Plant extracts for use in biocontrol

Abstract

The present invention relates to the field of plant extracts, more specifically, the present invention pertains to a method for the preparation of extracts from plants of the family Apiaceae, the extracts obtained thereof and the use of said extracts as a biopesticide in e.g. agriculture.

Description

[0001] PLANT EXTRACTS FOR USE IN BIOCONTROL

[0002] HELD OF THE INVENTION

[0003] The present invention relates to the field of plant extracts, more specifically, the present invention pertains to a method for the preparation of extracts from plants of the family Apiaceae, the extracts obtained thereof and the use of said extracts as a biopesticide in e.g. agriculture.

[0004] BACKGROUND TO THE INVENTION

[0005] Traditionally, plant protection products work by directly killing the pathogen (pesticides). However, application of these products is often correlated with unwanted side-effects on the environment, e.g. toxicity to beneficial organisms in the soil or aquatic life, as well as potential issues with food residues. Because of raising ecological awareness, multiple active substances have already been banned.

[0006] Following the current trend for more sustainable solutions, the majority of recently approved pesticides are of biological origin, so-called biopesticides. In a world increasingly concerned with the environmental impact of the chemicals included in plant protection products and fertilizers, there is a growing need for natural and eco-friendly alternatives, that could possibly one day replace synthetic agrochemicals. Biological plant protection products or biocontrols are agents, such as plant extracts, plant products, microorganisms such as bacteria, viruses, fungi, fungal and bacterial enzymes, enzyme inhibitors, or antibiotics that play an important role in control of plant pathogens. They have found widespread use, worldwide to control various plant diseases in the field of agriculture.

[0007] Apiaceae or Umbelliferae is a family of mostly aromatic flowering plants named after the type genus Apium and commonly known as the celery, carrot or parsley family, or simply as umbellifers. Aqueous extracts of fennel have been shown to contain anti-nematode properties when applied on the soil (Ghobadi et al., 2018; Guo et al., 2012), and fennel seeds were incorporated into the soil to control nematodes by El-Nagdi et al. (2019). However, most often, essential oils of fennel are used and described to have direct anti-nematode (Oka et al., 2000) and anti-fungal effects (among others Soylu et al., 2007; Wodnicka et al., 2019). Arslan at al., 2009, shows antifungal activity of extracts of different spices against bean rust. Fenicur (Andermatt Biocontrol, Switzerland) is a commercial product based on fennel oil, used against fungal plant infections. In general, said uses are aimed to the direct application on the pathogen and are applied as a curative treatment.

[0008] This is in contrast to the extracts of the present invention, aimed to apply preventively, e.g. as a foliar spray, on plants. It is hence an objective of the present invention to provide extracts of plants of the family Apiaceae and new uses thereof, as well as methods for providing said extracts and compositions comprising it.

[0009] SUMMARY OF THE INVENTION

[0010] The present invention provides extracts of an Apiaceae plant being one or more members of the family Apiaceae. It was found that extracts, such as e.g. aqueous extracts, prepared from Apiaceae plants are effective as a biopesticide (sometimes also referred to as biocontrol agent).

[0011] Even further, the present invention provides a method of preparing said extracts and uses thereof. It has been found that extracts according to the present invention provide for increased plant resistance to a broad spectrum of pathogens.

[0012] In particular, in a first aspect the present invention provides a method for the preparation of an extract of Apiaceae plants, comprising the steps of: a) providing Apiaceae plants, or parts thereof of the family Apiaceae; b) blending or mixing the plants or parts of step a) with a buffer, while heating said mixture; c) separating the heated mixture of step b) into a solid phase and a liquid phase; and d) obtaining the liquid phase of step c) as an extract.

[0013] In a particular aspect, the present invention provides a method for the preparation of an extract of an Apiaceae plant, comprising the steps of: a) providing Apiaceae plants, or parts thereof of the family Apiaceae b) slicing the plants or parts of step a); c) drying the sliced parts of step b); d) blending or mixing the dried parts of step c) with a buffer, while heating said mixture; e) separating the heated mixture of step d) into a solid phase and a liquid phase; and f) obtaining the liquid phase of step e) as an extract.

[0014] In a further embodiment of the present invention, the method further comprises milling the dried Apiaceae plants or parts before mixing them with a buffer, such as e.g. an aqueous solution or organic solvent solution.

[0015] In accordance with a further embodiment of the present invention, said heating performed onto the mixture obtained by mixing the Apiaceae plants or parts and a buffer is performed at a temperature in a range from about 30 °C to about 120°C, preferably from 50°C to 100°C, preferably from 60°C to 90°C, more preferably at a temperature of about 80°C and / or for a sustained period of time, in a range from about 5 minutes (min) to about 180 min, preferably from 10 min to 150 min, preferably from 50 min to 130 min, more preferably about 120 min.

[0016] In accordance with a further embodiment of the present invention, said Apiaceae plants or parts are provided in dried and / or powder form.

[0017] In a second aspect, the present invention relates to extracts obtainable by or obtained by applying the method described by any of the embodiments of the present invention.

[0018] In a third aspect, the present invention relates to the use of extracts obtainable by or obtained by applying the method or described by any of the embodiments of the present invention as a biopesticide, in particular in agriculture, horticulture, arboriculture and / or home gardening. More specific, the extracts are applied on the shoots of a plant. Even more specific, the extracts are applied pre-emptively.

[0019] In a fourth aspect, the present invention relates to the use of an extract of Apiaceae plants of the family Apiaceae as a biopesticide in agriculture, horticulture, arboriculture and / or home gardening. In particular, the invention provides the use of an extract of Apiaceae plants of the family Apiaceae as a priming agent, in particular for inducing and / or stimulating an immune response in plants, wherein the extract is applied on a plant or part(s) thereof, or in the growth medium of a plant. As such, the extract is used for activation of the systemic defense (induced systemic resistance) in plants against biotic-stress, more specific against plant-specific pests or pathogens, in particular against infections by nematodes, fungi and oomycetes.

[0020] In a fifth aspect, the present invention relates to a method for preventing or treating a plant against nematode, oomycete and / or fungal infection comprising applying to the shoot of said plant an extract obtained from an Apiaceae plant, or part thereof, being a member of the family Apiaceae.

[0021] BRIEF DESCRIPTION OF THE DRAWINGS

[0022] With specific reference to the figures, it is to be noted that the particulars shown are by way of example and for purposes of illustrative discussion of the different embodiments of the present invention only. They are presented in order to provide what is believed to be the most useful and readily description of the principles and conceptual aspects of the invention. In this regard no attempt is made to show structural details of the invention in more detail than is necessary for a fundamental understanding of the invention. The description taken with the drawings makes apparent to those skilled in the art how the several forms of the invention may be embodied in practice. Figure 1 , also abbreviated as Fig. 1 : Systemic defense activation in rice against the root-knot nematode Meloidogyne graminicola after treatment with an aqueous extract derived from fennel waste and a 1 / 2 and 1 / 4 concentration thereof. Inoculation with 250 second stage juveniles was done 24h after foliar spraying of the extracts. Data was taken 14 days later. The undiluted fennel water extract (FWE) significantly reduces gall formation as well as development of the nematodes to egg-laying females in rice roots. (Fig. 1 a) Number of galls per cm root and (Fig. 1 b) nematode development (J2 = second stage juvenile; J3 / J4 = third and fourth stage juveniles). Repeat with FWE derived from fennel batches from two different harvesting periods (year 2020 and year 2021 ) shows significant reduction in gall formation in rice roots (Fig. 1 c). The figure shows the number of galls per cm root. Bars show the average ± SE of 8 plants per treatment. Stars show statistically significant differences from control plants (“: p<0.01 ).

[0023] Figure 2, also abbreviated as Fig. 2. Systemic defense activation in tomato against the rootknot nematode Meloidogyne incognita after treatment with FWE. Inoculation with 250 second stage juveniles was done 24h after foliar spraying of the extract. Data was taken 14 days later. FWE significantly reduces gall formation in tomato roots, (fig. 2a) Number of galls per cm root, (Fig. 2b) and (Fig. 2c) root and shoot dry weight, respectively. Bars show the average ± SE of 8 plants per treatment. Stars show statistically significant differences from control plants (“*: p<0.001 ).

[0024] Figure 3, also abbreviated as Fig. 3. Systemic defense activation in sugar beet against the beet cyst nematode Heterodera schachtii after treatment with FWE. Inoculation with 300 second stage juveniles was done 24h after foliar spraying of the extract. Data was taken 7 weeks later. FWE significantly reduces nematode cyst formation. The figure shows the number of cysts per root system. Bars show the average ± SE of 8 plants per treatment. Stars show statistically significant differences from control plants (“: p<0.01 ).

[0025] Figure 4, also abbreviated as Fig. 4. Systemic defense activation in rice against the rice blast causing pathogen Pyricularia oryzae VT5M1 after treatment with FWE. Foliar inoculation with ±7.5*10A4 spores per plant was done 24h after soil drenching the plants with the extract. Data was taken 5 and 6 days later. FWE significantly reduces the number of sporulating lesions per leaf. Bars show the average ± SE of ±54 plants. Stars show statistically significant differences from control plants (***: p<0.001 ; ****: p<0.0001 ).

[0026] Figure 5, also abbreviated as Fig. 5. Defense activation in rice against the rice blast causing pathogen Pyricularia oryzae after treatment with FWE. Inoculation with ±7.5*10A4 spores per plant was done 24h after foliarly spraying the extract. Data was taken 5 and 6 days later. FWE significantly reduces the number of sporulating lesions per leaf. Bars show the average ± SE of ±54 plants. Stars show statistically significant differences from control plants (****: p<0.0001 ).

[0027] Figure 6, also abbreviated as Fig. 6. Phytohormone levels in rice root (Figure 6a) and shoot (Figure 6b) tissue 24h post treatment with FWE. FWE induces significant changes in phytohormone accumulation. Bars show the average ± SE of 5 biological replicates, each consisting of roots / shoot from 5-6 pooled rice plants. Stars show statistically significant differences from control-treated plants (* p<0.05; ** p<0.01 ; *“ p<0.001 ).

[0028] Figure 7, also abbreviated as Fig. 7. Systemic defense activation in rice against the root-knot nematode Meloidogyne graminicola after treatment with FWE and 6 other extracts derived from plants from the Apiaceae plant family. Inoculation with 250 second stage juveniles was done 24h after foliar spraying of the extracts. Data was taken 14 days later. All Apiaceae extracts reduce the number of galls per cm root, of which the majority even significantly reduces the number of galls per cm root. (Fig. 7a) Number of galls per cm root, (Fig. 7b) and (Fig. 7c) root and shoot length, respectively. Bars show the average ± SE of 8 plants per treatment. Stars show statistically significant differences from control plants (*: p<0.05; **: p<0.01 ; ***: p<0.001 ). CyWE = celery water extract, PIWE = parsley water extract, CPWE = carrot peeling water extract, CLWE = carrot leaf water extract, CcWE = celeriac peeling water extract and PnWE = parsnip peeling water extract .

[0029] Figure 8 also abbreviated as Fig.8. Defense activation in Arabidopsis against the necrotroph Botrytis cinerea and oomycete Hyaloperonospora arabidopsidis after treatment with FWE, CcWE and CLWE. Effects against H. arabidopsidis were examined by application of the extracts on the shoots of Arabidopsis, whereas systemic effects against B. cinerea were examined by application of the extracts on the roots. Inoculation of the shoots with H. arabidopsidis and B. cinerea took place at 1 and 3 days after treatment, respectively. Samples were taken three days post inoculation for analysis of the infection pressure by qPCR. All extracts significantly reduce fungal and oomycete infection. (Fig. 8a) Relative amount of oomycete DNA (Hyaloperonospora arabidopsidis), (Fig. 8b) Relative amount of fungal DNA (Botrytis cinerea). Bars show the average ± SE of 7 biological replicates, each consisting of a pool of 15 plants. Stars show statistically significant differences from control plants (“: p<0.01 ; ***: p<0.001 ).

[0030] Figure 9; also abbreviated as Fig. 9. Systemic defense activation in rice against the root-knot nematode Meloidogyne graminicola after treatment with an ethanol extract derived from fennel (FEE). Inoculation with 250 second stage juveniles was done 24h after foliar spraying with the extract. Data was taken 14 days later. The fennel ethanol extract (FEE) significantly reduces the number of galls per cm root. Bars show the average ± SE of 8 plants per treatment. Stars show statistically significant differences from control plants (*: p<0.05).

[0031] Figure 10; also abbreviated as Fig. 10. Systemic defense activation in rice against the root-knot nematode Meloidogyne graminicola after treatment with an aqueous extract derived from fennel (FWE) and an aqueous fraction resulting from liquid-liquid extraction with toluene (FWE-Fr-H2O). Inoculation with 250 second stage juveniles was done 24h after foliar spraying with the extract. Data was taken 14 days later. The fennel water extract (FWE) significantly reduces the number of galls per cm root. The aqueous fraction derived from liquid-liquid extraction of FWE almost significantly reduces the number of galls per cm root (p=0.0503). Bars show the average ± SE of 8 plants per treatment. Stars show statistically significant differences from control plants (“: p<0.01 ).

[0032] DETAILED DESCRIPTION OF THE INVENTION

[0033] As used herein, the singular forms “a”, “an”, and “the” include both singular and plural referents unless the context clearly dictates otherwise. By way of example, "an extract" means one extract or more than one extract.

[0034] The terms “comprising”, “comprises” and “comprised of” as used herein are synonymous with “including”, “includes” or “containing”, “contains”, and are inclusive or open-ended and do not exclude additional, non-recited members, elements, or method steps.

[0035] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.

[0036] The term “about” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, is meant to encompass variations of and from the specified value, in particular variations of + / -10% or less, preferably + / -5% or less, more preferably + / -1 % or less, and still more preferably + / -0.1 % or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier “about” refers is itself also specifically, and preferably, disclosed.

[0037] Whereas the term “one or more”, such as one or more members of a group of members, is clear per se, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any >3, >4, >5, >6 or >7 etc. of said members, and up to all said members.

[0038] Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention, and form different embodiments, as would be understood by those in the art. For example, in the following claims, any of the claimed embodiments can be used in any combination.

[0039] All documents cited in the present specification are hereby incorporated by reference in their entirety. Unless otherwise specified, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions may be included to better appreciate the teaching of the present invention.

[0040] The present invention provides extracts of Apiaceae plants of one or more members of the family Apiaceae. The inventors have found that extracts, such as aqueous and organic solvent extracts, including fractions thereof, prepared from said Apiaceae plants are effective as a biopesticide. Further, the present invention provides a method of preparing said extracts and uses thereof. It has been found that extracts according to the invention provide for increased resistance to certain plant pathogens, in particular nematodes and fungi.

[0041] An “extract” as used herein is a substance that is obtained by separating desired components from a raw material using a solvent such as an aqueous solvent or an organic solvent. In the present instance, the raw material are Apiaceae plants, or parts thereof. The resulting extract contains a concentrated form of the desired components. The solvent used in the extraction process of the present invention is preferably hydrophilic by nature. Accordingly, the invention does not include the use of essential oil extracts, which are typically hydrophobic by nature.

[0042] In a specific embodiment, the extract is obtained using a hydrophilic solvent, such as an aqueous solvent or an organic solvent.

[0043] A hydrophilic solvent is a type of solvent that has a strong affinity for water and is capable of dissolving hydrophilic (water-loving) compounds. Hydrophilic solvents are typically polar in nature and contain functional groups such as hydroxyl (-OH), carbonyl (>C=O), or amine (-NH2) groups that can interact with water molecules through hydrogen bonding or other electrostatic interactions. Examples of hydrophilic or polar solvents include alcohols such as methanol, ethanol and isopropanol or ketones such as acetone. Alternative hydrophilic or polar solvents include amongst others acetonitrile, N,N-Dimethylformamide (DMF), dimethylsulfoxide (DMSO), and dichloromethane.

[0044] Of particular interest is that these extracts activate and enhance plant immunity when applied (preventively) on the plant in contrast to other alternatives which act directly against pathogens and other non-targeted organisms, causing adverse impact on biodiversity.

[0045] In particular, and as shown in the present invention, extracts of fennel, celery, carrot, parsley, etc., or parts thereof, have strong plant defense-inducing capacity, leading to 30-70% reduction in root-galling by parasitic root-knot nematodes in e.g. rice and tomato, cyst nematodes in e.g. sugar beet, and significantly fewer lesions caused by fungus Pyricularia oryzae in rice. The observed disease reduction provided by these Apiaceae extracts is comparable to commercially available defense activating products which result in approximately 50% disease control. The application spectrum of these products however is limited and these suppress only specific pathogens or diseases. To the best of our knowledge, the only commercial plant based bionematicide currently available on the European market is a nematicide based on garlic extract which acts directly against nematodes via soil application. Unfortunately, nematicides with direct effect, affect free living beneficial nematodes as well. In contrast, the extracts of the invention will be preferably applied on the shoot of the plant thereby avoiding adverse impact on nontarget organisms in the soil. In addition, since the plant immune system is activated, it was demonstrated that the plant is protected against fungi and oomycetes as well.

[0046] Apiaceae, also called Umbelliferae, the parsley family, in the order Apiales, include about 434 genera and nearly 3,780 species of plants distributed throughout a wide variety of habitats, principally in the north temperate regions of the world. Plants of the genera of particular interest in the context of the present invention are: Foeniculum, Daucus, Pastinaca, Petroselinum, Levisticum and Apium.

[0047] A number of species are economically important as leaf and root vegetables, herbs and spices, and garden ornamentals. Species widely used as vegetables, and of particular interest for preparing extracts and for use in the methods of the present invention, include carrot (Daucus carota), celery (Apium graveolens), parsnip (Pastinaca sativa), lovage (Levisticum officinale), celeriac (Apium graveolens var. rapaceum) and fennel (Foeniculum vulgare). Species used as herbs and spices include parsley (Petroselinum crispum), anise (Pimpinella anisum), angelica (Angelica archangelica), dill (Anethum graveolens), coriander (Coriandrum sativum), caraway (Carum carvi), and cumin (Cuminum cyminum). Several species have long been used as herbal and folk remedies e.g., gum ammoniac (Dorema ammoniacum), smallage (Apium graveolens), and goutweed (Aegopodium podagraria). In one embodiment, the extracts of the invention are produced from these Apiaceae plant species, including whole Apiaceae plants, parts and byproducts thereof. By-products (sometimes also referred to as waste or food waste) are the secondary products that are not consumed or often discarded or wasted after harvest, during manufacturing or other stages of food processing.

[0048] In one embodiment, the extract is from carrot (Daucus carota), in particular the leaves or peeling thereof.

[0049] In another embodiment, the extract is from celery (Apium graveolens), in particular the stem, stick, leaves or peeling thereof.

[0050] In another embodiment, the extract is from celeriac (Apium graveolens var. rapaceum), in particular the peeling thereof.

[0051] In another embodiment, the extract is from fennel (Foeniculum vulgare), in particular the bulbs or leaves thereof. In another embodiment, the extract is from parsnip (Pastinaca sativa), in particular the peeling thereof.

[0052] In another embodiment, the extract is from parsley (Petroselinum crispum), in particular the leaves thereof.

[0053] In accordance with the present invention, the term extract of an Apiaceae plant of the family Apiaceae, refers to an extract obtained from the whole Apiaceae plant or part thereof. Plant extraction is a process that aims to separate certain components present in plants. It is a solid / liquid separation operation wherein the Apiaceae plant or a part(s) thereof is placed in contact with a fluid or a gas (water vapour or supercritical fluids), referred to as the buffer or solvent. The plant components of interest are then solubilized and contained within the buffer. The solution thus obtained is the “Apiaceae plant extract”. As used herein, “Apiaceae plants or parts” refers to the whole plant or elements thereof such as leaves, stems, sticks, bulbs, fruits, peels, flowers, branches, stalks, seeds, roots. More specific, the Apiaceae plants are germinated plants having a shoot and / or root system (including roots, tubers, and / or rhizoids). For example and with regard to celery, the sticks, peels and leaves are preferred. With regard to parsley, the leaves are preferred. With regard to fennel, the bulbs and / or leaves are preferred. With regard to carrots, the peels and leaves are preferred. With regard to parsnip, the peels are preferred. With regard to celeriac, the peels are preferred.

[0054] In one embodiment, the invention provides a method for the preparation of an extract of Apiaceae plants of the family Apiaceae, comprising the steps of: a) providing Apiaceae plants or parts of the family Apiaceae, including the genera and species as mentioned herein; b) blending or mixing the plants or parts of step a) with a buffer, e.g. an aqueous solution or an organic solvent; c) separating the blend or mixture of step b) into a solid phase and a liquid phase; and d) obtaining the liquid phase of step c) as an (aqueous) extract, f) optionally, adding to the blend or mixture a surfactant or an agriculturally and horticulturally acceptable carrier.

[0055] In one embodiment, the blend or mixture of step b) is heated. Step c) can be performed before, during or after cooling the blend or mixture below 50°C, in particular below 30°C.

[0056] At step a), the Apiaceae plants or parts can be provided in various forms, such as after cutting, slicing, chopping, grinding, milling or crunching, and / or in the form of pieces, pellets, granules, powder or larger conglomerates, wherein powder form is preferred. In the context of the present invention, the term “powder” is meant to be fine, dry particles produced by the grinding, crushing or disintegration of a solid substance. In a particular embodiment, the obtained Apiaceae plants or parts are dry or dried in a particular step of the method. Particularly interesting results are obtained when the Apiaceae plants or parts are dried prior to the mixing with the buffer. Specifically, it was found that a drying step prior to the separation step allows for increased preservation, prevents spoiling and facilitates storage and further processing (e.g. grinding) of the dried Apiaceae plants or parts. While these provide significant advantages for the processing of the plants, there was also a significant risk that the obtained extracts would be of low quality. Drying of plants is a harsh treatment upon which the active compounds could loose activity due to degradation or evaporation. Therefore, it was highly unexpected that the obtained extracts, despite the additional drying step, showed very good activity in the context of the invention.

[0057] Accordingly, in a particular embodiment, the present invention provides a method for the preparation of an extract of Apiaceae plants of the family Apiaceae, comprising the steps of: a) providing Apiaceae plants or parts of the family Apiaceae (including the genera and species as provided herein); b) cutting the plants or parts of step a) in smaller parts or pieces; c) drying the pieces of step b); d) optionally grinding the pieces of step c); e) mixing the dried or grinded pieces of step c) or d) with a buffer, e.g. an aqueous solution or an organic solvent, optionally while heating said mixture; f) separating the mixture of step e) into a solid phase and a liquid phase; and g) obtaining the liquid phase of step f) as an (aqueous) extract.

[0058] In a particular embodiment, the Apiaceae plants or parts are washed, cut into slices or pieces, dried (e.g. in an oven) and milled to obtain a powder. The drying temperature is between 20°C and 100°C, in particular between 30°C and 90°C, more in particular between 40°C and 80°C. The drying period will be dependent on the starting plant material and is to be determined by the skilled person. In general the drying period is for at least 10 minutes, in particular for at least 30 minutes or for at least 1 hour, more in particular for at least 2 hours, even more in particular for at least 3 hours. Typically, the drying period is between 10 minutes and 5 or up to 72 hours.

[0059] More specific, the drying temperature and duration is chosen so as to obtain dried Apiaceae plants or parts (in any form) having a moisture content below 40%, in particular below 30%, more in particular below 20%, even more in particular below 10%, such as below 9%, below 8%, below 7%, below 6%, below 5%, below 4%, below 3%, below 2% or below 1 %.

[0060] The (dried) Apiaceae plants or parts, in particular the pieces or powder, are subsequently mixed with a buffer such as an aqueous solution, which can be water, such as distilled water. The aqueous solution can be a saline solution, or a solution with other salts dissolved therein. The aqueous solution is preferably water. The ratio solid :buffer of the obtained mixture can be variable. For example, in accordance with an embodiment of the present invention, the ratio of solid (kg):buffer (e.g. aqueous solution) (L) is in the range of from 0.01 :5 to 5:5, in particular from 0.02:5 to 3:5, more in particular about 0.03:5.

[0061] In another embodiment, the (dried) Apiaceae plants or parts, in particular the pieces or powder, are subsequently mixed with an organic solvent, such as hexane or toluene, in particular a polar solvent, such as ethanol, methanol, ethyl acetate, acetone, acetonitrile, N,N-Dimethylformamide (DMF), dimethylsulfoxide (DMSO), dichloromethane, and isopropanol.

[0062] In accordance with a further embodiment of the present invention, the mixing of the Apiaceae plants or parts, in particular the pieces or powder, with the buffer, in particular the aqueous solution, is performed while heating the mixture comprising the buffer and the Apiaceae plants or parts. Heating has the advantage that the extraction is accelerated. The buffer penetrates faster into the plant tissue, allowing the solubility of most compounds to be higher, further, it has the advantage of killing microbes which helps to protect the obtained extract from degradation and prevents the spread of hazardous pathogens upon treating the plants.

[0063] In accordance with a further embodiment of the present invention, the step of heating the mixture obtained by mixing the Apiaceae plants or parts and a buffer or solvent, such as an aqueous solution, is performed at a temperature in a range from about 30°C to about 120°C, preferably from 50°C to 100°C, preferably from 60°C to 90°C, more preferably at a temperature of about 80°C and / or for a sustained period of time, in a range from about 5 minutes (min) to about 180 min, preferably from 10 min to 150 min, preferably from 50 min to 130 min, more preferably about 120 min.

[0064] In accordance with a specific embodiment, the step of heating the mixture obtained by mixing the Apiaceae plants or parts and an aqueous solution is performed at a temperature of about 80°C and for a period of time of about 120 min. A person skilled in the art is able to determine the required time and temperature in order to obtain the most suitable extract from the specified plant and for the intended application. Moreover, similar bioactivity can be obtained by extracting a bit longer at lower temperature, or a bit shorter at higher temperature.

[0065] Several different techniques can be used to separate the solid phase from the liquid phase. In a further embodiment and in order to provide for a solid phase, the mixture as provided herein is filtered, sieved (e.g. by using a filter means with mesh size ranging from 50pm, 100pm, 200pm, 300pm, 400pm or 500pm to 1 mm, 1 ,5mm or 2mm; in particular between 500pm and 1 ,5mm) or centrifuged. After extraction, the buffer can optionally be eliminated to isolate the obtained Apiaceae plant extract and possibly to obtain a dry extract (e.g. freeze-drying). In particular, the extract of the invention is a crude extract. Moreover, whereas the obtained extracts of the present invention may be used as such, they may also be further processed, such as evaporated, concentrated, dried, freeze-dried, centrifuged, etc. prior to use. Optionally a further excipient or diluent can be added.

[0066] In particular, the aqueous extract, either or not further concentrated, may be divided in different aliquots, all of which may further be treated differently. In some of these aliquots, the pH may be varied by using appropriate acids or bases such as HCI or KOH.

[0067] Furthermore, these aliquots may be subjected to a liquid-liquid fractionation procedure using organic solvents such as ethyl acetate or toluene. Either of which may be applied to the low or high pH aliquots. Any suitable ratio of water:solvent may be used such as about 1 :1 , 1 :2, 1 :3, 1 :4 or 1 :5. After mixing, the aliquots are separated into an organic and aqueous phase (optionally by centrifugation). The organic and / or aqueous phase may further be subjected to an evaporation step and / or freeze-drying step before further use; or they may directly be used as a biopesticide.

[0068] In a second aspect, the present invention relates to the extract obtainable by or obtained by applying the method described by any one of the embodiments of the present invention.

[0069] The present invention also encompasses (the use of) a composition or formulation comprising the extract of the invention. A “composition” or “agrochemical composition” as used herein means a composition for agrochemical use, such as use in the agrochemical industry, including agriculture, horticulture, floriculture, arboriculture and home and garden uses for stimulating plant / root growth and / or for protecting plants or parts of plants, crops, bulbs, tubers, fruits (e.g. from harmful organisms, diseases or pests) as herein defined, comprising at least the extract as defined herein, and at least one excipient, preferably an agriculturally and / or horticulturally acceptable excipient. Typically, the extract of the invention may be administered to a plant in a suitable agriculturally acceptable formulation, including but not limited to, a growing medium such as soil or hydroponic liquid medium, dusts, granules, solution concentrates, emulsifiable concentrates and wettable powders. The term “agriculturally acceptable” indicates that the formulation is non-toxic for the plant and otherwise acceptable for application to a plant, whether applied indoors (e.g. in a contained environment) or outdoors (e.g. in a non-contained environment that is exposed to other plant, animal and human life).

[0070] In a third aspect, the present invention relates to the use of the extract of the invention (and hence also the composition comprising it), in particular obtainable or obtained by the method described herein, as a biopesticide, in particular in agriculture, horticulture, arboriculture and / or home gardening. By means of the term “biopesticide”, reference is made to a pest or pathogen management / control agent derived from natural sources. The term ‘pest’ is used for creatures that damage crops, livestock, and forestry. Agricultural and horticultural crops are attacked by a wide variety of pests, the most important being insects, mites, nematodes and gastropod molluscs. Microorganisms, whether bacteria, fungi, oomycetes or protists, and viruses are generally thought of as causes of disease (pathogens) rather than as pests.

[0071] In one embodiment, the extract of the present invention (and hence also the composition comprising it) is used in a method of inducing (systemic) resistance to biotic stress, e.g. induced by a pest or pathogen, in a plant. The method comprises applying the extract to the plant, after which systemic plant immunity will be activated. The applying step can be performed according to various embodiments. For instance, the Apiaceae plant extract or composition could be sprayed on the plant, watered on the plant, added to the substrate, such as hydroponics, soil, peat, compost, vermiculite, perlite, sand or clay, in which the plant is growing, etc. In a particular embodiment there is no direct contact of the extract with the pathogen or target organism. Hence, the current invention provides a method for controlling infection, i.e. for treating or preventing, or at least inhibiting or alleviating, pathogen or pest damage in a plant, in particular through the activation of the plant defense mechanism. The Apiaceae plant extract is able to achieve this protecting effect in the whole plant even when sprayed only on a part of the plant, or when sprayed at relatively low concentrations. Of particular advantage is that the present Apiaceae plant extract can be used pre-emptively (e.g. to seedlings or non-infected plants or plants having no visible signs of infection or damage) and require only a simple formulation. This use as a priming agent will delay, or even prevent the damage to the plant when infected. Hence, by stimulating the immune system of the plant, the health of the plant is improved as compared to non-treated and infected plants. Remarkably and as shown in the examples, said effect is obtained without any direct (physical) contact of the agent with the pathogenic or damaging organism. For example, it was demonstrated in the present invention that application of the extract to the leaves of a plant induced defense in the plant against pathogens (such as nematodes) residing in the roots. In addition, it was demonstrated that treating the roots with the extract induces systemic resistance against foliar pathogens (such as fungi). Accordingly, the present invention provides a method and use of the extracts for priming a plant against plant pests and pathogens, in particular parasitic nematodes, phytopathogenic fungi and oomycetes, by application on or to said plant an extract of an Apiaceae plant or part of the family Apiaceae.

[0072] In one embodiment, the present invention relates to extracts, methods and compositions which can be used to stimulate or induce plant defense and / or immune responses against plant pathogens or pests such as nematodes, oomycetes and fungi. The invention provides a method for controlling plant pathogens or pests, said method comprising applying on or to said plant the extract provided herein.

[0073] In particular, the invention provides the use of an extract of an Apiaceae plant or part thereof of the family Apiaceae, for controlling plant parasitic nematodes. In said embodiment, the pathogen is a parasitic nematode such as e.g. a root-knot nematode, a root-lesion nematode or / and a cyst nematode, even more in particular a nematode belonging to the genus selected from the group consisting of Meloidogyne, Heterodera, Globodera, Pratylenchus, Paratylenchus, Aphelenchoides, Xiphinema, Radopholus, Bursaphelenchus, Rotylenchulus, Nacobbus, Longidorus, Ditylenchus and Trichodorus, especially the genera Meloidogyne and Heterodera.

[0074] The term “controlling plant parasitic nematodes” refers to reducing the overall negative effect of plant parasitic nematodes on plants such that the plants experience a decreased amount of negative effects by said nematodes as compared to plants not treated with the extract. For example, typical root symptoms indicating nematode attack are root knots or galls, root lesions, excessive root branching, injured root tips and stunted root systems. Symptoms on the aboveground plant parts indicating root infection are a slow decline of the entire plant, wilting even with ample soil moisture, foliage yellowing and fewer and smaller leaves. These are, in fact, the symptoms that would appear in plants deprived of a properly functioning root system. Bulb and stem nematodes produce stem swellings and shortened internodes. Bud and leaf nematodes distort and kill bud and leaf tissue. In some cases, yield loss may take place with no visible symptoms. By applying the extract, the overall negative effect by plant parasitic nematodes may be reduced, such as by reducing the overall number or density of plant parasitic nematodes (i.e. , decrease in nematode population) on the plant or in the soil or by reducing the severity or extent of negative effects of the plant parasitic nematodes (i.e., nematode population remains unchanged but exhibit fewer detrimental effects such as e.g. cyst or gall formation, number of lesions, growth reduction, yield losses, etc.).

[0075] As used herein, the term “nematode” refers to multicellular animals in the phylum Nematoda. “Plant parasitic nematode” refers to nematode parasites of plants which can be found in / on plant roots, seeds, flowers, leaves, stems, or the soil in which the plant is growing. Plant parasites are classified on the basis of their feeding habits into the broad categories migratory ectoparasites, migratory endoparasites, and sedentary endoparasites. Sedentary endoparasites, which include the root knot nematodes (Meloidogyne spp.) and cyst nematodes (Globodera and Heterodera) induce feeding sites (“giant cells” in the case of root knot nematodes and “syncytia” for cyst nematodes) and establish long-term infections within roots. These nematodes cause significant economic loss in plants, especially crop plants. Examples of cyst nematodes include, H. schachtii (sugar beet cyst nematode), H. avenae (cereal cyst nematodes), H. glycines (soybean cyst nematode), H. sacchari (sugarcane cyst nematode), H. carotae (carrot cyst nematode), G. pallida (white potato cyst nematode) and G. rostochiensis (yellow potato cyst nematode). Rootknot nematodes include, for example, M. graminicola, M. javanica, M. incognita, M. arenaria, M. chitwoodi, M. artiellia, M. fallax, M. hapla, M. microtyla, M. partityla, M. panyuensis, M. naasi, M. exigua, M. enterolobii and M. paranaensis. These pathogens establish “feeding sites” in the plant, by causing the morphological transformation of plant cells into giant cells, which block the flow of nutrients and photosynthesis products. Hence, nematode “infection” refers to invasion of and feeding upon the tissues of the host plant. Other nematodes that cause significant damage include the “root-lesion” nematodes such as Pratylenchus, particularly P. penetrans, which infects maize, rice and vegetables, P. brachyuruswhich infects pineapple, P. zeae, which infects cereals, sugarcane and coffee, P. coffeae, which infects coffee and banana, and P. thornei, which infects wheat.

[0076] In one embodiment, the invention provides the use of the plant extract described herein for preventing or suppressing plant disease, in particular for increasing the resistance of a plant against root-knot nematodes or cyst-nematodes, in particular against a nematode species selected from the group consisting of: Heterodera glycines, Heterodera schachtii, Globodera rostochiensis, Meloidogyne incognita, Meloidogyne graminicola, Globodera pallida, Heterodera avenae, Heterodera sacchari, Heterodera zeae, Heterodera carotae, Pratylenchus penetrans, Pratylenchus coffeae, Pratylenchus neglectus, Pratylenchus zeae, Pratylenchus loosi, Meloidogyne javanica, Meloidogyne arenaria, Meloidogyne hapla, Meloidogyne fallax, Meloidogyne chitwoodi. Meloidogyne exigua, Aphelenchoides besseyi, Aphelenchoides fragariae, Xiphinema index, Radopholus similis, Bursaphelenchus xylophilus, Rotylenchulus reniformis, Nacobbus abberans, Longidorus elongatus, Ditylenchus destructor, Ditylenchus dipsaci, Ditylenchus angustus and Tricochodorus minor.

[0077] Furthermore, the invention provides a method to reduce and / or prevent infection of a plant with a nematode from the genus Meloidogyne and / or Heterodera, said method comprising applying an extract of an Apiaceae plant or part thereof of the family Apiaceae (including a composition comprising the extract) to or on the plant by any one of the methods as described herein. In one embodiment, the nematode is Heterodera schachtii, Meloidogyne incognita, or Meloidogyne graminicola. In particular, the extract is an aqueous extract as provided herein, more specific an aqueous extract of a plant or part of Daucus carota, Apium graveolens, Pastinaca sativa, Levisticum officinale, Foeniculum vulgare, Petroselinum crispum Apium graveolens var. rapaceum Pimpinella anisum, Angelica archangelica, Anethum graveolens, Coriandrum sativum, Carum carvi, or Cuminum cyminum. In a further embodiment, the extract is applied on the shoot of the plant, more particular the leaves of the plant, even more particular the leaves of the plant of the genus Oryza, Solanaceae or Amaranthaceae.

[0078] In another embodiment, the invention provides the use of an extract of an Apiaceae plant or part thereof of the family Apiaceae (including a composition comprising the extract), for controlling phytopathogenic fungi. These include biotrophic, hemi-biotrophic, necrotrophic fungi, and more specific the genera Pyricularia, Botrytis, Puccinia, Fusarium, Blumeria, Mycosphaerella, Colletotrichum, Ustilago, Phakopsora, Alternaria, Sclerotinia, Cladosporium and Rhizoctonia. In one embodiment, the invention provides a method to reduce and / or prevent infection of a plant with a phytopathogen of the genus Pyricularia, including the species Pyricularia oryzae (sexual morph Magnaporthe oryzae), the causal agent of the rice blast disease. In a further embodiment, the invention provides a method to reduce and / or prevent infection of a plant with a phytopathogen of the genus Botrytis, including the species Botritis cinerea, the causal agent of the grey mold disease.

[0079] Furthermore, the invention provides a method to reduce and / or prevent infection of a plant with a fungus from the genus Pyricularia, said method comprising applying an extract of an Apiaceae plant or part thereof of the family Apiaceae (including a composition comprising the extract) to or on the plant by any one of the methods as described herein. In one embodiment, the fungus is Pyricularia oryzae. In particular, the extract is an aqueous extract as provided herein, more specific an aqueous extract of a plant or part of Daucus carota, Apium graveolens, Pastinaca saliva, Levisticum officinale, Foeniculum vulgare, Petroselinum crispum, Pimpinella anisum, Angelica archangelica, Anethum graveolens, Coriandrum sativum, Carum carvi, or Cuminum cyminum, in particular Daucus carota, Apium graveolens, Apium graveolens van rapaceum, Pastinaca saliva, Levisticum officinale, Foeniculum vulgare, or Petroselinum crispum. In a further embodiment, the extract is applied on the shoot of the plant, more particular the leaves of the plant, even more particular the leaves of the plant of the genus Oryza. In the alternative, the extract is applied to the roots of the plant of the genus Oryza, e.g. as a soil drench.

[0080] In another embodiment, the invention provides the use of an extract of an Apiaceae plant or part thereof of the family Apiaceae (including a composition comprising the extract), for controlling phytopathogenic oomycetes. Examples of phytopathogenic oomycetes (formerly classified as fungi) are species of the genera Pythium, Phytophtora and Peronosporaceae (e.g. Hyaloperonospora), in particular Phytophtora and Hyaloperonospora, e.g. Hyaloperonospora arabidopsidis.

[0081] Any plant / crop can be treated. The term "plant (or plants)" is a synonym of the term "crop" which is to be understood as a plant of economic importance and / or a men-grown plant. While the term “plant” or “plants” is used in the context of both the plant to be treated with the extracts of the invention, as well as the plant from which the extracts are obtained, the latter is clearly annotated herein as “Apiaceae plant”, or plant of the “Apiaceae family”. Or alternatively, the general context will provide clarification. In general the term “plant” or “plants” when used as such is meant to be the plant to be treated.

[0082] The methods, extracts and compositions of the present invention may be applied to any plant, such as monocots, dicots, non-vascular (liverworts, mosses), ferns, gymnosperms, etc. In one embodiment the plant belongs to the Solanaceae (nightshade) family, in particular to the genus Solanum. In a further embodiment, the treated plant is tomato (Solanum lycopersicum), potato (Solatium tuberosum) or eggplant (Solatium melongena). In another embodiment, the treated plant belongs to the amaranth family (Amaranthaceae) , such as is sugar beet (Beta vulgaris). In another embodiment, the treated plant is a grass (family Poaceae), in particular species from the genus Triticum or Zea, more in particular wheat or maize. In a further embodiment, the plant to be treated belongs to the genus Oryza, in particular the grass species Oryza sativa (Asian rice) or less commonly O. glaberrima (African rice).

[0083] The extract or a composition comprising the extract is applied to a plant or tree, directly or indirectly. All or part of a plant including, without limitation, leaves, stems, roots, propagules (e.g., cuttings), fruit, seeds etc., may be contacted with the extract described herein. In a specific embodiment, the extract or composition is applied to the shoot of a plant. As used herein ‘shoot’ refers to part of the plant above the ground. It bears the leaves, flowering buds, lateral buds and flowering stems. It is responsible for food production or photosynthesis in the plant. In the alternative, the extract or composition can be applied to the soil surrounding the plant, preferably without direct contact with the roots. The applying of the extract is prior to planting, at planting, or after planting. In one embodiment, contacting includes direct application such as to a plant. In another embodiment, contacting is via indirect application, e.g., to soil or other plant substrates but making uptake by the plant possible.

[0084] Suitable application methods include high or low-pressure spraying, immersion, atomizing, foaming, fogging, coating, and encrusting. Other suitable application procedures can be envisioned by those skilled in the art. In a particular embodiment, the extract of the invention is applied to the parts of the plant above ground (such as the shoots) or to the foliage of the plant by spraying e.g. by the use of mechanical sprayers. Sprayers convert a formulation of the invention which is mixed with a liquid carrier, such as water or fertilizer, into droplets. The droplets can be any size. Boom sprayers and air blast sprayers can also be used to apply formulations of the invention to pre-emerging or post-emerging crops. Air blast sprayers inject formulations of the invention mixed with a liquid carrier into a fast-moving air stream. Boom sprayers, aerial sprayers, ultra-low volume sprayers, drip irrigation, sprinkler irrigation, and foggers can also be used to apply compositions of the invention. Where the compositions of the invention are in a solid, powder or granule form, they can be applied with granule or dust application equipment. Compositions of the invention can also be applied as a fumigant to soil, plant media, plants, or plant tissues. In another embodiment, seeds of a plant are coated with the extract of the invention (“coated seeds”). Any appropriate seed coating method known to the skilled person can be used.

[0085] In a specific embodiment, the extract of the present invention can be applied to a plant as provided herein alone, in combination or in a mixture with other compounds. Suitable other compounds include effective amounts of other agricultural or horticultural biologicals and / or chemicals, such as herbicides, insecticides, nematicides, molluscicides, bactericides, acaricides, fungicides, and / or plant growth regulators or fertilizers. In one embodiment, the extract or composition further comprises a surfactant, e.g. a surfactant selected from the group consisting of polyoxyethylene (20 or 80) sorbitan monolaurate (e.g. Tween 20 or 80), ethoxylated fatty amines, alkylphenol ethoxylate-based surfactants, alcohol ethoxylate-based surfactants, ethoxylated isodecyl alcohol-based surfactants (e.g. Trend 90), silicone-based surfactants or vegetable oils. Surfactants overcome surface tension and there are several variations of surfactants available, and the suitable surfactant can be readily selected by the person skilled in the art.

[0086] The following examples are set forth below to illustrate the methods, compositions, and results according to the disclosed subject matter. These examples are not intended to exclude equivalents and variations of the present invention, which are apparent to one skilled in the art.

[0087] EXAMPLES

[0088] MATERIAL AND METHODS

[0089] 1 . Plants

[0090] Rice (Oryza sativa)

[0091] All infection experiments with Meloidogyne graminicola, the RNA-sequencing experiment and the phytohormone measurements were performed in Oryza sativa subp. japonica cultivar Kitaake. Seeds were germinated on wet tissue paper at 30°C for 4-5 days in the dark, followed by transfer to individual PVC tubes containing a 3:1 volume ratio of sand and sieved potting soil. The tubes were placed in plastic boxes and transferred to a growth chamber at 28°C with 12 hours of light. The first two days after transfer, the tubes were covered with polyethylene film (Saran Film, Dow Chemicals, Midland USA) to prevent excessive evaporation. Seedlings were watered three times per week with 10 mL of Hoagland solution (Hoagland and Arnon 1938).

[0092] The infection experiment with Pyricularia oryzae was performed in the indica rice accession CO39. Seeds were germinated on sterile filter paper for 5-6 days before transplant to white plastic trays containing moisturized potting soil. Each tray contained 9 seedlings. The trays were transferred to a growth chamber at 28°C with 12 hours of light. The first two days after transfer, the tubes were covered with polyethylene film to prevent excessive evaporation. Seedlings were watered two times a week and given 250 mL nutrient solution containing 1 g / L [(NH4)2SO4 and 2 g / L Fe(SO4)2 . 7 H2O] once a week.

[0093] Tomato (Solarium lycopersicum)

[0094] Tomato seeds, cv. Moneymaker (Vreeken’s Zaden, Dordrecht, the Netherlands) were sown on moisturized potting soil, covered with polyethylene film, and placed at 24°C for eight days. Seedlings were then transferred to small pots containing a 3:1 volume ratio sand and sieved potting soil and were placed in a growth chamber at 24°C with 16 hours of light. Plants were watered two times a week and given fertilizer (Soluplant NPK 19-8-16 + 4MgO + ME, Haifa Chemicals, 1 g / L) once a week.

[0095] Sugar beet (Beta vulgaris)

[0096] Sugar beet cv. Amarok seeds were germinated in moist potting soil for 4-5 days at 25°C after which they were transplanted to PVC tubes containing sieved potting soil. The tubes were placed in plastic boxes and transferred to a growth chamber at 25°C with 16 hours of light. The plants were fertilized by supplying Hoagland solution (Hoagland, 1938) as a source of nutrients three times a week.

[0097] Arabidopsis (Arabidopsis thaliana)

[0098] Arabidopsis thaliana Col-0 plants were grown in untreated and unsterilized soil (“DCM potgrond voor Zaaien and Stekken”, DCM, Sint-Katelijne-Waver, Belgium) in a growth chamber with 21 °C daytime temperature, 18°C night-time temperature, 75% humidity and a 12-h day-light cycle with a light intensity of approximately 120 pmol / m2 s.

[0099] 2. Preparation of the extracts and application

[0100] Fennel water extract (FWE), celery water extract (CyWE) and parsley water extract (PIWE): FWE, CyWE and PIWE were prepared from second choice fennel bulbs, second choice celery and parsley at ILVO Food Pilot (Melle). Therefore, the fennel bulbs including a small part of the green leaves, celery sticks including a small part of the green leaves and parsley were chopped into small pieces and dried in an oven at 60°C. The dried pieces were grinded to a fine powder using a vacuum cooking cutter (Seydelmann, Stuttgart, Germany) and subsequently continuously mixed with water for two hours at 80°C and 100 mbar in a Stephan® incubator (ProXES GmbH, Hameln, Germany). For parsley and celery, 39 grams of dried material was mixed per liter water. For fennel, 61 grams of dried material was mixed per liter water. Solids were separated from liquids by sieving and subsequent centrifugation. The dry weight of the FWE was adjusted for the 2021 batch to 46.5 mg / mL, which equals the dry weight of the original batch (year 2020), by upconcentration in a rotavapor machine at 50°C and 100 mbar (Heidolph Instruments GmbH & Co. KG, Schwabach, Germany). All extracts were stored at -20°C until further use.

[0101] Fennel ethanol extract (FEE) was prepared by using the solid phase obtained after sieving during the water extraction of FWE. Therefore, the material underwent two times liquid-liquid extraction with ethanol at 60°C for 1 h. The mixture was then filtered through a Buchner filter after which the flowthrough was dried using a rotavapor to acquire a dried extract. Prior to application on the plants, the dried extract was dissolved in 1 % DMSO (1 g / L). All other Apiaceae extracts were prepared in the laboratory of Epigenetics and defense (Department of Biotechnology, Ghent University). Therefore carrot peeling, carrot leaves, celeriac peeling and parsnip peeling were cut into small pieces and dried in an oven at 60°C. The dried material was grinded to a fine powder using a blender and 61 gram of dried material was mixed per liter water for 2 hours at 80°C and under atmospheric pressure. Solids were removed from the extract by centrifugation. All extracts were stored at -20°C until further use. Fractionation of the FWE was executed under acid conditions (pH=3) by liquid-liquid extraction with toluene. This resulted in an aqueous (FWE-Fr-H2O) and solvent phase, of which the aqueous phase was retained and used for bioassays.

[0102] For all experiments in which the extracts were foliarly sprayed on the plants, except for the infection experiments in Arabidopsis, 0.02v / v% Tween20 was added as a surfactant.

[0103] For the infection experiments in rice with M. graminicola, as well as for hormone measurements and RNA sequencing, fourteen-day old plants were treated with the extracts (7 mL / plant).

[0104] For the infection experiments in tomato and sugar beet with M. incognita and H. schachtii respectively, three-week old plants were treated with the extracts and for the infection experiments in rice with P. oryzae, 4-week old plants were treated.

[0105] 3. Nematode cultures

[0106] Meloidogyne graminicola

[0107] A pure culture of M. graminicola was maintained on barnyard grass (Echinochloa crus-galli) grown in potting soil at 25°C. Roots were washed to remove excessive soil, after which they were cut into fine fragments (with special taken care to cut through visible galls). The material was put on a 200 pm pore diameter sieve which was put into tap water at room temperature for 5 days. The water was then poured over a 20 pm mesh after which the sieve was washed with approximately 50 mL tap water to collect the nematodes.

[0108] Five 10 pL samples of nematode suspension were taken and the number of nematodes was counted under a stereo microscope to determine and adjust the inoculum concentration.

[0109] Meloidogyne incognita

[0110] M. incognita was extracted from infected tomato plants (cv. Moneymaker) roots grown in potting soil at 24°C. For nematode collection, roots were cleaned while taking care not to remove egg masses. Nematodes were collected, counted and inoculated using the same procedure as described for M. graminicola above.

[0111] Heterodera schachtii

[0112] Heterodera schachtii was cultured on sugar beet (cv. Amarok) plants. Cysts were obtained from stock cultures, by washing the infected soil, letting the cysts float in water and subsequent handpicking with a small paint brush. Full cysts with eggs were selected and allowed to dry before setting up for hatching. For second-stage juveniles (J2) to hatch, cysts were placed in 3 mM of ZnCI3 and transferred to an incubator / shaker at a temperature of 25.5°C at 70 rpm for 4 days. J2 were resuspended in water and counted under a stereomicroscope.

[0113] 4. Infection experiments

[0114] Infection experiments with M. graminicola were performed by inoculating rice plants 14 days after seed germination with 250 J2 juveniles to the root system. Plants were harvested 14 days after inoculation. At the harvesting time point, the plants were phenotyped by measuring the shoot and root length with a ruler. Root systems were then stained in acid fuchsin as described in (Bybd et al., 1983) and left to destain in glycerol containing 1 mL / L fuming HCI. The number of galls and nematodes was then counted using a binocular microscope.

[0115] Infection experiments with M. incognitawere performed by inoculating the tomato plants 21 days after seed germination with 250 J2 juveniles to the root system. Plants were harvested 28 days after inoculation and phenotyped by measuring root and shoot dry weight. Root systems were stained and the number of galls were counted as described above.

[0116] Infection experiments with H. schachtiiwere performed by inoculating sugar beet plants 21 days after seed germination with 300 J2 juveniles to the root system. Plants were harvested 7 weeks after inoculation and phenotyped by measuring shoot length and counting the number of leaves per plant. Cysts were obtained as described above and the number of cysts was counted per plant.

[0117] Infection experiments with Pyricularia oryzae were performed by inoculating rice plants 4 weeks after seed germination. Therefore, spores of 5-days old P. oryzae VT5M1 were suspended in 0.5% (w / v) gelatin to final concentration 5 x 104 spores / ml. Rice plants were evenly sprayed with 1 ml of spore suspension using a compressor-powered airbrush gun (Badger Airbrush model 150TM). Inoculated rice plants were kept for 22 h in a dark chamber (relative humidity > 90%; 25 ± 5°C), and further transferred to the greenhouse for disease development. Disease was scored 5 and 6 days after inoculation by counting the number of sporulating lesions (ellipsoid to round-shaped lesion with a gray center indicative of sporulation) on the second fully developed leaf.

[0118] Infection experiments with Hyaloperonospora arabidopsidis (Noksl ) were performed by inoculating Arabidopsis plants 9 days after sowing (i.e. one day after treatment with the extracts) in sterilized potting soil. Therefore, a spore suspension with a final concentration of 8.4*10A4 spores / mL were sprayed until run-off. Disease was scored by qPCR. Therefore, the oomycete DNA was quantified relative to the plant’s DNA by the delta delta Ct method. A specific pair of DNA primers based on H. arabidopsidis actin (forward, 5’-GTGTCGCACACTGTACCCATTTAT (SEQ ID NO: 1 ); reverse, 5’-ATCTTCATCATGTAGTCGGTCAAGT (SEQ ID NO: 2)) and A. thaliana actin (forward, 5’-AATCACAGCACTTGCACCA (SEQ ID NO: 3); reverse, 5’- GAGGGAAGCAAGAATGGAAC (SEQ ID NO: 4)) was used for qPCR.

[0119] Infection experiments with Botrytis cinerea (B05.10) were performed by inoculating Arabidopsis plants 24 days after sowing (i.e. one day after treatment with the extracts) in medium. Therefore, 3 pL of a 5 x 10A5 spore suspension was inoculated on the roots of the plants. Disease was scored by qPCR. Therefore, the fungal DNA was quantified relative to the plant’s DNA by the delta delta Ct method. A specific pair of DNA primers based on B. cinerea cutinase A (forward, 5’ -AGCCTTATGTCCCTTCCCTTG (SEQ ID NO: 5); reverse, 5’- GAAGAGAAATGGAAAATGGTGAG (SEQ ID NO: 6)) and A. thaliana SHAGGY-related protein kinase (forward, 5’-CTTATCGGATTTCTCTATGTTTGGC (SEQ ID NO: 7); reverse, 5’- GAGCTCCTGTTTATTTAACTTGTACATACC (SEQ ID NO: 8)) was used for qPCR.

[0120] 5. Gene expression profiling by RNA-sequencing on local and systemic tissue in rice Fourteen-day old rice plants were treated with FWE as described above. Root and shoot material from 3 biological replicates of control plants and 3 biological replicates of FWE-treated plants were sampled 24 hours after treatment. Each biological replicate consisted of at least 5 pooled rice plants to minimize inherent biological variability. RNA was extracted using the RNeasy Mini Kit by Qiagen. Quality and concentration of the samples was assessed using NanoDrop 2000. The QuantSeq 30 mRNA-Seq Library Prep Kit was used for RNA seq library preparation. Quality of the libraries was confirmed using an Agilent Bioanalyzer 2100 and used for sequencing on a NextSeq 500 Illumina sequencing platform. The samples were multiplexed to minimize lane effects. Reads were trimmed with Trimmomatic (version 0.36) using following settings: ILLUMINACLIP:TruSeq3-SE.fa:3:30:10, SLIDINGWINDQW:5:20, MINLEN:20 (Bolger et al., 2014) and mapped against the O. sativa ssp. japonica reference genome (build MSU7.0) using STAR (version 2.5.2a) (Dobin et al. 2013). Only uniquely mapped reads were kept for further analysis. BAM files of multiplexed samples were merged using samtools (version 1 .3). Count tables were generated by the “Summarize Overlaps” function in the Genomic Alignments R package (version 1 .16.0) (Lawrence et al., 2013). Differential expression analysis was performed using the DESeq2 package (version 1 .20) (Love et al., 2014). Relative gene expressions with an adjusted p-value < 0.05 were considered as differentially expressed. PLAZA 5.0 (Van Bel et al. 2022) was used for gene ontology analysis.

[0121] 6. Phytohormone quantification

[0122] Abscisic acid (ABA), indole-3-acetic acid (IAA), jasmonic acid (JA) and salicylic acid (SA) levels were determined according to the protocol described by (Haeck et al. 2018). After sampling, roots and shoots were grinded in liquid nitrogen. This was followed by a cold solvent extraction, filtration and clean up. Ultimately, phytohormone levels were measured using an ultrahigh- performance liquid chromatograph in combination with a tandem high resolution mass spectrometer. Five biological replicates were assayed, each consisting of root or shoot tissue of a pool of at least five plants. 7. Absolute quantification of the main metabolites in three of the Apiaceae extracts

[0123] The absolute quantification of the main primary metabolites in the extracts FWE, CPWE and CcWE, was carried out by the means of quantitative 1 HNMR. Briefly, the extracts were evaporated in vacuo, and weighed aliquots of the extracts were dissolved in 500 (or 550) pL of buffered D2O (K2HPO4 90 mM, pH 7), to which 100 pL of 5 mM DSS in D2O were added. D2O and DSS provided a field frequency lock and chemical shift reference (1 H 6 0.00 ppm) respectively. NMR experiments were performed using a Bruker AVANCE III spectrometer, equipped with 1 H / BB z-gradient probe (BBO, 5 mm). The 1 H spectra were measured at 400 MHz. All spectra were acquired through the standard pulse sequences available in the Bruker pulse program library. Spectral data were all processed with Bruker TopSpin version 4.1 .3. Exponential window multiplication of the FID, Fourier transformation and phase correction were performed using Bruker AU programs proc_1 d. The 1 H NMR data quantification was attained by acquiring the integration values of selected resonance signals of all the identified metabolites with the reference integration value of the resonance signal at 0.00 ppm of DSS set to 9. This was manually done using Bruker TopSpin version 4.1 .3. Normalization for each metabolite was done by dividing the corresponding integration value of the resonance signal of each metabolite by its corresponding number of protons. The absolute quantification of the metabolites was then performed using the calculated concentrations of each metabolite in the solution. From each extract 3 technical replicates were prepared. Each aliquot was analyzed 3 times.

[0124] 8. Statistical analysis

[0125] All statistical analyses were performed in RStudio (version: 2022.12.0+353). The analyses were performed at the a = 0.05 significance level. Statistical graphics were created using the ggplot2 package (Wickham, 2009). For pairwise comparisons, data was statistically analyzed using a Student’s T-test or the non-parametric Wilcoxon signed rank test.

[0126] RESULTS

[0127] Example 1 : FWE induces systemic resistance in rice against the root-knot nematode Meloidogyne graminicola.

[0128] In this experiment, the potential systemic resistance-inducing effect of foliar application of an aqueous extract derived from fennel plants was investigated against the root-knot nematode Meloidogyne graminicola. Inoculation was done 24h after spraying and root galls were counted 14 days later. Effects on plant growth were evaluated by measuring both root and shoot length. The number of second stage juveniles (J2), third and fourth stage juveniles (J3 / J4), young females and egg-laying females were evaluated as a measure for nematode development. The results show that the fennel water extract (FWE) induces systemic resistance in rice against the root-knot nematode Meloidogyne graminicola, with a significant reduction in number of galls (Figure 1 a). Negative effects on nematode development are observed as well as can be seen in the significant reduction of egg-laying females in FWE-treated plants (Figure 1 b).

[0129] In a further experiment, FWE derived from fennel plants from different harvesting periods (year 2020 and year 2021 ) were investigated for their induced systemic resistance capacity in rice against the root-knot nematode Meloidogyne graminicola. Similar results are obtained as a significant reduction in number of galls per cm root were observed for both extracts (Figure 1 c).

[0130] Example 2: FWE induces systemic resistance in tomato against the root-knot nematode Meloidogyne incognita.

[0131] In this experiment, three-weeks old tomato plants were treated with FWE 24h before inoculation with the root-knot nematode Meloidogyne incognita. Root galls were counted 28 days after inoculation and potential phytotoxic effects were evaluated by measuring both root and shoot dry weight. A strong and significant reduction in number of galls per gram root was observed in plants treated with FWE (Figure 2a). No effects on root or shoot dry weight were observed (Figure 2b, c).

[0132] Example 3: FWE induces systemic resistance in sugar beet against the beet cyst nematode Heterodera schachtii.

[0133] In this experiment, three-weeks old sugar beet plants were treated with FWE 24h before inoculation with the beet cyst nematode Heterodera schachtii. The number of cysts were counted 7 weeks after inoculation and potential phytotoxic effects were evaluated by measuring both shoot length and the number of leaves per plant. A strong and significant reduction in number of cysts per root system was observed in plants treated with FWE (Figure 3).

[0134] Example 4: Soil drench with FWE induces systemic resistance in rice against the foliar rice blast causal agent Pyricularia oryzae.

[0135] In this experiment, four-weeks old rice plants were treated by soil drench with the FWE 24h before inoculation with the rice blast pathogen Pyricularia oryzae. The number of sporulating lesions were counted 5 and 6 days after inoculation. 50 pM PA was used as a positive control. A significant reduction in number of sporulating lesions was observed in plants treated with FWE at both 5 and 6 days after inoculation (Figure 4).

[0136] Example 5: Spraying FWE reduces rice blast caused by Pyricularia oryzae in rice.

[0137] In this experiment, four-weeks old rice plants were treated by foliar spray with FWE 24h before inoculation with the rice blast pathogen Pyricularia oryzae. The number of sporulating lesions were counted 5 and 6 days after inoculation. 300 pM PA was used as a positive control. A significant reduction in number of sporulating lesions was observed in plants treated with FWE at both 5 and 6 days after inoculation (Figure 5).

[0138] Example 6: FWE activates the rice immune system systemically and locally.

[0139] In this experiment, (systemic) defense induction by FWE in rice plants is confirmed by performing transcriptome analysis on root and shoot tissue of two-weeks old rice plants 1 day after treatment with the extract. Many Gene Ontology (GO) and InterPro terms related to plant immunity were found to be significantly enriched in both shoot (Table 1 ) and root tissue (Table 2) 1 day after treatment with FWE. Among the significantly enriched GO and InterPro terms in rice shoot tissue, many are related to ROS metabolism and ET signaling. Additionally, several genes playing a role in ET biosynthesis were also differentially expressed (genes encoding ACC synthase and ACC oxidase). Among the significantly enriched GO and InterPro terms in rice root tissue, many are related to ROS metabolism and jasmonate (JA) signaling. Interestingly, the gene encoding allene oxide synthase (essential in JA biosynthesis) was strongly and significantly upregulated. Several genes playing a role in ET signaling (genes encoding ERFs) and biosynthesis (ACC synthase and ACC oxidase) were significantly upregulated. This illustrates the involvement of ROS, ET and JA in (systemic) induced resistance in rice upon FWE treatment.

[0140] Table 1. Gene expression profiling by RNA-sequencing on shoots of treated plants shows induction of plant defense related processes. The significantly enriched plant immunity related Gene Ontology (GO) and InterPro (IPR) terms, their p-values and description are given in the table. MF = Molecular function; BP = biological process.

[0141] Table 2. Systemic gene expression profiling by RNA-sequencing on roots of treated plants shows induction of plant defense related processes. The significantly enriched plant immunity related Gene Ontology (GO) and InterPro (IPR) terms, their p-values and description are given in the table. MF = Molecular function; BP = biological process.

[0142] Example 7: FWE induces changes in phytohormone accumulation.

[0143] In this experiment, the involvement of several phytohormones in (systemic) induced resistance in rice upon FWE treatment is confirmed by quantifying hormone levels in two-weeks old rice plants treated with the extract. Jasmonate (JA) levels are significantly increased in rice root tissue 24h after treatment (Figure 6a) whereas ABA and indole-3-acetic acid (IAA) are significantly increased in rice shoot tissue (Figure 6b). Example 8: Other extracts derived from the Apiaceae family induce systemic resistance in rice against the root-knot nematode Meloidogyne graminicola.

[0144] In this experiment, two-weeks old rice plants were treated by spraying FWE and 6 other water extracts prepared from plant parts from the same plant family (Apiaceae). The extracts applied were as follows: celery water extract (CyWE), parsley water extract (PIWE), carrot peeling water extract (CPWE), carrot leaf water extract (CLWE), celeriac peeling water extract (CcWE) and parsnip peeling water extract (PnWE). Induced systemic resistance activity against the root-knot nematode Meloidogyne graminicolawas evaluated by inoculating the roots 1 day after treatment and counting the number of galls two weeks later. All waste extracts, except for celery (CyWE) significantly reduce the number of galls (Figure 7a). No significant effects on root or shoot length were observed (Figure 7b, c).

[0145] Example 9: Several promising extracts derived from the Apiaceae family induce resistance in Arabidopsis against the oomycete Hyaloperonospora arabidopsidis and the necrotrophic fungal pathogen Botrytis cinerea.

[0146] In the infection experiment with Hyaloperonospora arabidopsidis, 8-day-old Arabidopsis plants were treated by spraying FWE, CcWE and CLWE until run-off. Induced resistance activity against the oomycete was evaluated by inoculating the shoots 1 day after treatment. Three days later, samples were taken for quantification by qPCR. All water extracts significantly reduce the amount of oomycete DNA (Fig. 8a).

[0147] In the infection experiment with Botrytis cinerea, 21 -day-old Arabidopsis plants were treated by adding 2pL of the extract at 4 different locations on the roots. Induced resistance activity against the fungal pathogen was evaluated by inoculating the roots 3 days after treatments with a fungal spore suspension. Three days later, samples were taken for quantification by qPCR. All water extracts significantly reduce the amount of fungal DNA (Fig. 8b).

[0148] Example 10: Extracts prepared from the Apiaceae family show a similar main metabolic composition.

[0149] In this experiment, the main metabolites in three of the Apiaceae extracts were quantified by means of quantitative 1 HNMR. All three extracts show a similar main metabolite profile: all main metabolites except for mannitol, citric acid, lactic acid and 2,3-butanediol were detected in similar concentrations for each metabolite.

[0150] Example 11 : An ethanol extract derived from fennel induces systemic resistance in rice against the root-knot nematode Meloidogyne graminicola.

[0151] In this experiment, the potential systemic resistance-inducing effect of foliar application of an ethanol extract derived from fennel plants was investigated against the root-knot nematode Meloidogyne graminicola. Inoculation was done 24h after spraying and root galls were counted 14 days later. Effects on plant growth were evaluated by measuring both root and shoot length. The results show that the fennel ethanol extract (FEE) induces systemic resistance in rice against the root-knot nematode Meloidogyne graminicola, with a significant reduction in number of galls (Figure 9).

[0152] Example 12: An aqueous fraction derived from liquid-liquid extraction of FWE with toluene under acidic conditions induces systemic resistance in rice against the root-knot nematode Meloidogyne graminicola.

[0153] In this experiment, the potential systemic resistance-inducing effect of foliar application of an aqueous fraction resulting from liquid-liquid extraction of FWE with toluene (FWE-Fr-H2O) was investigated in rice plants against the root-knot nematode Meloidogyne graminicola. Inoculation was done 24h after spraying and root galls were counted 14 days later. The results show that the FWE-Fr-H2O induces systemic resistance in rice against the root-knot nematode Meloidogyne graminicola, with a nearly significant reduction in number of galls per cm root (p=0.0503) (Figure 10).

[0154] Table 3. Absolute quantification of primary metabolites in three of the Apiaceae extracts that induce systemic resistance in rice against the root-knot nematode Meloidogyne graminicola. The primary metabolites in all three extracts show very similar concentrations. All the values are expressed as mg / g of dry extract, with related standard deviations (n=9). REFERENCES

[0155] Arslan, Umit, Kadir llhan, and Ozgur Akgun Karabult. 2009. “Antifungal Activity of Aqueous Extracts of Spices against Bean Rust (Uromyces Appendiculatus).” Allelopathy Journal 24 (1 ): 207-13.

[0156] Bel, Michiel Van, Francesca Silvestri, Eric M. Weitz, Lukasz Kreft, Alexander Botzki, Frederik Coppens, and Klaas Vandepoele. 2022. “PLAZA 5.0: Extending the Scope and Power of Comparative and Functional Genomics in Plants.” Nucleic Acids Research 50 (D1 ): D1468- 74. https: / / doi.Org / 10.1093 / nar / gkab1024.

[0157] Bolger, Anthony M., Marc Lohse, and Bjoern Usadel. 2014. “Trimmomatic: A Flexible Trimmer for Illumina Sequence Data.” Bioinformatics 30 (15): 21 14-20. https: / / d0i.0rg / l 0.1093 / bioinformatics / btu170.

[0158] Bybd, D W, T Kirkpatrick, and K R Barker. 1983. “An Improved Technique for Clearing and Staining Plant Tissues for Detection of Nematodes.” Journal of Nematology 15 (1 ): 142-43.

[0159] Dobin, Alexander, Carrie A. Davis, Felix Schlesinger, Jorg Drenkow, Chris Zaleski, Sonali Jha, Philippe Batut, Mark Chaisson, and Thomas R. Gingeras. 2013. “STAR: Ultrafast Universal RNA-Seq Aligner.” Bioinformatics 29 (1 ): 15-21 . https: / / d0i.0rg / l 0.1093 / bioinformatics / bts635.

[0160] Haeck, Ashley, Herman Van Langenhove, Lies Harinck, Tina Kyndt, Godelieve Gheysen, Monica Hofte, and Kristof Demeestere. 2018. “Trace Analysis of Multi-Class Phytohormones in Oryza Sativa Using Different Scan Modes in High-Resolution Orbitrap Mass Spectrometry: Method Validation, Concentration Levels, and Screening in Multiple Accessions.” Analytical and Bioanalytical Chemistry 410 (18): 4527-39. https: / / d0i.0rg / l 0.1007 / s00216-018-1 1 12-9.

[0161] Hoagland, and Arnon. 1938. “The Water-Culture Method for Growing Plants without Soil.”

[0162] Lawrence, Michael, Wolfgang Huber, Herve Pages, Patrick Aboyoun, Marc Carlson, Robert Gentleman, Martin T. Morgan, and Vincent J. Carey. 2013. “Software for Computing and Annotating Genomic Ranges.” PLoS Computational Biology 9 (8): 1-10. https: / / d0i.0rg / l 0.1371 / journal. pcbi.10031 18.

[0163] Love, Michael I., Wolfgang Huber, and Simon Anders. 2014. “Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2.” Genome Biology 15 (12): 1-21 . https: / / doi.org / 10.1 186 / s13059-014-0550-8.

[0164] Wickham, H. 2009. “Ggplot2: Elegant Graphics for Data Analysis.” Springer.

[0165] Ghobadi, N.; Rakhshandehroo, F.; Saeedizadeh, A. Applied Entomology and Phytopathology, 2018, Vol. 85, No. 2, pp. Pe167-Pe179

[0166] Guo, Yanzhi; Qin, Lili; Qiao, Chunxiao; Guo, Daosen; Zhao, Aiyun; Zhao, Boguang; Yue, Tongqing; Li, Ronggui. African Journal of Microbiology Research, 2012, 6(8): 1837-1843.

[0167] El-Nagdi, W.M.A., Youssef, M.M.A., El-Khair, H.A. et al. Effect of certain organic amendments and Trichoderma species on the root-knot nematode, Meloidogyne incognita, infecting pea (Pisum sativum L.) plants. Egypt J Biol Pest Control 29, 75 (2019).

[0168] Oka Y, Nacar S, Putievsky E, Ravid U, Yaniv Z, Spiegel Y. Nematicidal activity of essential oils and their components against the root-knot nematode. Phytopathology. 2000 Ju I ;90(7) :710- 5. Soylu et al., 2007, Journal of Applied Microbiology 103 (2007) 1021 -1030

[0169] Wodnicka, Alicja, Huzar, Elzbieta, Dzi^ciol, Malgorzata and Krawczyk, Maria. "Comparison of the composition and fungicidal activity of essential oils from fennel fruits cultivated in Poland and Egypt" Polish Journal of Chemical Technology, vol.21 , no.2, 2019, pp.38-42.

Claims

CLAIMS1 . A method for preventing or treating a plant against nematode, oomycete and / or fungal infection comprising applying to the shoot of said plant an extract obtained from an Apiaceae plant, or part thereof, being a member of the family Apiaceae and selected from the group consisting of: fennel (Foeniculum vulgare), celery (Apium graveolens), carrot (Daucus carota), celeriac (Apium graveolens var. rapaceum), parsnip (Pastinaca sativa), lovage (Levisticum officinale), parsley (Petroselinum crispum), anise (Pimpinella anisum), angelica (Angelica archangelica), dill (Anethum graveolens), coriander (Coriandrum sativum), caraway (Carum carvi), and cumin (Cuminum cyminum), and wherein said extract is an aqueous extract or an organic extract obtained from germinated plant part(s).

2. The method according to claim 1 , wherein the nematodes are root-knot nematodes, rootlesion nematodes, and / or cyst nematodes.

3. The method according to claim 1 , for preventing or treating a plant against fungal or oomycete infections.

4. The method according to anyone of claims 1 to 3, wherein said extract is obtained from the leaves, sticks, bulbs, peels, fruits, stem or stalks of said Apiaceae plant, or part thereof.

5. The method according to anyone of claims 1 to 4, wherein the nematode is from the genus Meloidogyne, Heterodera, Globodera, Pratylenchus, Paratylenchus, Aphelenchoides, Xiphinema, Radopholus, Bursaphelenchus, Rotylenchulus, Nacobbus, Longidorus, Ditylenchus or Trichodorus.

6. The method according anyone of claims 1 to 4, wherein the fungus is from the genus Pyricularia, Botrytis, Puccinia, Fusarium, Blumeria, Mycosphaerella, Colletotrichum, Ustilago, Phakopsora, Alternaria, Sclerotinia, Cladosporium or Rhizoctonia; and wherein the oomycete is from the genus Pythium, Phytophtora and Peronosporaceae.

7. The method according to anyone of claims 1 to 6, wherein the extract is applied by spraying, immersion, atomizing, foaming, fogging, coating, or encrusting.

8. The method according to anyone of claims 1 to 7, wherein said extract is applied onto the leaves of said shoot.

9. The method according to anyone of claims 1 to 8, wherein said extract is obtained from a mixture of Apiaceae plant part(s) and a buffer in a ratio plant part(s):buffer of at least 0.3 % w / v.

10. The method according to claim 9, wherein said buffer is an aqueous solution, in particular selected from the list comprising: water, distilled water, purified water, and / or saline water, preferably water.1 1 . The method according to any one of claims 1 to 9, wherein said buffer is an organic solvent, in particular hexane, toluene, or a polar solvent, more in particular methanol, ethanol, ethyl acetate, acetone, acetonitrile, N,N-Dimethylformamide (DMF), dimethylsulfoxide (DMSO), dichloromethane, or isopropanol.

12. Use of an extract obtained from Apiaceae plants, or parts thereof, as a priming agent for controlling nematode, oomycete and / or fungal infections on plants, wherein the Apiaceae plants are selected from the group consisting of: fennel (Foeniculum vulgare), celery (Apium graveolens), carrot (Daucus carota), celeriac (Apium graveolens var. rapaceum), parsnip (Pastinaca sativa), lovage (Levisticum officinale), parsley (Petroselinum crispum), anise (Pimpinella anisum), angelica (Angelica archangelica), dill (Anethum graveolens), coriander (Coriandrum sativum), caraway (Carum carvi), and cumin (Cuminum cyminum), and wherein said extract is an aqueous extract or an organic solvent extract obtained from germinated plant part(s).

13. The use according to claim 12, wherein said organic solvent is hexane, toluene or a polar solvent, more in particular methanol, ethanol, ethyl acetate, acetone, acetonitrile, N,N- Dimethylformamide (DMF), dimethylsulfoxide (DMSO), dichloromethane, or isopropanol.

14. The use according to claims 12 or 13, wherein said extract is obtained from the leaves, sticks, bulbs, peels, fruits, stem or stalks of a plant.

15. A method for preparing an extract from Apiaceae plant part(s) comprising the steps of: a) providing Apiaceae plants or part(s) being a member of the Apiaceae family; b) optionally cutting the plant or part(s) of step a) into pieces; c) drying the plant or part(s) of step a) or the pieces of step b); d) mixing the dried plant part(s) or pieces of step c) with a buffer, optionally while heating said mixture; e) separating the mixture of step d) into a solid phase and a liquid phase; and f) obtaining the liquid phase of step e) as an Apiaceae extract.

16. The method according to claim 15, wherein said member of the Apiaceae family is selected from the group consisting of: fennel (Foeniculum vulgare), celery (Apium graveolens), carrot (Daucus carota), celeriac (Apium graveolens var. rapaceum), parsnip (Pastinaca sativa), lovage (Levisticum officinale), parsley (Petroselinum crispum), anise (Pimpinella anisum), angelica (Angelica archangelica), dill (Anethum graveolens), coriander (Coriandrum sativum), caraway5 (Carum carvi), and cumin (Cuminum cyminum).

Images