Bundle sheath cell specific plant promoter

Abstract

The present invention relates to plant-operable promoter sequences and regulatory sequences derived therefrom. The present invention also relates to uses of such promoters to confer improved gene expression, especially in bundle sheath cells. The invention further relates to plants comprising said promoter sequences operably linked to downstream plant genes, to methods for obtaining said plants and to plants obtainable by such methods. The present invention also relates to methods and genetic constructs for specifically expressing genes in bundle sheath cells in plants.

Description

[0001] Plant Promoter

[0002] Technical Field

[0003] The present invention relates generally to the field of molecular biology, and more particularly to plant-operable promoter sequences and regulatory sequences related thereto. The present invention also relates to uses of such promoters to confer improved gene expression, especially in bundle sheath cells. The invention further relates to plants of the Oryza family, in particular to rice plants (Oryza .saliva), comprising said promoter sequences operably linked to downstream plant genes, to methods for obtaining said plants and to plants obtainable by such methods. The present invention also relates to methods and genetic constructs for specifically expressing genes in bundle sheath cells in plants. One application of the methods and constructs of the present invention is genetic engineering of C4 photosynthetic metabolism into C3 plants, although it is not necessarily so limited. The present invention also relates to plants obtained by such methods.

[0004] Background

[0005] It is desirable in agriculture to be able to manipulate plant biochemical pathways, for example to increase yield, efficiency, or disease or stress resistance. In some cases, this may involve activating or expressing in plant cells multiple genes expressing a number of proteins / enzymes, to institute a pathway in those cells that is otherwise limited in activity, inactive or not coded for at all in those cells.

[0006] The bundle sheath of plants that use C3 photosynthesis is conditioned through gene expression to allow water transport from veins to mesophyll cells, to carry out sulphur assimilation, and to undertake nitrate reduction (Leegood, 2008; Aubry et al., 2014b; Hua et al., 2021). Whilst bundle sheath cells of C3 plants contain chloroplasts and are photosynthetic, the total volume of cell occupied by these organelles is much lower than that occupied by chloroplasts in mesophyll cells. In essence, the bundle sheath of C4 species is full of chloroplasts that contain Ribulose Bisphosphate Carboxylase Oxygenase (RuBisCO) and so the cell type is critical for photosynthesis.

[0007] Compared with the ancestral C3 state, C4 plants operate at higher light, water and nitrogen use efficiencies (Sage, 2004; Mitchell and Sheehy, 2006; Makino et al., 2003). Moreover, introducing C4 photosynthetic metabolism into C3 plants such as rice is predicted to allow a 50% increase of yield and because of the higher water and nutrient use efficiencies this is accompanied by improvements in sustainability (Hibberd et al., 2008; i Mitchell and Sheehy, 2006). However, to engineer C4 photosynthesis into C3 plants such as rice, specific expression of genes in the bundle sheath is required. This could include phosphoenolpyruvate carboxykinase, NAD- or NADP-dependent malic enzymes and a number of other enzymes involved in the C4 pathway, including for example aminotransferases, organic acid transporters, RuBisCO activase, enzymes of starch and / or sugar metabolism, components of the electron transport chain, as well as transcription factors that regulate these classes of protein and / or which may assist in activating part of the Calvin-Benson-Bassham cycle, or repress other part(s) depending on metabolite balances (Kajala et al., 2011; Aubry et al., 2014a; Ermakova et al., 2020). Bundle sheath cells of C3 plants also need to be activated to accommodate a greater volume of chloroplasts and mitochondria, which requires rewiring of gene expression at early leaf developmental stages (Wang et al., 2017; Lee et al., 2021). Thus, manipulating processes in the bundle sheath is desirable but is currently constrained by a lack of promoters that allow strong and specific expression in these cells.

[0008] To date, two promoters, one from the Zoysia japonica gene encoding PHOSPHOENOLPYRUVATE CARBOXYKINASE - Z / PCK, the other one from the GLYCINE DECARBOXYLASE P-SUBUNIT gene of Flaveria trinervia - FtGLDP, have been shown to direct gene expression in this cell type (Nomura et al., 2005a; Lee et al., 2021; Danila et al., 2022). However, they are both weak and are activated relatively late during leaf development. Promoters of other C4 cycle genes that preferentially express in the bundle sheath of C4 grasses do not generate bundle sheath specific expression in rice, for example, promoters from NADP -MALATE ENZYME (ZmME) of Zea mays and mitochondrial ASPARTATE AMINOTRANSFERASE of Panicum miliaceum produce non- preferential expression in rice leaves (Nomura et al., 2005a, 2005b), suggesting the cis- regulatory network in these promoters is not recognised by transcription factors in rice that condition gene expression to the bundle sheath. It was hypothesized that endogenous genes expressed in rice bundle sheath cells would allow the identification of promoters and defining of elements allowing expression in this cell type. Therefore, twenty -five promoters from endogenous rice genes that are preferentially expressed in bundle sheath cells were tested, and in so doing four promoters were identified that were capable of driving bundle sheath preferential expression. One of these, derived from the SULFITE REDUCTASE (SiR) gene, not only generates strong and specific bundle sheath expression, but also activates at early leaf developmental stages. Dissection of SiRpro identified short DNA fragments that enhance, activate or repress gene expression in specific cell types, and it was found that bundle sheath specific expression of SiRpro is likely mediated by mesophyll specific repression under a constitutive background. Truncation analysis showed that bundle sheath expression pattern from the SiR promoter is mediated by a short distal enhancer and a pyrimidine patch in the core promoter. This bundle sheath module is cryptic until other enhancers acting to both constitutively activate and repress expression in mesophyll cells are removed. The enhancer is composed of a quartet of cv.s-elements recognised by their cognate transcription factors from the GLK2, MYBS1, IDD and bZIP families. These four transcription factors act synergistically and have been found to be sufficient to drive expression of the strong bundle sheath SiR promoter.

[0009] There is a need for new regulatory sequences, genetic elements, genetic constructs and methods for specifically expressing genes in bundle sheath cells, including for expressing multiple genes, and at differential levels, with limited off-target effects. Accordingly, one embodiment of the present invention relates to a new promoter element.

[0010] Any discussion of the prior art throughout the specification should in no way be considered as an admission that such prior art is widely known or forms part of the common general knowledge in the field.

[0011] It is an object of the present invention to overcome or ameliorate at least one of the disadvantages of the prior art, or to provide a useful alternative.

[0012] Summary of the Invention

[0013] The present investigations have surprisingly shown that substantially specific expression of one or more desired target genes in bundle sheath cells can be achieved by placing one or more target genes under the control of a novel promoter or active fragment thereof, providing the desired level of expression in the bundle sheath cell. In some embodiments, a construct is provided comprising a suitable bundle sheath cell specific promoter operably linked to a gene of interest. In other embodiments, a construct is provided comprising a suitable transcription factor activated promoter, which in turn will be operably linked to a suitable transcription factor and the transcription factor in turn will be operably linked to a bundle sheath cell specific promoter, such as the novel promoter of the present invention. The novel promoter of the invention provides robust bundle sheath cell-specific expression of genes to which it is operably linked. In some embodiments, the bundle sheath cell-specific promoter of the invention may be advantageously used to facilitate the orthogonal expression of a wide range of gene(s) within plant bundle sheath cells. In some embodiments, the bundle sheath cell-specific promoter of the invention may be used in a dTALE / STAP expression system. The bundle sheath cell specific promoter of the invention is suitable for use in rice plants, such as Oryza saliva.jand in some embodiments is isolated from rice. In some embodiments, the isolated promoter is derived from the SULFITE REDUCTASE (SiR) gene, preferably from Oryza sativa plants. In other embodiments, the bundle sheath cell specific promoter of the invention has been genetically modified as compared to the wild-type promoter from which it is derived.

[0014] Thus, according to one aspect of the invention, there is provided an isolated promoter sequence or active fragment or derivative thereof, for expression of gene(s) in a bundle sheath cell of a plant.

[0015] Accordingly, in a first aspect, the present invention provides an isolated promoter or active fragment or derivative thereof, capable of directing transcription of a gene to which it is operably connected in a plant bundle sheath cell, wherein said promoter comprises a sequence selected from the group consisting of: a) SEQ ID NOs: 1-3, 15-33 or 39; b) Residues 2325 to 2575 and 1596 to 1746 of SEQ ID NO: 1, or residues 2325 to 2575 and 1596 to 1746 of SEQ ID NO: 2; c) an isolated homolog, analog, ortholog or paralog sequence of SEQ ID NO: 1-3, 15-33 or 39 or a sequence complementary thereto; and d) a sequence having at least: 70%, 75%, 80%, 85%, 87%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any one of the group consisting of: i) SEQ ID NOs: 1-3, 15-33 or 39; ii) residues 2325 to 2575 and 1596 to 1746 of SEQ ID NO: 1; and iii) residues 2325 to 2575 and 1596 to 1746 of SEQ ID NO: 2.

[0016] In some embodiments, said promoter further comprises a sequence selected from the group consisting of residues 1988 to 2037 of SEQ ID NO: 1 or SEQ ID NO: 2; and / or residues 2164 to 2169 of SEQ ID NO: 1 or SEQ ID NO: 2.

[0017] Preferably, said promoter comprises a sequence comprising residues 2325 to 2575 of SEQ ID NO: 1 or SEQ ID NO:2; residues 1596 to 1746 of SEQ ID NO: 1 or SEQ ID NO:2; residues 1988 to 2037 of SEQ ID NO: 1 or SEQ ID NO: 2; and residues 2164 to 2169 of SEQ ID NO: 1 or SEQ ID NO: 2.

[0018] In one embodiment, said promoter consists of a sequence selected from the group consisting of SEQ ID NOs: 1-3, 15-33 and 39.

[0019] Preferably, the plant is a C3 grass, such as rice, more preferably Oryza sativa. The expression may be orthogonal expression in the bundle sheath cell. Preferably the promoter is derived from the SULFITE REDUCTASE (SiR) gene of a plant such as rice, more preferably Oryza sativa. The promoter may in some embodiments be a wild type SiRpro. preferably OsSirpro, but in others may be a genetically modified version of such a promoter, for example by replacement or modification of one or more residues or elements.

[0020] In a second aspect, the present invention provides a recombinant construct comprising a promoter sequence or active fragment, or derivative thereof operably linked to one or more gene(s) and / or one or more gene component(s). Preferably, the promoter is a promoter in accordance with the first aspect.

[0021] In the embodiments and aspects of the invention described herein, the gene or genes or the gene component(s) suitable for expression with the novel promoter include a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene ( a NADP -Malic enzyme (NADP-ME) encoding gene; a NAD-Malic enzyme (NAD-ME) encoding gene; a RbcS encoding gene; a Rubisco activase encoding gene; all regenerative phase genes of the Calvin cycle; genes controlling chloroplast division; a transcription factor such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; genes that control plasmodesmata formation; a reporter gene; or any combination of the foregoing.

[0022] In some embodiments, these include the following genes or components thereof: a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene (GRMZM2G001696, Zm00001d028471) ; a NADP -Malic enzyme (NADP-ME) encoding gene (GRMZM2G085019, Zm00001d000316); a NAD-Malic enzyme (NAD-ME) encoding gene (PAHAL 9G197100); a RbcS encoding gene (Zm00001d052595, Zm00001d004894, LOC_Os02g05830, LOC Os 12g 17600, LOC Osl 2g 19381, LOC_Osl2gl9470); a Rubisco activase encoding gene (Zm00001d048593, Zm00001d048592,

[0023] LOC_Osl lg47970); all regenerative phase genes of the Calvin cycle (triose phosphate isomerase: Zm00001d006221, Zm00001d021310, LOC_Os09g36450; fructose-1,6- bisphosphate aldolase: Zm00001d040084, Zm00001d053015, Zm00001d023559, LOC_Os01g02880, LOC_Osl lg07020; fructose- 1,6-bisphosphatase: Zm00001d028562, LOC_Os03gl6050; transketolase: Zm00001d004171, Zm00001d045451,

[0024] LOC_Os04gl9740, LOC_Os06g04270; sedoheptulose-l,7-bisphosphatase:

[0025] Zm00001d042840, LOC_Os04gl6680; ribulose-5-phosphate 3-epimerase:

[0026] Zm00001d027841, LOC_Os03g07300; ribose-5-phosphate isomerase: Zm00001d018936, LOC_Os07g08030; phosphoribulokinase: Zm00001d038579, LOC_Os05g41640); genes controlling chloroplast division (FtsZl : Zm00001d001939, LOC_Os04g56970; FtsZ2: Zm00001d026669, Zm00001d010135, LOC_Os03g44420, LOC_Os05g37160; ARC6: Zm00001d053923, LOC_Os02g03000; ARC5: Zm00001d023583, LOC_Osl2g07880; PDV: Zm00001d008970, Zm00001d053359, Zm00001d018718, ZmOOOOldO 16061, LOC_Os07g03130, LOC_Os01gl2460, LOC_Os02gl6450, LOC_Os06g30930; MinD: Zm00001d035898, LOC 0s06g01690; MinE: Zm00001d023760, LOC Osl2g31450: ARC3: Zm00001d021407, LOC_Os09g38330; PARC6: Zm00001d001844,

[0027] LOC_Os04g57920; a transcription factor such as CGA1 (ZmOOOOldO 16361, LOC_Os02g 12790), GNC (Zm00001d046354, LOC_Os06g37450) and G2 (Zm00001d039260, LOC_Os01gl3740) or G2-like (Zm00001d044785,

[0028] LOC_Os06g24070) that control chloroplast biogenesis; genes that control plasmodesmata formation (callose synthase: Zm00001d030266, Zm00001d044584, Zm00001d044566,

[0029] Zm00001d027472, Zm00001d027392, Zm00001d036351, Zm00001d014865,

[0030] Zm00001d018565, Zm00001d043428, Zm00001d043909, Zm00001d016155,

[0031] Zm00001d035841, LOC_Os01g34880, LOC_Os01g48200, LOC_Os01g55040,

[0032] LOC_Os01g34890, LOC_Os01g34930, LOC_Os03g03610, LOC_Os02g58560,

[0033] LOC_Os02g 14900, LOC_Os06g51270, LOC_Os06g08380, LOC_Os06g02260; beta- 1,3 glucanase: Zm00001d048055, Zm00001d021903, Zm00001d028243, Zm00001d006658,

[0034] Zm00001d021598, LOC_Os07g32600, LOC_Os07g38930, LOC_Os03gl2140); a reporter gene; or any combination of the foregoing.

[0035] In a third aspect, the present invention provides a recombinant cell engineered to express or overexpress a promoter sequence according to the invention.

[0036] In a fourth aspect, the present invention provides a recombinant cell comprising a recombinant construct of the invention.

[0037] In some embodiments, the recombinant cell is at least one of: a C3 plant cell, a C3 grass cell, a rice cell, an Oryza sativa cell. Preferably, the recombinant cell is a bundle sheath cell.

[0038] In some embodiments, the promoter sequence: a) is operably linked to a regulatory sequence; and / or b) is a component of an expression vector; and / or c) is a domesticated sequence.

[0039] In a fourth aspect, the present invention provides a transgenic plant or a seed thereof comprising the promoter sequence, the recombinant construct, or the recombinant cell of the invention.

[0040] Preferably, the transgenic plant or seed thereof is a C3 plant, preferably a C3 grass, preferably rice, more preferably Oryza sativa.

[0041] In a fifth aspect, the present invention provides a use of the recombinant construct or the recombinant cell of the invention, to express a gene product.

[0042] In some embodiments, the gene product is a phospho-enol pyruvate carboxykinase (PEPCK) or a component thereof; a NADP-Malic enzyme (NADP-ME) or a component thereof; a NAD-Malic enzyme (NAD-ME) or a component thereof; ribulose-1,5- bisphosphate carboxylase / oxygenase small subunit or a component thereof; Rubisco activase or a component thereof; a gene product of a regenerative phase gene of the Calvin cycle; a gene product of a gene controlling chloroplast division; a transcription factor such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; a gene product of a gene that controls plasmodesmata formation; a gene product of a reporter gene or a component thereof; or any combination of the foregoing.

[0043] In a sixth aspect, the present invention also provides a system for expressing a target gene in bundle sheath cells of a plant, said system comprising: a) a recombinant construct comprising: a target gene operably linked to a transcription-factor activated promoter; a transcription factor encoding sequence operably linked to said transcription factor-activated promoter; and b) a bundle sheath cell-specific promoter operably linked to said transcription factor encoding sequence.

[0044] Preferably, the bundle sheath cell-specific promoter is a promoter in accordance with the invention.

[0045] In a seventh aspect, the present invention provides a method for expressing a target gene in bundle sheath cells of a plant, said method comprising: a. introducing a promoter of the invention operably linked to a target gene, or a recombinant construct comprising a promoter of the invention operably linked to a target gene, into a plant cell; and b. generating the plant using the plant cell, wherein said bundle sheath cells of the plant express said target gene.

[0046] In some embodiments the target gene is operably linked to a transcription-factor activated promoter; a transcription factor encoding sequence is operably linked to said transcription factor-activated promoter; and said promoter of the invention is operably linked to said transcription factor encoding sequence.

[0047] In some embodiments of the invention, the transcription-factor is a designer Transcription Activator-like Effector (dTALE) and the transcription factor-activated promoter is a Synthetic TALE Activated Promoter (STAP).

[0048] Preferably, the target gene may be selected from: a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene; a NADP -Malic enzyme (NADP-ME) encoding gene; a NAD-Malic enzyme (NAD-ME) encoding gene; a RbcS encoding gene; a Rubisco activase encoding gene; all regenerative phase genes of the Calvin cycle; genes controlling chloroplast division; a transcription factor such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; genes that control plasmodesmata formation; a reporter gene; or any combination of the foregoing. However, the recombinant construct may also comprise multiple target genes each operably linked to a separate transcription-factor activated promoter, optionally wherein each said transcription-factor activated promoter is a STAP. Alternatively, the recombinant construct may also comprise multiple target genes each operably linked to a separate promoter of the invention.

[0049] In some embodiments, the separate transcription-factor activated promoters comprise different types of STAPs, and in yet further embodiments, the different types of STAPs differentially express the multiple target genes.

[0050] In yet further embodiments, the method for expressing a target gene may comprise introducing a plurality of promoters of the invention operably linked to a target gene, or a plurality of recombinant constructs comprising one or more promoter of the invention operably linked to a target gene, into said plant cell.

[0051] The method may further comprise generating T1 generation plant / s from the plant, wherein the T1 generation plant / s heritably express the target gene in bundle sheath cells. Optionally, the method may also comprise generating T2 generation plant / s from the T1 generation plant / s, wherein the T2 generation plant / s heritably express the target gene in bundle sheath cells.

[0052] The promoters and methods of the present invention have been found to allow specific and robust expression of genes in bundle sheath cells. Further, the methods of the present invention have been found to allow differential expression of multiple genes in bundle sheath cells, by placing the multiple genes under the control of two or more transcription factor-activated promoters providing different levels of expression. STAPs, under the control of one or more dTALEs in particular lend themselves to such methods. A plurality of STAPs may be under the control of a plurality of dTALEs, and these may be paired one-to-one, or a plurality of STAPs may be under the control of fewer dTALEs, such that, for example, a number of STAPs may be under the control of one dTALE, and one or more individual STAPs may be under the control of individual dTALEs. Each target gene may be under the control of a separate STAP, or a number of target genes may be under the control of a single STAP, or a combination of such target gene-STAP relationships may be employed.

[0053] In an eighth aspect, the present invention provides a method for differentially expressing a plurality of target genes in bundle sheath cells of a plant, said method comprising:

[0054] (i) introducing a recombinant construct into a plant cell or cells, said construct comprising: a plurality of target genes, each operably linked to a STAP or series of STAPs to form a STAP -target gene sequence module, said STAP-target gene sequence modules being sequentially organised; a dTALE upstream of and operably linked to said sequentially organised STAP- target gene modules; and a bundle sheath cell-specific promoter upstream of and operably linked to said dTALE; and,

[0055] (ii) generating the plant using the plant cell or cells, wherein said bundle sheath cells of the plant express said target gene.

[0056] The target genes may be selected from a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene; a NADP-Malic enzyme (NADP-ME) encoding gene; a NAD- Malic enzyme (NAD-ME) encoding gene; a RbcS encoding gene; a Rubisco activase encoding gene; all regenerative phase genes of the Calvin cycle; genes controlling chloroplast division; a transcription factor such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; genes that control plasmodesmata formation; a reporter gene; or any combination of the foregoing and the recombinant construct may further comprise an antibiotic resistance gene, which is optionally operably linked to a constitutive promoter, an inducible promoter, or a bundle sheath specific promoter. In this aspect, the bundle sheath cell specific promoter in each or either case can be a promoter of the first embodiment.

[0057] The method may further comprise generating T1 generation plant / s from the plant, wherein the T1 generation plant / s heritably express the target gene in bundle sheath cells, and optionally further comprise generating T2 generation plant / s from the T1 generation plant / s, wherein the T2 generation plant / s heritably express the target gene in bundle sheath cells.

[0058] Preferably, said plant is a C3 plant such as a C3 grass, preferably rice, more preferably Oryza sativa. Preferably, said promoter is a promoter as defined in the invention.

[0059] In a ninth aspect, the present invention provides a recombinant construct for expressing a target gene in a plant bundle sheath cell, said construct comprising: a plurality of target genes, each operably linked to a STAP or series of STAPs to form a STAP-target gene sequence module, said STAP-target gene sequence modules being sequentially organised; a dTALE upstream of and operably linked to said sequentially organised STAP- target gene modules; and a bundle sheath cell-specific promoter upstream of and operably linked to said dTALE.

[0060] The bundle sheath cell-specific promoter is preferably a promoter as defined in the first aspect.

[0061] In aspects of the invention, the bundle sheath cell-specific promoter of the invention is a sulfite reductase (SiR) promoter or a modified sulfite reductase (SiR) promoter. This can be an Oryza sativa sulfite reductase (SiR) promoter.

[0062] In some embodiments, the target gene can be selected from: a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene; a NADP -Malic enzyme (NADP-ME) encoding gene; a NAD-Malic enzyme (NAD-ME) encoding gene; a RbcS encoding gene; a Rubisco activase encoding gene; all regenerative phase genes of the Calvin cycle; genes controlling chloroplast division; a transcription factor such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; genes that control plasmodesmata formation; a reporter gene; or any combination of the foregoing.

[0063] In a tenth aspect, the present invention provides a recombinant construct for differentially expressing a plurality of target genes in bundle sheath cells of a plant, said construct comprising: a plurality of target genes, each operably linked to a STAP or series of STAPs to form a STAP -target gene sequence module, said STAP-target gene sequence modules being sequentially organised; a dTALE upstream of and operably linked to said sequentially organised STAP- target gene modules; and a bundle sheath cell-specific promoter upstream of and operably linked to said dTALE. Preferably, the bundle sheath cell-specific promoter is a promoter of the invention.

[0064] Preferably, said target genes are selected from: a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene; a NADP -Malic enzyme (NADP-ME) encoding gene; a NAD-Malic enzyme (NAD-ME) encoding gene; a RbcS encoding gene; a Rubisco activase encoding gene; all regenerative phase genes of the Calvin cycle; genes controlling chloroplast division; a transcription factor such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; genes that control plasmodesmata formation; a reporter gene; or any combination of the foregoing.

[0065] Optionally, said recombinant construct further comprises an antibiotic resistance gene, which is optionally operably linked to a constitutive promoter, an inducible promoter, or a bundle sheath specific promoter.

[0066] Preferably, the plant is a C3 plant such as a C3 grass, preferably rice, more preferably Oryza sativa. Preferably, the bundle sheath cell specific promoter is a promoter as defined in the invention.

[0067] In an eleventh aspect, the present invention provides a plant or a part thereof (such as seeds, fruit, embryos, or shoots, stems, roots, stolons, buds, cuttings or other non- reproductive vegetative material thereof) expressing one or more target genes in bundle sheath cells, obtained by a method of the invention or comprising a recombinant construct according to the invention or comprising a promoter according to the invention or comprising a transgenic cell of the invention.

[0068] Preferably, said plant is a C3 plant such as a C3 grass, preferably rice, more preferably Oryza sativa.

[0069] In a twelfth aspect, the present invention provides a method for increasing crop yield in a plant of the Oryza family, comprising of introducing into the genome of said plant a recombinant construct according to the invention or a promoter according to the invention in operable linkage with a downstream gene product, wherein said downstream gene product is optionally selected from the group consisting of the product of a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene; a NADP-Malic enzyme (NADP-ME) encoding gene; a NAD-Malic enzyme (NAD-ME) encoding gene; a RbcS encoding gene; a Rubisco activase encoding gene; all regenerative phase genes of the Calvin cycle; genes controlling chloroplast division; a transcription factor such as CGA1, GNC and G2 or G2- like that control chloroplast biogenesis; genes that control plasmodesmata formation; a reporter gene; or any combination of the foregoing. However, as would be understood by a person skilled in the art, the downstream gene product may comprise other genes without departing from the spirit of the invention. The plant heritably expresses the target gene in bundle sheath cells, and the method optionally further comprises generating further generation plant / s from the plant, wherein the further generation plant / s heritably express the target gene in bundle sheath cells. The plants heritably expressing the target gene in bundle sheath cells may then be grown as crops using agricultural methods known in the art.

[0070] Preferably, the plant is Oryza sativa, and / or plants derived therefrom.

[0071] Brief Description of the Drawings

[0072] Figure 1 - Shows the first attempt for identification of BS-specific promoter based on rice endogenous BSS (bundle sheath strands) transcriptome. (A) Transcript abundance (Transcript per million, TPM) of the seven candidate genes. (B) representative GUS staining images using promoters from MYB, bolA, GS1, SRP, ABP, SULT3;1 and SULT3;3, scale bars represent 50 pm. (C) Summary of the promoters tested including gene information, upstream flanking region cloned and GUS localisation.

[0073] Abbreviation: BSS, Bundle Sheath Strands (vascular bundle and bundle sheath); M, Mesophyll; V, vascular bundle (cell types including xylem, phloem which are surrounded by bundle sheath cells).

[0074] Figure 2 - Identification of BS-specific promoters based on Kitaake BS transcriptome. (A) Transcript abundance (Transcript per million, TPM) of the 18 candidate genes in BS and M cells. (B) Representative leaf cross sections after GUS staining showing bundle sheath or vascular bundle preferential expression, proportion of transgenic plants showing the GUS pattern indicated on upper-right corner, the rest show no GUS expression, scale bars represent 50 pm. (C) Summary of gene information, region of cloning and GUS localisation.

[0075] Abbreviation: BS, Bundle Sheath; M, Mesophyll; V, Vascular bundle (cell types including xylem, phloem which are surrounded by bundle sheath cells).

[0076] Figure 3 - Shows the promoter of the rice sulfite reductase (SiR) gene drives expression in the bundle sheath. (A) SiRpro::kzGUS (SiRpro: SEQ ID NO: 1; kzGUS: SEQ ID NO: 6) introduced into rice with a Gateway compatible vector generates strong GUS staining in bundle sheath after incubation at 37 °C for 20 hours. (B) mTurquoise2 (Arabidopsis thaliana nuclear localization peptide H2B: SEQ ID NO: 7; mTurquoise2: SEQ ID NO: 8) signal driven by SiRpro (SEQ ID NO: 1) specifically locate in nuclei (indicated by yellow arrow) of bundle sheath cells (marked by yellow dash lines) and vein cells in mature leaves, red indicates chlorophyll autofluorescence. (C) SiRpro activity determined by the fluorometric 4-methylumbelliferyl-P-D-glucuronide (MUG) assay shows no significant difference between Gateway pENTR-SiRpro (SEQ ID NO: 1) and Golden gate (domesticated SiRpro) system (SEQ ID NO: 2). Data were subjected to a pairwise Wilcoxon test with Benjamini -Hochberg correction, where NS= not statistically different. (D) mTurquoise2 (mTurq2) detected in chloroplasts of bundle sheath cells (marked by yellow dashed line) from transgenic plants expressing SiRpro: :dTALEl-STAP 1.4: :CP- mTurq2 (SiRpro'. SEQ ID NO: 2; dTALEl'. SEQ ID 10; Chloroplast localisation peptide (CP): SEQ ID 13; STAP1.4: SEQ ID 11), red indicates chlorophyll autofluorescence. (E) GUS staining of transgenic line expressing SiRpro: :dTALEl-STAP 1.62: :kzGUS (SiRpro SEQ ID NO: 2; dTALEl: SEQ ID 10; STAP1.62: SEQ ID 12) The leaf was incubated at 37 °C for 1 hour. (F) shows a 4-methylumbelliferyl-P-D-glucuronide (MUG) assay indicating an 18-fold increase of median value by using dTALEl in combination with STAR 1.62., data were subjected to a pairwise Wilcoxon test with Benjamini -Hochberg correction, where *** p < .001, median value was indicated by red lines. Scale bars represent 50 pm. (G) Landscape of transcription factor binding sites in the SIR promoter using the Find Individual Motif Occurrences (FIMO) program. The likelihood of match between 656 plant nonredundant known transcription factor motifs in the SIR promoter is shown by transcription factor families.

[0077] Figure 4 - Shows that the rice SIR promoter drives expression in bundle sheath cells earlier than the ZjPCKpro. GUS in transgenic rice plants expressing ZjPCKpro::kzGUS (ZjPCKpro'. SEQ ID NO: 4,5; kzGVS'. SEQ ID NO:6) (A, B, G, H) and SiRpro.-.kzGUS SiRpro-. SEQ ID NO: 1; kzGVS'. SEQ ID NO:6) (D, E, J, K) from 5-mm (A, B, D, E) and 2-cm (G, H, J, K) fourth leaves. B&E show magnified views of the boxed regions in A and D. Expression of green fluorescent protein (C, I) and mTurquoise2 (F, L) in transgenic plants expressing ZjPCKpro ..dTALE 1-STAP 1.4: :eGFP-NLS ZjPCKpro-. SEQ ID NO: 4, 5; dTALEl-. SEQ ID NO: 10; STAP1.4-. SEQ ID NO: lOf; eGFP-. SEQ ID NO: 9; NLS: SEQ ID NO: 14) (C, I) and SiRpro: :H2B-mTurquoise2 (SiRpro. SEQ ID NO: 2; H2B: SEQ ID NO: 7; mTurquoise: SEQ ID NO: 8) (F, L) from 5-mm (C, F) and 2-cm (I, L) fourth leaves. NLS and H2B are nuclear localisation signal peptides. Yellow arrows indicate nuclei of bundle sheath cells expressing H2B-mTurquoise2. Chlorophyll autofluorescence is indicated in red (C, F, I, L). Scale bars represent 500 pm for A, D; 50 pm for B, E, H, K; 25 pm for C, F, I, L; 5 mm for G, J.

[0078] Figure 5 - Shows Nucleotides -980 to -394 bp of the SiRpro is necessary for bundle sheath expression. (A) Prediction of transcription factor binding sites indicated in color-coded motif clusters in SiR promoter using Find Individual Motif Occurrences (FIMO) program. (B) diagram showing 5’ deletion series of SiRpro. (C) representative leaf cross section after GUS staining, zoom-in image of lateral veins were shown in right panel, scale bars = 50 um. (D) promoter activity determined by the fluorometric 4- methylumbelliferyl- P -D- glucuronide (MUG) assay, median value was indicated by red lines, multiple pairwise comparison was performed using a Kruskal -Wallis test (nucleotides -2571 to -2181: SEQ ID NO: 15; nucleotides -2180 to -1491: SEQ ID NO: 16; nucleotides -1490 to -981: SEQ ID NO: 17; nucleotides -980 to -395: SEQ ID NO: 18; nucleotides -394 to +42: SEQ ID NO: 19)

[0079] Figure 6 - Shows nucleotides -980 to -829 (SEQ ID NO: 20) and -119 to +42 bp (SEQ ID NO: 24) are both necessary for bundle sheath gene expression. (A) diagram showing 5’ and 3’ deletion series. (B) representative leaf cross section after GUS staining, zoom-in image of lateral veins were shown in right panel, scale bars = 50 pm. (C) promoter activity determined by the fluorometric 4- methylumbelliferyl- P -D-glucuronide (MUG) assay, multiple pairwise comparison was performed using a Kruskal -Wallis test.

[0080] Figure 7 - Shows nucleotides -980 to -849 (SEQ ID NO: 20) and -119 to +42 bp (SEQ ID NO: 24) are sufficient and for BS-specific expression with the core promoter. (A) two transcription start sites supported by full length cDNA clones (TSS1 : AK073969, AK103289; TSS2: AK100773) and leaf RNA sequencing reads (SRR1616572) and their relative position to TATA box variant (TATA var. -130 to -125 bp: SEQ ID NO: 26) and Y-Patch core promoter element (-62 to -42bp: SEQ ID NO: 27). (B) Profile of general transcription factor binding site associated with RNA Polymerase II were produced by FIMO, hits between nucleotides -980 and -849 were omitted. (C) diagram showing constructs for generate robust bundle sheath specific expression by incorporating upstream core promoter elements, rev. comp, represents for reverse complementary of 5’UTR sequence except for leading 6-bp and ending 10-bp. (nucleotides -251 to -198: SEQ ID NO: 25; nucleotides -197 to -120: SEQ ID NO: 26; nucleotides -85 to -10: SEQ ID NO: 27; nucleotides -85 to -41 : SEQ ID NO: 28) (D) representative leaf cross section after GUS staining, zoom-in image of lateral veins were shown in right panel, scale bars = 50 pm. (E) promoter activity determined by the fluorometric 4- methylumbelliferyl- P -D-glucuronide (MUG) assay, multiple pairwise comparison was performed using a Kruskal-Wallis test.

[0081] Abbreviations of core promoter elements: TATA, TATA box; Y-patch;INR, initiator; MTE, motif ten element; BREu, TFIIB recognition element upstream; DCE S I, downstream core element S-I; DCE S II, downstream core element S-II, MED-1, mediator-1.

[0082] Figure 8 - Shows permanganate footprinting targeting the 5’UTR region of OsSiR determined by ligation mediated PCR coupled with capillary electrophoresis. Compared with naked DNA sample (the 2ndpanel), and mesophyll nuclei (the 3rdpanel) that don’t show accumulation of RNA Polymerase II in OsSiR 5’UTR, suggesting lack of expression of OsSiR in mesophyll is caused by repression of transcription initiation.

[0083] Figure 9 - Shows 5’ deletions from nucleotide -980 to -829 identified motif repressing mesophyll expression. (A) Profile of transcription factor binding site produced by FIMO. (B) diagram showing 5 prime deletion series (nucleotides -980 to -947: SEQ ID NO: 29; nucleotides -946 to -924: SEQ ID NO: 30; nucleotides -923 to -905: SEQ ID NO: 31; nucleotides -904 to -887: SEQ ID NO: 32; nucleotides -886 to -850: SEQ ID NO: 33). (C) representative leaf cross section after GUS staining, zoom-in image of lateral veins were shown in right panel, scale bars = 50 pm. (D) promoter activity determined by the fluorometric 4- methylumbelliferyl- P -D-glucuronide (MUG) assay, multiple pairwise comparison was performed using a Kruskal-Wallis test.

[0084] Abbreviations of transcription factor binding sites: ARF, AUXIN RESPONSE FACTOR, G21ike, GOLDEN2-LIKE, MYBR, MYELOBLASTOSIS-RELATED; MADS, MADS- box containing; Dof, DNA-BINDING WITH ONE FINGER; IDD, INDETERMINATE DOMAIN; ARR, ARABIDOPSIS RESPONSE REGULATORS ;NAC, NAM, ATAF and CUC family..

[0085] Figure 10 - Shows conserved motifs and a E-box motif regulate SiRpro activity. (A) location of EIL, MADS / DOF and E-box. (B) diagram showing deletion of motifs. (C) representative leaf cross section after GUS staining, zoom-in image of lateral veins were shown in right panel, scale bars = 50 pm. (D) promoter activity determined by the fluorometric 4- methylumbelliferyl- P -D-glucuronide (MUG) assay, multiple pairwise comparison was performed using a Kruskal-Wallis test.

[0086] Abbreviations: MADS, MADS-box containing; Dof, DNA-BINDING WITH ONE FINGER; EIL, ETHYLENE INSENSITIVE3-LIKE; E-box, ENHANCER BOX (CACGTG).

[0087] Figure 11 - Shows identification of conserved transcription factor binding sites across Oryza and grasses species. (A) conservation profile of 50-bp sliding window of SiRpro promoter across seven grass species. (B) sequence alignment at region -558 to -538 bp, as well as the best match motif to this region. (C) conservation profile of nucleotides -980 to 42 bp in distant Oryza species. (D) sequence alignment at region -958 to -890 bp and best match motif to this region. (E) and (F): The evolutionally conserved ETHYLENE INSENSITIVE3-LIKE (EIL) binding site regulates the expression level but not cell specificity of the SiR promoter.

[0088] Figure 12 - Shows establishment of bundle sheath specific expression of SiRpro is mediated by opposing expression of activators and repressors. Multiple activators and core promoter elements, such as EIL, NAC binding site and Y-patch core promoter element, generate a constitutive expression pattern, MYBR and MADS / DOF transcription factors may act to repress mesophyll expression, leading to a bundle sheath specific expression pattern.

[0089] Figure 13 - Shows the 2613-bp rice SiRpro sequence in pENTR-SiRpro (SEQ ID NO: 1). Figure 14 - Shows the domesticated rice SiRpro sequence in Golden Gate level 0 PU module EC 14328 (SEQ ID NO: 2).

[0090] Figure 15 - Shows the sequence of rice SiRpro without coding region in a level 0 PU module EC 14330 (SEQ ID NO:3).

[0091] Figure 16 - Shows the sequences of Zoysia japonica Phosphoenolpyruvate CarboxyKinase (ZjPCKpro) promoter in the level 0 P module EC 17020 (SEQ ID NO: 4) and 5’UTR (B) a level 0 U module EC 17021 (SEQ ID NO: 5).

[0092] Figure 17 - Shows the sequence of kzGUS in a level 0 SC module EC 18323 (SEQ ID NO: 6).

[0093] Figure 18 - Shows the sequences of Arabidopsis thaliana nuclear localization peptide H2B in a level 0 S module EC 18285 (SEQ ID NO: 7).

[0094] Figure 19 - Shows the sequences of (A) mTurquoise 2 in a level 0 C module EC18162 (SEQ ID NO: 8) and (B) eGFP in a level 0 S module EC 15094 (SEQ ID NO: 9).

[0095] Figure 20 - Shows the sequences of dTALEl and cognate STAPs. (A) the sequence of dTALEl in a level 0 SC module pICH73103 (SEQ ID NO: 10). (B) the sequence of STAP1.4 in a level 0 PU module pAGT582-STAP1.4 (SEQ ID NO: 11). (C) the sequence of STAP1.62 in a level 0 PU module pAGT582-STAP1.62 (SEQ ID NO: 12).

[0096] Figure 21 - Shows the sequence of chloroplast localization signal peptide CP (A) in a level 0 S module EC18212 (SEQ ID NO: 13) and the sequence of nuclear localization peptide NLS (B) in a level 0 C module EC15101 (SEQ ID NO: 14).

[0097] Figure 22 - Shows regions of nucleotide sequences (5’- 3’) in rice SiRpro. nucleotide -2571 to -2181 : SEQ ID NO: 15; nucleotide -2180 to -1491 : SEQ ID NO: 16; nucleotide -1490 to -981 : SEQ ID NO: 17; nucleotide -980 to -395: SEQ ID NO: 18; nucleotide -394 to +42: SEQ ID NO: 19)

[0098] Figure 23 - Shows sequences of fragments between nucleotide -980 and +42. (A) nucleotide from -980 to -850: SEQ ID NO: 20; nucleotide from -849 to -701: SEQ ID NO: 21; nucleotide from -700 to -395: SEQ ID NO: 22; nucleotide from -394 to -120: SEQ ID NO: 23; nucleotide from -119 to +42: SEQ ID NO: 24) of rice SiRpro,' (B) sequences associated with the core promoter of SiR. Nucleotide from -251 to -198: SEQ ID NO: 25; nucleotide from -197 to -120: SEQ ID NO: 26; nucleotide from -85 to -42: SEQ ID NO: 27; nucleotide from -41 to -10: SEQ ID NO: 28. Figure 24 - Shows sequences (5’- 3’) of fragments between nucleotide -980 and -849. nucleotide from -980 to -947: SEQ ID NO: 29; nucleotide from -946 to -924: SEQ ID NO: 30; nucleotide from -923 to -905: SEQ ID NO: 31; nucleotide from -904 to -887: SEQ ID NO: 32; nucleotide from -886 to -849: SEQ ID NO: 33).

[0099] Figure 25 - Shows the sequence of minimal CaMV35S promoter in a level 0 U module HL0018 (SEQ ID NO: 34).

[0100] Figure 26 - Shows the sequence of Oryza sativaActin-1 gene promoter (pOsAcll in a level 0 PU module EC 18216 (SEQ ID NO: 35).

[0101] Figure 27 - Shows the sequence of hygromycin resistance gene (HYG) in a level 0 SC module EC 15069 (SEQ ID NO: 36).

[0102] Figure 28 - Shows the sequences of terminators in level 0 T modules. (A) sequence of NOS terminator (Trios') sequence in the level 0 T module EC41421 (SEQ ID NO: 37). (B) sequence of Arabidopsis Act2 terminator (Tact2) in the level 0 T module EC44300 (SEQ ID NO: 38)

[0103] Figure 29 - Shows the sequence of minimal BS specific promoter (SEQ ID NOs: 39).

[0104] Figure 30 - Shows exemplary C4 enzyme target gene sequences: (A) Zea mays malic enzyme (SEQ ID NO: 40); (B) Zea mays phosphenolpyruvate carboxykinase (SEQ ID NO: 41); (C) photosynthetic NAD-dependent malic enzyme (SEQ ID NO: 42); and (D) mitochondrial aspartate aminotransferase (SEQ ID NO: 43).

[0105] Figure 31 - Shows exemplary reporter gene and selection marker gene sequences: (A) Kusabira Orange (SEQ ID NO: 44); (B) mNeonGreen (SEQ ID NO: 45); (C) mClover3 (SEQ ID NO: 46); (D) tdTomato (SEQ ID NO: 47); (E) KOKappa (SEQ ID NO: 48); (F) BASTA (glufosinate) resistance gene 1 (SEQ ID NO: 49); and (G) moPAT (monocot- optimised phosphinothricin acetyltransferase) (SEQ ID NO: 50); italics represent overhangs for Golden Gate cloning; capital italics represent fusion sites for Golden Gate cloning (these are the overhangs that remain after cutting with Bsal); and the remainder is the fluorescent gene reporter sequence.

[0106] Figure 32- Shows primers used to clone OsSiRpro pENTR-BS15.0_F-CACCATGCTTGACCATGTGGACTC (SEQ ID NO: 51) pENTR-BS15.0_R-ACGGAACCCGTGGAACTC (SEQ ID NO: 52) Figure 33 - Shows identification of G2, CGA1 and GNC transcription factors as likely limiting chloroplast development in the bundle sheath. Data obtained from sampling bundle sheath strands (BSS) and mesophyll (M) cells during their development.

[0107] Figure 34 - Shows the effects of overexpression of ZmG2, CGA1 and GNC by SIRpro in increased bundle sheath chloroplast occupancy.

[0108] Figure 35 - Shows results of 3D scanning of bundle sheath cells. Following overexpression of ZmG2, CGA1 and GNC by SIRpro in bundle sheath, 3D scanning confirms massively increased chloroplast occupancy.

[0109] Figure 36 - Shows quantitation of OE ZmG2, OsGNC and OsCGAl increased individual chloroplast size in three independent lines: 161% compared with controls, 141% compared with ZmG2 alone.

[0110] Figure 37 - Shows OE of ZmG2, OsGNC and OsCGAl results in higher BS chloroplast occupancy than OE ZmG2 alone. The occupancy reached 62%, which matches that in C4 sugarcane.

[0111] Figure 38 - Shows a distal enhancer and the core promoter are necessary and sufficient for bundle sheath gene expression. (A) Schematics showing deletions of nucleotides -980 to - 849 and -119 to +42. (B) Representative image of leaf cross sections of transgenic lines after GUS staining. Zoomed-in images of lateral veins shown in right panels, bundle sheath cells were highlighted with white dash line, scale bars = 50 pm. (C) Promoter activity determined by the fluorometric 4-methylumbelliferyl-P-D-glucuronide (MUG) assay, data subjected to a Kruskal-Wallis test, median indicates median value of catalytic rate of GUS protein, n indicates total number of transgenic lines assessed.

[0112] Figure 39 - Shows identification of transcription factors interacting with the SiR promoter.

[0113] Figure 40 - Shows the Y-patch and four short regions in the distal enhancer are required for bundle sheath specific expression. (A-C) Nucleotides -980 and -829 from the SiR promoter pattern expression to the bundle sheath when linked with the PIP1; 1 an NRTl.lA core promoters containing Y-patches. (A) Prediction of Y-patch and TATA-box sequences in core promoters of PIP1;1, NRT1.1A, PIP1;3 and ATPSb. (B) Representative cross sections of transgenic rice leaves after GUS staining, zoomed-in image of lateral veins shown in the right panel, bundle sheath cells highlighted with white dashed lines, scale bars = 50 pm. (C) Promoter activity determined by the fluorometric 4- methylumbelliferyl-P-D- glucuronide (MUG) assay. Data were subjected to a Kruskal -Wallis test, median indicates median value of catalytic rate of GUS protein, n indicates total number of transgenic lines assessed. (D) Schematics showing transcription factor binding sites between nucleotides - 980 and -829. (E) Schematics showing consecutive deletions between nucleotides -980 and -829 fused to the GUS reporter. (F) Representative images of cross sections from transgenic lines after GUS staining, zoomed-in images of lateral veins shown in right panels, bundle sheath cells highlighted with white dashed lines, scale bars = 50 pm. (G) Promoter activity determined by the fluorometric 4-methylumbelliferyl-P-D-glucuronide (MUG) assay. Data were subjected to a Kruskal-Wallis test, median indicates median value of catalytic rate of GUS protein, n indicates total number of transgenic lines assessed.

[0114] Figure 41 - Shows subregions in the distal enhancer not required for bundle sheath specific expression between nucleotides -980 to -829.

[0115] Figure 42 - Shows regions between nucleotides -980 and -829 that in combination with nucleotides -828 to -252 repress mesophyll expression.

[0116] Figure 43 - Shows G2-like, MYB-related, IDD and bZIP transcription factors interact and activate with the distal enhancer. (A) Schematics showing transcription factor binding sites between nucleotides -980 and -829 which are likely required for bundle sheath specific expression. (B) Effector assays showing that each transcription factor activates expression from the distal enhancer. (C) Effector assays showing synergistic activation from the distal enhancer when GLK2 and IDD3,4,6,10 were co-expressed. (D) Transcript abundance of transcription factors in bundle sheath strands (BSS) and mesophyll (M) cells during maturation. Leaf developmental stage S2 to S7 represent base of the 4thleaf at the 6th, 8th, 9th, 10th, 13th and 17th day after sowing. (E) Representative image of transgenic lines expressing WRKY121, IDD2 and bZIP9 in mesophyll cells, bundle sheath cells highlighted with white dashed lines. (F) GUS activity determined by the fluorometric 4- methylumbelliferyl-P-D-glucuronide (MUG) assay. Data were subjected to a pairwise Wilcoxon test, *** represents P <0.001.

[0117] Figure 44 - Shows nucleotide sequence in the distal enhancer.

[0118] Figure 45 - Shows transcription factors used in transactivation assay.

[0119] Figure 46 - Shows effector assay showing the effect of WRKY (A), G2-like (B), IDD (C), MYB-related (D), SNAC and bZIP (E) transcription factors on the distal enhancer.

[0120] Figure 47 - Shows schematic showing mis-expression of WRKY121, IDD2 and bZIP9 in mesophyll cells using the maize PEPC promoter driving dTALEl in combination with STAP56, 45 and 62, the bundle sheath enhancer fused with SiR core promoter were used as reporter.

[0121] Figure 48 - Shows oligomerisation of the bundle sheath enhancer increases bundle sheath expression. (A&E) Schematic showing site-directed mutagenesis of WRKY, G2-like, MYBR, IDD and bZIP motifs, mutated nucleotides were highlight in red (A), as well as the distal enhancer comprises three short regions and oligomerisation this enhancer, fusing them to the SiR or PIP1;1 core promoter sequence (E). (B&F) Representative images of cross sections from transgenic lines after GUS staining, zoomed-in image of lateral veins shown in right panel, bundle sheath cells highlighted with white dashed lines, scale bars = 50 pm. (C&G) Promoter activity determined by the fluorometric 4-methylumbelliferyl-P- D-glucuronide (MUG) assay. Data subjected to a Kruskal -Wallis test (C), or pairwise Wilcoxon test (G), *** represents P <0.001, median indicates median value of catalytic rate of GUS protein, n indicates total number of transgenic lines assessed.

[0122] Figure 49 -Shows model depicting mechanism underpinning bundle sheath expression from the SiR promoter in rice. (A) Schematic showing c / .s-regulatory landscape in SiR promoter, including Bundle Sheath (BS) enhancer, constitutive activator and mesophyll repressor. (B) Schematic indicating how the enhancer operates within a broader cis- regulatory landscape. (C&D) Schematics illustrating the Bundle Sheath enhancer along with and Y-patch and / ra / rs-acting factors that can bind and act as activators.

[0123] Figure 50 - Shows G2-like, MYB-related, IDD and bZIP transcription factor binding sites identified by FIMO program in Fd, HAC1;1, PIP 1.1, NRT1.1A, ZjPCK and FtGLDP promoters.

[0124] Figure 51 - Shows wheat bundle sheath cells after GUS staining showing bundle sheath preferential expression generated by OsSiRpro - 2.5mM Ferri&Ferro 120 hours staining.

[0125] Definitions

[0126] As used herein the term “gene”, refers to a defined region that is located within a genome and that may comprise regulatory, nucleic acid sequences responsible for the control of expression, i.e., transcription and translation of the coding portion. A gene may also comprise other 5' and 3' untranslated sequences and termination sequences. Further elements that may be present are, for example, introns and coding sequences.

[0127] As used herein, the term “analogue” in the context of a peptide or protein means an artificial or natural substance that resembles the peptide or protein in function. For example, a protein or peptide analogue may bind a receptor and thereby bring about the same or similar result as if a natural protein / peptide had bound to the receptor. In an embodiment such analogues may also resemble the protein / peptide in structure. Analogues contemplated in an embodiment of the present invention include fully or partially peptidomimetic compounds as well as peptides or proteins resembling a subject peptide in activity but comprising addition, deletion, or substitution of one or more amino acids compared to the subject peptide or protein. The term “analogue” as used herein with reference to nucleotide sequences encompasses sequences comprising addition, deletion, or substitution (including conservative amino acid substitutions) of one or more bases relative to a subject nucleotide sequence, wherein the encoded polypeptide resembles the polypeptide encoded by the subject nucleic acid molecule in function.

[0128] As used herein, the term “homologue” in the context of proteins means proteins having substantially the same functions and similar properties in different species, and which, within at least regions, share at least 50% amino acid identity. Such homologous proteins may share, over their entire amino acid sequences, at least about 30% amino acid identity, at least about 40% amino acid identity, at least about 50% amino acid identity, at least about 60% amino acid identity, at least about 70% amino acid identity, at least about 80% amino acid identity, at least about 90% amino acid identity or at least about 95% identity. Similarly, homologues of nucleic acid molecules are nucleic acid molecules that encode proteins having substantially the same functions and similar properties in different species, wherein the encoded proteins share, within at least regions, at least 50% amino acid identity (such nucleic acid homologues may share significantly less than 50% identity due to degeneracy in the genetic code, and differences in preferred codon usage amongst different genera and species), and may share at least about 30% amino acid identity, at least about 40% amino acid identity, at least about 50% amino acid identity, at least about 60% amino acid identity, at least about 70% amino acid identity, at least about 80% amino acid identity, at least about 90% amino acid identity or at least about 95% identity over the whole encoded amino acid sequences.

[0129] A “nucleic acid”, as referred to herein, refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single-, double-stranded or triplexed form. The term may encompass nucleic acids containing known analogues of natural nucleotides having similar binding properties as the reference nucleic acid. A particular nucleic acid sequence may also implicitly encompass conservatively modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences. The terms “nucleic acid”, “nucleic acid sequence” or “polynucleotide” may also be used interchangeably with gene, cDNA, and mRNA encoded by a gene. As used herein the term “bundle sheath cell” includes associated strands and mestome sheath cells, and similarly the term “substantially bundle sheath cell specific promoter” means a promoter that is mostly, if not only active in bundle sheath cells, optionally including activity in associated strands and mestome sheath cells.

[0130] As used herein the term “orthogonal” in the context of an expression system (e.g. a recombinant construct) or component / s thereof (e.g. a promoter, a transcription factor such as a dTALE, a transcription factor-activated promoter such as a STAP, a gene) will be understood to mean that the expression system or component / s thereof are capable of providing target tissue-specific and / or target cell-specific expression of nucleic acids, with only negligible or background levels of non-target tissue-specific and / or non-target cellspecific expression of the nucleic acids (e.g. less than: 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, or 10%, of the total expression of the nucleic acids provided by the expression system or component / s thereof over a given time period).

[0131] As used herein the term “bundle sheath cell-specific” promoter is one that is capable of selectively inducing expression of operably linked nucleic acids in bundle sheath cells of plants, with only negligible or background expression levels of the nucleic acids occurring in other leaf cell type / s that are not bundle sheath cells (e.g. less than: 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, or 10%, of the total expression of the nucleic acids induced by the promoter over a given time period).

[0132] As used herein, a “recombinant cell” will be understood to mean a cell into which a recombinant nucleic acid (e.g. recombinant DNA, recombinant RNA) has been introduced. A “recombinant nucleic acid” is a nucleic acid sequence comprising a combination of nucleic acid molecules that would not otherwise exist in nature. Recombinant nucleic acids as referred to herein may be synthesised recombinant nucleic acids.

[0133] As used herein, the terms “overexpress”, “overexpressed” and “overexpression” in the context of expressing a given biological entity (e.g. nucleic acid, protein, peptide and the like) in a recombinant cell refers to: (i) expression of the entity in the recombinant cell at a level greater than a level of expression of the same entity in a corresponding wild-type cell; or (ii) expression of the entity in the recombinant cell at a detectable level when a corresponding wild-type cell expresses the same entity at detectable levels, or does not express the entity at all.

[0134] As used herein, a “C3 photosynthetic plant” or a “C3 plant” will be understood to encompass any plant in which all or the majority of photosynthesis is limited to C3 photosynthesis. “C3 photosynthesis” means a photosynthetic pathway which uses only the Calvin-Benson cycle for fixing carbon dioxide from air, providing a three-carbon compound. Cell types referred to herein as “C3” will be understood to be from a “C3 photosynthetic plant”.

[0135] As used herein, a “C4 photosynthetic plant” or a “C4 plant” will be understood to encompass any plant in which all or the majority of photosynthesis is limited to C4 photosynthesis. “C4 photosynthesis” means a photosynthetic pathway in which an intermediate four-carbon compound is used to transfer CO2 to the site of CO2 fixation through the Calvin-Benson cycle. C4 photosynthesis commences with light-dependent reactions in mesophyll cells and the preliminary fixation of carbon dioxide to malate. Carbon dioxide is released from malate, where it is fixed again by RuBisCO and the Calvin- Benson cycle. Cell types referred to herein as “C4” will be understood to be from a “C4 photosynthetic plant”. C4 photosynthesis can occur in a single cell or can be distributed across multiple cells in a plant leaf.

[0136] As used herein, a “CAM photosynthetic plant” or a “CAM plant” will be understood to encompass any plant in which all or the majority of the photosynthetically active tissues of the plant conduct CAM photosynthesis. “CAM photosynthesis” is also known as “crassulacean acid metabolism” and means a photosynthetic pathway that comprises a temporally distributed carbon fixation pathway. In plants that conduct CAM photosynthesis the stomata are open at night to allow CO2 to diffuse into the leaf and be fixed into C4 acids by the enzyme phosphoenolpyruvate carboxylase. These C4 acids accumulate during the night and then during the day the plants close their stomata and decarboxylate the C4 acids to release CO2 around RuBisCO. Thus, PEP carboxylation and RuBisCO carboxylation are temporally separated in CAM plants. “CAM photosynthetic plants” as referred to herein include “inducible CAM plants” or “facultative CAM plants”, which will be understood to be plants that can switch between normal C3 photosynthesis and CAM photosynthesis depending on environmental conditions. The “inducible CAM plants” may also switch between CAM and C4 photosynthesis. “CAM photosynthetic plants” as referred to herein may also conduct a version of CAM photosynthesis known as "CAM-cycling", in which stomata do not open at night, but instead the plants recycle CO2 produced by respiration and store some CO2 that is captured during the day.

[0137] As used herein, a percentage of “sequence identity” will be understood to arise from a comparison of two sequences in which they are aligned to give a maximum correlation between the sequences. This may include inserting “gaps” in either one or both sequences to enhance the degree of alignment. The percentage of sequence identity may then be determined over the length of each of the sequences being compared. For example, a nucleotide sequence (“subject sequence”) having at least 95% “sequence identity” with another nucleotide sequence (“query sequence”) is intended to mean that the subject sequence is identical to the query sequence except that the subject sequence may include up to five nucleotide alterations per 100 nucleotides of the query sequence. In other words, to obtain a nucleotide sequence of at least 95% sequence identity to a query sequence, up to 5% (i.e. 5 in 100) of the nucleotides in the subject sequence may be inserted or substituted with another nucleotide or deleted.

[0138] As used herein the term “operably linked” refers to an arrangement in which a first nucleic acid sequence is placed in a functional relationship with a second nucleic acid sequence, such that the first nucleic acid sequence affects the function of the second nucleic acid sequence. For example, a sequence encoding a transcription factor (e.g. a dTALE sequence) is operably linked to a transcription factor-activated promoter sequence (e.g. a STAP) if the encoded transcription factor can bind and activate the promoter. Similarly, a promoter is operably linked to a gene sequence if the promoter can regulate transcription of the gene. Operably linked nucleic acid sequences may be components of a single contiguous nucleic acid molecule. Operably linked nucleic acid sequences may be adjacent to one another, either directly or with intervening sequence between them. A promoter operably linked to a coding sequence will be capable of modulating the transcription of the coding sequence.

[0139] Unless the context clearly requires otherwise, throughout the description and the claims, the words “comprise”, “comprising”, and the like are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense; that is to say, in the sense of “including, but not limited to”.

[0140] Detailed Description of the Invention

[0141] Engineering metabolic pathways in organisms such as plants may require specific expression of one or more target genes in particular cells, and where a plurality of such target genes is required, their expression may be required at significantly different levels, lest one or more points within a pathway become overloaded or that essential metabolites be diverted excessively from other pathways. For example, the expression of C4 photosynthesis in rice will demand activation of multiple genes in bundle sheath (BS) cells at different levels. Another problem with expressing multiple genes within cells is the potential for unintended off-target activation (or suppression) of other genes.

[0142] During the studies leading to the present invention, it was found that controlled expression of target genes specifically in bundle sheath cells can be achieved using a new promoter derived from rice SULFITE REDUCTASE known as SiRpro. SiRpro has also been identified as having suitability for controlling transcription factor / promoter pairings within bundle sheath cells and is otherwise suitable for use in the more general application of bundle sheath cell-specific gene expression.

[0143] Thus, the promoter, methods and constructs of the present invention allow for a target gene to be substantially specifically expressed in bundle sheath cells of a plant.

[0144] In one aspect of the present invention, a novel promoter (SiRpro) derived from rice SULFITE REDUCTASE has been developed that drives bundle sheath-specific gene expression. Compared with other promoters such as ZjPCKpro, the SiRpro is stronger and activated at earlier stages during leaf development. This promoter is compatible with the dTALE / STAP system by which expression level can be tuned, and transgenes can be multiplexed. In addition, short DNA fragments in SiRpro that activate or repress gene expression in specific leaf cell types of rice have been identified. Bundle sheath activity from SiRpro is mediated by interaction between specific chromatin sequence and the nascent 5’ UTR RNA. A particular region of DNA ensures that this interaction does not take place in the mesophyll cells. A number of functional DNA fragments of SiRpro have also been identified and are disclosed herein.

[0145] SiRpro and the functional DNA fragments thereof have a number of potential applications, for example, they may be used for manipulating bundle sheath associated biological processes in crops, such as water transport, sulphur and nitrogen assimilation, transport of nutrients and photosynthetic metabolites and so on; for engineering the C4 cycle into C3 crops, they may also be used for modifying bundle sheath development, such as enhancing chloroplast and cell wall biosynthesis, and expressing C4 photosynthesis related enzymes and metabolite transporters.

[0146] In some embodiments, the methods comprise introducing into one or more cells of a plant a recombinant construct. The recombinant construct comprises a target gene operably linked to SiRpro. In some preferred embodiments, the recombinant construct comprises the target gene operably linked to at least one transcription-factor activated promoter, the transcription-factor activated promoter(s) being in turn operably linked to a corresponding transcription factor. In such embodiments, the construct also comprises a bundle-sheath cell-specific promoter which controls expression of the transcription factor, such as a promoter of the invention. Where higher or amplified expression of a target gene in bundle sheath cells is desired a target gene may for example be operably linked to a plurality of transcription-factor activated promoters which are in turn operably linked to a transcription factor under the control of the bundle-sheath cell-specific promoter. In some preferred embodiments, methods and constructs have been designed to be orthogonal to the host genome to thereby minimise the chance of any off-target activation of endogenous genes. In other embodiments, the methods comprise introducing into one or more cells of a plant a recombinant construct. The recombinant construct comprises the target gene(s) operably linked to a promoter of the present invention, for example, a sulfite reductase (SiR) promoter of the invention or a functional fragment thereof. The promoter may, for example, be a modified Oryza sativa sulfite reductase promoter (OsSiR promoter). Expression of the target gene(s) using the promoter can facilitate expression of the target gene within the cells. The cells are preferably bundle sheath cells of rice plants. The expression of the gene(s) within the bundle sheath cells may be substantially or entirely orthogonal. In embodiments of the invention, the promoter or fragment thereof may be in an isolated form.

[0147] The sulfite reductase (SiR) promoter

[0148] The novel Oryza sativa SiR promoter (OsSiRpro) of the invention allows for direction of substantially specific gene expression to rice BS cells and is suitable for use in the methods according to the present invention. Non-limiting examples of suitable OsSiR promoter sequences are set out in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 39.

[0149] According to an embodiment of the present invention, the OsSiRpromay comprise or consist of a sequence as defined in any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 39, or an analogue or homologue thereof. The promoter may comprise one or more substitutions, insertions or deletions, provided its specificity for expression in bundle sheath cells and its function are not significantly altered, although the modification may include enhancements in promoter activity in accordance with the invention and preferred use of the promoter. The promoter may comprise a sequence sharing at least about 85% identity, at least 90% identity, at least 95% identity, or at least 99% identity with the sequence of SEQ ID NOs: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 39. Oligomerized subfragments of the OsSiRproare also contemplated herein as substantially bundle sheath cell-specific promoters.

[0150] One embodiment of the invention includes residues 2325 to 2575 of SEQ ID NO: 1 or 2 and residues 1596 to 1746 of SEQ ID NO: 1 or 2. In experiments leading to the invention, it was surprisingly found that the sequence represented by residues 2325 to 2575 provides bundle sheath specific expression, whereas the sequence represented by residues 1596 to 1746 represses mesophyll expression (Figure 9). Additional elements that either enhance BS-specific expression or repress mesophyll expression were also identified. For example, Residues 1988 to 2037 of SEQ ID NO. 1 or 2 enhance BS-specific expression and appear to be an EIL binding site. Further, residues 2164 to 2169 of SEQ ID NO. 1 or 2 repress mesophyll expression and appear to be an E-box site. According to another embodiment, a bundle sheath cell-specific promoter for use in a method or construct of the present invention may comprise a minimal promoter sequence comprising at least nucleotide -980 to -395 and / or nucleotide -394 to +42 of the OsSiRpro(SEQ ID NO: 18 and / or SEQ ID NO: 19, respectively), or a variant, homologue or analog thereof conferring the same specificity and having at least about 85% identity, at least 90% identity, at least 95% identity, or at least 99% identity with nucleotide -980 to -395 and / or nucleotide -394 to +42 of the OsSiRpro(SEQ ID NO: 19 and / or SEQ ID NO: 18, respectively), optionally operably linked to a TATA box. According to another embodiment, a bundle sheath cell-specific promoter for use in a method or construct of the present invention may comprise at least regions nucleotide from -980 to -850, -251 to +42 of the OsSiRpm(SEQ ID NO: 20, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 24); or a variant, homologue or analog of the aforementioned sequences conferring the same specificity and having at least about 85% identity, at least 90% identity, at least 95% identity, or at least 99% identity with said aforementioned sequences. According to another embodiment, a bundle sheath cell-specific promoter for use in a method or construct of the present invention may comprise at least nucleotide from -980 to -850, -251 to +42 of the OsSiRpro (SEQ ID NO: 39), or a variant, homologue or analog thereof conferring the same specificity and having at least about 85% identity, at least 90% identity, at least 95% identity, or at least 99% identity with nucleotide from -980 to -850, -251 to +42 of the (?55z7?pro(SEQ ID NO: 39), optionally operably linked to a TATA box.

[0151] Target genes for expressing in bundle sheath cells

[0152] Any gene the expression of which is desired in bundle sheath cells may be employed in the methods of the present invention.

[0153] According to certain embodiments, the target gene(s) may be one or more C4 genes including Malic enzyme (NAD- or NADP-dependent; see, for example, SEQ ID NOs: 40 and 42, respectively), PCK (see, for example, SEQ ID NO: 41), and aspartate aminotransferase (see, for example, SEQ ID NO: 43).

[0154] According to other embodiments, the target gene(s) may be components of one or more other metabolic pathways including, for example, enzymes associated with sugar or storage carbohydrate synthesis, metabolism and transport, such as SUT1, SWEET13A,B, ADPG-pyrophosphorylase and sucrose phosphate synthase, transporter proteins such as BASS2, PPT1, 0MT1, DIT2, and NHD1, and proteins involved in ion homeostasis, hydraulic conductance, transport of metabolites in and out of veins, and response to high light episodes. Reporter genes may also be used to track successful transformation and may be placed under the control of substantially bundle sheath cell-specific promoter(s) or under the control of constitutive promoter(s). Examples of suitable reporter genes include those encoding GUS (see, for example, SEQ ID NO: 6), GFP (see, for example, SEQ ID NO: 9), KOrange (Kusabira Orange; see, for example, SEQ ID NO: 44), mTurquoise2 (see, for example, SEQ ID NO: 8), mNeonGreen (see, for example, SEQ ID NO: 45), mClover3 (see, for example, SEQ ID NO: 46), tdTomato (see, for example, SEQ ID NO: 47) and KOkappa (see, for example, SEQ ID NO: 48).

[0155] Antibiotic resistance genes, and other selection genes, such as herbicide resistance genes, may also be employed to assist in transformant selection / screening, and may be placed under the control of substantially bundle sheath cell-specific promoter(s) or under the control of constitutive promoter(s). Suitable selection genes may include, for example, the hygromycin resistance gene (see, for example, SEQ ID NO: 36) and BASTA (glufosinate) resistance genes (see, for example, SEQ ID NOs: 49 and 50).

[0156] Recombinant constructs

[0157] Recombinant constructs of the present invention may be created in any suitable cloning system as known in the art, using known techniques. General guidance on suitable methods can be found, for example, in standard texts such as Green and Joseph. (2012), Molecular cloning: a laboratory manual, fourth edition. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press; Ausubel et al. (1987-2016). Current Protocols in Molecular Biology. New York, NY, John Wiley & Sons; and ‘Cloning a Specific Gene.’ in Griffiths et al. 1999 Modern Genetic Analysis. New York: W. H. Freeman.

[0158] According to certain embodiments, the cloning system lends itself easily to modular insertion of desired sequences, such as the Golden Gate modular cloning system (Weber, E., Engler, C., Gruetzner, R., Werner, S., Marillonnet S. (2011) “A Modular Cloning System for Standardized Assembly of Multigene Constructs” PLOS ONE. doi.org / 10.1371 / joumal. pone.0016765, the entire disclosure of which is incorporated herein by cross-reference). The recombinant construct may be constructed to include one or more target genes, operably linked to the bundle-sheath cell specific promoter of the invention or one or more transcription factor activated promoters, which are operably linked to the bundle-sheath cell specific promoter of the invention. Multiple genes may be operably linked to a single transcription factor activated promoter (such as a STAP), or each target gene may be operably linked to a separate transcription factor activated promoter (such as a STAP), or each target gene may be operably linked to a plurality of transcription factors which, together (fused, linked in series, or otherwise interconnected), result in increased expression of the target gene, or any combination of the foregoing.

[0159] In such embodiments, the transcription factor activated promoter(s) is / are operably linked to at least one transcription factor (such as a dTALE). In one preferred embodiment, the transcription factor activated promoter(s) / target gene assembly(ies) is / are under the effect of one dTALE, although multiple transcription factors may be employed to effect multiple transcription factor activated promoters (such as one transcription factor activated promoter / target gene assembly per transcription factor, or a combination of single associations and multiple associations). In addition, a plurality of transcription-factor activated promoters (such as STAPs) may be fused, linked in series or otherwise operably interconnected, and the fused / linked promoters operably linked to a single target gene.

[0160] In such embodiments, the transcription factor(s) (for example dTALE) is operably linked to the bundle sheath cell-specific promoter (such as OsSiRpro) of the invention, upstream of the transcription effector / transcription factor activated promoter / target gene assemblies.

[0161] The construct may also comprise an antibiotic resistance gene (such as the hygromycin resistance gene hpl), or other selective marker, operably linked to an appropriate promoter, which may be constitutive and ubiquitous (such as the actin promoter), orientated in the opposite direction to the OsSiRpropromoter, or which may be inducible and / or expressed selectively in certain cell types.

[0162] Methods for transforming plant cells and obtaining plants therefrom

[0163] Recombinant constructs as described above may be introduced into plants by a variety of techniques as known in the art including, for example, Agr()bacterium-mQd\aiQ transformation, cation or polyethylene glycol treatment of protoplasts, electroporation, microinjection, viral infection, protoplast fusion, microparticle bombardment, abrasion of plant material with DNA-coated particles (such as carborundum), agitation of cell suspensions in solution with microbeads or microparticles coated with the transforming DNA, direct DNA uptake, liposome-mediated DNA uptake, and the like, as also described in a wide range of publicly available texts, such as: “Methods for Plant Molecular Biology” (Weissbach & Weissbach, eds., 1988); Clough, S.J. and Bent, A.F. (1998) “Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thalianci" Plant J Ab, 735-743; “Methods in Plant Molecular Biology” (Schuler & Zielinski, eds., 1989); “Plant Molecular Biology Manual” (Gelvin, Schilperoort, Verma, eds., 1993); and “Methods in Plant Molecular Biology-A Laboratory Manual” (Maliga, Kiessig, Cashmore, Gruissem& Varner, eds., 1994). See also Sambrook, J. et al., Molecular Cloning, Cold Spring Harbor Laboratory (1989), Sambrook, J. and Russell, D.W. (2001), “Molecular Cloning: A Laboratory Manual”, 3rd edition, Cold Spring Harbor Laboratory Press, and references cited therein and Ausubel et al. (eds) Current Protocols in Molecular Biology, John Wiley & Sons (2000), these references being incorporated herein by cross-reference.

[0164] The preferred method of transformation may depend upon the plant to be transformed. Agrobacterium vectors are often used to transform dicot species, especially members of the Solanaceae and Brassicaceae . However, HgroZ>acterzwm-mediated transformation of monocotyledonous species, including rice and wheat, have been known for some time and are now well established (see, for example, International patent publications WO 97 / 48814; see also Hiei, Y. et al (1994), Plant J. 6(2):271-282 and international patent publication WO 92 / 06205). Biolistic bombardment with particles coated with transforming DNA / constructs and silicon fibers coated with transforming DNA are often useful for nuclear transformation. More recently nanoparticle-mediated direct delivery of genetic material into plant cells, including monocot cells, has been developed and overcomes a number of the drawbacks associated with other transformation techniques (such as tissue damage, cytotoxicity, apoptosis, necrosis) - see, for example, Cunningham, F.J. et al (2018) Trends in Biotechnology 36(9) DOI: 10.1016 / j.tibtech.2018.03.009}

[0165] Any of the methods of the present invention, as discussed above or below, can be used to transform any plant cell. In this manner, genetically modified plants, plant cells, plant tissue, seed, and the like can be obtained. The plant cell(s) to be transformed may be a plant cell from any plant selected from angiosperms or gymnosperms. Non-exhaustive examples of angiosperms for treatment or transformation by a method of the invention may include any member of the Aceraceae, Anacardiaceae, Apiaceae, Asteraceae, Betulaceae, Brassicaceae, Buxaceae, Chenopodiaceae / Amaranthaceae, Compositae, Cucurbitaceae, Fabaceae, Fagaceae, Gramineae, Juglandaceae, Lamiaceae, Lauraceae, Leguminosae, Moraceae, Myrtaceae, Oleaceae, Platanaceae, Poaceae, Polygonaceae, Rosaceae, Rutaceae, Salicaceae, Solanaceae, Ulmaceae or Vitaceae. Examples of gymnosperms for treatment or transformation by a method of the invention may include any member of the Cuppressaceae, Pinaceae, Taxaceae or Taxodiaceae.

[0166] In some embodiments, the plant cell(s) to be transformed may be from any of a C3 photosynthetic plant, a C4 photosynthetic plant, or a CAM photosynthetic plant.

[0167] In some embodiments, the transgenic plants may be monocotyledonous. In other embodiments, the transgenic plants may be dicotyledonous. In still other embodiments, the transgenic plants may be a genus Oryza plant such as, for example, a rice plant (e.g. an Oryza sativa plant or an Oryza glaberrima plant). In some embodiments, the transgenic plant may be soy (Glycine max), cotton (Gossypium hirsutum), oilseed rape / Cannola (B. napus subsp. Napus), potato (Solanum tuberosum), tomato (Solarium lycopersicum), cassava (Manihot esculenta), maize (Zea mays), sorghum (Sorghum bicolor), sugar cane (Saccharum officinarum), foxtail millet (Setaria italica), proso millet (Panicum miliaceum), mischanthus (Miscanthus giganteus), wheat (Triticum aestivum), barley (Hordeum vulgar e), pigeon pea (Cajanus cajan), cowpea (Vigna unguiculata), pea (Pisum sativum), cannabis (Cannabis sativa), sugar beet (Beta vulgaris), oat (Avena sativa), rye (Secale cereal), peanut (Arachis hypogaea), sunflower (Helianthus annuus), flax (Linum spp.), beans (Phaseolus vulgaris), lima bean (Phaseolus lunatus), mung bean (Phaseolus mung), adzuki bean (Phaseolus angularis), Chickpea (Cicer arietinum), tobacco (Nicotiana tabacum), buckwheat (Fagopyrum esculentum), oil palm (Elaeis guineensis), or rubber (Hevea brasiliensis).

[0168] Also provided are seeds obtained from the transgenic plants of the present invention.

[0169] According to certain embodiments, the plant is a crop plant, such as a cereal crop plant. The plant may be a C3 grass. The plant may be a wheat, barley, oat or rice plant. According to a specific embodiment the plant is a rice plant.

[0170] Cells which have been transformed may be grown into plants in accordance with conventional methods as are known in the art (See, for example, McCormick, . etal (1986), Plant Cell Reports 5:81-84). Such cells may be screened early on by their ability to grow in the presence of antibiotics, by virtue of including an antibiotic resistance gene in the recombinant construct (under the regulation of an appropriate promoter). The resulting plants may be self-pollinated, pollinated with the same transformed strain or different strains or hybridised, and the resulting plant(s) expressing the target gene(s) in bundle sheath cells identified. Such plants may be identified by virtue of expression of a reporter gene, such as GUS or GFP, in the bundle sheath cells. Two or more generations may be grown to ensure that the desired phenotypic characteristic is stably maintained. Alternatively, in vegetatively propagated crops, mature mutant / transgenic plants may be propagated by cutting or by tissue culture techniques to produce identical plants. Selection of mutant / transgenic plants can be carried out and new varieties may be obtained and propagated vegetatively for commercial use. For a general description of plant transformation and regeneration see, for example, Walbot et al. (1983) in “Genetic Engineering of Plants”, Kosuge et al. (eds.) Plenum Publishing Corporation, 1983 and “Plant Cell, Tissue and Organ Culture: Fundamental Methods”, Gamborg and Phillips (Eds.), Springer-Verlag, Berlin (1995). See also Sambrook, J. et al., Molecular Cloning, Cold Spring Harbor Laboratory (1989), Sambrook, J. and Russell, D. W. (2001), “Molecular Cloning: A Laboratory Manual” , 3rd edition, Cold Spring Harbor Laboratory Press, and references cited therein and Ausubel et al. (eds) Current Protocols in Molecular Biology, John Wiley & Sons (2000).

[0171] Plants transformed / mutated by the methods of the invention may also be screened based on expression of one or more of the inserted gene(s), for example by detecting expression of the introduced nucleotide sequence(s), by molecular analysis using specific oligonucleotide probes and / or amplification of the target gene.

[0172] Plants expressing target genes in bundle sheath cells

[0173] Plants expressing one or more target gene(s) in bundle sheath cells (including associated strands and mestome sheath cells), obtained by any of the methods described above, are also encompassed within the ambit of the present invention. Such plants may include, for example, plants expressing one or more components of the C4 photosynthetic pathway.

[0174] According to an embodiment, the plant(s) obtained by the methods of the present invention express one or more components of the C4 photosynthetic pathway, optionally all necessary components for a complete C4 photosynthetic pathway.

[0175] According to an embodiment, the plant may be any member of the Aceraceae, Anacardiaceae, Apiaceae, Asteraceae, Betulaceae, Brassicaceae, Buxaceae, Chenopodiaceae / Amaranthaceae, Compositae, Cucurbitaceae, Fabaceae, Fagaceae, Gramineae, Juglandaceae, Lamiaceae, Lauraceae, Leguminosae, Moraceae, Myrtaceae, Oleaceae, Platanaceae, Poaceae, Polygonaceae, Rosaceae, Rutaceae, Salicaceae, Solanaceae, Ulmaceae or Vitaceae. Examples of gymnosperms for treatment or transformation by a method of the invention may include any member of the Cuppressaceae, Pinaceae, Taxaceae or Taxodiaceae.

[0176] According to certain embodiments, the plant is a crop plant, such as a cereal crop plant. The plant may be a C3 grass. The plant may be a wheat, barley, oat or rice plant. According to a specific embodiment the plant is a rice plant, and according to a more specific embodiment, the plant is a rice plant expressing one or more components of the C4 photosynthetic pathway, optionally all necessary components for a complete C4 photosynthetic pathway. Preferably, the plant is Oryza sativa.

[0177] Also encompassed are plant parts, including but not restricted to leaves, stems, roots, tubers, flowers, fruits and seeds, fruit, embryos, or shoots, leaves, stems, roots, stolons, tubers, buds, cuttings or other non-reproductive vegetative material thereof obtained from such plants. Preferred forms of the present invention will now be described, by way of example only, with reference to the following examples, including comparative data, and which are not to be taken to be limiting to the scope or spirit of the invention in any way.

[0178] Example 1

[0179] Materials and Methods

[0180] Plant Materials and Growth Conditions

[0181] Kitaake rice (O. sativa ssp. Japonicd) was transformed using Agrobacterium tumefaciens as described previously (Hiei and Komari (2008) Nat. Protoc. 3, 824-834) with the following modifications. Mature seeds were sterilized with 2.5% (v / v) sodium hypochlorite for 15 mins, and calli were induced on NB medium with 2 mg / L 2,4-D at 30°C in darkness for 3-4 weeks. Actively growing calli were then co-incubated with A. tumefaciens strain LBA4404 in darkness at 22°C for 3 days. Calli were selected on NB medium supplied with 35 mg / L hygromycin B for 4 weeks, and proliferating calli regenerated on NB medium with 10 mg / L hygromycin B for 4 weeks at 28°C under continuous light condition. Plants resistant to hygromycin were planted in 1 : 1 mixture of top soil and sand and placed in a greenhouse at the Botanic Gardens, University of Cambridge under natural light conditions but supplemented with minimum light intensity of 390 pmol m-2s-1, 60% humidity, temperatures of 28°C and 23°C during the day and night respectively, and a photoperiod of 12 h light, 12 h dark. Subsequent generations were grown in a growth cabinet in 12 h light / 12 h dark, at 28°C, relative humidity of 65%, and a photon flux density of 300 pmol m-2s-1.

[0182] Identification and cloning of OsSiR promoter

[0183] Leaf samples for LCM were processed as described (Hua, L. & Hibberd, J.M. (2019) Plant Direct 3, e00156). After laser capture microdissection of bundle sheath, veinal and mesophyll cells of Kitaake, followed by RNA sequencing (Hua et al., 2021) a rice gene (LOC_Os05g42350) annotated as ferredoxin-nitrite reductase in the MSU7 genome annotation was identified as showing preferential expression in the bundle sheath. Subsequent analysis using BlastP indicated that the gene is more similar to sulfite reductase rather than nitrite reductase genes from maize and Arabidopsis thaliana. A 2613 -bp promoter region containing 42-bp of the 1stexon of the rice sulfite reductase gene (LOC_Os05g42350) was amplified from Kitaake genomic DNA using forward primer pENTR-BS15.0_F-CACCATGCTTGACCATGTGGACTC (SEQ ID NO: 51) and reverse primer pENTR-BS15.0_R-ACGGAACCCGTGGAACTC (SEQ ID NO: 52). The PCR product was purified using QIAquickgel extraction kit (Qiagen) then placed in the pENTR / D-TOPO cloning vector (Invitrogen). The promoter-GUS construct was prepared with the entry vector containing the promoter (hereafter termed SiRpro) and destination vector pGWB3 (containing the intronless GUS coding sequence) using an LR reaction according to Gateway cloning manual.

[0184] To engineer the SiRpro such that it is compatible with the Golden gate system, four Bsa\ or Bpil restriction enzyme recognition sites at -214, -298, -1468, and -2309 were mutated from T to A and cloned into the pAGM9121 vector using Golden Gate level 0 cloning reactions and then into a level 0 PU module EC 14328 (SEQ ID NO: 2), which was used for driving kzGUS (intronless GUS) (SEQ ID NO: 6) and H2B-mTurquoise2 (H2B SEQ ID NO: 7; mTurquoise 2: SEQ ID NO: 8) reporter genes via Golden gate reaction and using Tnos (SEQ ID NO: 37) as a terminator.

[0185] All deletion series was generated using EC 14328 (SEQ ID NO: 2) as the template and prepared as level 0 PU modules, and the three prime deletion construct prepared as level 0 P modules. The minimal CaMV35S promoter (SEQ ID NO: 34) was used as the U module, and they were linked with kzGUS (SEQ ID NO: 6) and terminated with Tnos (SEQ ID NO: 37)

[0186] To test SiRpro in the dTALE / STAP system, the 42-bp coding region were excluded and the 2571-bp resultant fragment placed into a level 0 PU module EC14330 (SEQ ID NO:3) and was used to drive dTALEl (SEQ ID NO: 10). Two reporters were used. For the GUS reporter kzGUS (SEQ ID NO: 6) was linked with STAP1.62 (SEQ ID NO: 12) and terminated with Tnos (SEQ ID NO: 37). In the fluorescent reporter construct, a chloroplast targeting peptide fused to mTurquoise 2 CP: SEQ ID NO: 13; mTurquoise 2: SEQ ID NO: 8) was linked with STAP1. 4 (SEQ ID NO: 11) and terminated with Tact2 (SEQ ID NO: 38) In both constructs, pOsActl driving HYG (Hygromycin resistant gene) was terminated with Tnos (pOsActl: SEQ ID NO: 35; HYG SEQ ID NO: 36; Tnos: SEQ ID NO: 37) and used as the selection marker during rice transformation.

[0187] Example 2

[0188] The SiR promoter from rice allows expression in the bundle sheath To identify sequences that could allow more robust expression in bundle sheath cells of rice we first investigated the patterns of gene expression in this tissue. Initially, we used Laser Capture Microdissection (LCM) to generate transcriptomes of bundle sheath strands and mesophyll cells from mature leaves of IR64. Promoter sequence form seven of the most strongly expressed genes in bundle sheath strands (Figure 1A) were cloned, fused to the P- glucoronidase (GUS) reporter and transformed into Kitaake. Although five of these promoters (MYB, bolA, GS1, SRP and ABP) led to GUS accumulation, it was restricted to veins. For the other two promoters (SULTR3.1 and SULTR3.3') no staining was observed (Figure IB, 1C). The approach of cloning promoters from bundle sheath strands therefore appeared to be more efficient at identifying sequences capable of driving expression in veins than in bundle sheath cells per se. We therefore developed an optimised LCM procedure allowing bundle sheath cells to be separated from veins (Hua and Hibberd, 2019), and with this approach produced high quality transcriptomes from mesophyll, bundle sheath and vascular bundles of rice (Hua et al., 2021). From these data, eighteen genes preferentially expressed in bundle sheath cells compared with both veins and mesophyll cells were identified (Figure 2A). Their promoters were cloned, fused to GUS and transformed into rice. Of these eighteen promoters, four (A TPS, SiR, HAC1.1, Fd) were sufficient to generate some expression in the bundle sheath (Figure 2B). However, ATPS and Fd also displayed weak activity in mesophyll, and the HAC1.1 promoter showed GUS in the epidermis and vascular bundles as well as the bundle sheath cells. Thus, only the SiR promoter drove strong expression in bundle sheath cells, with no detectable GUS expression in mesophyll. An additional six promoters (PPase, PIP 1.1, PIP 1.3, ADF, PTR2, NIA2) generated expression in vascular bundles, and eight promoters produced no staining (Figure 2B, 2C) Taken together, multiple bundle sheath promoters were identified from rice endogenous bundle sheath preferentially expressed genes, among them, SiR promoter were identified to drive specific bundle sheath expression with no detectable expression in mesophyll or epidermis, hence SiR promoter was selected for further characterization.

[0189] Example 3

[0190] The SiR promoter drives strong and early expression in bundle sheath cells

[0191] The above analysis indicated that sequence upstream of the SiR gene from -2571 to +42- bp (from ATG) was sufficient to generate strong expression in the rice bundle sheath. To allow a faster analysis of the sequences responsible for this output we domesticated the sequence such that is compatible with the modular Golden Gate cloning system, and in so doing removed four Bsal and Bpil sites. A fusion of this modified OsSiRpro sequence to GUS also generated strong bundle sheath preferential accumulation indicating that these domesticated sites were not necessary for this patterning (Figure 3A). Fusion to a nuclear- targeted mTurquoise2 fluorescent protein confirmed that the SiR sequence is sufficient to direct expression to bundle sheath cells, but also generated some expression in the longer nuclei of veinal cells (Figure 3B). Promoter activity determined by the fluorometric 4- methylumbelliferyl-P-D-glucuronide (MUG) assay showed the original (pENTR SiRpro and domesticated SiRpro have similar activity (Figure 3C). Compared with 0.58 nmol 4- MU / min / mg protein from ZjPCKpro (Emmerling, 2018) MUG activity from the SiR promoter was at least 36% higher.

[0192] The SiR promoter is compatible with the dTALE-STAP system and its activity can be strengthened

[0193] The dTALE-STAP system (Designer Transcription Activator-Like Effector (dTALE)) and cognate synthetic TALE-activated promoters (STAPs) allows multiple transgenes to be driven by a single promoter (Bruckner et al., 2015; Danila et al., 2022). To test whether 57A / ?ro-mediated bundle sheath expression can be maintained and strengthened by the dTALE-STAP system, it was placed upstream of the dTALE sequence. STAP62 and STAP4 were fused to a chloroplast targeted mTurquoise2, and cytosolic kzGUS respectively. Stable transformants harbouring these reporters showed bundle sheath specific expression (Figure 3D, 3E). Activity of MUG mediated by dTALE and STAP62 was ~18-fold higher than GUS driven by endogenous SiR promoter (Figure 3F). We conclude that SiR is compatible with the dTALE-STAP system and its activity can be strengthened.

[0194] SiRpro is able to drive detectable expression earlier than known promoters

[0195] We next tested whether the SiR promoter can drive expression in bundle sheath cells earlier than the ZjPCKpro promoter. GUS staining was detected in developing 5 -20mm long fourth leaves, whereas this was not the case for ZjPCKpro (Figure 4A, 4B, 4D, 4E, 4G, 4H, 4J, 4K) Consistent with the GUS data, fluorescence from mTurquoise2 was localized to bundle sheath and vascular nuclei in 5-20mm fourth leaves driven by SiRpro. However, GFP fluorescence signal was not detectable in stable lines containing ZjPCKpro driving dTALE and STAP4:GFP (Figure 4C, 4F, 41, 4L). These results indicate that SiRpro is able to drive detectable expression earlier than ZjPCKpro. Example 4

[0196] Nucleotides from -980 to -394 bp in the SiR promoter are necessary for expression in the bundle sheath

[0197] To provide an overview of DNA sequences in the SiR promoter that could limit expression to the bundle sheath, we used the Find Individual Motif Occurrences (FIMO) program to define known cv.s-elements between nucleotides -2571 and +42 bp from the translational start site. After removing binding sites associated with transcription factors not expressed in rice leaves, 137 binding sites belonging to 34 motif clusters remained (Figure 5A). Thus, this 2613 bp region of the SiR gene contains a complex c / .s-regulatory landscape. To investigate regions necessary for expression in the bundle sheath we generated a 5’ deletion series (Figure 5B). Deleting nucleotides -2180 to -1490 and -1490 to -980 led to a statistically significant reduction and increase in MUG activity respectively (Figure 5C&D), but neither abolished preferential accumulation of GUS in the bundle sheath (Figure 5C). These data therefore exclude 84 individual cv.s-elements associated with binding of 34 transcription factor families as being necessary for expression in the bundle sheath. However, when nucleotides -980 to -394 bp from the predicted translational start site were deleted, GUS was no longer detectable in bundle sheath cells (Figure 5C). Consistent with this GUS staining, the MUG assay showed that removal of these nucleotides led to a statistically significantly reduction in activity (Figure 5D). Thus, nucleotides -980 to -394 bp of the SiR promoter are necessary for bundle sheath specific expression. To test whether this region is also sufficient for bundle sheath specific expression, we linked it to the minimal CaMV35S core promoter. Whilst this fusion generated weak GUS signal in a few veinal cells, it failed to do so in the bundle sheath (Figure 5B, 5C, 5D). Sequence between -394 and +42 bp must therefore interact with that between -980 and -394 to specify expression to the bundle sheath. To better understand the regions responsible for this interaction we next used an unbiased 5’ and 3’ deletion approach to dissect the region of -980 - +42 bp.

[0198] The 5’ deletion series revealed a complex c / .s-regulatory landscape within the SiR promoter. For example, when nucleotides -980 to -849 bp were removed, very weak GUS staining without preferential pattern was observed and activity was significantly reduced (Figure 6A, 6B). These data indicate that nucleotides -980 to -849 bp of the SiRpro are necessary for expression in the leaf. However, when region -849 to -700 bp was removed, accumulation of GUS was strong in both bundle sheath and mesophyll cells (Figure 6A, 6B) When nucleotides -700 to -394 bp were deleted, GUS accumulation was once again no longer detectable in either cell type (Figure 6A, 6B). The 3’ deletion in which -119 to +42 bp abolished accumulation of GUS in both bundle sheath and mesophyll cells (Figure 6A, 6B) We conclude that nucleotides -700 to -394 containing 33 cv.s-elements associated with 6 families of transcription factors activate promoter activity. Moreover, nucleotides from -849 to -700 bp that contain only one known cv.s-element known as GT-2 and bound by the Trihelix family of transcription factors repress expression of SiR in mesophyll cells.

[0199] Example 5

[0200] Analysis of minimal SiRpro for bundle sheath specific expression

[0201] The above analysis identified two regions that were necessary for strong expression in the bundle sheath. We next fused them to test whether they are sufficient. When nucleotides -980 to -849 bp were combined with -119 to +42 bp weak expression in the bundle sheath was detected (Figure 5B, 5C). The sequence spanning -119 to +42 bp likely represents the core promoter but also encodes the 5’ untranslated region (Figure 7A). For SiR, there is evidence of two major transcription start sites (TSS) at nucleotides -91 (TSS1) and -41 bp (TSS2) supported by full length cDNA clones and RNA sequencing abundance (Figure 7 A). Although there is no canonical TATA-box in this region, at -130 bp there is a TATA- box variant (5'-ATTAAA-3’) (Civan and Svec, 2009) that might be responsible for transcription at TSS1. Moreover, a putative pyrimidine patch (Y-patch) that represents an alternate but common TC-rich core promoter motif (Civan and Svec, 2009) is located between TSS1 and TSS2 (Figure 7A). We assume that core promoter elements in this region were not sufficient to initiate robust transcription, to test this, we scanned core promoter elements in region -251 to +42 bp, and this identified MTE, BREu and DCE S I core promoter motifs around TSSs and presenting in upstream region (Figure 7B). We then expanded core promoter region to -197 bp and -251 bp, this generated stronger bundle sheath specific expression of GUS reporter especially when region -251 to -119 bp were included (Figure 7C, 7D, 7E). These results indicate that bundle sheath-specific expression is likely caused by interaction between regions of -980 to -849 bp and -119 to +42 bp, and TF binding sites or core promoter elements in region of -251 to -119 enhance and are required for strong bundle sheath specific expression.

[0202] We also investigated if the 5’UTR was required to be transcribed for SiR promoter activity, and generated lines with the reverse complemented 5’UTR sequence containing both TSS 1 and TSS2, it showed that GUS expression was no longer detectable (Figure 7C, 7D, 7E). However, we didn’t observe obvious accumulation of RNA Polymerase II on 5’UTR using permanganate footprinting (Figure 8), suggesting SiRpro is likely controlled by transcription initiation instead of transcription elongation. Consistent with this, deletion of region -41 to -10 downstream of TSS2 maintained bundle sheath specific GUS expression, whereas deletion of region -97 to -41 containing the direction sensitive Y-patch abolished GUS expression (Figure 7C, 7D, 7E), these results showed that the involvement of 5’UTR for bundle sheath specific expression of SiRpro is likely due to the Y-patch element, which is required for transcription initiation at TSS2.

[0203] FIMO motif scanning in region of -980 to -829 bp identified transcription factor binding sites including those from families of G21ike, MYB-related, MADS-box, DOF, IDD, ARF, ARR, and NAC (Figure 9A). To understand their role in bundle sheath specificity, a 5’ deletion series in this region was produced (Figure 9B). Deletion of region -980 to -946 bp containing G21ike and MYB-related (MYBR) motifs led to GUS expression in mesophyll cells (Figure 9B, 9C), GUS expression was not affected when nucleotides -946 to -886 bp were removed, however, GUS expression was hardly detectable after deletion of nucleotides -886 to -849 bp (Figure 9B, 9C, 9D). These results indicate bundle sheath specific expression of SiRpro is likely caused by mesophyll specific repression by nucleotides -980 to -946 bp, and region -886 to -849 bp is required for a constitutive expression.

[0204] Example 6

[0205] MADS / DOF, EIL and bHLH transcription factor binding sites regulate SiRpro activity

[0206] MYC-MYB bipartite module has been reported to be necessary and sufficient to produce bundle sheath specific expression of MYB76 in Arabidopsis (Dickinson et al., 2020), a E- box (CACGTG) motif, potential binding site of MYC, were present in SiRpro at position - 412 to -407 bp (Figure 10A), to test whether this motif is involved in the bundle sheath specific expression of SiRpro, this motif was deleted and surprisingly, GUS was expressed in mesophyll in addition to bundle sheath (Figure 10B, 10C), suggesting the MYC-MYB module is not responsible for SiRpro expression pattern, but rather the E-box represses mesophyll expression.

[0207] Evolutionary conserved sequences in promoters are suggestive of regulatory importance. We therefore conducted an inter-species comparison of the SiR promoter using the Evolutionary Analysis of Regulatory Sequences program (http: / / wsbc.warwick.ac.uk / ears / main.php) (Picot et al., 2010). A conservation profile for SiR promoter sequence among four distant Oryza species and close relative L.perrieri showed high conservation across SiRpro, a 69 bp region was found between -958 to -890 bp, which overlaps with mesophyll repressive region identified by promoter deletion (Figure 11 A), best match transcription factor binding sites were predicted as DOF and / or MADS motifs, and they share “AAAG” pattern (Figure 11B); interestingly, when more distant species were used, such as seven grass species O. sativa, P. virgatum, Z. mays, S .bicolor, B. distachyon, S. italica and T. aestivum, a highly conserved region located between nucleotides -588 to -539 (Figure 11C), and sequence alignment confirmed that there limited mutations in this region (Figure 11D). Mapping of this region to known transcription factor binding sites showed that it is associated with the ETHYLENE INSENSITIVE-LIKE transcription factor binding sites (Figure HD).

[0208] These putative binding sites were deleted to test whether the impact on the bundle sheath expression of the SiR promoter. When the MADS / DOF sites were deleted GUS appeared in the mesophyll as well as the bundle sheath (Figure 10B, 10C), suggesting this motif acts to repress expression in the mesophyll. Although deletion of the EIL site did not impact on GUS accumulation in the bundle sheath (Figure 10B, 10C), activity was significantly reduced (Figure 10D). This implies that the EIL binding site facilitates positive regulation of SiR. Taken together, evolutionary conserved sequence in the SiR promoter allowed us to identify specific cv.s-elements that impact on both the level of expression as well as the cell specificity.

[0209] Example 7

[0210] Bundle sheath specific expression of SiRpro is mediated by combinatory effect of activators and repressors

[0211] Core promoter is required for the binding of general transcription factors and the assembly of transcription pre-initiation complex. TATA-box core promoter is the most well characterized one, however, Y-patch also plays a major role in plant (Civan and Svec, 2009). SiRpro seems to contain a putative TATA-box variant (5'-ATTAAA-3’) and Y- patch (pyrimidine patch) upstream of TSS1 and TSS2 respectively, the TATA variant is not sufficient for transcription initiation, however, it and its upstream core promoter elements enhanced SiRpro activity; the Y-patch is necessary and weakly sufficient for bundle sheath specific expression. In addition, the TATA variant cannot be replaced by the minimal CAMV35S promoter, suggesting the interaction between upstream cis-element and specific core promoter is associated with bundle sheath specific expression. It is also showed that nucleotides -886 to -849 bp (containing NAC transcription factor binding site) are required to generate a constitutive expression and nucleotides -980 to -946 bp (containing a MYB related transcription factor binding site) repress mesophyll expression. In addition, evolutionary conserved DNA elements including EIL, MADS / DOF binding sites, and known bundle sheath expression element MYC binding sites, activates or represses SiRpro activity specifically in mesophyll. Overall, bundle sheath specific expression of SiRpro is mediated by opposing expression of multiple activators and repressors, whereby NAC and EIL trans-factor binding sites activate promoter expression whereas MYBR, MADS / DOF and MYC motifs repress mesophyll expression by interacting with the core promoter of SiRpro (Figure 12).

[0212] Example 8

[0213] Cell specific over expression ZmG2, OsCGAl, OsGNC increases chloroplast occupancy of the rice bundle sheath

[0214] Engineering C4 photosynthesis into rice requires increased occupancy of the bundle sheath by chloroplasts. In rice, chloroplast occupancy of bundle sheath cells is 30%, in ZmG2 lines it is 40%, and in the new lines we report here it is 60%. This is comparable to that in C4 species such as maize. Thus, although over-expression of ZmG2 increases chloroplast size in the rice bundle sheath, further increases are required. Photosynthesis associated nuclear genes (PhANGs) and chloroplast biogenesis are also controlled by members of the GATA family including CGA1 and GNC (Figure 33). Here we report that cell specific over expression of ZmG2, OsCGAl, OsGNC significantly increases bundle sheath chloroplast occupancy size in rice such that it matches that of maize Figures 34 to 37).

[0215] Bundle sheath cells of C4plants show 60-70% occupancy by chloroplasts (cf ~25% ff? C3.s)

[0216] Lee et al., New Phytol 2022

[0217] 1. Transgenic lines that over-express ZmG0LDEN2 (G2) and OsCGAl and OsGNC. were placed under control of a dTALE system driven by the Oryza sativa Sulphite Reductase promoter (psSiRpro).

[0218] 2. Transgenic lines increased bundle sheath cell chloroplast size in both leaf 4 and leaf 7. Chloroplast size in bundle sheath cells in transgenic lines showed a 57% increase compared with wild type, and 32% increase compared with over-expression of ZmG2 alone (Figure 36).

[0219] 3. Transgenic lines show increased bundle sheath cell occupancy - in wild type the percentage of a bundle sheath cell occupied by chloroplasts is about 30%, while in the transgenic lines the percentage increased to 60% (Figure 37). This higher occupancy matches that seen in the bundle sheath of C4 plants, and so the transgenes phenocopies a component required for the C4 pathway engineering.

[0220] 4. The transgenic lines also increased the chloroplast sizes in mestome sheath cells.

[0221] Transgenic lines expressing the ZmG2, OsGNC and OsCGAl were generated in 2022. For this work, a designer transcription activator-like effector (dTALE) and the synthetic TALE-activated promoter (STAP4) obtained from Alain Tissier, Leibniz Institute of Plant Biochemistry was used. The Golden Gate cloning system obtained from Sylvestre Marillonnet, Leibniz Institute of Plant Biochemistry was also used.

[0222] T2 homozygous lines were generated in 2023. Chloroplast parameters in bundle sheath cell was quantified in 2023.

[0223] Example 9

[0224] A transcription factor quartet orchestrates bundle sheath expression in rice

[0225] The SULFITE REDUCTASE promoter has been identified as sufficient for strong bundle sheath expression. This promoter encodes an intricate cv.s-regulatory logic with multiple activators and repressors acting combinatorially. Within this landscape we identified a distal enhancer activated by quartet of transcription factors from the G2-like, MYB-related, IDD and bZIP families. This module is important and sufficient to pattern gene expression to the rice bundle sheath. Oligomerisation of the enhancer and fusion to core promoters containing Y-patches allowed activity to be increased over 280-fold. In addition, the ability of this enhancer to generate bundle sheath-specific expression in Arabidopsis indicates its deep conservation across monocots and dicots. In summary, we have identified an ancient, short, and tuneable enhancer patterning expression to the bundle sheath that we anticipate will be useful for engineering this cell type in various crop species.

[0226] Materials and methods

[0227] Plant material and growth conditions

[0228] Kitaake (O. sativa ssp. japonicd) was transformed using Agrobacterium tumefaciens with the following modifications as described previously (Hiei et al., 2008). Mature seeds were sterilized with 2.5% (v / v) sodium hypochlorite for 15 mins, and calli were induced on NB medium with 2 mg / L 2,4-D at 30 °C in darkness for 3-4 weeks. Actively growing calli were then co-incubated with tumefaciens strain LBA4404 in darkness at 25°C for 3 days, they were selected on NB medium supplied with 35 mg / L hygromycin B for 4 weeks, and those that proliferated placed on NB medium with 10 mg / L hygromycin B for 4 weeks at 28 °C under continuous light. Plants resistant to hygromycin were planted in 1 : 1 mixture of topsoil and sand and placed in a greenhouse at the Botanic Gardens, University of Cambridge under natural light conditions but supplemented with a minimum light intensity of 390 pmol m-2s-1, a humidity of 60%, temperatures of 28°C and 23°C during the day and night respectively, and a photoperiod of 12 h light, 12 h dark. Subsequent generations were grown in a growth cabinet in 12 h light / 12 h dark, at 28 °C, a relative humidity of 65%, and a photon flux density of 400 pmol m-2s-1. Cloning and construct preparation, and motif analysis

[0229] The 2613-bp promoter DNA fragment of SULFITE REDUCTASE (SiR, MSU7 ID: LOC_Os05g42350, RAP-DB ID: 0s05g0503300) was originally amplified from Kitaake genomic DNA, with forward primer (5 ’-3’) “CACCATGCTTGACCATGTGGACTC” and reverse primer (5 ’-3’) “ACGGAACCCGTGGAACTC”. Gel-purified PCR product was cloned into a Gateway pENTR™ vector to generate pENTR-SiRpro using pENTR™ / D- TOPO™ Cloning Kit (Invitrogen), then the promoter was recombined into the pGWB3 expression vector and fused with GUS gene using LR reaction. The resultant vector was transformed into A tumefaciens strain LBA4404 and transformed into Kitaake. To engineer the SiRpro such that it is compatible with the Golden gate system, four Bsal or Bpil restriction enzyme recognition sites at -214, -298, -1468, and -2309 were mutated from T to A and cloned into the pAGM9121 vector using Golden Gate level 0 cloning reactions and then into a level 0 PU module EC 14328, which was used for driving kzGUS (intronless GUS) and H2B-mTurquoise2 reporter genes via Golden gate reaction and using Tnos as a terminator. A five prime deletion series was generated using EC 14328 as the template and prepared as level 0 PU modules, and a three prime deletion series prepared as level 0 P modules. The minimal CaMV35S promoter was used as the U module, and they were linked with kzGUS and terminated with Tnos.

[0230] To test SiRpro in the dTALE / STAP system, the 42-bp coding region were excluded and the 2571-bp resultant fragment placed into a level 0 PU module EC14330 and was used to drive dTALEl. Two reporters were used. For the GUS reporter kzGUS was linked with STAP62 and terminated with Tnos. In the fluorescent reporter construct, a chloroplast targeting peptide fused to mTurquoise 2 was linked with STAP 4 and terminated with Tact2. In both constructs, pOsActl driving HYG (Hygromycin resistant gene) was terminated with Tnos and used as the selection marker during rice transformation.

[0231] The Find Individual Motif Occurrences (FIMO) tool (Grant et al. 2011) from the Multiple Em for Motif Elucidation (MEME) suite v.5.4.0 (Bailey et al. 2015) was used to search for individual motifs within the promoter sequences using default parameters with “—thresh” of “le-3”. Position weight matrix of 656 non-redundant plant motifs and 13 RNA polymerase II (POLII) core promoter motifs were obtained from JASPAR (https: / / jaspar.elixir.no / downloads / ) (Fornes et al. 2020). To cluster the transcription factor binding motifs, the RS AT matrix-clustering tool (Castro-Mondragon et al. 2017) was run on all 656 non-redundant plant motifs using the default parameters, which yield 51 motif clusters, these clusters were further divided based on transcription factor families. Analysis of GUS and fluorescent reporters

[0232] GUS staining was performed as described previously (Jefferson et al., 1987) with the following minor modifications. Leaf tissue was fixed in 90% (v / v) acetone overnight at 4 °C after washing with 100 mM phosphate buffer (pH 7.0). Leaf samples were transferred into 1 mg / ml 5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc) GUS staining solution, subjected to 2 mins vacuum infiltration 5 times, and then incubated at 37 °C for between 1 and 168 hours. Chlorophyll was cleared further using 90% (v / v) ethanol overnight at room temperature. Cross sections were prepared manually using a razor blade and images were taken using an Olympus BX41 light microscopy. Quantification of GUS activity was performed using a fluorometric MUG assay (Jefferson et al., 1987). -200 mg mature leaves from transgenic plants were frozen in liquid nitrogen and ground into fine powder with a Tissuelyser (Qiagen). Soluble protein was extracted in 1 mL of 50 mM phosphate buffer (pH 7.0) supplemented with 0.1% [v / v] Triton X-100 and cOmplete™ Protease Inhibitor Cocktail (half tablet per 50 mL). Protein concentration then determined using a Qubit protein assay kit (Invitrogen). The MUG fluorescent assay was performed in duplicates with 20 pl protein extract in MUG assay buffer (50mM phosphate buffer (pH 7.0), 10 mM EDTA-Na2, 0.1% [v / v] Triton X-100, 0.1% [w / v] N-lauroylsarcosine sodium, 10 mMDTT, 2 mM 4-methylumbelliferyl-P-D-glucuronide (MUG)) in a 200 pl total volume. The reaction was conducted at 37 °C in GREINER 96 F-BOTTOM microtiter plate using a CLARIOstar plate reader. 4-Methylumbelliferone (4-MU) fluorescence was recorded every 2 minutes for 20 cycles with excitation at 360 nm and emission detected at 450 nm. 4-MU concentration was determined based on a standard curve of ten 4-MU standards placed in the same plate. GUS enzymatic rates were calculated by averaging the slope of MU production from each of the duplicate reactions.

[0233] In order to visualize mTurquoise2 mature leaves were dissected into 2-cm sections, leaf epidermal cells were removed by scraping the leaf surface with a razor blade and then mounted with deionized water. 5-mm and middle sections of 2-cm young tissue of the fourth leaves were dissected and mounted with deionized water directly. Imaging was then performed using a Leica TCS SP8 confocal laser-scanning microscope using a 20x air objective. mTurquoise2 fluorescence was excited at 442 nm with emission at 471-481 nm, chlorophyll autofluorescence was excited at 488 nm with emission at 672-692 nm. Yeast one hybrid, protoplast isolation and transactivation assay

[0234] The yeast one hybridisation assay was performed by Hybrigenics (https: / / www.hybrigenics-services.com / ). Fragments were synthesized and used as bait. Rice leaf and root cDNA libraries were used as prey. The number of clones screened and concentration of 3-AT were as follows: fragment 1, 70.2 million clones screened with 0 mM 3-AT; fragment 2, 61.5 million clones screened with 0 mM 3-AT; fragment 3, 68.4 million clones screened with 20 mM 3-AT; fragment 4, 57.4 million clones screened with 100 mM 3-AT; fragment 5, 94.2 million clones screened with 200 mM 3-AT.

[0235] Rice leaf protoplasts and PEG-mediated transformation were performed as described previously (Page et al. 2019). Golden gate level 1 modules for transformation were isolated using ZymoPURE™ II Plasmid Midiprep Kit, ZmUBIpro: :GUS-Tnos was used as transformation control. Transcription factor coding sequences were amplified using rice leaf cDNA, with Bsal and Bpil sites mutated, and cloned into Golden gate SC level 0 modules. They were assembled into a level 1 module with a ZmUBIpro promoter and Tnos terminator module. Nucleotides -980 to -829 with the endogenous core promoter (nucleotide -250 to +42) were fused with the LUC reporter to generate output of transcription activity. In each transformation, 2 pg of transformation control plasmids, 5 pg of reporter plasmids, and 5 pg of effector plasmids per transcription factor were combined and mixed with 170 pl protoplasts. After incubation on the benchtop for overnight protein was extracted using passive lysis buffer, GUS activity was determined with 20 pl of protein sample and MUG fluorescent assay as described above, LUC activity was measured with 20 pl of protein sample and 100 pl of LUC assay reagent (Promega) using Clariostar plate reader. Transcriptional activity from the promoter was calculated as LUC luminescence / rate of MUG accumulation.

[0236] A distal enhancer and Y-patch are necessary for expression in the bundle sheath

[0237] Analysis of the SiR promoter sequence revealed a highly complex cis landscape (Figure 3G) comprising at least 638 predicted motifs from 56 transcription factor families. We therefore designed a 5’ truncation series to investigate regions necessary for expression in the bundle sheath (Figure 5B). Deleting nucleotides -2571 to -2180 and -1490 to -980 led to a statistically significant reduction and then increase in MUG activity respectively but neither truncation abolished preferential accumulation of GUS in the bundle sheath (Figure 5B-D). However, when nucleotides -980 to -394 upstream of the predicted translational start site were removed GUS was no longer detectable in bundle sheath cells (Figure 5B- C). Consistent with this, MUG assays showed a statistically significantly reduction in activity when these nucleotides were absent (Figure 5D). Thus, nucleotides spanning -980 to -394 of the SiR promoter are necessary for bundle sheath specific expression.

[0238] To test whether this region is sufficient for bundle sheath specific expression we linked it to the minimal CaMV35S core promoter. Although weak GUS signal was detected in a few veinal cells it failed to do so in the bundle sheath (Figure 5B-D). We conclude that sequence in two regions of the promoter (from -394 to +42 and from -980 to -394) interact to specify expression to the bundle sheath. To better understand this interaction we next generated unbiased 5’ and 3’ deletions. This second deletion series further reinforced the notion that the SiR promoter contains a complex c / .s-regulatory landscape. For example, when nucleotides -980 to -829 were removed very weak GUS staining was observed and the MUG assay confirmed that activity was significantly reduced to 11% that of the full- length promoter (Figure 38, Figure 6). We conclude that nucleotides -980 to -829 from the SiR promoter are necessary for tuning expression in the leaf. When nucleotides -829 to - 700 were removed GUS appeared in mesophyll cells (Figure 6). Truncating nucleotides - 613 to -529 abolished GUS accumulation (Figure 6). The 3’ deletion that removed nucleotides -251 to +42 also stopped accumulation of GUS in both bundle sheath and mesophyll cells (Figure 38A-C, Figure 6). Notably, when the distal region required for bundle sheath expression (-980 to -829) was combined with nucleotides -251 to +42 these two regions were sufficient for patterning to this cell type (Figure 38).

[0239] Having identified a region in the SiR promoter that was necessary and sufficient for patterning to the bundle sheath, we next used phylogenetic shadowing and yeast one hybrid analysis to better understand the c / .s-elements and / ra / / .s-factors responsible. Analysis of cv.s-elements in the SiR promoter that are highly conserved in grasses identified a short region located from nucleotides -588 to -539 that contained an ETHYLENE INSENSITIVE3-LIKE 3 (El 1.3) transcription factor binding site (Figure 11C&D). Whilst deletion of this motif had no detectable effect of patterning to the bundle sheath (Figure HE) the level of expression was reduced (Figure HF). We infer that the EIL3 motif positively regulates activity of the SiR promoter but is not responsible for cell specificity. These data are consistent with the promoter truncation analysis that showed nucleotides - 613 to -529 containing this motif were not required for bundle sheath specific expression, but instead function as a constitutive activator (Figure 6). When yeast one hybrid was used to search for transcription factors capable of binding the SiR promoter, sixteen were identified (Figure 39A, 39B). For each, cognate binding sites were present. This included TCP21 and OsOBFl that can bind to TCP motifs and Ocs / bZIP elements respectively. Consistent with the outcome of deleting the EIL3 motif, three EIL transcription factors interacted with nucleotides -899 to -500 (Figure 39B, 39C) Examination of transcript abundance in mature leaves showed that most of these transcription factors were expressed in both bundle sheath and mesophyll cells (Figure 39D) implying that combinatorial interactions with cell specific factors may be required for bundle sheath specific expression from the SiR promoter.

[0240] The distal enhancer contains a tetrapartite c / v-regulatory for bundle sheath expression

[0241] The truncation analysis above identified two short regions comprising nucleotides -980 to -829 and -251 to +42 that were necessary and sufficient for expression in the rice bundle sheath (Figure 38). Sequence spanning nucleotides -251 to +42 includes both the annotated 5’ untranslated region but also likely contains core promoter elements (Figure 7A). Reanalysis of publicly available data identified two major transcription start sites at positions -91 (TSS1) and -41 (TSS2) (Figure 7A). Although no canonical TATA-box was evident in this region, a TATA-box variant was detected at position -130 (5'-ATTAAA-3’) (Civan and Svec 2009) that could be responsible for transcription from TSS1. Moreover, upstream of TSS2 is a putative pyrimidine patch (Y-patch) that represents an alternate but common TC-rich core promoter motif in plant genomes (Civan and Svec 2009) (Figure 7A). Scanning sequence from -251 to +42 for core promoter elements also identified MTE (Motif Ten Element), BREu (TFIIB Recognition Element upstream) and DCE-S-I (Downstream Core Element S-I) motifs associated with eukaryotic core promoters (Figure 7B). We therefore assume the region upstream of TSS1 and TSS2 contains the core promoter elements. When consecutive deletions to this sequence were made, statistically significant reductions in MUG activity were evident but there was no impact on accumulation of GUS in the bundle sheath. Interestingly, when the Y-patch was retained but the TATA-box like motif removed, low levels of GUS specific to the bundle sheath were apparent (Figure 7C, 7D, 7E, 7F), and deletion of the Y-patch completely abolished GUS staining (Figure 7C, 7D, 7E, 7F). Consistent with the Y-patch being important for bundle sheath expression, when core promoters from other genes (PIP1;1, NRT1.1A) containing a Y-patch were linked to the distal enhancer from SiR bundle sheath expression was detected (Figure 40A, 40B), but this was not the case for genes with only a TATA- box (Figure 40A, 40B). GUS activity was higher from the PIP1;1 core promoter that contains more Y-patches. Overall, we conclude that the TATA-box like motif is not required for expression in the bundle sheath, but in contrast the Y-patch is necessary for this patterning and in combination with a distal enhancer comprising nucleotides -980 to - 829 is sufficient for expression in this cell type.

[0242] We next assessed the distal enhancer for transcription factor binding sites. The FIMO algorithm identified motifs associated with WRKY, G2-like, MYB-related, MADS, DOF, IDD, ARR, SNAC (Stress-responsive NAC) families. PlantPAN (Chow et al. 2018), which includes historically validated cv.s-elements, found an additional Dc3 Promoter Binding Factor (DPBF) binding site for group A bZIP transcription factors (Figure 40D). Seven consecutive deletions spanning this enhancer region and hereafter termed subregions a-g were generated (Figure 40D). Deletion of subregions a, b, d and f resulted in loss of GUS from bundle sheath cells, although veinal expression persisted when subregions a, b and d were absent (Figure 40E-40G) MUG analysis showed that deletion of all four regions significantly reduced promoter activity (Figure 40G). In contrast, deletions of nucleotides -938 to -923 (subregion c), -904 to 873 (subregion e), and -853 to -829 (subregion g) had no impact on either the pattern or level of expression (Figure 41). Subregions a, b, d and f that were necessary for expression in the bundle sheath contained unique binding sites for WRKY, G2-like, MYB-related, IDD, NAC and bZIP (DPBF) transcription factors. To examine the significance of these regions in the context of full-length SiR promoter, consecutive deletions from subregion a to f were generated (Figure 42A). Deletion of subregion a, d or f, led to GUS accumulating primarily in mesophyll cells whereas removal of subregion b, c or e, caused GUS staining in both mesophyll cells and bundle sheath cells (Figure 42B). No significant changes in GUS activity were observed in these deletion lines (Figure 42C). We conclude that that the distal enhancer generates expression in the bundle sheath due to four distinct sub-regions and that other nucleotides between -980 to -853 function as repressors of mesophyll expression.

[0243] G2-like, MYB-related, IDD and bZIP transcription factors activate the distal enhancer

[0244] To gain deeper insight how the distal enhancer operates we employed multiple approaches including transactivation assay, co-expression analysis and site directed mutagenesis. The distal enhancer contained WRKY, G2-like, MYBR, IDD, SNAC and bZIP (DPBF) motifs (Figure 43A, Figure 44). We therefore cloned rice transcription factors from each family and used them as effectors in transient assays (Figure 45). WRKY121, GLK2, MYBS1, IDD2 / 3 / 4 / 6 / 10, and bZIP9 / 10 / l l transcription factors led to the strongest activation of expression from the bundle sheath enhancer (Figure 43B, Figure 46A-46D), whereas the stress-responsive NAC transcription factors targeting a SNAC motif that overlaps a bZIP (DPBF) motif, activated less strongly than bZIP factors (Figure 46E). We therefore conclude that the SNAC motif is not important for activity of the bundle sheath enhancer. Effector assays using pairwise combinations of transcription factors showed synergistic activation from the distal enhancer when GLK2 and IDD3,4,6,10 were co-expressed (Figure 43C).

[0245] Co-expression analysis using a cell-specific leaf developmental gradient dataset revealed that GLK2, MYBS1 and IDD4,6,10 transcription factors that bind the G2-like, MYB-related and IDD motifs respectively were more abundant in mesophyll cells (Figure 43D). However, the WRKY121, IDD2, and bZIP9 / 10 / l l transcription factors correlated with SiR transcript abundance and were preferentially expressed in bundle sheath cells (Figure 43D). To test whether WRKY121, IDD2, and bZIP9 / 10 / l 1 are sufficient to pattern SiR expression to specific cells, we mis-expressed them in the mesophyll in the presence of the SiR distal enhancer and Y-patch (Figure 47). Presence of these three factors in mesophyll cells activated expression in this cell type (Figure 43E&F) suggesting at least one directly interacts with the distal enhancer in bundle sheath cells to drive SiR expression. We next mutated WRKY, G2-like, MYB-related, IDD, and bZIP motifs. Although mutating the WRKY did not affect bundle sheath expression pattern, mutations in the G2- like, MYB-related, IDD, and bZIP (DPBF) motifs diminished or abolished enhancer activity in the bundle sheath (Figure 48A-48C). We therefore conclude that the WRKY motif is not necessary for bundle sheath expression.

[0246] In order to test whether the regions containing the G2-like, MYB-related IDD, and bZIP (DPBF) sites are sufficient to pattern expression to rice bundle sheath cells we concatenated them and fused them to the core promoter of SiR (Figure 48E). GUS staining was evident in the bundle sheath (Figure 48F). Fusion to the stronger PIP1; 1 core promoter maintained bundle sheath expression and resulted in an ~5 fold increase in activity (Figure 48E&F). Oligomerisation of the enhancer by repeating it for 3 or 5 times increased bundle sheath specific expression by 23 or 58-fold when fused to SiR core promoter (Figure 48E-48G), this effect was further amplified to over 90 or 282-fold increase when fused with the PIP1;1 core (Figure 48E-48G). Collectively our data indicate that transcription factors belonging to the G2-like, MYB-related, IDD and bZIP (DPBF) families act cooperatively to decode distinct cv.s-elements in a distal enhancer of the SiR promoter. Synthetic promoters, created by oligomerising this enhancer and combining it with core promoters that contain Y- patches enabled fine-tuning of bundle sheath-specific expression in rice. We test the enhancer’s ability to generate bundle sheath specific expression in Arabidopsis, by introducing the enhancer repeated three times with the SiR core promoter and linked to GUS into Arabidopsis, the result showed specific expression in bundle sheath cells (Figure 48H), indicating this enhancer is deeply conserved between monocot and dicot in controlling bundle sheath specific expression.

[0247] Expression of multiple genes in the rice bundle sheath is not associated with close upstream enhancers

[0248] Gene expression is determined by interactions between elements in the core promoter allowing basal levels of transcription (Juven-Gershon and Kadonaga 2009; Haberle and Stark 2018) with more distal cz.s-regulatory modules (Spitz and Furlong 2012; Shlyueva et al. 2014; Ray- Jones and Spivakov 2021). Such cz.s-regulatory modules include enhancers and silencers that act as hubs receiving input from multiple transcription factors and so allow gene expression to respond spatially and temporally to both internal and external stimuli (Li et al. 2007; Buecker and Wysocka 2012). After testing 25 promoters, we discovered that the majority were not capable of driving expression in the rice bundle sheath, and this included ten that generated no detectable activity of GUS in leaves. In all cases we had cloned sequence between -3191 and -960 nucleotides upstream of the predicted translational start site and so these data demonstrate that the core promoter and any enhancers in these regions are not sufficient to direct expression to rice bundle sheath cells. Combined with the paucity of previously reported promoters active in this cell type (Nomura et al. 2005a; Lee et al. 2021) these data argue either for long range upstream enhancers (Studer et al. 2011; Liu et al. 2015; Li et al. 2019; Yan et al. 2019; Zhao et al. 2022) or other regulatory mechanisms being important to specify expression in the bundle sheath. Possibilities include transcription factor binding sites in introns that impact on transcription start site and strongly enhance gene expression (Rose et al. 2008; Gallegos and Rose 2019; Rose 2019), or in exons where because such sequences specify amino acid sequence as well as binding of / zzzzz.s-factors, they have been termed duons (Stergachis et al. 2013). Functional analysis showed that duons can pattern expression to the bundle sheath of the C4 plant Gynandropsis gynandra (Reyna-Llorens et al. 2018), and it is notable that a genome-wide analysis of transcription factor binding sites in grasses revealed genes preferentially expressed in bundle sheath cells tended to contain transcription factor binding sites in their coding sequence (Burgess et al. 2019). It therefore appears possible that gene expression in the bundle sheath is commonly encoded by non-canonical architecture perhaps based on duons rather than more traditional enhancer elements upstream of the core promoter. Despite the above, we discovered four promoters capable of driving expression in the rice bundle sheath, and each was associated with a gene important in sulphur metabolism. For example, A TPS, SiR and Fd all participate in the first two steps of sulphate reductive assimilation, while HAC1;1 encodes an arsenate reductase important in the detoxification of arsenate using glutathione that is a product of sulphur assimilation. Collectively, these data further support the notion that the rice bundle sheath cell is specialised in sulphur assimilation (Hua et al. 2021).

[0249] Two distinct genetic networks governing expression in bundle sheath cells

[0250] The only other promoter for which both cv.s-elements and Zra / / .s-factors that are necessary and sufficient to pattern bundle sheath expression have been reported is from the dicotyledonous model Arabidopsis thaliana. Here, a bipartite MYC-MYB module upstream of theA7FB76 gene is responsible for this output (Dickinson et al. 2020b). MYB76 forms part of a network governing glucosinolate biosynthesis in A. thaliana, and so it is notable that the gene regulatory network we report in rice is also associated with sulphur metabolism. However, rather than the bipartite transcription factor network that regulates bundle sheath expression in A. thaliana, in rice we report a quartet of transcription factors controlling SiR (Figure 49C&49D). The enhancer controlling bundle sheath SiR expression in rice comprises four distinct regions recognised by transcription factors belonging to the G2-like, MYB-related, IDD and bZIP families (Figure 49D). As loss of the G2-like, MYB-related, IDD and bZIP motifs all reduced expression in the bundle sheath, this implies they act co-operatively - a notion further supported by the fact that GLK2 and IDD3,4,6,10 synergistically activated promoter output in a transient assay (Figure 43C). It is of course possible that other motifs in the enhancer such as MADS, DOFs and ARRs act as modulators to tune the level of bundle sheath expression. In fact, single nuclei sequencing of rice and sorghum during photomorphogenesis identified DOFs as important for the evolution of C4 gene bundle sheath expression (Swift, Luginbuhl et al. 2023). For the PIP1;1 and NRT1.1A genes, whose transcripts preferentially accumulate in the bundle sheath, the core promoters are not able to generate bundle sheath expression, but they do contain a Y-patch and the G2-like, MYB-related, IDD and bZIP enhancer is present in intronic sequence (Figure 2). It is therefore possible that this regulatory system controls their expression. Moreover, for two other rice promoters (Fd and HAC1; 1) and for two from others species (ZjPCK and FtGLDP) that are sufficient to drive expression to the bundle sheath Y-patches and the cognate cv.s-elements for G2-like, MYB-related, IDD and bZIP transcription factors are evident (Figure 50). The distal enhancer in the SiR promoter operates in conjunction with the core promoter that contains two transcription start sites, one with an upstream TATA-box and the other a TC-rich element known as a pyrimidine (Y) patch (Figure 7A). The TATA-box is found in metazoans and plants and allows recognition by the pre-initiation complex (Smale and Kadonaga 2003), but in plants computational analysis showed that many promoters lack a TATA-box and instead contain a Y-patch (Yamamoto et al. 2007a, 2007b; Bernard et al. 2010). These genes tend to be relatively steadily expressed and associated with protein metabolism (Bernard et al., 2010), and presence of a Y-patch can increase core promoter strength (Jores et al. 2021). For SiR, whilst the TATA-box is not required, the Y- patch is needed for expression in the bundle sheath. Notably, core promoters with a higher number or longer Y-patches tended to drive stronger expression, and showed that in plants cell specific gene expression can be tuned by selecting different core promoters.

[0251] This regulatory network comprising the Y-patch and distal enhancer enabling bundle sheath expression of SiR is embedded within a complex c / .s-regulatory landscape upstream of SiR with distinct regions encoding activating and repressing activities (Figure 49A&49B) For example, the distal enhancer (nucleotides -980 to -829) activating expression in the bundle sheath overlaps with sequence (nucleotides -900 to -700) that suppresses expression in the mesophyll. Notably, the distal enhancer is both essential for mesophyll repression and also sufficient to drive bundle sheath specific expression (Figure 49A). In addition to controlling cell specificity, this complexity likely also facilitates the tuning of expression to environmental conditions. For instance, the EIL motif (position - 572 to -552) is recognised by ETHYLENE-INSENSITIVE LIKE (EIL) transcription factors that respond to sulphur deficiency (Maruyama-Nakashita et al. 2006; Dietzen et al. 2020). As transcripts encoding EIL accumulate in both bundle sheath and mesophyll cells in response to sulphate deficiency it seems likely that transcription factors repressing expression in these mesophyll cells respond in a dynamic manner. In addition to EIL, the yeast one hybrid analysis identified seven other families of transcription factor families that can bind the SiR promoter. Many play documented roles during abiotic or biotic stress, with for example OBF1, ERF3, NAP and FLP acting during low-temperature or drought responses (Shimizu et al. 2005; Zhang et al. 2013, 2022; Chen et al. 2014; Qu et al. 2022), while TCP21, EREBP 1, ERF3, ERF72, ERF83 are involved in both abiotic and biotic stress (Lin et al. 2007; Jisha et al. 2015; Zhang et al. 2016, 2018; Tezuka et al. 2019; Jung et al. 2021). Consistent with previous in silico analysis (Kurt et al. 2022) the presence of multiple AP2 / ERF and EIL transcription factors binding sites suggests that SiR is likely subject to control from ethylene signalling (Binder 2020) and also of transcription factors that respond to ABA and jasmonic acid biosynthesis and signalling (Yaish et al. 2010; Chen et al. 2014; Jisha et al. 2015; Zhang et al. 2016, 2018). Together this implies that multiple phytohormone signalling pathways converge on the SiR promoter. These data are similar to those reported for the SHORTROOT promoter in A. thaliana roots where a complex network of activating and repressing / ra / z.s-factors also tunes expression (Sparks et al. 2016). It is also notable that the architecture we report for the bundle sheath enhancer of SiR appears of similar complexity to the collective of five transcription factors used to specify cardiac mesoderm in Drosophila melanogaster and vertebrates (Junion et al., 2012). For the five transcription factors that bind the cardiac mesoderm enhancer, the order and positioning of motifs (motif grammar) is flexible. However, this is not always the case, with for example output from the human interferon-beta (INF-fi) enhancer demanding a conserved grammar (Thanos and Maniatis 1995; Panne 2008). Further work will be needed to determine if the bundle sheath enhancer reported here for rice is more similar to one of these models, or indeed, as reported for Drosophila eve stripe 2 enhancer operates as a billboard in different tissues to determine patterning of expression (Kulkarni and Arnosti 2003).

[0252] Using the SiR promoter to engineer the rice bundle sheath

[0253] In addition to bundle sheath cells being important for sulphur assimilation (Leegood 2008; Aubry et al. 2014b; Hua et al. 2021) they have also been implicated in nitrate assimilation, and the control of leaf hydraulic conductance and solute transport (Hua et al. 2021) and the systemic response to high light (Xiong et al. 2021). Moreover, in one of the most striking examples of a cell type being repurposed for a new function, bundle sheath cells have repeatedly been rewired to allow the evolution of C4 photosynthesis (Sage 2004c). To engineer these diverse processes, specific and tuneable promoters for this cell are required. However, identification of sequence capable of driving specific expression to bundle sheath strands has previously been limited to A. thaliana and C4 species. For example, the SCARECROW (Cui et al. 2014), SCL23 (Cui et al. 2014), SULT2;2 (Kirschner et al. 2018) andA7FB76 promoters (Dickinson et al. 2020a)derive from A. thaliana, whilst the Glycine Decarboxylase P-protein (GLDP) promoter is from the C4 dicotyledon Flaveria trinervia (Engelmann et al. 2008; Wiludda et al. 2012). In rice, only the C4 Zoysia japonica PCK and the C4 Flaveria trinervia GLDP promoters are known to pattern expression to the bundle sheath (Nomura et al. 2005c; Lee et al. 2021). Both are capable of conditioning expression in this cell type, but are weak, turn on at late leaf developmental stages and the molecular basis underpinning their ability to restrict expression to the bundle sheath has not been defined. It has therefore not been possible to rationally design or tune expression to this important cell type in rice.

[0254] From analysis of the -2600 nucleotide SiR promoter we identify an enhancer comprising 81 nucleotides that with the Y-patch is sufficient to drive expression to bundle sheath cells. Moreover, we show that output can be tuned via two approaches. First, oligomerising the distal enhancer can drastically increase expression. Second, combining it with different core promoters achieved the same output, and this appears to correlate with length of the Y-patch in each promoter. Our identification of a minimal promoter that drives expression in bundle sheath cells of rice now provides a tool to allow this important cell type to be manipulated. Cell specific manipulation of gene expression has many perceived advantages. For example, when constitutive promoters have been used to drive gene expression gene silencing and reduction of plant fitness due to metabolic penalties (Glick 1995; Que et al. 1997). In contrast, tissue specific promoters allow targeted gene expression either spatially or at particular developmental stages and so allow increased precision in trait engineering (Kummari et al. 2020). The SiR promoter and the bundle sheath cis- regulatory module that we identify provides insights into mechanisms governing cell specific expression in rice, and may also contribute to our ability to engineer and improve cereal crops.

[0255] Example 10

[0256] Full length OsSiRpro directs bundle sheath preferential expression in wheat

[0257] OsSiRpro generates bundle sheath preferential expression in wheat, but expression is relatively weak (Fig 51).

Claims

Claims1. An isolated promoter or active fragment or derivative thereof, capable of directing transcription of a gene to which it is operably connected in a plant bundle sheath cell, wherein said promoter comprises a sequence selected from the group consisting of: a) SEQ ID NOs: 1-3, 15-33 or 39; b) Residues 2325 to 2575 and 1596 to 1746 of SEQ ID NO: 1, or residues 2325 to 2575 and 1596 to 1746 of SEQ ID NO: 2; c) an isolated homolog, analog, ortholog or paralog sequence of SEQ ID NOs: 1- 3, 15-33 or 39 or a sequence complementary thereto; and d) a sequence having at least: 70%, 75%, 80%, 85%, 87%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with any one of the group consisting of: i) SEQ ID NOs: 1-3, 15-33 or 39; ii) residues 2325 to 2575 and 1596 to 1746 of SEQ ID NO: 1; and iii) residues 2325 to 2575 and 1596 to 1746 of SEQ ID NO: 2: SEQ ID NOs: 1-3, 15-33 and 39, residues 2325 to 2575 of SEQ ID NO: 1, or residues 2325 to 2575 of SEQ ID NO: 2.

2. The promoter of claim 1 , wherein said promoter further comprises a sequence selected from the group consisting of residues 1596 to 1746 of SEQ ID NO: 1 or residues 1596 to 1746 of SEQ ID NO: 2, or a sequence having at least: 70%, 75%, 80%, 85%, 87%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity thereto.

3. The promoter of claim 1 or claim 2, wherein said promoter further comprises a sequence selected from the group consisting of residues 1988 to 2037 of SEQ ID NO: 1 or residues 1988 to 2037 of SEQ ID NO: 2.

4. The promoter of any one of claims 1 to 3, wherein said promoter further comprises a sequence selected from the group consisting of residues 2164 to 2169 of SEQ ID NO: 1 or residues 2164 to 2169 of SEQ ID NO: 2.

5. The promoter of any one of claims 1 to 4, wherein said promoter comprises a sequence comprising residues 1988 to 2037 of SEQ ID NO: 1 or SEQ ID NO: 2; and residues 2164 to 2169 of SEQ ID NO: 1 or SEQ ID NO: 2.

6. The promoter of any one of claims 1 to 5, wherein said promoter comprises a sequence comprising residues 2325 to 2575 of SEQ ID NO: 1 or SEQ ID NO: 2; residues 1596 to 1746 of SEQ ID NO: 1 or SEQ ID NO: 2; residues 1988 to 2037 of SEQ ID NO: 1 or SEQ ID NO: 2; and residues 2164 to 2169 of SEQ ID NO: 1 or SEQ ID NO: 2.

7. A recombinant construct comprising the promoter sequence or active fragment, or derivative thereof according to any one of claims 1 to 6, operably linked to one or more gene(s) and / or one of more gene component s).

8. The recombinant construct of claim 7, wherein the gene is or the gene component(s) are component s) of: a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene; a NADP-Malic enzyme (NADP-ME) encoding gene; a NAD-Malic enzyme (NAD-ME) encoding gene; a RbcS encoding gene; a Rubisco activase encoding gene; all regenerative phase genes of the Calvin cycle; genes controlling chloroplast division; transcription factors such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; genes that control plasmodesmata formation; a reporter gene; or any combination of the foregoing.

9. A recombinant cell engineered to express or overexpress a promoter sequence according to any one of claims 1 to 6.

10. A recombinant cell comprising the recombinant construct of any one of claims 7 or 8.

11. The recombinant cell of claim 9 or claim 10, wherein the recombinant cell is at least one of: a C3 plant cell, a C3 grass cell, a rice cell, an Oryza sativa cell.

12. The recombinant cell of any one of claims 9 to 11, wherein the recombinant cell is a bundle sheath cell.

13. The isolated promoter sequence of any one of claims 1 to 6, the recombinant construct of any one of claims 7 to 8, or the recombinant cell of any one of claims 9 to 12, wherein the promoter sequence: i. is operably linked to a regulatory sequence; and / or ii. is a component of an expression vector; and / or iii. is a domesticated sequence.

14. A transgenic plant or a seed thereof comprising the promoter sequence of any one of claims 1 to 6, the recombinant construct of any one of claims 7 to 8, or the recombinant cell of any one of claims 9 to 12.

15. The transgenic plant or a seed thereof of claim 14, wherein said plant is a C3 plant.

16. The transgenic plant or a seed thereof of claim 14 or claim 15, wherein said plant is a C3 grass, preferably rice, more preferably Oryza sativa.

17. Use of the promoter of any one of claims 1 to 6, the recombinant construct of any one of claims 7 or 8, or the recombinant cell of any one of claims 9 to 12, to express a gene product.

18. The use of claim 17, wherein the gene product is a phospho-enol pyruvate carboxykinase (PEPCK) or a component thereof; a NADP-Malic enzyme (NADP-ME) or a component thereof; a NAD-Malic enzyme (NAD-ME) or a component thereof; ribulose-1,5- bisphosphate carboxylase / oxygenase small subunit or a component thereof; Rubiscoactivase or a component thereof; a gene product of a regenerative phase gene of the Calvin cycle; a gene product of a gene controlling chloroplast division; a transcription factor such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; a gene product of a gene that controls plasmodesmata formation; a gene product of a reporter gene or a component thereof; or any combination of the foregoing.

19. A system for expressing a target gene in bundle sheath cells of a plant, said system comprising: a) a recombinant construct comprising: a target gene operably linked to a transcription-factor activated promoter; a transcription factor encoding sequence operably linked to said transcription factor-activated promoter; and b) a bundle sheath cell-specific promoter operably linked to said transcription factor encoding sequence.

20. The system of claim 19, wherein said bundle sheath cell-specific promoter is a promoter in accordance with any one of claims 1 to 6.

21. A method for expressing a target gene in a bundle sheath cell of a plant, said method comprising a. introducing a promoter of any one of claims 1 to 6 operably linked to a target gene, or a recombinant construct comprising a promoter of any one of claims 1 to 6 operably linked to a target gene, into a plant cell; and b. generating the plant using the plant cell, wherein said bundle sheath cells of the plant express said target gene.

22. The method of claim 21 further wherein the target gene is operably linked to a transcription-factor activated promoter; a transcription factor encoding sequence is operably linked to said transcription factor-activated promoter; and said promoter of any one of claims 1 to 6 is operably linked to said transcription factor encoding sequence.

23. The method of claim 22, wherein said transcription-factor is a designer Transcription Activator-like Effector (dTALE) and said transcription factor-activated promoter is a Synthetic TALE Activated Promoter (STAP).

24. The method of any one of claims 21 to 23, wherein said target gene is selected from: a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene; a NADP -Malic enzyme (NADP-ME) encoding gene; a NAD-Malic enzyme (NAD-ME) encoding gene; a RbcS encoding gene; a Rubisco activase encoding gene; all regenerative phase genes of theCalvin cycle; genes controlling chloroplast division; transcription factors such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; genes that control plasmodesmata formation; a reporter gene; or any combination of the foregoing.

25. The method of any one of claims 21 to 24, wherein said recombinant construct comprises multiple target genes each operably linked to a separate transcription-factor activated promoter, optionally wherein each said transcription-factor activated promoter is a STAP.

26. The method of claim 25, wherein the separate transcription-factor activated promoters comprise different types of STAPs.

27. The method of claim 26, wherein the different types of STAPs differentially express the multiple target genes.

28. A method for differentially expressing a plurality of target genes in bundle sheath cells of a plant, said method comprising:(i) introducing a recombinant construct into a plant cell, said construct comprising: a plurality of target genes, each operably linked to a STAP or series of STAPs to form a STAP -target gene sequence module, said STAP-target gene sequence modules being sequentially organised; a dTALE upstream of and operably linked to said sequentially organised STAP- target gene modules; and a bundle sheath cell-specific promoter upstream of and operably linked to said dTALE; and,(ii) generating the plant using the plant cell, wherein said bundle sheath cells of the plant express said target gene; wherein said bundle sheath cell-specific promoter is a promoter as defined in any one of claims 1 to 6.

29. The method of claim 28, wherein said target genes are selected from: a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene; a NADP-Malic enzyme (NADP-ME) encoding gene; a NAD-Malic enzyme (NAD-ME) encoding gene; a RbcS encoding gene; a Rubisco activase encoding gene; all regenerative phase genes of the Calvin cycle; genes controlling chloroplast division; transcription factors such as CGA1, GNC and G2 or G2- like that control chloroplast biogenesis; genes that control plasmodesmata formation; a reporter gene; or any combination of the foregoing.

30. The method of any one of claims 21 to 29, wherein said recombinant construct further comprises an antibiotic resistance gene, which is optionally operably linked to a constitutive promoter, an inducible promoter, or a bundle sheath specific promoter.

31. The method of any one of claims 21 to 30, further comprising generating Ti generation plant / s from the plant, wherein the Ti generation plant / s heritably express the target gene in bundle sheath cells.

32. The method of claim 31, further comprising generating T2 generation plant / s from the Ti generation plant / s, wherein the T2 generation plant / s heritably express the target gene in bundle sheath cells.

33. The method of any one of claims 21 to 32, wherein said plant is a C3 plant.

34. The method of claim 33, wherein said plant is a C3 grass, preferably rice, more preferably Oryza sativa.

35. A recombinant construct for expressing a target gene in a plant bundle sheath cell, said construct comprising: a plurality of target genes, each operably linked to a STAP or series of STAPs to form a STAP -target gene sequence module, said STAP-target gene sequence modules being sequentially organised; a dTALE upstream of and operably linked to said sequentially organised STAP- target gene modules; and a bundle sheath cell-specific promoter upstream of and operably linked to said dTALE, wherein said bundle sheath cell-specific promoter is a promoter as defined in any one of claims 1 to 6.

36. The recombinant construct of claim 35, wherein said target gene is selected from: a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene; a NADP -Malic enzyme (NADP-ME) encoding gene; a NAD-Malic enzyme (NAD-ME) encoding gene; a RbcS encoding gene; a Rubisco activase encoding gene; all regenerative phase genes of the Calvin cycle; genes controlling chloroplast division; transcription factors such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; genes that control plasmodesmata formation; a reporter gene; or any combination of the foregoing.

37. The recombinant construct of claim 35 or claim 36, wherein the separate transcriptionfactor activated promoters (STAPS) comprise different types of STAPs.

38. The recombinant construct of claim 37, wherein the different types of STAPs differentially express the multiple target genes.

39. A recombinant construct for differentially expressing a plurality of target genes in bundle sheath cells of a plant, said construct comprising: a plurality of target genes, each operably linked to a STAP or series of STAPs to form a STAP -target gene sequence module, said STAP-target gene sequence modules being sequentially organised; a dTALE upstream of and operably linked to said sequentially organised STAP- target gene modules; and a bundle sheath cell-specific promoter upstream of and operably linked to said dTALE, wherein said bundle sheath cell-specific promoter is a promoter as defined in any one of claims 1 to 6.

40. The recombinant construct according to any one of claims 35 to 39, wherein said target genes are selected from: a phospho-enol pyruvate carboxykinase (PEPCK) encoding gene; a NADP -Malic enzyme (NADP-ME) encoding gene; a NAD-Malic enzyme (NAD-ME) encoding gene; a RbcS encoding gene; a Rubisco activase encoding gene; all regenerative phase genes of the Calvin cycle; genes controlling chloroplast division; transcription factors such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; genes that control plasmodesmata formation; a reporter gene; or any combination of the foregoing.

41. The recombinant construct of any one of claims 35 to 40, wherein said recombinant construct further comprises an antibiotic resistance gene, which is optionally operably linked to a constitutive promoter, an inducible promoter, or a bundle sheath specific promoter.

42. The recombinant construct of any one of claims 35 to 41 wherein said plant is a C3 plant.

43. The recombinant construct of claim 42, wherein said plant is a C3 grass, preferably rice, more preferably Oryza sativa.

44. A plant or a part thereof expressing one or more target genes in bundle sheath cells, obtained by the method of any one of claims 21 to 34 or comprising a recombinant construct according to any one of claims 7, 8, 13, 17 or 35 to 43 or comprising a promoter according to any one of claims 1 to 6, 13 or 17 or comprising the transgenic cell of any one of claims 10 to 13 or 17.

45. The plant or part thereof of claim 44, or part thereof wherein said plant is a C3 plant.

46. The plant or part thereof of claim 44 or claim 45, or part thereof wherein said plant is a C3 grass, preferably rice, more preferably Oryza sativa.

47. Method for increasing crop yield in a plant of the Oryza family, comprising of introducing into the genome of said plant a recombinant construct according to any one of claims 7, 8, 13, 17 or 35 to 43 or a promoter according to claim 1 to 6, 13 or 17 in operable linkage with a downstream gene product, wherein said downstream gene product is selected from the group consisting of a phospho-enol pyruvate carboxykinase (PEPCK) or a component thereof; a NADP -Malic enzyme (NADP-ME) or a component thereof; a NAD-Malic enzyme (NAD-ME) or a component thereof; ribulose-l,5-bisphosphate carboxylase / oxygenase small subunit or a component thereof; Rubisco activase or a component thereof; a gene product of a regenerative phase gene of the Calvin cycle; a gene product of a gene controlling chloroplast division; a transcription factor such as CGA1, GNC and G2 or G2-like that control chloroplast biogenesis; a gene product of a gene that controls plasmodesmata formation; a gene product of a reporter gene or a component thereof; or any combination of the foregoing.

48. Method according to claim 47, wherein the plant is Oryza sativa, and / or plants derived therefrom.

Images