (miRNAs), possess regulatory function exerted on the gene expression regulation of protein-encoding messenger RNAs (mRNAs). In the last two decades, other short fragments of long and short RNAs with regulatory functions were described, such as fragments of ribosomal RNA (rRNA), transfer RNA (tRNA), small nucleolar RNA (snoRNA), and others. A plethora of short fragments with no described regulatory function can be readily found in biological RNA samples. This is likely result of (active or passive) fragmentation of longer RNA precursors. Small non-coding RNA molecules may exist in cells in the form of ribonucleoprotein (RNP) complexes. RNA-binding proteins exert several RNA-related functions, e.g. RNA degradation, RNA transport, RNA storage, or RNA regulation.

[0008] The present inventors have now discovered that a 28S ribosomal RNA (rRNA) fragment exists in cells as part of a ribonucleoprotein (RNP) complex and that this complex is upregulated in lung cancer cell lines compared to healthy control cell lines. The detection of said complex will, thus, allow lung cancer diagnosis in patients. Specifically, the present inventors have found that the 28S ribosomal RNA (rRNA) fragment having a nucleotide sequence according to SEQ ID NO: 1 is bound to the ribosomal protein L10A (RPL10A) and that this complex is detectable in the extracellular fraction of blood. The present inventors could demonstrate that this complex is further found secreted by lung cancer cell lines and its prevalence is higher in medium conditioned by lung cancer cell lines as compared to cell-free fraction from healthy human individuals. In addition, the present inventors could show that this complex is stable in different blood collection devices and under different storage conditions. Thus, the detection of said complex will allow lung cancer diagnosis in patients. According to the present inventors, even the detection of the ribosomal protein L10A (RPL10A) alone appears to enable lung cancer diagnosis.

[0009] SUMMARY OF THE INVENTION

[0010] In a first aspect, the present invention relates to a method of diagnosing lung cancer in a patient comprising the step of: determining the level of a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A), and / or the level of ribosomal protein L10A (RPL10A) in an extracellular fraction of blood of a patient.

[0011] In a second aspect, the present invention relates to the use of a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A), and / or a ribosomal protein L10A (RPL10A) for diagnosing lung cancer. In a third aspect, the the present invention relates to a kit for diagnosing lung cancer, said kit comprising: means for determining the level of a a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A), and / or means for determining the level of ribosomal protein L10A (RPL10A) in an extracellular fraction of blood of a patient.

[0012] This summary of the invention does not necessarily describe all features of the present invention. Other embodiments will become apparent from a review of the ensuing detailed description.

[0013] DETAILED DESCRIPTION OF THE INVENTION

[0014] Definitions

[0015] Before the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0016] Preferably, the terms used herein are defined as described in “A multilingual glossary of biotechnological terms: (IUPAC Recommendations)”, Leuenberger, H.G.W, Nagel, B. and Kdlbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland).

[0017] Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, GenBank Accession Number sequence submissions etc.), whether supra or infra, is hereby incorporated by reference in its entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. In the event of a conflict between the definitions or teachings of such incorporated references and definitions or teachings recited in the present specification, the text of the present specification takes precedence.

[0018] The term “comprise” or variations such as “comprises” or “comprising” according to the present invention means the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. The term “consisting essentially of’ according to the present invention means the inclusion of a stated integer or group of integers, while excluding modifications or other integers which would materially affect or alter the stated integer. The term “consisting of’ or variations such as “consists of’ according to the present invention means the inclusion of a stated integer or group of integers and the exclusion of any other integer or group of integers.

[0019] The terms “a” and “an” and “the” and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0020] As used herein, the term “about” indicates a certain variation from the quantitative value it precedes. In particular, the term “about” allows a ±5% variation from the quantitative value it precedes, unless otherwise indicated or inferred. The use of the term “about” also includes the specific quantitative value itself, unless explicitly stated otherwise. For example, the expression “about 80°C” allows a variation of ±4°C, thus referring to range from 76°C to 84°C.

[0021] The similarity of nucleotide and amino acid sequences, i.e. the percentage of sequence identity, can be determined via sequence alignments. Such alignments can be carried out with several art-known algorithms, preferably with the mathematical algorithm of Karlin and Altschul (Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5877), with hmmalign (HMMER package) or with the CLUSTAL algorithm (Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-80) or the CLUSTALW2 algorithm (Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. (2007). Clustal W and Clustal X version 2.0. Bioinformatics, 23, 2947-2948).

[0022] The grade of sequence identity (sequence matching) may be calculated using e.g. BLAST, BLAT or BlastZ (or BlastX). A similar algorithm is incorporated into the BLASTN and BLASTP programs of Altschul et al. (1990) J. Mol. Biol. 215: 403-410. BLAST protein searches are performed with the BLASTP program available e.g. on the web site: http: / / blast.ncbi.nlm.nih. go v / B last. cgi?PROGRAM=blastp&BLAST_PROGRAMS=blastp&PA GE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome.

[0023] Preferred algorithm parameters used are the default parameters as they are set on the indicated web site:

[0024] Expect threshold = 10, word size = 3, max matches in a query range = 0, matrix = BLOSUM62, gap costs = Existence: 11 Extension: 1, compositional adjustments = conditional compositional score matrix adjustment together with the database of non-redundant protein sequences (nr). To obtain gapped alignments for comparative purposes, Gapped BLAST is utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25: 3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs are used. Sequence matching analysis may be supplemented by established homology mapping techniques like Shuffle-LAGAN (Brudno M., Bioinformatics 2003b, 19 Suppl 1: 154-162) or Markov random fields.

[0025] The term “RNA molecule”, as used herein, refers to a polymeric molecule essential in various biological roles in coding, decoding, regulation, and expression of genes. RNA and deoxyribonucleic acid (DNA) are nucleic acids. Along with lipids, proteins, and carbohydrates, nucleic acids constitute one of the four major macromolecules essential for all known forms of life. Like DNA, RNA is assembled as a chain of nucleotides, but unlike DNA, RNA is found in nature as a single strand folded onto itself, rather than a paired double strand. Cellular organisms use messenger (mRNA) to convey genetic information (using the nitrogenous bases of guanine, uracil, adenine, and cytosine, denoted by the letters G, U, A, and C) that directs synthesis of specific proteins. Some RNA molecules play an active role within cells by catalysing biological reactions, controlling gene expression or sensing and communicating responses to cellular signals. One of these active processes is protein synthesis, a universal function in which RNA molecules direct the synthesis of proteins on ribosomes. This process uses transfer RNA (tRNA) molecules to deliver amino acids to the ribosome, where ribosomal RNA (rRNA) then links amino acids together to form coded proteins.

[0026] The term “ribosomal ribonucleic acid (rRNA)”, as used herein, refers to a type of noncoding RNA which is the primary component of ribosomes, essential to all cells. rRNA is a ribozyme which carries out protein synthesis in ribosomes. Ribosomal RNA is transcribed from ribosomal DNA (rDNA) and then bound to ribosomal proteins to form small and large ribosome subunits. rRNA is the physical and mechanical factor of the ribosome that forces transfer RNA (tRNA) and messenger RNA (mRNA) to process and translate the latter into proteins. Ribosomal RNA is the predominant form of RNA found in most cells; it makes up about 80% of cellular RNA despite never being translated into proteins itself. Ribosomes are composed of approximately 60% rRNA and 40% ribosomal proteins by mass.

[0027] Mammalian cells have 2 mitochondrial (12S and 16S) rRNA molecules and 4 types of cytoplasmic rRNA molecules (the 28S, 5.8S, 18S, and 5S subunits). The 28S, 5.8S, and 18S rRNAs are encoded by a single transcription unit (45S) separated by 2 internally transcribed spacers. The first spacer corresponds to the one found in bacteria and archaea, and the other spacer is an insertion into what was the 23S rRNA in prokaryotes. The 45S rDNA is organized into 5 clusters (each has 30-40 repeats) on chromosomes 13, 14, 15, 21, and 22. These are transcribed by RNA polymerase I. The DNA for the 5S subunit occurs in tandem arrays (-200-300 true 5S genes and many dispersed pseudogenes), the largest one on the chromosome lq41-42. 5S rRNA is transcribed by RNA polymerase III. The 18S rRNA in most eukaryotes is in the small ribosomal subunit, and the large subunit contains three rRNA species (the 5S, 5.8S, and 28S).

[0028] The present inventors have now discovered that a 28S ribosomal RNA (rRNA) fragment / molecule (and precursors or variants therefrom) exists in cells as part of a ribonucleoprotein (RNP) complex and that this complex is upregulated in lung cancer cell lines compared to healthy control cell lines. The detection of said complex will, thus, allow lung cancer diagnosis in patients.

[0029] The term “28S ribosomal RNA (rRNA)”, as used herein, refers to a structural ribosomal RNA (rRNA) for the large subunit (LSU) of eukaryotic cytoplasmic ribosomes, and thus, to one of the basic components of all eukaryotic cells. It has a size of 28S in mammals, hence the name.

[0030] The term “ribonucleoprotein (RNP) complex”, as used herein, refers to a protein complex containing a ribonucleic acid (RNA). An RNP complex is found in all living organisms. A ribonucleoprotein complex includes, for example, the subunits of ribosomes, the spliceosome, telomerase, snRNPs and hnRNPs, the nuclease RNase P, and various transcription initiation factors, all of which are localized in the nucleus.

[0031] The term “methylated RNA”, as used herein, refers to RNA which has been post- transcriptionally edited or modified by methylation. The methylation involves the transfer of a methyl group from an active methyl compound to another compound. More than 160 modifications have been found in mRNA and non-coding RNA species. Reported roles of RNA methylation include RNA splicing stability, nuclear export, translation, initiation of miRNA biogenesis, immunogenicity, DNA damage repair, perturbation of cellular differentiation, sex determination, spermatogensesis, embryonic development, learning, memory, immune response, and several human and animal diseases. The methylation can occur at a base (e.g. methyl-6-adenine, pseudouridine) and / or ribose ring (2'-O-methylated nucleotide (2'-O-m)). The methylation of RNA occurring at a base is preferably selected from the group consisting of 6-methyladenosine (m6A), 5 -methylcytidine (m5C), 5-methyluridine (m5U), 3-methyluridine (m3U), 1 -methyladenosine (m^A), and 1 -methylguanosine (m^G), or is a combination thereof. The 2'-O-methylation of the backbone ribose is the most common and conserved type of small non-coding RNA modification.

[0032] The term “2'-O-methylation”, as used herein, refers to a common nucleoside modification of RNA, where a methyl group is added to the 2’hydroxyl of the ribose moiety of a nucleoside, producing a methoxy group. 2'-O-methylated nucleosides are mostly found in ribosomal RNA and small nuclear RNA and occur in the functionally essential regions of the ribosome and spliceosome. Specifically, the present inventors have found that the 28S ribosomal RNA (rRNA) fragment / molecule having a nucleotide sequence according to SEQ ID NO: 1 ( CGCCGGU GA A AU ACC ACU) is bound to the ribosomal protein L10A (RPL10A) and that this complex is detectable in the extracellular fraction of blood. The present inventors could demonstrate that this complex is further found secreted by lung cancer cell lines and its prevalence is higher in medium conditioned by lung cancer cell lines as compared to cell-free fraction from healthy human individuals. In addition, the present inventors could show that this complex is stable in different blood collection devices and under different storage conditions.

[0033] Thus, the detection of said complex will allow lung cancer diagnosis in patients. According to the present inventors, even the detection of the ribosomal protein L10A (RPL10A) alone appears to enable lung cancer diagnosis.

[0034] The term “ribosomal protein L10A (RPL10A)”, as used herein, refers to a protein that is encoded by the RPL10A gene. The RPL10A gene encodes a 217 amino acid protein. The protein has a molecular weight of about 25 Da. Ribosomes, the organelles that catalyse protein synthesis, consists of a small 40S subunit and a large 60S subunit. The ribosomal protein L10A (RPL10A) is a component of the 60S subunit. It belongs to the LIP family of ribosomal proteins. Specifically, RPL10A has one domain called the ribosomal LI superfamily domain. There are 13 conserved mRNA / rRNA interface residues on this domain. RPL10A is required for joining the 60S and 40S ribosomal subunits into the functional 80S ribosome. RPL10A is common and detected across all eukaryotic groups. The number and sequence of amino acids are highly conserved among animals, fungi, plants, and protists. RPL10A is found on the exit tunnel of 80S ribosomes and preferentially provides the translation of specific subsets of mRNAs by binding to Internal Ribosome Entry Sites (IRES) on the mRNAs. Preferably, the ribosomal protein L10A (RPL10A) is human ribosomal protein L10A (RPL10A). In the latest ribosomal proteins nomenclature, it is also denoted under the name “large ribosomal subunit protein uLl” protein. In particular, the human uLl protein has the Accession number NP_009035 (Version NP_009035.3).

[0035] More specifically, the present inventors have found that also variants / precursors of the nucleotide sequence according to SEQ ID NO: 1 ( CGCCGGU GA A AU ACC ACU) (“core sequence”) allow lung cancer diagnosis. The variants / precursors of the nucleotide sequence according to SEQ ID NO: 1 ( CGCCGGU GA A AU ACC ACU) as described herein have the following nucleotide sequences:

[0036] GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 2) CGGGCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 3),

[0037] CGGGCCGCCGGUGAAAUACCACUACU (SEQ ID NO: 4), and

[0038] GCCGCCGGUGAAAUACCACUACU (SEQ ID NO: 5). The level of ribonucleoprotein (RNP) complexes comprising any of / at least one of the nucleotide sequences according to SEQ ID NO: 1 to SEQ ID NO: 5 and ribosomal protein L10A (RPL10A) may be determined in the method of the present invention. In this respect, it should be noted that by the wording RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1 ( CGCCGGU GA A AU ACC ACU) (“core sequence”) also the nucleotide sequences according to SEQ ID NO: 2 to SEQ ID NO: 5 are covered. The sequences according to SEQ ID NO: 1 to SEQ ID NO: 5 are preferably human sequences.

[0039] The above-mentioned nucleotide sequences can be present in a 2’ -ortho-methylated or 2’-ortho- non-methylated state and optionally possess various 5’ ends, such as 5’ phosphorylation or 5’ hydroxyl and / or various 3’ ends, such as 3’ hydroxyl, 3’ phosphate or 3’, 2’ cyclic phosphate.

[0040] The term “cancer”, as used herein, refers to or describes a physiological condition in an individual that is typically characterized by unregulated cell growth. The term “cancer”, as used herein, also encompasses cancer metastases.

[0041] The term “lung cancer”, as used herein, refers to a disease which consists of uncontrolled cell growth in tissues of the lung. This growth may lead to metastasis, which is the invasion of adjacent tissue and infiltration beyond the lungs. The vast majority of primary lung cancers are carcinomas of the lung, derived from epithelial cells. Lung cancer is the most common cause of cancer-related death in men and women. The most common symptoms are shortness of breath, coughing (including coughing up blood), and weight loss.

[0042] The lung cancer, e.g. lung cancer of state I, II, III, or IV, may be non- small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). For example, the lung cancer is non-small-cell lung carcinoma (NSCLC), e.g. NSCLC of stage I, II, III or IV. Alternatively, the lung cancer is small-cell lung carcinoma (SCLS), e.g. SCLS of stage I, II, III or IV.

[0043] Lung cancer can be staged as follows:

[0044] Stage 1 means that the cancer is small. It hasn’t spread to the lymph nodes or other distant organs. Stage I belongs to the early lung cancer stages. Stage I can be divided into IA and IB. Stage IA means the cancer is 3 cm or smaller.

[0045] Stage IB means the cancer is between 3 cm and 4 cm. It might also be growing into structures such as: the main airway of the lung (main bronchus) or the membrane covering the lung (visceral pleura).

[0046] Stage 11 still belongs to the early lung cancer stages. Stage II can be divided into stage IIA and IIB. Part of the affected lung might have collapsed.

[0047] Stage IIA means that the cancer is between 4 cm and 5 cm in size but there are no cancer cells in any lymph nodes. Stage IIB means that the cancer is up to 5 cm in size and there are cancer cells in the lymph nodes close to the affected lung. Alternatively, it is between 5 cm and 7 cm but there are no cancer cells in any lymph nodes. Alternatively, the cancer is not in any lymph nodes but has spread into one or more of the following areas: the chest wall (ribs, muscle or skin), the nerve close to the lung (the phrenic nerve), or the layers that cover the heart (mediastinal pleura and parietal pericardium). Alternatively, the cancer is less than 7 cm but there is more than one tumor in the same lobe of the lung.

[0048] Stage III can be divided into stage IIIA, IIIB and IIIC. It is sometimes called locally advanced lung cancer.

[0049] In stage IIIA, the cancer is up to 5cm in size and has spread to the lymph nodes in the center of the chest on the same side as the tumor. Alternatively, the cancer it is between 5 cm and 7 cm and there is more than one tumor in the same lobe of the lung. Alternatively, the cancer has spread into one or more of the following areas just outside the lung: the chest wall (ribs, muscle or skin), the nerve close to the lung (the phrenic nerve), the layers that cover the heart (mediastinal pleura and parietal pericardium), or lymph nodes in the lung or close to the lung. Alternatively, the cancer is larger than 7 cm. It hasn't spread into lymph nodes but has spread into one or more of the following areas: the muscle under the lung (diaphragm), the center area of the chest (mediastinum), the heart, a main blood vessel, the wind pipe (trachea), the nerve that goes to the voice box (larynx), the food pipe (oesophagus), a spinal bone, or the area where the wind pipe divides (the carina). Alternatively, the cancer is in more than one lobe of the same lung and there might also be cancer cells in lymph nodes close to the affected lung.

[0050] Stage IIIB can also mean different things. The cancer is less than 5 cm and has spread into lymph nodes in one of these places: the opposite side of the chest from the affected lung, the neck, or above the collarbone. Alternatively, the cancer is between 5 cm to 7 cm and has spread into lymph nodes in the center of the chest. Alternatively, the cancer is any size, has spread into lymph nodes in the center of the chest, and has spread into one or more of the following areas: the chest wall, the muscle under the lung (diaphragm), or the layers that cover the heart (mediastinal pleura and parietal pericardium). Alternatively, the cancer has spread into the lymph nodes in the center of the chest. The lung tumor is more than 7 cm or it has spread into a major structure in your chest such as: the heart, the wind pipe (trachea), the food pipe (oesophagus), or a main blood vessel.

[0051] Stage IIIC means the cancer is between 5 cm and 7 cm in size or has spread into one or more of the following: the nerve close to the lung (phrenic nerve) or the covering of the heart (parietal pericardium) and it has spread into lymph nodes: in the center of the chest on the opposite side from the affected lung or at the top of the lung on the same side or opposite side or above the collar bone. Alternatively, there is more than one tumor in a different lobe of the same lung. Alternatively, stage IIIC can mean the cancer is bigger than 7 cm or it has spread into one of the following: the muscle under the lung (the diaphragm), the center of the chest (mediastinum), the heart, a major blood vessel, the wind pipe (trachea), the nerve going to the voice box (the recurrent laryngeal nerve), the food pipe (oesophagus), a spinal bone, or the area where the windpipe divides (the carina) and it has spread into lymph nodes: in the center of the chest on the opposite side from the affected lung or at the top of the lung on the same side or opposite side or above the collar bone. Alternatively, there are tumors in more than one lobe of the lung.

[0052] Stage IV means that the lung cancer has spread. It can be designated as advanced lung cancer. It is divided into stage IVA and IVB.

[0053] Stage IVA can mean any of the following: there is cancer in both lungs, the cancer is in the covering of the lung (the pleura) or the covering of the heart (pericardium), or there is fluid around the lungs or the heart that contains cancer cells. Alternatively, it can mean that there is a single area of cancer that has spread outside the chest to a lymph node or to an organ such as the liver or bone.

[0054] Stage IVB means that the cancer has spread to several areas in one or more organs.

[0055] The term “early stage lung cancer”, as used herein, refers to lung cancer that is early in its growth. It has not grown deeply into nearby tissues. In addition, it has not spread to other parts of the body of a patient. No metastasis has been formed. Specifically, early stage lung cancer is lung cancer of stage I.

[0056] The term “small-cell lung carcinoma (SCLC)”, as used herein, refers to a type of highly malignant cancer that arises within the lungs. Small-cell carcinoma of the lungs usually presents in the central airways and infiltrates the submucosa leading to narrowing of bronchial airways. Common symptoms include cough, dyspnea, weight loss, and debility. Compared to non-small cell carcinoma, small cell carcinoma has a shorter doubling time, higher growth fraction, and earlier development of metastases. SCLC accounts for about 15% of all lung cancers.

[0057] Small-cell lung carcinoma can be divided into two clinicopathological stages, termed limited stage (LS) and extensive stage (ES). The stage is generally determined by the presence or absence of metastases, whether or not the tumor appears limited to the thorax, and whether or not the entire tumor burden within the chest can feasibly be encompassed within a single radiotherapy portal. In general, if the tumor is confined to one lung and the lymph nodes close to that lung, the cancer is said to be LS. If cancer has spread beyond that, it is said to be ES.

[0058] The term “non-small-cell lung carcinoma (NSCLC)”, as used herein, refers to any type of epithelial lung cancer other than small-cell lung carcinoma (SCLC). NSCLC accounts for about 85% of all lung cancers. As a class, NSCLCs are relatively insensitive to chemotherapy, compared to small-cell lung carcinomas. When possible, they are primarily treated by surgical resection with curative intent, although chemotherapy has been used increasingly both preoperatively (neoadjuvant chemotherapy) and postoperatively (adjuvant chemotherapy). In one embodiment, NSCLC is squamous-cell carcinoma, large-cell carcinoma, or adenocarcinoma.

[0059] The term “diagnosing lung cancer”, as used herein, means determining whether a patient shows signs of or suffers from lung cancer.

[0060] The term “(therapeutic) treatment / therapy”, as used herein, relates to any treatment / therapy which improves the health status and / or prolongs (increases) the lifespan of a patient. Said treatment / therapy may eliminate the disease in a patient, arrest, inhibit, or slow the development of a disease in a patient, decrease the frequency or severity of symptoms in a patient, and / or decrease the recurrence in a patient who currently has or who previously has had a disease.

[0061] As used herein, the term “lung cancer therapy” refers to any protocol, method, and / or agent that can be used in the prevention, management, treatment, and / or amelioration of lung cancer. In particular, the term “lung cancer therapy”, as used herein, means accomplishing one or more of the following: (i) tumor growth inhibition and / or tumor cell death, (ii) reduction of tumor marker(s), (iii) reduction of tumor lesions and metastases, (iv) reduction of tumor burden as evidenced by imaging studies (e.g. computer tomography (CT), magnetic resonance imaging (MRI), positron emission tomography (PET), etc.), and (v) reduction of tumor burden as evidenced by clinical appraisal or self-report by the patient.

[0062] The term “patient”, as used herein, refers to any subject for whom it is desired to know whether she or he suffers from lung cancer. In particular, the term “patient”, as used herein, refers to a subject suspected to be affected by lung cancer. The patient may be diagnosed to be affected by lung cancer, i.e. diseased, or may be diagnosed to be not affected by lung cancer, i.e. healthy. The patient may be any mammal, including both a human and another mammal, e.g. an animal such as a rabbit, mouse, rat, or monkey. Human individuals are particularly preferred.

[0063] The term “(control) subject”, as used herein, refers to a subject known to be not affected by lung cancer (negative control), i.e. healthy. The term “(control) subject”, as used herein, also refers to a subject known to be affected by lung cancer (positive control), i.e. diseased.

[0064] It should be noted that a (control) subject which is known to be healthy, i.e. not suffering from lung cancer, may possibly suffer from another disease or condition not tested / known.

[0065] The (control) subject may be any mammal, including both a human and another mammal, e.g. an animal such as a rabbit, mouse, rat, or monkey. Human healthy individuals are particularly preferred.

[0066] The term “whole blood”, as used herein, refers to a blood product which contains all physiologically occurring blood components, i.e. cells, proteins, and other components. Whole blood is blood from a standard blood donation. Specifically, whole blood is made up of erythrocytes, leukocytes, and thrombocytes, all of which are suspended in a liquid called plasma. More specifically, whole blood encompasses the cellular (erythrocytes, leukocytes, and thrombocytes) components as well as the extracellular (serum and plasma) components of blood. A whole blood sample may be provided by removing blood from a patient or (control) subject, but may also be provided by using a previously isolated sample. For example, a blood sample may be taken from a patient or (control) subject by conventional blood collection techniques.

[0067] If the blood sample is obtained from at least one (control) subject, e.g. from at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 400, 500, or 1,000 (control) subject(s), it is designated as “reference blood sample”. Preferably, the reference blood sample is from the same source than the blood sample of the patient to be tested. For example, the blood sample from the patient to be tested is an extracellular fraction of blood and the (reference) blood sample from the control subject is also an extracellular fraction of blood. It is further preferred that both are from the same species, e.g. from a human. It is also (alternatively or additionally) preferred that the measurements of the reference blood sample of the (control) subject and the blood sample of the patient to be tested are identical, e.g. both have an identical volume. It is particularly preferred that the reference blood sample and the blood sample are from (control) subjects / patients of the same sex and similar age.

[0068] The whole blood sample may be collected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA-tube, Serum- Monovette tube, in a Na-citrate tube, Heparin-tube, or in an ACD-tube (Acid citrate dextrose). Alternatively, the whole blood sample may be collected in a blood collection tube containing cell- free nucleic acid stabilizing chemical agents, such as glutaraldehyde, formaldehyde, or similar (e.g. Streck cfRNA BCT tube, Streck cfDNA BCT tube), and others, or cellular crowding agents, such as polyethyleneglycol (PEG) (e.g. Norgen cfDNA / cfRNA preservation tube), and others. The whole blood sample, as used herein, may also be collected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 pl for humans or less. For example, the whole blood may be extracted from the patient via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. the RNA molecule as described herein, are extracted from the dried blood spots into a supernatant which is then further analyzed. In this way, the level of the RNA molecule is determined. This technique is suitable for monitoring patients having lung cancer at home (on a home care / home sampling basis) or for screening purposes.

[0069] The term “extracellular fraction of blood”, as used herein, refers to the acellular portion of blood which is produced from whole blood by removing the cellular fraction (erythrocytes, leukocytes, and thrombocytes). In other words, the acellular portion of blood is depleted of the cellular blood components (erythrocytes, leukocytes, and thrombocytes). The cellular fraction of blood comprises / essentially consists of / consists of erythrocytes, leukocytes, and thrombocytes. Thus, the extracellular fraction of blood structurally differs from whole blood. While a whole blood sample comprises the cellular (erythrocytes, leukocytes, and thrombocytes) components as well as the extracellular (serum and plasma) components of blood, the extracellular fraction of blood is only composed of the acellular (serum and plasma) components of blood. In other words, the extracellular fraction of blood is free of the cellular (erythrocytes, leukocytes, and thrombocytes) components of blood. Particularly, serum and plasma represent the extracellular components of blood. The extracellular fraction of blood is often denoted as “cell- free blood”.

[0070] The term “cellular fraction of blood”, as used herein, refers to the cellular portion of blood which is produced from whole blood by removing the extracellular fraction (serum and plasma). In other words, the cellular fraction of blood is depleted of the extracellular blood components (serum and plasma). Specifically, the cellular portion of blood comprises / essentially consists of / consists of erythrocytes, leukocytes, and thrombocytes.

[0071] The term “blood plasma”, as used herein, refers to the liquid component of blood in which the blood cells are absent, but which contains proteins and other constituents of whole blood in suspension. It makes up about 55% of the body's total blood volume. It is the intravascular part of extracellular fluid (all body fluid outside cells). It is mostly water (up to 95% by volume), and contains important dissolved proteins (6-8%, e.g. serum albumins, globulins, and fibrinogen), glucose, clothing factors, electrolytes (Na+, Ca2+, Mg2+, HCO3 , CF, etc.), hormones, carbon dioxide (plasma being the main medium for excretory product transportation), and oxygen. Blood plasma is obtained from whole blood by removing the blood cells (erythrocytes, leukocytes, and thrombocytes) by centrifugation in the presence of an anticoagulant. During the centrifugation process, the blood cells fall to the bottom of the tube. The blood plasma (supernatant) is then poured or drawn off.

[0072] The term “blood serum”, as used herein, refers to the liquid component of blood which does not play a role in clotting. It may be defined as blood plasma without the clotting factors, or as blood with all cells and clotting factors removed. Serum includes all proteins not used in blood clotting, all electrolytes, antibodies, antigens, hormones and potential exogenous substances. Serum does not contain erythrocytes, leukocytes, thrombocytes, and clotting factors anymore. To obtain blood serum, a blood sample is allowed to clot (coagulation). The sample is then centrifuged to remove the clot and blood cells, and the resulting liquid supernatant is serum.

[0073] In the method described herein, the level of the ribonucleoprotein (RNP) complex and / or the level of RPL10A is determined in an extracellular fraction of blood of a patient. The term “level”, as used herein, refers to an amount (measured for example in grams, mole, or ion counts) or concentration (e.g. absolute or relative concentration) of the RNP complex. The term “level”, as used herein, also comprises scaled, normalized, or scaled and normalized amounts or values (e.g. units / ml or mol / ml).

[0074] Those of skill in the art will appreciate that, in many embodiments described herein, the determined ribonucleoprotein (RNP) complex level is compared with an appropriate ribonucleoprotein (RNP) complex “reference level”. Specifically, the level of the ribonucleoprotein (RNP) complex is compared to a reference level of said ribonucleoprotein (RNP) complex. More specifically, the reference level of the ribonucleoprotein (RNP) complex is determined in an extracellular fraction of blood of (control) subjects.

[0075] The reference level may also be a cut-off or threshold level. Typically, a cut-off or threshold level can be determined experimentally, empirically, or theoretically. A cut-off or threshold level can also be arbitrarily selected based upon the existing experimental and / or clinical conditions, as would be recognized by a person of ordinary skilled in the art. The cut-off or threshold level must be determined in order to obtain the optimal sensitivity and specificity according to the function of the test and the benefit / risk balance (clinical consequences of false positive and false negative). Typically, the optimal sensitivity and specificity (and so the threshold level) can be determined using a Receiver Operating Characteristic (ROC) curve based on experimental data. For example, after determining the ribonucleoprotein (RNP) complex level in a group of a reference, one can use algorithmic analysis for the statistic treatment of the measured ribonucleoprotein (RNP) complex level in samples to be tested, and thus obtain a classification standard having significance for sample classification. The full name of ROC curve is receiver operator characteristic curve, which is also known as receiver operation characteristic curve. It is mainly used for clinical biomarker tests. The ROC curve is a comprehensive indicator that reflects the continuous variables of true positive rate (sensitivity) and false positive rate (1 -specificity). It reveals the relationship between sensitivity and specificity with the image composition method. A series of different cutoff or threshold levels are set as continuous variables to calculate a series of sensitivity and specificity values. Then sensitivity is used as the vertical coordinate and specificity is used as the horizontal coordinate to draw a curve. The higher the area under the curve (AUC), the higher the accuracy of a prediction / prognosis / diagnosis. On the ROC curve, the point closest to the far upper left of the coordinate diagram is a critical point having both high sensitivity and high specificity values. The AUC value of the ROC curve is between 1.0 and 0.5. When AUC > 0.5, the predicted / prognosed / diagnosed result gets better and better as AUC approaches 1.

[0076] The level of the RNP complex is preferably determined by an immunoprecipitation-based assay or by an RNA-pulldown assay.

[0077] More preferably, the immunoprecipitation-based assay is an antibody-based pull-down of RPL10A followed by the detection of the co-immunoprecipitated RNA molecule. Even more preferably, the detection of the co-immunoprecipitated RNA molecule is carried out by a Polymerase Chain Reaction (PCR) or next generation sequencing (NGS). Still even more preferably, the PCR is selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably TaqMan qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR.

[0078] Alternatively, the RNA-pulldown assay is an antisense oligonucleotide-based pull-down of the RNA molecule followed by the detection of RPL10A. Even more preferably, the detection of RPL10A is carried out by an antibody-based assay or a mass spectrometry-based assay. Still even more preferably, the antibody-based assay is selected from the group consisting of an Enzyme- Linked Immunosorbent Assay (ELISA), an Immuno-Polymerase Chain Reaction (Immuno-PCR) assay, an Immuno-Next generation sequencing (Immuno-NGS) assay, and a Western Blot assay or the mass spectrometry-based assay is selected from the group consisting of a liquid chromatography-mass spectrometry (LC-MS) assay and fractionation followed by mass spectrometry (F / MS).

[0079] The term “polymerase chain reaction (PCR)”, as used herein, refers to laboratory technique to rapidly make millions to billions of comprising (complete or partial) of a specific sample comprising DNA. It allows to take a very small sample of DNA and amplify it (or a part of it) to a large enough amount to study in detail. The majority of PCR methods rely on thermal cycling. Thermal cycling exposes reactants to repeated cycles of heating and cooling to permit different temperature-dependent reactions - specifically, DNA melting and enzyme-driven DNA replication. PCR employs two main reagents-primers (which are short single strand DNA fragments known as oligonucleotides that are a complementary sequence to the target DNA region) and a DNA polymerase. This is the basic principle of PCR. Diverse PCR techniques are known. As mentioned above, the PCR is preferably selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably TaqMan qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR.

[0080] The term “next generation sequencing (NGS)” as used herein, refers to a new method for sequencing nucleotide sequences at high speed and at low cost. Next-generation sequencing (NGS) is, thus, a high-throughput methodology that enables rapid sequencing of the base pairs in DNA or RNA samples. Supporting a broad range of applications, including gene expression profiling, chromosome counting, detection of epigenetic changes, and molecular analysis, NGS is driving discovery and enabling the future of personalized medicine. NGS is also known as second generation sequencing (SGS) or massively parallel sequencing (MPS).

[0081] The term “point-of-care testing (POCT)”, as used herein, refers to a medical diagnostic testing at or near the point of care that is the time and place of individual care. This contrasts with the historical pattern in which testing was wholly or mostly confined to the medical laboratory, which entailed sending off specimens away from the point of care and then waiting hours or days to learn the results, during which time care must continue without the desired information. Point- of-care tests are simple medical tests that can be performed at the bedside. The driving notion behind POCT is to bring the test conveniently and immediately to the individual to be tested. This increases the likelihood that the individual, physician, and care team will receive the results quicker, which allows for immediate clinical management decisions to be made. POCT is often accomplished through the use of transportable, portable, and handheld instruments and test kits. Small bench analyzers or fixed equipment can also be used when a handheld device is not available - the goal is to collect the specimen and obtain the results in a very short period of time at or near the location of the individual so that the treatment plan can be adjusted as necessary before the individual leaves the hospital.

[0082] In the context of the present invention, the term “kit of parts (in short: kit)” is understood to be any combination of at least some of the components identified herein, which are combined, coexisting spatially, to a functional unit, and which can contain further components.

[0083] Embodiments of the invention

[0084] The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous, unless clearly indicated to the contrary.

[0085] Lung cancer or bronchogenic carcinoma refers to tumors originating in the lung parenchyma or within the bronchi. It is one of the leading causes of cancer-related deaths in Europe and in the United States. Since 1987, lung cancer has been responsible for more deaths in women than breast cancer. It is estimated that there are 225,000 new cases of lung cancer in the United States annually, and approximately 160,000 die because of lung cancer. It is interesting to note that lung cancer was a relatively rare disease at the beginning of the 20th century. Its dramatic rise in later decades is attributable primarily to the increase in smoking among both males and females. Historically, markers such as age, performance status and disease stage have been used to risk-stratify lung cancer patients and guide therapeutic decisions. These parameters provide some useful information, but more sensitive markers are clearly needed. Molecular and genetic studies have identified several such markers, which appear to play critical roles in carcinogenesis and affect patient outcomes. However, their prognostic and predictive value for lung cancer medicine has been low so far.

[0086] Small non-coding RNAs, typically with a length of 18 to 50 nucleotides (nt), are a subgroup of short non-coding RNAs (18 to 200 nt). These RNAs can be found intracellularly and in extracellular environments, including body fluids such as blood. A subclass of small non-coding RNAs, so called microRNAs (miRNAs), possess regulatory function exerted on the gene expression regulation of protein-encoding messenger RNAs (mRNAs). In the last two decades, other short fragments of long and short RNAs with regulatory functions were described, such as fragments of ribosomal RNA (rRNA), transfer RNA (tRNA), small nucleolar RNA (snoRNA), and others. A plethora of short fragments with no described regulatory function can be readily found in biological RNA samples. This is likely result of (active or passive) fragmentation of longer RNA precursors.

[0087] Small non-coding RNA molecules may exist in cells in the form of ribonucleoprotein (RNP) complexes. RNA-binding proteins exert several RNA-related functions, e.g. RNA degradation, RNA transport, RNA storage, or RNA regulation.

[0088] As mentioned above, the present inventors have now discovered that a 28S ribosomal RNA (rRNA) fragment (and precursors or variants therefrom) exists in cells as part of a ribonucleoprotein (RNP) complex and that this complex is upregulated in lung cancer cell lines compared to healthy control cell lines. The detection of said complex will, thus, allow lung cancer diagnosis in patients. Specifically, the present inventors have found that the 28S ribosomal RNA (rRNA) fragment having a nucleotide sequence according to SEQ ID NO: 1 is bound to the ribosomal protein L10A (RPL10A) and that this complex is detectable in the extracellular fraction of blood. The present inventors could demonstrate that this complex is further found secreted by lung cancer cell lines and its prevalence is higher in medium conditioned by lung cancer cell lines as compared to cell- free fraction from healthy human individuals. In addition, the present inventors could show that this complex is stable in different blood collection devices and under different storage conditions. Thus, the detection of said complex will allow lung cancer diagnosis in patients. According to the present inventors, even the detection of the ribosomal protein L10A (RPL10A) alone appears to enable lung cancer diagnosis.

[0089] Thus, in a first aspect, the present invention relates to a (an) (in vitro) method of diagnosing lung cancer in a patient comprising the step of: determining the level of a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising / having a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g. at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity thereto and a ribosomal protein L10A (RPL10A), and / or the level of ribosomal protein L10A (RPL10A) in an extracellular fraction / portion of blood of a patient.

[0090] Specifically, an RNA molecule comprising

[0091] (i) a nucleotide sequence according to SEQ ID NO: 1,

[0092] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment which is between 1 to 6, more preferably between 1 to 4, and most preferably between 1 to 2, e.g. 1, 2, 3, 4, 5, or 6, nucleotide(s) shorter than the nucleotide sequence according to (i), or

[0093] (iii) a nucleotide sequence that has at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g. at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the nucleotide sequence according to (i) or nucleotide sequence fragment according to (ii) is part of the RNP complex whose level is determined in the extracellular fraction of blood of a patient.

[0094] In one preferred embodiment, the level of the RNP complex is compared to a reference level of said RNP complex, and / or the level of RPL10A is compared to a reference level of said RPL10A.

[0095] Thus, in one particular embodiment, the present invention relates to a (an) (in vitro) method of diagnosing lung cancer in a patient comprising the steps of:

[0096] (i) determining the level of a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A) in an extracellular fraction of blood of a patient, and

[0097] (ii) comparing the level of the RNP complex to a reference level of said RNP complex.

[0098] The above comparison allows to diagnose lung cancer in a patient, in particular in a patient suspected of suffering from lung cancer. The patient may be diagnosed as suffering from lung cancer, i.e. being diseased, or as not suffering from lung cancer, i.e. being healthy. In one another particular embodiment, the present invention relates to a (an) (in vitro) method of diagnosing lung cancer in a patient comprising the steps of:

[0099] (i) determining the level of ribosomal protein L10A (RPL10A) in an extracellular fraction of blood of a patient, and

[0100] (ii) comparing the level of RPL10A to a reference level of said RPL10A.

[0101] The above comparison allows to diagnose lung cancer in a patient, in particular in a patient suspected of suffering from lung cancer. The patient may be diagnosed as suffering from lung cancer, i.e. being diseased, or as not suffering from lung cancer, i.e. being healthy.

[0102] The reference level may be any reference level which allows to determine whether the patient suffers from lung cancer or not. The reference level may be obtained from (control) subjects (i.e. subjects different from the patient to be tested such as healthy subjects and / or subjects known to have lung cancer) or from the same patient. In the latter case, the patient may be retested for lung cancer, e.g. in the form of a longitudinal monitoring. It may be determined that the patient is now affected by lung cancer or still not affected by lung cancer.

[0103] In one more preferred embodiment, the reference level is the level of the RNP complex, or the level of RPL10A determined empirically by measuring a number of reference extracellular fractions of blood of healthy subjects (not suffering from lung cancer), and / or subjects known to suffer from lung cancer.

[0104] For example, the reference level is determined by measuring at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000 at least 5000 reference extracellular fractions of blood of healthy subjects, and / or the reference level is determined by measuring at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000 at least 5000 reference extracellular fractions of blood of subjects known to suffer from lung cancer.

[0105] Specifically, the reference level is an average reference level. It is determined by measuring reference levels of control subjects (e.g. healthy subjects or subjects having lung cancer / known to have lung cancer) and calculating the “average” level (e.g. mean, median or modal value) thereof. It is preferred that the reference extracellular fraction of blood is from the same source (e.g. serum or plasma) than the extracellular fraction of blood obtained from the patient to be tested. It is further preferred that the reference level is obtained from control subjects (e.g. healthy subjects or subjects having lung cancer / known to have lung cancer) of the same gender (e.g. female or male) and / or of a similar age / phase of life (e.g. adults or elderly) than the patient to be tested. Especially, the reference level represents an average value of the RNA molecule in a healthy population and / or the reference level represents an average value of the RNA molecule in a population of subjects having lung cancer / known to have lung cancer.

[0106] In one even more preferred embodiment, the reference level is the level of the RNP complex, or the level of RPL10A determined empirically by measuring a number of reference extracellular fractions of blood of healthy subjects (not suffering from lung cancer), wherein the level of the RNP complex, and / or the level of RPL10A above the reference level indicates that the patient suffers from lung cancer.

[0107] Specifically, the level of the RNP complex and / or of RPL10A is at least 0.6-fold or 0.7- fold, more specifically at least 0.8-fold or 0.9-fold, even more specifically at least 1.2-fold or 1.5- fold, and still even more specifically at least 2.0-fold or 3.0-fold above the reference level. For example, the level of the RNP complex and / or of RPL10A is at least 0.6-fold, at least 0.7-fold, at least 0.8-fold, at least 0.9-fold, at least 1.0-fold, at least 1.1-fold, at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9- fold, at least 2.0-fold, at least 2.1-fold, at least 2.2-fold, at least 2.3-fold, at least 2.4-fold, at least 2.5-fold, at least 2.6-fold, at least 2.7-fold, at least 2.8-fold, at least 2.9-fold, or at least 3.0-fold above the reference level.

[0108] As mentioned above, the level of a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A) is / are determined in the method of diagnosing lung cancer in a patient. Thereby, the nucleotide sequence according to SEQ ID NO: 1 (CGCCGGUGAAAUACCACU) represents the “core sequence” which allows lung cancer diagnosis. This core sequence is also comprised in / encompassed by other nucleotide sequences which equally allow lung cancer diagnosis. The variants / precursors of the nucleotide sequence according to SEQ ID NO: 1 ( CGCCGGU GA A AU ACC ACU) as described herein have the following nucleotide sequences: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 2) CGGGCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 3),

[0109] CGGGCCGCCGGUGAAAUACCACUACU (SEQ ID NO: 4), and GCCGCCGGUGAAAUACCACUACU (SEQ ID NO: 5).

[0110] Thus, the level of ribonucleoprotein (RNP) complexes comprising any of the nucleotide sequences according to SEQ ID NO: 1 to SEQ ID NO: 5 and ribosomal protein L10A (RPL10A) may be determined in the method of the present invention. In this respect, it should be noted that by the wording RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1 ( CGCCGGU GA A AU ACC ACU) (“core sequence”) also the nucleotide sequences according to SEQ ID NO: 2 to SEQ ID NO: 5 are covered. The sequences according to SEQ ID NO: 1 to SEQ ID NO: 5 are preferably human sequences.

[0111] The above-mentioned nucleotide sequences can be present in a 2’ -ortho-methylated or 2’-ortho- non-methylated state and optionally possess various 5’ ends, such as 5’ phosphorylation or 5’ hydroxyl and / or various 3’ ends, such as 3’ hydroxyl, 3’ phosphate or 3’, 2’ cyclic phosphate.

[0112] Diverse molecular biological techniques are known which allow the determination of the level of the above-mentioned ribonucleoprotein (RNP) complex and / or ribosomal protein L10A (RPL10A). These techniques aim to detect the protein of the RNP complex first and then the RNA molecule or vice versa.

[0113] In one embodiment, the level of the RNP complex is determined by an immunoprecipitation-based assay.

[0114] The immunoprecipitation-based assay is, for example, an antibody-based pulldown of RPL10A followed by the detection of the co-immunoprecipitated RNA molecule.

[0115] Immunoprecipitation (IP) is a technique which allows the selectively isolation of a particular protein species from a sample. The technique relies on antigen / antibody recognition (immuno) and the subsequent mass- or affinity-related isolation of the capture / target complex (precipitation). It is the precipitation of the target protein that is referenced by the name: Pull-down assay. The pulldown assay for “pull down” RPL10A and, thereby the RNP complex comprising the RNA molecule, involves the use of a matrix-associated antibody for RPL10A, and various wash and elution steps to ensure the specific preference for the targeted RPL10A. After isolation of the RNP complex via the RPL10A “pull down”, the RNA molecule is subsequently detected. For subsequent RNA molecule detection, the RNA may be extracted from the complex via phenol- guanidyl chloride-based extraction (e.g. QIAzol). Otherwise, Protease K may be used to libereate the RNA molecule from the complex. Preferably, the detection of the co-immunoprecipitated RNA molecule is carried out by a Polymerase Chain Reaction (PCR) or next generation sequencing (NGS). More preferably, the PCR is selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably TaqMan qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR.

[0116] Preferred RPL10A antibodies may be obtained from ChromoTek & Proteintech Germany, Ref# 16681-AP, OriGene Technologies GmbH, Ref# TA809520S, or NovusBio, Ref# NBP1-56304.

[0117] In one another embodiment, the level of the RNP complex is determined by an RNA- pulldown assay. The RNA-pulldown assay is, for example, an antisense oligonucleotide-based pulldown of the RNA molecule followed by the detection of RPL10A.

[0118] RNA pulldown is a popular RNA-centric approach to study RNA-protein interaction.

[0119] Antisense oligonucleotides (ASO) are single strands of DNA or RNA that are complementary to a chosen sequence, in the present case to the RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1. The antisense oligonucleotides bind the chosen sequence, in the present case the RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, in a process called hybridization. Thus, antisense oligonucleotides can be used to target a specific, complementary RNA, in the present case the RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1. The pull-down assay for “pull down” the RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1 and, thereby the RNP complex comprising RPL10A, involves the use of a matrix-associated antisense oligonucleotide, and various wash and elution steps to ensure the specific preference for the targeted RNA molecule. After isolation of the RNP complex via the RNA molecule “pull down”, RPL10A is subsequently detected. Preferably, the detection of RPL10A is carried out by an antibody-based assay or a mass spectrometry-based assay. More preferably, the antibody-based assay is selected from the group consisting of an Enzyme-Linked Immunosorbent Assay (ELISA), an Immuno-Polymerase Chain Reaction (Immuno-PCR) assay, an Immuno-Next generation sequencing (Immuno-NGS) assay, and a Western Blot assay.

[0120] Preferred antisense oligonucleotides for binding to / hybridizing with the RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1 are selected from the group consisting of DNA oligonucleotides containing a core sequence of 5’- AGTGGTATTTCACCGGCG-3’ (SEQ ID NO: 18), RNA oligonucleotides containing a core sequence 5’-AGUGGTAUUUCACCGGCG-3’ (SEQ ID NO: 19), and any of these oligonucleotides enhanced by any number of modifications such as 2’ -ortho methylation, locked- nucleid acids (LNA) and similar.

[0121] In one alternative or additional embodiment, the level of RPL10A is determined by an antibody-based assay or a mass spectrometry-based assay.

[0122] Preferably, the antibody-based assay is selected from the group consisting of an Enzyme-Linked Immunosorbent Assay (ELISA), an Immuno-Polymerase Chain Reaction (Immuno-PCR) assay, an Immuno-Next generation sequencing (Immuno-NGS) assay, and a Western Blot assay, or the mass spectrometry-based assay is selected from the group consisting of a liquid chromatography-mass spectrometry (LC-MS) assay and fractionation followed by mass spectrometry (F / MS). In an Enzyme-Linked Immunosorbent Assay (ELISA), for example, an RPL10A antibody is immobilized on a solid surface (microplate) and then complexed with RPL10A being part of the RNP complex comprising the RNA molecule. Subsequently, another antibody which binds RPL10A and which is linked to a reporter, e.g. reporter enzyme, is used. Detection is accomplished by measuring the activity of the reporter, e.g. reporter enzyme, via incubation with the appropriate substrate to produce a measurable product.

[0123] Although many variants of ELISA have been developed and used in different situations, they all depend on the same basic elements:

[0124] Coating / capture — direct or indirect immobilization of antibodies to the surface of polystyrene microplate wells.

[0125] Plate blocking — addition of irrelevant protein or other molecule to cover all unsaturated surfacebinding sites of the microplate wells.

[0126] Probing / detection — incubation with proteins comprised in a sample that affinity-bind to the immobilized antibodies.

[0127] Signal measurement — detection of the bound proteins, e.g. directly or via a secondary tag on another specific antibody.

[0128] In an Immuno-Polymerase Chain Reaction (Immuno-PCR, IPCR) assay, for example, two RPL10A antibodies are allowed to bind to the RPL10A target. Each antibody bears an DNA oligonucleotide. Only proximity of the two oligonucleotides, what requires an antibody / protein bond, allows for oligonucleotide ligation and subsequent PCR detection. The Immuno-Polymerase Chain Reaction (Immuno-PCR, IPCR) assay is the most sensitive technique for the detection of proteins and gains its uniqueness through the exponential amplification of a signal- generating nucleic acid intermediate attached to a protein target.

[0129] In an Immuno-Next generation sequencing (Immuno-NGS) assay, for example, two RPL10A antibodies are allowed to bind to the RPL10A target. Each antibody bears an DNA oligonucleotide. Only proximity of the two oligonucleotides, what requires an antibody / protein bond, allows for oligonucleotide ligation and subsequent detection via next generation sequencing.

[0130] In a Western Blot assay, for example, three elements are used to achieve the separation of a specific protein from a complex mixture: separation by size, transfer of protein to a solid support, and marking target protein using a primary and secondary antibody to visualize. In case of RPL10A, a primary antibody is used that recognizes and binds to RPL10A. Therefore, the electrophoresis membrane is washed in a solution containing primary antibody, before excess antibody is washed off. Subsequently, a secondary antibody is added which recognizes and binds to the primary antibody. The secondary antibody is visualized through various methods such as staining, immunofluorescence, and radioactivity allowing indirect detection of RPL10A. The lung cancer, e.g. lung cancer of state I, II, III, or IV, may be non- small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). For example, the lung cancer is non- small-cell lung carcinoma (NSCLC), e.g. NSCLC of stage I, II, III or IV. Alternatively, the lung cancer is small-cell lung carcinoma (SCLS), e.g. SCLS of stage I, II, III or IV. Particularly, the lung cancer is early stage lung cancer, i.e. lung cancer of stage I.

[0131] The patient is preferably a mammal, more preferably a human.

[0132] Preferably, the extracellular fraction of blood is selected from the group consisting of serum and plasma. More preferably, the plasma is stabilized by covalently-non-crosslinking or covalently-crosslinking chemical agents.

[0133] In a second aspect, the present invention relates to the (in vitro) use of a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g. at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity thereto and a ribosomal protein L10A (RPL10A), and / or a ribosomal protein L10A (RPL10A) for diagnosing lung cancer.

[0134] Especially, the ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A), and / or a ribosomal protein L10A (RPL10A) is / are part of / comprised in an extracellular fraction of blood of a patient. Preferably, the extracellular fraction of blood is selected from the group consisting of serum and plasma. More preferably, the plasma is stabilized by covalently- non-crosslinking or covalently-crosslinking chemical agents.

[0135] The patient is preferably a mammal, more preferably a human.

[0136] The lung cancer, e.g. lung cancer of state I, II, III, or IV, may be non- small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). For example, the lung cancer is non- small-cell lung carcinoma (NSCLC), e.g. NSCLC of stage I, II, III or IV. Alternatively, the lung cancer is small-cell lung carcinoma (SCLS), e.g. SCLS of stage I, II, III or IV. Particularly, the lung cancer is early stage lung cancer, i.e. lung cancer of stage I.

[0137] Specifically, an RNA molecule comprising

[0138] (i) a nucleotide sequence according to SEQ ID NO: 1,

[0139] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment which is between 1 to 6, more preferably between 1 to 4, and most preferably between 1 to 2, e.g. 1, 2, 3, 4, 5, or 6, nucleotide(s) shorter than the nucleotide sequence according to (i), or

[0140] (iv) a nucleotide sequence that has at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g. at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the nucleotide sequence according to (i) or nucleotide sequence fragment according to (ii) is part of the RNP complex which is used to diagnose lung cancer.

[0141] As mentioned above, a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A) is used / detected for diagnosing lung cancer in a patient.

[0142] Thereby, the nucleotide sequence according to SEQ ID NO: 1 (CGCCGGUGAAAUACCACU) represents the “core sequence” which allows lung cancer diagnosis. This core sequence is also comprised in / encompassed by other nucleotide sequences which equally allow lung cancer diagnosis. The variants / precursors of the nucleotide sequence according to SEQ ID NO: 1 ( CGCCGGU GA A AU ACC ACU) as described herein have the following nucleotide sequences: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 2) CGGGCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 3),

[0143] CGGGCCGCCGGUGAAAUACCACUACU (SEQ ID NO: 4), and GCCGCCGGUGAAAUACCACUACU (SEQ ID NO: 5).

[0144] Thus, the ribonucleoprotein (RNP) complexes comprising any of the nucleotide sequences according to SEQ ID NO: 1 to SEQ ID NO: 5 and ribosomal protein L10A (RPL10A) are used for lung cancer diagnosis. In this respect, it should be noted that by the wording RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1 (CGCCGGUGAAAUACCACU) (“core sequence”) also the nucleotide sequences according to SEQ ID NO: 2 to SEQ ID NO: 5 are covered. The sequences according to SEQ ID NO: 1 to SEQ ID NO: 5 are preferably human sequences.

[0145] The above-mentioned nucleotide sequences can be present in a 2’ -ortho-methylated or 2’-ortho- non-methylated state and optionally possess various 5’ ends, such as 5’ phosphorylation or 5’ hydroxyl and / or various 3’ ends, such as 3’ hydroxyl, 3’ phosphate or 3’, 2’ cyclic phosphate.

[0146] As to the preferred embodiments to detect the ribonucleoprotein (RNP) complex and / or the RNA molecule, it is referred to the first aspect of the present invention.

[0147] In a third aspect, the present invention relates to (the (in vitro) use of) a kit for diagnosing lung cancer, said kit comprising: means for determining the level of a a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g. at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity thereto and a ribosomal protein L10A (RPL10A), and / or means for determining the level of ribosomal protein L10A (RPL10A) in an extracellular fraction of blood of a patient.

[0148] The patient is preferably a mammal, more preferably a human.

[0149] The lung cancer, e.g. lung cancer of state I, II, III, or IV, may be non- small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLS). For example, the lung cancer is non- small-cell lung carcinoma (NSCLC), e.g. NSCLC of stage I, II, III or IV. Alternatively, the lung cancer is small-cell lung carcinoma (SCLS), e.g. SCLS of stage I, II, III or IV. Particularly, the lung cancer is early stage lung cancer, i.e. lung cancer of stage I.

[0150] Preferably, the extracellular fraction of blood is selected from the group consisting of serum and plasma. More preferably, the plasma is stabilized by covalently-non-crosslinking or covalently-crosslinking chemical agents.

[0151] Specifically, an RNA molecule comprising

[0152] (i) a nucleotide sequence according to SEQ ID NO: 1,

[0153] (ii) a nucleotide sequence that is a fragment of the nucleotide sequence according to (i), preferably a nucleotide sequence that is a fragment which is between 1 to 6, more preferably between 1 to 4, and most preferably between 1 to 2, e.g. 1, 2, 3, 4, 5, or 6, nucleotide(s) shorter than the nucleotide sequence according to (i), or

[0154] (v) a nucleotide sequence that has at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g. at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the nucleotide sequence according to (i) or nucleotide sequence fragment according to (ii) is part of the RNP complex which is to be detected with the means as described herein.

[0155] As mentioned above, the means are for determining the level of a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A).

[0156] Thereby, the nucleotide sequence according to SEQ ID NO: 1 (CGCCGGUGAAAUACCACU) represents the “core sequence” which allows lung cancer diagnosis. This core sequence is also comprised in / encompassed by other nucleotide sequences which equally allow lung cancer diagnosis. The variants / precursors of the nucleotide sequence according to SEQ ID NO: 1 ( CGCCGGU GA A AU ACC ACU) as described herein have the following nucleotide sequences: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 2) CGGGCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 3),

[0157] CGGGCCGCCGGUGAAAUACCACUACU (SEQ ID NO: 4), and GCCGCCGGUGAAAUACCACUACU (SEQ ID NO: 5).

[0158] Thus, the means are for determining the level of ribonucleoprotein (RNP) complexes comprising any of the nucleotide sequences according to SEQ ID NO: 1 to SEQ ID NO: 5 and ribosomal protein L10A (RPL10A). In this respect, it should be noted that by the wording RNA molecule comprising the nucleotide sequence according to SEQ ID NO: 1 (CGCCGGUGAAAUACCACU) (“core sequence”) also the nucleotide sequences according to SEQ ID NO: 2 to SEQ ID NO: 5 are covered. The sequences according to SEQ ID NO: 1 to SEQ ID NO: 5 are preferably human sequences.

[0159] The above-mentioned nucleotide sequences can be present in a 2’ -ortho-methylated or 2’-ortho- non-methylated state and optionally possess various 5’ ends, such as 5’ phosphorylation or 5’ hydroxyl and / or various 3’ ends, such as 3’ hydroxyl, 3’ phosphate or 3’, 2’ cyclic phosphate. Preferably, the means for determining the level of ribosomal protein L10A (RPL10A) comprise means for antibody-based detection of RPL10A, more preferably means for detecting RPL10A via an ELISA, an Immune-PCR assay, Immuno-NGS assay, and / or a Western Blot assay, and / or means for mass spectrometry-based detection of RPL10A.

[0160] For example, the means for determining the level of ribosomal protein L10A (RPL10A) via ELISA may comprise one or more of the following: a solid surface (microplate) to which a ribosomal protein L10A (RPL10A) antibody (primary antibody) can bind, a ribosomal protein L10A (RPL10A) antibody (primary antibody) to which RPL10A can bind, another antibody which can bind RPL10A and which is linked to a reporter such as reporter enzyme (secondary antibody), and a substrate for the reporter such as the reporter enzyme.

[0161] For example, the means for determining the level of ribosomal protein L10A (RPL10A) via Immuno-Polymerase Chain Reaction (Immuno-PCR, IPCR) assay may comprise one or more of the following: two RPL10A antibodies which can bind to the RPL10A target, wherein each antibody bears an DNA oligonucleotide, means for carrying out oligonucleotide ligation (e.g. ligase buffer and ligase) and subsequent PCR detection (PCR puffer and DNA polymerase).

[0162] For example, the means for determining the level of ribosomal protein L10A (RPL10A) via Immuno-Next generation sequencing (Immuno-NGS) assay may comprise one or more of the following: two RPL10A antibodies which can bind to the RPL10A target, wherein each antibody bears an DNA oligonucleotide, means for carrying out oligonucleotide ligation (e.g. ligase buffer and ligase) and subsequent next generation sequencing.

[0163] For example, the means for determining the level of ribosomal protein L10A (RPL10A) via Western Blot assay may comprise one or more of the following: an antibody which can bind RPL10A (primary antibody), another antibody which can bind the primary antibody (secondary antibody). The secondary antibody can further comprise a reporter, e.g. a reporter which can be visualized through various methods such as staining, immunofluorescence, and radioactivity, allowing indirect detection of RPL10A.

[0164] Preferably, the means for determining the level of the ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A) comprise means for an immunoprecipitation-based assay to detect the complex, or means for an RNA-pulldown assay to detect the complex.

[0165] For example, the means for determining the level of the complex via an immunoprecipitationbased assay comprise one or more of the following: a matrix to which an antibody for RPL10A can bind, an antibody for RPL10A, means for detecting the co-immunoprecipitated RNA molecule such as means for carrying out a Polymerase Chain Reaction (PCR) or next generation sequencing (NGS), and optionally a washing buffer, an elution buffer and / or a protease.

[0166] For example, the means for determining the level of the complex via an RNA-pulldown assay comprise one or more of the following: an antisense oligonucleotide, specifically a matrix- associated antisense oligonucleotide, for binding the RNA molecule, means for detecting the co- immunoprecipitated RPL10A, such as means for carrying out an antibody-based assay or a mass spectrometry-based assay, and optionally a washing buffer and / or an elution buffer. The specific means for carrying out an antibody-based assay or a mass spectrometry-based assay are described above.

[0167] Preferred

[0168] RPL10A antibodies may be obtained from ChromoTek & Proteintech Germany, Ref# 16681-AP, OriGene Technologies GmbH, Ref# TA809520S, or NovusBio, Ref# NBP1-56304, and / or antisense oligonucleotides for binding to / hybridizing with the RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1 are selected from the group consisting of DNA oligonucleotides containing a core sequence of 5’-AGTGGTATTTCACCGGCG-3’ (SEQ ID NO: 18), RNA oligonucleotides containing a core sequence 5’-AGUGGTAUUUCACCGGCG-3’ (SEQ ID NO: 19), and any of these oligonucleotides enhanced by any number of modifications such as 2’ -ortho methylation, locked- nucleid acids (LNA) and similar. The kit may further comprise a container, and / or a data carrier.

[0169] The data carrier may be a non-electronical data carrier, e.g. a graphical data carrier such as an information leaflet, an information sheet, a bar code or an access code, or an electronical data carrier such as a floppy disk, a compact disk (CD), a digital versatile disk (DVD), a microchip or another semiconductor-based electronical data carrier. The access code may allow the access to a database, e.g. an internet database, a centralized, or a decentralized database. The access code may also allow access to an application software that causes a computer to perform tasks for computer users or a mobile app which is a software designed to run on smartphones and other mobile devices.

[0170] Said data carrier may further comprise at least one reference, e.g. reference level(s) of the complex or protein determined herein and / or cut-off score(s). In case that the data carrier comprises an access-code which allows the access to a database, said at least one reference, e.g. reference level(s) of the complex or protein determined herein and / or cut-off score(s), may be deposited in this database.

[0171] In one embodiment, the kit is useful for conducting the method according to the first aspect.

[0172] In one embodiment, the kit comprises instructions on how to carry out the method according to the first aspect.

[0173] Various modifications and variations of the invention will be apparent to those skilled in the art without departing from the scope of invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art in the relevant fields are intended to be covered by the present invention.

[0174] BRIEF DESCRIPTION OF THE FIGURES

[0175] The following Figures are merely illustrative of the present invention and should not be construed to limit the scope of the invention as indicated by the appended claims in any way.

[0176] Figure 1: Expression of miLung#l in RNA samples isolated from cell pellets or conditioned medium, respectively, was measured by NGS. The expression of the miLung#l is plotted as its counts over counts of all RNAs mapping to 28S rRNA. n=3. Figure 2: Position of miLung#l and two of its precursors is indicated in the context of the mature 28S rRNA sequence (SEQ ID NO: 2).

[0177] Figure 3: Expression of miLung#l and its precursors in RNA samples isolated from conditioned medium was measured by NGS. The expression of the RNAs is plotted as reads per million (RPM). n=2.

[0178] Figure 4: NGS expression of miLung#l and its precursors in RNA samples isolated from conditioned medium that was control-treated or treated with RNaseA. n=2.

[0179] Figure 5: NGS expression of miLung#l and in RNA samples isolated from conditioned medium that was control-treated or treated with RNaseA, or proteinase K and RNaseA, respectively. n=2.

[0180] Figure 6: Digital PCR expression of miLung#l in RNA samples isolated from human serum that was control-treated or treated with RNaseA, or proteinase K and RNaseA, respectively. Two sets of treatments were measured in duplicates.

[0181] Figure 7: Digital PCR expression of miLung#l in RNA samples isolated from human peripheral blood (donor#5) using various preservation tubes, either processed freshly or as frozen material. The cell- free fractions were either control-treated, treated with RNaseA, or proteinase K and RNaseA, respectively. Duplicated measurements were performed.

[0182] Figure 8: Digital PCR expression of miLung#l in RNA samples isolated from cancer patient serum that was control-treated or treated with RNaseA, or proteinase K and RNaseA, respectively. Two sets of treatments were measured in duplicates.

[0183] Figure 9: An image of RPL10A protein and miLung#l RNA as derived from the cryo electron microscopy (ProteinDataBank accession code 5T2C).

[0184] Figure 10: Western blotting image of immuno-precipitation experiment. * indicates unspecific signal.

[0185] Figure 11: Digital PCR measurements of miLung#l biomarker and two unrelated rRNA fragments as enriched by immunoprecipitation (IP) from conditioned media (miLung#l / rRNA 2718-2738: Replicate 1 - left, Replicate 2 - right, miLung#l / rRNA 2503-2523: Replicate 1 - left, Replicate 2 - right).

[0186] EXAMPLES

[0187] The examples given below are for illustrative purposes only and do not limit the invention described above in any way.

[0188] Experimental section I EXAMPLE 1:

[0189] METHODS

[0190] Cell culture

[0191] HCC-827 and A-549 cells were obtained from the German Collection of Microorganisms and Cell Cultures (DSMZ). HCC-827 were cultured in RPMI medium supplemented with 20% fetal bovine serum. A-549 were cultured in DMEM medium supplemented with 10% fetal bovine serum. Both media contained 1% penicillin / streptomycin.

[0192] Human donor blood collection

[0193] Upon donors’ agreement to the study and informed consent collection, the blood was collected into following tubes as per manufacturers’ instructions:

[0194] . 9 ml in S-Monovette, Serum-Gel CAT tube

[0195] . 6 ml in Norgen cfDNA / cfRNA preservative tube

[0196] . 9 ml in Streck cfRNA BCT tube

[0197] The samples were incubated and processed (centrifugation, aliquoting) at room temperature as per manufacturers’ instructions, with the exception that serum tubes were centrifuged for 10 min at 2,000 xg. Aliquotes were processed immediately or stored at -80°C.

[0198] RNaseA and proteinase K treatments

[0199] Typically, 250 pl of sample were treated with 2.5 pl of RNaseA for 15 min at 37°C. The same volume of sample was used for treatment with 2.5 pl of thermolabile proteinase K for 15 min at 37°C, followed by 10 min at 55°C for protease inactivation.

[0200] RNA isolation from medium and cell- free blood fractions

[0201] RNA was isolated using miRneasy Serum / Plasma Kit following manufacturer’s instructions and eluted in 18 pl or using Zymo Research Quick-cfRNA Serum & Plasma Kit following the manufacturer’s instructions while eluted in 18 pl.

[0202] Next generation sequencing (NGS) of small RNAs

[0203] To measure expression of many small RNAs at the time in the biological samples, a NGS method is used. Shortly, the small RNAs are extended using adapter molecules and converted to complementary DNA (cDNA). cDNAs are amplified using PCR reaction and the products are loaded on flow cell that captures the cDNA molecules and determines their sequence (and thus the sequence of the small RNA) in a massive parallel fashion. Localy amplified cDNA molecules on flow-cell form clusters and the determination of the number of clusters for a given cDNA molecule provides relative measurement of its expression, often denoted as reads per million (RPM) of all clusters or all reads.

[0204] Typically, 5 pl of RNA elution or 100 ng of RNA was used for 3’ adapter ligation reaction as outlined below.

[0205] Pre-adenylated DNA linker sequence: 5’-AACTGTAGGCACCATCAAT-3’ (SEQ ID NO: 6)

[0206] The reaction was held 1 hour at 28°C followed by 20 min at 65°C. Then was the reaction cooled to 4°C.

[0207] To the previous reaction, the following components were added for the ligation of 5’ adapter.

[0208] RNA adapter sequence: 5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ (SEQ ID NO: 7) The reaction was held 30 min at 28°C followed by 20 min at 65°C. Then was the reaction cooled to 4°C. To the previous reaction, following components were added:

[0209] The reaction was denatured at 85°C for 2 min, 2 min at 75°C, 2 min at 70°C, 2 min at 65°C, 2 min at 60°C, 2 min at 55°C, 5 min at 37°C and finally 25°C for 5 min. Then the reaction was placed on ice and following components were added:

[0210] The sequence of the RT primer DNA oligo is as follows (where “+” denotes locked nucleic acid,

[0211] N is any deoxyribonucleotide):

[0212] 5 ’ - AGACGTGTGCTCTTCCGATCTNNNNNNNNNNNNATTGATG+GT+GCCTACAGTT-3 ’

[0213] (SEQ ID NO: 8)

[0214] The reaction was incubated at 50°C for 60 min and then 15 min at 70°C. The reaction was then placed on ice.

[0215] Next, the cDNA was purified using Omega MagBind pure NGS beads (Omega biotek) as recommended by the vendor. 2.5x ratio of the beads to the cDNA reaction volume was used. The cDNA was eluted in 25 pl of 10 mM Tris-HCl, pH 8.5.

[0216] Next, cDNA was used for PCR using following components: The sequence of the indexing primers were as follows (“*” denotes phosphortioate bond, while “N” denotes 8 nucleotide index sequence unique for each primer):

[0217] Forward primer:

[0218] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACGTTCAGAGTTCTACA

[0219] GTCCG*A (SEQ ID NO: 9)

[0220] Reverse primer:

[0221] CAAGCAGAAGACGGCATACGAGATATNNNNNNNNGACTGGAGTTCAGACGTGTGCT

[0222] CTTCCGATC*T (SEQ ID NO: 10)

[0223] The PCR reaction conditions were as follows:

[0224] Next, the PCR product was purified using Omega MagBind pure NGS beads as recommended by the vendor. First, a 0.9x ratio of the beads to the PCR reaction volume was used and supernatant was used for second binding reaction with 1.8x ratio of beads to supernatant. The DNA was eluted in 13 pl of 10 mM Tris-HCl, pH 8.5.

[0225] Next, the DNA concentration was determined using QuantIT (Thermo fisher scientific). Equimolar pool of DNA libraries was prepared and loaded as 500 pM concentration on NextSeq2000 P3 50 cycles cartridge (Illumina). Custom index 2 primer was used for sequencing (sequence: 5’- GATCGTCGGACTGTAGAACTCTGAACGTGT-3’ (SEQ ID NO: 11)).

[0226] The sequence files (fasta) were preprocessed by trimming the 3 ’adapter sequence. Read count matrix was established and RPM values were calculated.

[0227] HBDx digital PCR To measure expression of a given small RNAs in the biological samples, a HBDx digital PCR method is used. Shortly, the RNA are extended using anti-complementary adapter molecules and converted to complementary DNA (cDNA). cDNAs are amplified using PCR reaction and the products are detected using defined fluorescently labelled probes in thousands of partitions of a larger PCR mixture. Because only some partitions will be positive, their ratio to the total number of partitions (positive and negative) is proportional to the orginal number of molecules in the biological RNA sample, enabling thus absolute quantification of the RNA expression.

[0228] First, adapters are denatured and renatured such that they form required stem loop-like structures. The source RNA is denatured separately, treated with the polynucleotide kinase (to restore the 5’ phosphate), mixed with adapters and used for the ligation by T4 RNA ligase 2. Subsequently, RT primer aligning to the 3’ adapter is used for the cDNA production. Next, diluted cDNA is used for the digital PCR with a reverse primer aligning to the 5’ end of first strand cDNA and forward primer complementary to the 3’ end of the first strand cDNA. Finally, a TaqMan probe is used for the detection of the specific signal in digital PCR.

[0229] 1. Adapter preparation

[0230] Heat the mixture to 82°C for 2 min

[0231] Ramp-down rate of 0. l°C / sec to 4°C

[0232] Store at -20°C

[0233] 5’ adapter: CACmCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID

[0234] NO: 12)

[0235] 3’ adapter:

[0236] / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGGTAGTGGTA / 3InvdT / (SEQ ID NO: 13)

[0237] 2. RNA denaturation

[0238] Denature RNA for 2 min at 70°C

[0239] Immediately place on ice PNK treatment of the RNA

[0240] Incubate 20 min @37 °C - Denature at 65 °C for 10 min Ligation of the adapters to RNA

[0241] Incubate 1 hour at 37 °C with the lid heated to 45 °C - Store at -20°C Reverse transcription

[0242] Prepare the RT reaction:

[0243] Incubate 5 min at 65 °C and cool immediately on ice

[0244] Add following to the previous mixture

[0245] Incubate at 55°C for 30 min, followed by 3 min incubation at 85°C and store at 4°C

[0246] Store at -20°C

[0247] RT primer: 5’-CTCAGTGCGAATACCTCGGACCCTGCACTGAGGTAGT (SEQ ID NO: 14)

[0248] 6. QIAcuity dPCR

[0249] Dilute cDNA accordingly

[0250] Prepare the following mixture for each per well

[0251] Transfer 12pl to the 96-well-plate for dPCR

[0252] Taqman Probe: 5’- / 6-FAM / TGAGGTAGTGGTATTTCACCGGCGGCCGT / BHQ-l / (SEQ ID

[0253] NO: 15)

[0254] Forward primer: 5’-TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 16)

[0255] Reverse primer: 3’-GTGCGAATACCTCGGACC (SEQ ID NO: 17) RESULTS

[0256] To study the aspects of miLung#l biology (GCCGCCGGUGAAAUACCACUAC, SEQ ID NO:

[0257] 2), the expression of the miLung#l in the human lung cancer cell lines A549 and HCC827 was inspected using next generation sequencing of small RNAs (Figure 1). While low-to-none expression of miLung#l in the cell pellets was observed, there was considerably higher expression of miLung#l in the conditioned cell culture medium. It was reasoned that this is analogous to the expression of miLung#l in plasma of lung cancer patients as it was observed before (Sikosek et al, manuscript under revision).

[0258] Because longer fragments of 28S rRNA that contain the sequence of miLung#l may exist, the NGS data of conditioned cell culture medium were inspected for their expression. Two prominent precursor species of miLung#l were observed (Figure 2), named as “Precursor A” (SEQ ID NO:

[0259] 3) and “Precursor B” (SEQ ID NO: 4) that contain extra nucleotide sequence on the 5’ and 3’ end of miLung#l . Both precursors showed considerably higher expression in conditioned medium than the expression of miLung#l (Figure 3).

[0260] Because the expression of precursors is not considerably higher than miLung#l expression in human blood (data not shown), it was reasoned that the precursor RNAs are further processed extracellularly by RNases into mature miLung#l sequence. Indeed, extracellular RNase presence was described previously in various human body fluids. To mimic the action of RNases, the conditioned medium was treated by RNaseA and measured the expression of miLung#l and its precursors (Figure 4). As expected, the expression of precursor RNA species was diminished upon digestion with RNaseA, while the expression of miLung#l was - interestingly - increased.

[0261] The increase in expression of miLung#l upon RNaseA treatment suggested its resistance to the RNaseA digestion. RNA can be resistant to the RNase by being included in a complex with other molecules that “protect” the RNA. Typically, such molecules are (RNA-binding) proteins that form a complex with RNA; such complex is termed ribonucleoprotein complex, or “RNP”. To investigate whether miLung#l is protected from RNase digest in conditioned medium by a RNP, the medium was first treated with thermolabile proteinase K that typically digest all present proteins. Upon thermal inactivation of proteinase K, RNaseA treatment was applied and the expression of miLung#l was measured. It was observed that pre-treatment with proteinase K enabled almost complete digestion of miLung#l by RNaseA (Figure 5). Thus, miLung#l is bound to a protein in a RNP in the conditioned medium of A549 and HCC827 cells. It was next investigated whether miLung#l forms a RNP in human blood. Healthy human donors’ blood was collected in serum tubes and the expression of miLung#l was inspected upon RNaseA, and proteinase K followed by RNaseA treatment, respectively (Figure 6). It was observed that miLung#l also forms RNP in human blood. Interestingly, it was observed that while miLungl is bound completely in RNP in conditioned medium of cancer cell lines, the fraction of RNP-bound miLung#l is considerably lower in healthy human donors.

[0262] Finally, the stability of miLung#l RNP in various sampling tubes and stability of miLung#l RNP upon freezing at -80°C was tested. The presence of miLung#l RNP was found in all three tested tubes and it was noted that the RNP is stable upon 24 h freezing and storage in -80°C (Figure 7). Therefore, collection and storage of cell-free human blood specimens enable the detection and analysis of miLung#l RNP in the context of lung cancer diagnostics.

[0263] Because the RNP protection of miLung#l is much pronounced in the conditioned medium of lung cancer cell lines than in the peripheral blood of healthy donors, miLung#l RNP detection techniques can be used for the diagnosis of lung cancer. Especially techniques that employ (simultaneous) detection of RNP protein(s) using antibodies raised against these protein(s) and / or detection of miLung#l using anti-complementary oligonucleotides may enable sensitive and specific detection of miLung#l RNP and can be used for (early) lung cancer detection. miLung#l refers to the RNA molecule having a nucleotide sequence according to SEQ ID NO: 2 ( GCCGCCGGU GA A AU ACC ACU AC) . Thus, the present experiments were conducted with the RNA molecule having a nucleotide sequence according to SEQ ID NO: 2. However, similar results were also achieved for SEQ ID NO: 1 ( CGCCGGU GA A AU ACC ACU) (data not shown).

[0264] EXAMPLE 2:

[0265] The RNP complex detection in a cell- free fraction of blood of a patient can include dilution of the biological material, flow of the diluted material and immobilization of the RNP complex on a solid support using an antibody against RPL10A attached thereto, washing and subsequent detection of the RNA molecule in the complex using anti-complementary flurophore labelled probes. Upregulation of the complex in the cell-free fraction of blood of a patient compared to a healthy control sample is indicative for lung cancer.

[0266] EXAMPLE 3: The RPL10A detection in a cell-free fraction of blood of a patient can include dilution of the biological material, flow of the diluted material and immobilization of the RPL10A on a solid support using an antibody against RPL10A attached thereto. Subsequently, another antibody which binds RPL10A and which is linked to a reporter, e.g. reporter enzyme, may be used. Detection is accomplished by measuring the activity of the reporter, e.g. reporter enzyme, via incubation with the appropriate substrate to produce a measurable product. Up-regulation of RPL10A in the cell-free fraction of blood of a patient compared to a healthy control sample is indicative for lung cancer.

[0267] Experimental section

[0268] MATERIALS & METHODS

[0269] HCC-827 cells expressing HA tag and Prescission cleavage site at the N-terminus of RPL10A were washed 2x with PBS and cultured overnight in growth medium without fetal calf serum.

[0270] After overnight incubation, medium was harvested and centrifuged for 8 min at 500xg to remove floating cells and large cell debris. The supernatant was concentrated using 3K cutoff (3kDa) columns several time with centrifugation for lOmin at 14.000xg, until final volume was lower than 1ml.

[0271] The concentrated medium was diluted with lysis buffer to 1 ml, such that the final concentration of lysis buffer components were: 50 mM NaCl, 10 mM Tris-HCl pH7.5, 0.5 rnM EDTA, 0.05 mM EGTA, 1 % Triton-XlOO, lx protease inhibitor cocktail and 10 units of murine RNase inhibitor.

[0272] 50 pl of HA beads were washed 3x with lx lysis buffer and resuspended in 50 pl of lx lysis buffer.

[0273] Input samples for protein (3% volume) and RNA (10% volume) analysis were set aside.

[0274] Medium was mixed with HA beads and incubated 1 hour at room temperature by rotating.

[0275] After the immunoprecipitation (IP), beads were washed with 600 pl of lx lysis buffer. Beads were washed 6 times in total. Last wash was split in 3 tubes, 200 pl each. One tube was mixed with 1 ml of QIAzol and used for RNA extraction using protocol as recommended by miRNeasy serum / plasma RNA extraction kit. Input samples for RNA were isolated using the same procedure.

[0276] Second tube was used for competitive elution by HA-peptide with final concentration of 2 mg / ml.

[0277] Third tube was used for protease cleavage using 2 pl Prescission protease in 50 pl total cleavage buffer (50mM TRIS-HC1, pH7.0, 150mM NaCl, ImM EDTA pH8.0, ImM DTT) for 4 hours at 4°C.

[0278] Protein samples were mixed with 4x sample buffer, boiled for 3 min at 90°C, loaded on 4-12% denaturating SDS-PAGE gel, and blotted to nitrocellulose membrane. Membrane was blocked for 1 hour in 5% milk in PBS, 0,05% Tween- 20. Anti-RPLIO antibody (#A305-061A) was used in 1:8000 concentration in 5% milk in PBS-T overnight at 4°C. After 3 washes with PBS-T, the membrane was stained with anti-rabbit HPR-conjugated secondary antibody for 1 hour at room temperature in 5% milk in PBS-T. The membrane was washed 3 times in PBS-T and developed using ECL chemistry.

[0279] RNA samples isolated from input and IP samples were used for digital PCR detection using Dumbbell PCR protocol as described in, specifically in the experimental section of, WO 2023 / 016938. The adapters and probes used for additional 28S rRNA fragments are outlined in Table 1 below.

[0280] Table 1: Adapters and probes used for additional 28S rRNA fragments. RESULTS

[0281] Using serum samples from healthy donors it has been shown that miLung#l forms a ribonucleoprotein (RNP) complex in human peripheral blood (see above). To evaluate whether there is a difference in RNP stability in cancer patients as compared to healthy donors, serum from two cancer patients were analysed. Patient “A” suffers from small-cell carcinoma of stage IIIA, whereas patient “B” suffers from non-small cell adenocarcinoma, stage IVA. The expression of miLung#l upon RNaseA, and proteinase K followed by RNaseA treatment, respectively, was inspected (Figure 8). It was observed that the “protection” of miLung#l to RNaseA treatment is much more pronounced in cancer patients than in healthy donors, as reported above.

[0282] Moreover, pre-treatment by proteinase K did not render miLung#l amenable for digestion by RNase, suggesting that the nature of miLung#l-contatining particles may involve other molecules than proteins only, such as glycoproteins or double-layered membranes.

[0283] Next, it was investigated which protein may bind miLung#l and offer, thus, protection in extracellular environment. Based on the cryo electron microscopy images of 80S human ribosomes, protein RPL10A (also known as uLl) shows binding to 28S rRNA in the region of miLung#l on two nucleotide stretches (Figure 9). It was, therefore, asked whether RPL10A protein binds miLung#l RNA biomarker in the conditioned media of HCC-827 cancer cells. A HA-tagged form of RPL10A was expressed and immunoprecipitation on conditioned media using anti-HA beads was performed to enrich tagged RPL10A and small RNAs that could bind to RPL10A.

[0284] First, it was inspected, whether a HA-tagged form of RPL10A can be expressed and whether it can be detected in the conditioned medium. Indeed, two bands were observed when stained with anti- RPL10A antibody (Figure 10, lane 1), one at 25 kDa (endogenous protein) and one at ca 28 kDa (HA-tag-Prescission-tag-RPLIOA, exogenous). Thus, both endogenous and exogenous protein is secreted by HCC-827 cells to conditioned medium. Next, immunoprecipitation (IP) was applied and it was observed that the exogenous protein was depleted in the flowthrough (Figure 10, lane 2) and enriched in the IP when eluted competitively with HA-peptide (Figure 10, lane 3). Minority of the protein remained on the beads (Figure 10, lane 4). Finally, when using Prescission protease for the elution from the beads, enriched exogenous RPE10A void of HA-tag was observed (Figure 10, lane 5). Thus, it could be confirmed that RPE10A is secreted by lung cancer cell line to the conditioned medium, analogous to secretion of RPE10A by cancer tissue to blood circulation. Next, the presence of miLung#l RNA in the input and eluate of the HA immunoprecipitations was measured using digital PCR. To evaluate binding of unspecific, but abundant, small RNAs, the presence of two additional 28S rRNA fragments was also measured that can be found in conditioned media and in the human serum, but should not interact with RPL10A based on the cry EM images. The additional 28S rRNA fragment 2718-2738 has the sequence according to SEQ ID NO: 20 and the additional 28S rRNA fragment 2503-2523 has the seqeunce according to SEQ ID NO: 21 (Figure 11). rRNA 2718-2738 (SEQ ID NO: 20): rUrCrCrGrGrUrGrArGrCrUrCrUrCrGrCrUrGrGrCrC rRNA 2503-2523 (SEQ ID NO: 21): rGrCrCrGrArUrCrGi ArAi ArGrGrGrArGrUrCrGrGrG

[0285] It was observed that cancer biomarker miLung#l is specifically enriched as compared to unrelated rRNA fragments in the immunoprecipitates of RPL10A (Figure 11). Thus, RPL10A protein is responsible for the binding and protection of miLung#l in the conditioned growth medium of cancer cell line HCC-827.

[0286] In conclusion, miLung#l biomarker is stabilized in peripheral blood by interaction with (at least) RPL10A protein, and protection effect of this interaction is enhanced in the cancer patient serum samples as compared to healthy donors.

Claims

CLAIMS1. A method of diagnosing lung cancer in a patient comprising the step of: determining the level of a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A), and / or the level of ribosomal protein L10A (RPL10A) in an extracellular fraction of blood of a patient.

2. The method of claim 1, wherein the level of the RNP complex is compared to a reference level of said RNP complex, and / or the level of RPL10A is compared to a reference level of said RPL10A.

3. The method of claim 2, wherein the reference level is the level of the RNP complex, or the level of RPL10A determined empirically by measuring a number of reference extracellular fractions of blood of healthy subjects.

4. The method of claim 3, wherein level of the RNP complex, and / or the level of RPL10A above the reference level indicates that the patient suffers from lung cancer.

5. The method of any one of claims 1 to 4, wherein the level of the RNP complex is determined by an immunoprecipitation-based assay or by an RNA-pulldown assay.

6. The method of claim 5, wherein the immunoprecipitation-based assay is an antibody-based pulldown of RPL10A followed by the detection of the co-immunoprecipitated RNA molecule.

7. The method of claim 6, wherein the detection of the co-immunoprecipitated RNA molecule is carried out by a Polymerase Chain Reaction (PCR) or next generation sequencing (NGS).

8. The method of claim 7, wherein the PCR is selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably TaqMan qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR.

9. The method of any one of claims 5 to 8, wherein the RNA-pulldown assay is an antisense oligonucleotide-based pulldown of the RNA molecule followed by the detection of RPL10A.

10. The method of claim 9, wherein the detection of RPL10A is carried out by an antibodybased assay or a mass spectrometry-based assay.

11. The method of claim 10, wherein the antibody-based assay is selected from the group consisting of an Enzyme-Linked Immunosorbent Assay (ELISA), an Immuno-Polymerase Chain Reaction (Immuno-PCR) assay, an Immuno-Next generation sequencing (Immuno- NGS) assay, and a Western Blot assay.

12. The method of claim 10, wherein the mass spectrometry-based assay is selected from the group consisting of a liquid chromatography-mass spectrometry (LC-MS) assay and fractionation followed by mass spectrometry (F / MS).

13. The method of any one of claims 1 to 12, wherein the level of RPL10A is determined by an antibody-based assay or a mass spectrometry-based assay.

14. The method of claim 13, wherein the antibody-based assay is selected from the group consisting of an Enzyme-Linked Immunosorbent Assay (ELISA), an Immuno-Polymerase Chain Reaction (Immuno-PCR) assay, an Immuno-Next generation sequencing (Immuno- NGS) assay, and a Western Blot assay.

15. The method of claim 13, wherein the mass spectrometry-based assay is selected from the group consisting of a liquid chromatography-mass spectrometry (LC-MS) assay and fractionation followed by mass spectrometry (F / MS).

16. The method of any one of claims 1 to 15, wherein the lung cancer is non- small-cell lung carcinoma (NSCLC) or small-cell lung carcinoma (SCLC).

17. The method of any one of claims 1 to 16, wherein the patient is a mammal, preferably a human.

18. The method of any one of claims 1 to 17, wherein the extracellular fraction of blood is selected from the group consisting of serum, plasma, and plasma stabilized by covalently- non-crosslinking or covalently-crosslinking chemical agents.

19. Use of a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A), and / or a ribosomal protein L10A (RPL10A) for diagnosing lung cancer.

20. A kit for diagnosing lung cancer, said kit comprising: means for determining the level of a a ribonucleoprotein (RNP) complex, wherein the RNP complex comprises an RNA molecule comprising a nucleotide sequence according to SEQ ID NO: 1, a fragment thereof, or a sequence having at least 80% sequence identity thereto and a ribosomal protein L10A (RPL10A), and / or means for determining the level of ribosomal protein L10A (RPL10A) in an extracellular fraction of blood of a patient.

21. The kit of claim 20, wherein the kit is useful for conducting the method according to any one of claims 1 to 18.

22. The kit of claims 20 or 21, wherein the kit comprises instructions on how to carry out the method according to any one of claims 1 to 18.

Images