RNA compositions for delivery of MPOX antigens and related methods

Abstract

The present disclosure provides pharmaceutical compositions for delivery of mpox virus antigens (e.g., an mpox vaccine) and related technologies (e.g., components thereof and / or methods relating thereto). For example, the present disclosure provides polyribonucleotides encoding one or more mpox antigens or antigenic fragments thereof.

Description

RNA COMPOSITIONS FOR DELIVERY OF MPOX ANTIGENS AND RELATED METHODS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority to United States Provisional Application No. 63 / 581,265, filed September 7, 2023, United States Provisional Application No. 63 / 588,961, filed October 9, 2023, United States Provisional Application No. 63 / 604,159, filed November 29, 2023, United States Provisional Application No. 63 / 639,545, filed April 26, 2024, and United States Provisional Application No. 63 / 646,826, filed May 13, 2024, the entireties of which are incorporated herein by reference.SEQUENCE LISTING

[0002] The present application contains a Sequence Listing which has been submitted electronically inXML format and is hereby incorporated by reference in its entirety. Said XML file copy, created on August 30, 2024, is named 2013237-1163_SL.xml and is 657,817 bytes in size.BACKGROUND

[0003] Orthopoxvirus is a genus encompassing a number of viral species including mpox virus(previously known as "monkeypox"; also referred to herein as"MPXV"), vaccinia virus (also referred to herein as "VACV", e.g., Vaccinia virus Ankara, Vaccinia virus Copenhagen, Vaccinia virus WR), rabbitpox, buffalopox, camelpox, Cantagalo virus, ectromelia virus (also referred to herein as "ECTV" and "mousepox"), borealpox virus (previously known as "Alaskapox"; also referred to herein as "AKPV" or "BRPV"), cowpox virus (also referred to herein as "CPXV"), and variola virus (also referred to herein as "VARV"). Some orthopoxviruses are restricted in the hosts they infect, while others have been identified in a broad range of host species. Orthopoxviruses share a number of biological phenotypes including: a lack of a specific receptor required for infection of mammalian cells, a relatively low mutations rate, environmental stability of virion, and the ability to infect hosts via a number of routes (e.g., mucosal, respiratory, parenteral, etc.).

[0004] Mpox was first discovered in 1958 when two outbreaks of a pox-like disease occurred in colonies of monkeys kept for research, hence the name "monkeypox." The first human case of mpox was recorded in 1970 in the Democratic Republic of Congo during a period of intensified effort to eliminate smallpox. Since then, mpox has been reported in humans in other central and western African countries.

[0005] Beginning in May 2022, a multinational outbreak of mpox led to over 85,000 cases worldwide spanning 114 countries, many of which have not been previously considered endemic. Transmission of this zoonotic infection has sustained endemicity in West and Central Africa for many years, but the scale of the 2022 outbreak was unprecedented leading to its declaration as a public health emergency of international concern (PHEIC) by the World Health Organization (WHO) in July 2022. The PHEIC was discontinued in May 2023 due to a significant decline in the number of reported cases and no changes in the severity of the disease (WHO Emergency Committee Meeting 2023). In 2024, the WHO declared a new PHEIC as a result of the upsurge of mpox and the emergence of a new clade (clade lb) in the Democratic Republic of the Congo and other African countries. The recent mpox outbreak illustrates the potential for orthopoxvirus re-emergence and spread and highlights limitations in the current vaccine supply.SUMMARY

[0006] Pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) that deliver portions or components of a pathogen (e.g., virus) have advantages to live pathogen approaches by focusing the vaccine response only on targets with a high potential for eliciting protective responses. While specific antigens have been shown to be immunogenic following orthopoxvirus (e.g., VACV) administration, the minimal set of antigens and the types of immunity to them that are essential for protection from disease are not fullyunderstood. Therefore, despite the multivalency enabled by current RNA vaccine platforms, antigen selection for subunit vaccines against orthopoxviruses is still being explored. Pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) that deliver portions or components of orthopoxviruses therefore face a key question around antigen selection as, despite the multivalency enabled by the RNA platform, prioritization must take place.

[0007] Pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) of the present disclosure are designed to encode multiple mpox antigens because of the many surface proteins and complex replication cycle of orthopoxviruses. Orthopoxviruses have two distinct infectious forms, mature virions (MV) and extracellular virions (EV). Each viral form has a unique set of surface antigens. While immune responses raised to any single target can offer some protection from infection, both subunit vaccine and monoclonal antibody prophylaxis studies in animals illustrated that the value of combining antibodies to multiple EV and MV targets. Therefore, to effectively reduce viral replication and infectivity, exemplary vaccine compositions of the present disclosure elicit immune responses to a combination of mpox proteins from both EVs and MVs: A35 and B6, which are EV surface glycoproteins, and Ml and H3, which are displayed on the surface of MVs. Without wishing to be bound by theory, selection of this subset of antigens from the surface proteomes of mpox virions involved a consideration, in part, of the fact that A35, B6, Ml and H3 are conserved across many orthopoxviruses, including VARV and VACV. All four proteins have been observed to be highly immunogenic following VACV immunization or in MPXV convalescent subjects. A35, B6, and Ml have been shown to protect mice and macaques from lethal orthopoxvirus disease. Additionally, antibodies to all four antigens have previously been shown to protect animals in monoclonal and / or polyclonal antibody prophylaxis studies. While prior studies have shown that A35, B6, Ml and H3 can elicit immune responses and provide some degree of protection against orthopoxviruses, challenges remain with the use of pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) that include the antigens as polypeptides.

[0008] The present disclosure provides a recognition of several challenges involved in development and administration of polypeptide-based therapies. First, development of polypeptide-based therapies can be time consuming and expensive. For example, polypeptide development is challenged by demanding and costly production, including purification and formulation methods. Second, polypeptide-based therapies present an increased number of regulatory challenges. In addition to demonstrating that a protein therapy will be safe and efficacious, there is tight regulation over manufacture of polypeptide-based therapies (e.g., assessing post- translational modifications, etc.) and quality control during storage and administration complicate the use of protein therapies. Third, administration of polypeptide-based therapies to a subject can be painful and time consuming. Generally, polypeptide-based therapies are administered intravenously over a longer period of time, increasing patient discomfort. Finally, polypeptide-based therapies can have a relatively short serum half-life. The present disclosure provides insights that address these challenges, making it possible to deliver one or more therapies, as described herein, to a subject safely, reliably, and with strong potency.

[0009] Among other things, the present disclosure describes one or more orthopoxvirus (e.g., mpox) antigens, antigenic fragments, or variants thereof that are delivered to a subject via one or more polyribonucleotides. Utilizing one or more polyribonucleotides as a therapeutic agent (in contrast to administering a polypeptide itself) involves simpler and less expensive manufacturing processes. The less complex production of polyribonucleotide encoding antigens can streamline manufacture, mitigating regulatory and production challenges associated with developing and using an antigen themselves. Additionally, polyribonucleotides are effective at producing similar effects to recombinant polypeptides, but tend to require much lower volumes beadministered to a subject. This is because polyribonucleotides encoding an antigen characteristic portion, or variant thereof, can be administered to a subject and the subject's body produces the polypeptide itself. Without wishing to be bound by any particular theory, a polyribonucleotide encoding antigens, as a therapeutic agent, has higher therapeutic efficacy (in contrast to administering a polypeptide itself) due to its continuous translation into encoded antigen to trigger long-lasting expression compared to transient traditional antigen polypeptide delivery. The present disclosure also provides technologies that address certain limitations of recombinant polypeptide technologies, including for example, expression of antigens by utilizing RNA technologies as a modality to express antigens directly in the patient's cells.[OO1O] The present disclosure provides pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) for delivering particular orthopox antigen constructs to a subject (e.g., a patient) and related technologies (e.g., methods). More specifically, the present disclosure provides pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) for delivering particular polyribonucleotide constructs encoding mpox antigens to a subject (e.g., a patient) and related technologies (e.g., methods). In particular, the present disclosure provides polyribonucleotide constructs encoding mpox antigens and related technologies (e.g., methods). The present disclosure includes the unexpected discovery that mpox antigens, and antigenic fragments thereof, provided herein are particularly advantageous for use in preventing or treating mpox infection and infections by related orthopoxviruses (e.g., variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, modified vaccinia virus Ankara, or vaccinia viruses).

[0011] In some embodiments, the present disclosure provides certain polyribonucleotide constructs encoding mpox antigens particularly useful in effective vaccination. In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for vaccination against mpox. In various embodiments, an mpox antigen construct includes and / or encodes one or more mpox antigens or fragments thereof (e.g., one or more B cell antigens for mpox and / or one or more T cell antigens for mpox, or fragments thereof). As disclosed herein, T cell antigens include, e.g., CD4 T cell antigens and / or CD8 T cells. For the avoidance of doubt, as will be appreciated by those of skill in the art, any reference herein to an antigen as a "B cell antigen" or "T cell antigen" or the like does not exclude that any given antigen, or any given agent when exposed to an immune system, can activate, induce, and / or cause a diversity of immunological responses that can include, regardless of labels applied for expediency of description, one or both of a B cell response and a T cell response.

[0012] The present disclosure also provides the insight that an mpox vaccine may cross-protect against other orthopoxviruses (e.g., variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara)). In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for the prevention or treatment of a vaccinia virus (e.g., vaccinia virus Ankara, etc.) infection when administered to a subject. In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for the prevention or treatment of a rabbitpox infection when administered to a subject. In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for the prevention or treatment of a variola virus infection when administered to a subject. In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for the prevention or treatment against a cowpox virus when administered to a subject. In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for the prevention or treatment of a ectromelia virus infection when administered to a subject. In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for vaccination against mpox andone or more other orthopoxviruses. In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for vaccination against mpox and variola virus. In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for vaccination against mpox and vaccinia virus. In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for vaccination against mpox and cowpox virus. In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for vaccination against mpox and ectromelia virus. In some embodiments, provided polyribonucleotide constructs encoding mpox antigens are effective for vaccination against mpox and a novel orthopoxvirus.

[0013] In some embodiments, polyribonucleotide constructs encoding mpox antigens of the present disclosure are effective for the prevention or treatment of a lethal mpox virus infection. In some embodiments, polyribonucleotide constructs encoding mpox antigens of the present disclosure are effective for the prevention or treatment of a lethal clade I mpox virus infection. In some embodiments, polyribonucleotide constructs encoding mpox antigens of the present disclosure are effective for the prevention or treatment of a strain V79-I- 005 mpox virus infection.

[0014] In some embodiments, a composition of the present disclosure comprises a therapeutically effective amount of one or more polyribonucleotides encoding one or more mpox virus antigens or fragments thereof; and a pharmaceutically acceptable carrier, wherein each of the one or more polyribonucleotides or fragments thereof is fully or partially encapsulated within a lipid nanoparticle. In some embodiments, the one or more polyribonucleotides are purified. In some embodiments, the one or more polyribonucleotides are singlestranded. In some embodiments, the one or more polyribonucleotides comprise a 5'-capped Nl- methylpseudouridine.

[0015] In some embodiments, mpox virus antigens or fragments thereof comprise: (i) B6R or a fragment of B6R; (ii) MIR or a fragment of MIR; (iii) A35R or a fragment of A35R; or (iv) H3L or a fragment of H3L.

[0016] In some embodiments, a composition of the present disclosure comprises at least three or four polyribonucleotides, and wherein the at least three or four polyribonucleotides each encode a different mpox virus antigen or fragment thereof.

[0017] In some embodiments, a composition of the present disclosure comprises: (i) a polyribonucleotide encoding B6R or a fragment of B6R; (ii) a polyribonucleotide encoding MIR or a fragment of MIR; and (iii) a polyribonucleotide encoding A35R or a fragment of A35R.

[0018] In some embodiments, a composition of the present disclosure comprises: (i) a polyribonucleotide encoding B6R or a fragment of B6R; (ii) a polyribonucleotide encoding MIR or a fragment of MIR; (iii) a polyribonucleotide encoding A35R or a fragment of A35R; and (iv) a polyribonucleotide encoding H3L or a fragment of H3L.

[0019] In some embodiments, the lipid nanoparticle targets liver cells and / or secondary lymphoid organ cells. In some embodiments, the lipid nanoparticle is a cationic lipid nanoparticle. In some embodiments, the lipid nanoparticle comprises: (a) a polymer-conjugated lipid; (b) a cationic lipid; and (c) one or more neutral lipids. In some embodiments, the polymer-conjugated lipid comprises a PEG-conjugated lipid or 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide. In some embodiments, the one or more neutral lipids comprise 1,2- Distearoyl-sn-glycero-3-phosphocholine (DPSC) or cholesterol. In some embodiments, the cationic lipid comprises ((3-hydroxypropyl)azanediyl)bis(nonane-9,l-diyl) bis(2-butyloctanoate).

[0020] In some embodiments, a lipid nanoparticle of the present disclosure comprises: (a) 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide; (b) DPSC; (c) cholesterol; and (d) ((3- hydroxypropyl)azanediyl)bis(nonane-9,l-diyl) bis(2-butyloctanoate).In some embodiments, a lipid nanoparticle of the present disclosure comprises: (a) the polymer-conjugated lipid at about 1-2.5 mol% of the total lipids; (b) the cationic lipid at 35-65 mol% of the total lipids; and (c) the one or more neutral lipids are present in 35-65 mol% of the total lipids.

[0021] In some embodiments, lipid nanoparticles of the present disclosure have an average diameter of about 50-150 nm.

[0022] In some embodiments, a therapeutically effective amount of the one or more polyribonucleotides is 1 μg to 250 μg, 5 μg to 200 μg, 10 μg to 100 μg, or 10 μg to 60 μg. In some embodiments, a therapeutically effective amount of the one or more polyribonucleotides is about 10 μg, about 30 μg, or about 60 μg.

[0023] In some embodiments, the present disclosure provides a method of preventing an orthopoxvirus infection in a subject. In some embodiments, a method of preventing an orthopoxvirus infection in a subject comprises administering a composition to the subject. In some embodiments, a composition comprises: a therapeutically effective amount of one or more polyribonucleotides encoding one or more mpox virus antigens or antigenic fragments thereof; and a pharmaceutically acceptable carrier.

[0024] In some embodiments, a composition comprises at least three polyribonucleotides, wherein each of the at least three polyribonucleotides encodes a different mpox virus antigen or antigenic fragment thereof. In some embodiments, a method of preventing an orthopoxvirus infection in a subject provided herein comprises administering a composition to the subject, wherein the composition comprises: a first polyribonucleotide encoding a B6R antigen, or antigenic fragment thereof; a second polyribonucleotide encoding an MIR antigen, or antigenic fragment thereof; and a third polyribonucleotide encoding an A35 antigen, or antigenic fragment thereof. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182. In some embodiments, an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158. In some embodiments, an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182; an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158; and an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174.

[0025] In some embodiments, a composition comprises at least four polyribonucleotides, wherein each of the at least four polyribonucleotides encodes a different mpox virus antigen or antigenic fragmentthereof. In some embodiments, a method of preventing an orthopoxvirus infection in a subject comprises administering a composition to the subject, wherein the composition comprises: a first polyribonucleotide encodes a B6R antigen, or antigenic fragment thereof; a second polyribonucleotide encodes an MIR antigen, or antigenic fragment thereof; a third polyribonucleotide encodes an A35 antigen, or antigenic fragment thereof; and a fourth polyribonucleotide encodes an H3L antigen, or antigenic fragment thereof. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182. In some embodiments, an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31- 40, and 158. In some embodiments, an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174. In some embodiments, an H3L antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, and 190. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182; an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158; an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174; and an H3L antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, and 190.

[0026] In some embodiments, a method of preventing an orthopoxvirus infection, wherein the orthopoxvirus infection comprises an mpox infection, a vaccinia infection, an ectromelia infection, a variola infection, a borealpox infection, a cowpox infection, a volepox infection, a buffalopox infection, a camelpox infection, a rabbitpox infection, or a modified vaccinia virus Ankara infection. In some embodiments, an orthopoxvirus infection is an mpox infection. In some embodiments, an orthopoxvirus infection is a clade I mpox infection. In some embodiments, an orthopoxvirus infection is a clade la or clade lb mpox infection. In some embodiments, an orthopoxvirus infection is a clade II mpox infection. In some embodiments, an orthopoxvirus infection is a clade Ila or clade lib mpox infection.

[0027] In some embodiments, a method provided herein is a method of treating an orthopoxvirus infection in a subject. In some embodiments, a method of treating an orthopoxvirus infection in a subject comprises administering a composition to the subject. In some embodiments, a composition comprises: a therapeutically effective amount of one or more polyribonucleotides encoding one or more mpox virus antigens or antigenic fragments thereof; and a pharmaceutically acceptable carrier.

[0028] In some embodiments, a composition comprises at least three polyribonucleotides, wherein each of the at least three polyribonucleotides encodes a different mpox virus antigen or antigenic fragmentthereof. In some embodiments, a method of treating an orthopoxvirus infection in a subject provided herein comprises administering a composition to the subject, wherein the composition comprises: a first polyribonucleotide encoding a B6R antigen, or antigenic fragment thereof; a second polyribonucleotide encoding an MIR antigen, or antigenic fragment thereof; and a third polyribonucleotide encoding an A35 antigen, or antigenic fragment thereof. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182. In some embodiments, an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158. In some embodiments, an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182; an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158; and an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174.

[0029] In some embodiments, a composition comprises at least four polyribonucleotides, wherein each of the at least four polyribonucleotides encodes a different mpox virus antigen or antigenic fragment thereof. In some embodiments, a method of treating an orthopoxvirus infection in a subject comprises administering a composition to the subject, wherein the composition comprises: a first polyribonucleotide encoding a B6R antigen, or antigenic fragment thereof; a second polyribonucleotide encoding an MIR antigen, or antigenic fragment thereof; a third polyribonucleotide encoding an A35 antigen, or antigenic fragment thereof; and a fourth polyribonucleotide encoding an H3L antigen, or antigenic fragment thereof. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182. In some embodiments, an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31- 40, and 158. In some embodiments, an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174. In some embodiments, an H3L antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, and 190. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182; an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158; an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174; and an H3L antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, and 190.

[0030] In some embodiments, the present disclosure provides a method of treating an orthopoxvirus infection, wherein the orthopoxvirus infection comprises an mpox infection, a vaccinia infection, an ectromelia infection, a variola infection, a borealpox infection, a cowpox infection, a volepox infection, a buffalopox infection, a camelpox infection, a rabbitpox infection, or a modified vaccinia virus Ankara infection. In some embodiments, an orthopoxvirus infection is an mpox infection. In some embodiments, an orthopoxvirus infection is a clade I mpox infection. In some embodiments, an orthopoxvirus infection is a clade la or clade lb mpox infection. In some embodiments, an orthopoxvirus infection is a clade II mpox infection. In some embodiments, an orthopoxvirus infection is a clade Ila or clade lib mpox infection.

[0031] In some embodiments, the present disclosure provides a method of preventing an orthopoxvirus infection in a subject. In some embodiments, a method of preventing an orthopoxvirus infection in a subject comprises administering a combination to the subject. In some embodiments, a combination comprises: a therapeutically effective amount of one or more polyribonucleotides encoding one or more mpox virus antigens or antigenic fragments thereof; and a pharmaceutically acceptable carrier.

[0032] In some embodiments, a combination comprises at least three polyribonucleotides, wherein each of the at least three polyribonucleotides encodes a different mpox virus antigen or antigenic fragment thereof. In some embodiments, a method of preventing an orthopoxvirus infection in a subject provided herein comprises administering a combination to the subject, wherein the combination comprises: a first polyribonucleotide encoding a B6R antigen, or antigenic fragment thereof; a second polyribonucleotide encoding an MIR antigen, or antigenic fragment thereof; and a third polyribonucleotide encoding an A35 antigen, or antigenic fragment thereof. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182. In some embodiments, an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158. In some embodiments, an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182; an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158; and an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174.

[0033] In some embodiments, a combination comprises at least four polyribonucleotides, wherein each of the at least four polyribonucleotides encodes a different mpox virus antigen or antigenic fragment thereof. In some embodiments, a method of preventing an orthopoxvirus infection in a subject comprises administering a combination to the subject, wherein the combination comprises: a first polyribonucleotide encoding a B6R antigen, or antigenic fragment thereof; a second polyribonucleotide encoding an MIR antigen, or antigenic fragment thereof; a third polyribonucleotide encoding an A35 antigen, or antigenic fragment thereof; and a fourth polyribonucleotide encoding an H3L antigen, or antigenic fragment thereof. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182. In some embodiments, an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31- 40, and 158. In some embodiments, an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174. In some embodiments, an H3L antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, and 190. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182; an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158; an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174; and an H3L antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, and 190.

[0034] In some embodiments, the present disclosure provides a method of preventing an orthopoxvirus infection, wherein the orthopoxvirus infection comprises an mpox infection, a vaccinia infection, an ectromelia infection, a variola infection, a borealpox infection, a cowpox infection, a volepox infection, a buffalopox infection, a camelpox infection, a rabbitpox infection, or a modified vaccinia virus Ankara infection. In some embodiments, an orthopoxvirus infection is an mpox infection. In some embodiments, an orthopoxvirus infection is a clade I mpox infection. In some embodiments, an orthopoxvirus infection is a clade la or clade lb mpox infection. In some embodiments, an orthopoxvirus infection is a clade II mpox infection. In some embodiments, an orthopoxvirus infection is a clade Ila or clade lib mpox infection.

[0035] In some embodiments, a method provided herein is a method of treating an orthopoxvirus infection in a subject. In some embodiments, a method of treating an orthopoxvirus infection in a subject comprises administering a combination to the subject. In some embodiments, a combination comprises: a therapeutically effective amount of one or more polyribonucleotides encoding one or more mpox virus antigens or antigenic fragments thereof; and a pharmaceutically acceptable carrier.

[0036] In some embodiments, a combination comprises at least three polyribonucleotides, wherein each of the at least three polyribonucleotides encodes a different mpox virus antigen or antigenic fragment thereof. In some embodiments, a method of treating an orthopoxvirus infection in a subject provided herein comprises administering a combination to the subject, wherein the combination comprises: a first polyribonucleotide encoding a B6R antigen, or antigenic fragment thereof; a second polyribonucleotide encoding an MIR antigen, or antigenic fragment thereof; and a third polyribonucleotide encoding an A35 antigen, or antigenic fragment thereof. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182. In some embodiments, an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158. In some embodiments, an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182; an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158; and an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174.

[0037] In some embodiments, a combination comprises at least four polyribonucleotides, wherein each of the at least four polyribonucleotides encodes a different mpox virus antigen or antigenic fragment thereof. In some embodiments, a method of treating an orthopoxvirus infection in a subject comprises administering a combination to the subject, wherein the combination comprises: a first polyribonucleotide encoding a B6R antigen, or antigenic fragment thereof; a second polyribonucleotide encoding an MIR antigen, or antigenic fragment thereof; a third polyribonucleotide encoding an A35 antigen, or antigenic fragment thereof; and a fourth polyribonucleotide encoding an H3L antigen, or antigenic fragment thereof. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182. In some embodiments, an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31- 40, and 158. In some embodiments, an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174. In some embodiments, an H3L antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, and 190. In some embodiments, a B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs:21-30, 180, and 182; an MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158; an A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174; and an H3L antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, and 190.

[0038] In some embodiments, the present disclosure provides a method of treating an orthopoxvirus infection, wherein the orthopoxvirus infection comprises an mpox infection, a vaccinia infection, an ectromelia infection, a variola infection, a borealpox infection, a cowpox infection, a volepox infection, a buffalopox infection, a camelpox infection, a rabbitpox infection, or a modified vaccinia virus Ankara infection. In some embodiments, an orthopoxvirus infection is an mpox infection. In some embodiments, an orthopoxvirus infection is a clade I mpox infection. In some embodiments, an orthopoxvirus infection is a clade la or clade lb mpox infection. In some embodiments, an orthopoxvirus infection is a clade II mpox infection. In some embodiments, an orthopoxvirus infection is a clade Ila or clade lib mpox infection.

[0039] In some embodiments, a composition of the present disclosure comprises one or more polyribonucleotides that are purified. In some embodiments, a combination of the present disclosure comprises one or more polyribonucleotides that are purified.

[0040] In some embodiments, a composition of the present disclosure comprises one or more singlestranded polyribonucleotides. In some embodiments, a combination of the present disclosure comprises one or more single-stranded polyribonucleotides.

[0041] In some embodiments, a composition of the present disclosure comprises one or more polyribonucleotides comprising a 5'-capped Nl-methylpseudouridine. In some embodiments, a combination of the present disclosure comprises one or more polyribonucleotides comprising a 5'-capped Nl- methylpseudouridine.

[0042] In some embodiments, a composition of the present disclosure comprises one or more polyribonucleotides that are fully or partially encapsulated within a lipid nanoparticle. In some embodiments, a combination of the present disclosure comprises one or more polyribonucleotides that are fully or partially encapsulated within a lipid nanoparticle. In some embodiments, a lipid nanoparticle targets liver cells. In some embodiments, a lipid nanoparticle targets secondary lymphoid organ cells. In some embodiments, a lipid nanoparticle is a cationic lipid nanoparticle. In some embodiments, a lipid nanoparticle comprises: (a) a polymer-conjugated lipid; (b) a cationic lipid; and (c) one or more neutral lipids. In some embodiments, a polymer-conjugated lipid comprises a PEG-conjugated lipid. In some embodiments, one or more neutral lipids comprise 1,2-Distearoyl-sn-glycero-3-phosphocholine (DPSC). In some embodiments, one or more neutral lipids comprise cholesterol. In some embodiments, a lipid nanoparticle comprises: (a) the polymer-conjugated lipid at about 1-2.5 mol% of the total lipids; (b) the cationic lipid at 35-65 mol% of the total lipids; and (c) the one or more neutral lipids are present in 35-65 mol% of the total lipids. In some embodiments, a lipid nanoparticle has an average diameter of about 50-150 nm.

[0043] In some embodiments, a method provided herein is a method of preventing an orthopoxvirus infection in a subject comprising administering a composition to the subject in one or more doses. In some embodiments, one or more doses comprises about 10 μg, about 30 μg, or about 60 μg of the one or more polyribonucleotides. In some embodiments, administering one or more doses comprises administering a first dose of a composition and a second dose of a composition. In some embodiments, a second dose of a composition is administered to a subject about 31 days after a first dose of a composition is administered to the subject. In some embodiments, one or more doses are administered to the subject intramuscularly.

[0044] In some embodiments, a method provided herein is a method of treating an orthopoxvirus infection in a subject comprising administering a composition to the subject in one or more doses. In some embodiments, one or more doses comprises about 10 μg, about 30 μg, or about 60 μg of the one or more polyribonucleotides. In some embodiments, administering one or more doses comprises administering a first dose of a composition and a second dose of a composition. In some embodiments, a second dose of a composition is administered to a subject about 31 days after a first dose of a composition is administered to the subject. In some embodiments, one or more doses are administered to the subject intramuscularly.

[0045] In some embodiments, a method provided herein is a method of preventing an orthopoxvirus infection in a subject comprising administering a combination to the subject in one or more doses. In some embodiments, one or more doses comprises about 10 μg, about 30 μg, or about 60 μg of the one or more polyribonucleotides. In some embodiments, administering one or more doses comprises administering a first dose of a combination and a second dose of a combination. In some embodiments, a second dose of a combination is administered to a subject about 31 days after a first dose of a combination is administered to the subject. In some embodiments, one or more doses are administered to the subject intramuscularly.

[0046] In some embodiments, a method provided herein is a method of treating an orthopoxvirus infection in a subject comprising administering a combination to the subject in one or more doses. In some embodiments, one or more doses comprises about 10 μg, about 30 μg, or about 60 μg of the one or more polyribonucleotides. In some embodiments, administering one or more doses comprises administering a first dose of a combination and a second dose of a combination. In some embodiments, a second dose of a combination is administered to a subject about 31 days after a first dose of a combination is administered to the subject. In some embodiments, one or more doses are administered to the subject intramuscularly.

[0047] In some embodiments, a method of preventing an orthopoxvirus infection in a subject comprising administering a composition, wherein administering the composition comprises mixing the one or more polyribonucleotides and wherein each of the one or more polyribonucleotides is administered as a single injection dose.

[0048] In some embodiments, a method of treating an orthopoxvirus infection in a subject comprising administering a composition, wherein administering the composition comprises mixing the one or more polyribonucleotides and wherein each of the one or more sub-doses is administered as a single injection dose.

[0049] In some embodiments, a method of preventing an orthopoxvirus infection in a subject comprising administering a combination, wherein administering the combination comprises mixing the one or more polyribonucleotides and wherein each of the one or more polyribonucleotides is administered as a single injection dose.

[0050] In some embodiments, a method of treating an orthopoxvirus infection in a subject comprising administering a combination, wherein administering the combination comprises mixing the one or more polyribonucleotides and wherein each of the one or more polyribonucleotides is administered as a single injection dose.

[0051] In some embodiments, the present disclosure provides a method of preventing an orthopoxvirus infection in a subject comprising administering a composition to the subject, wherein administering results in an increased serum level of one or more orthopoxvirus-neutralizing antibodies in the subject.

[0052] In some embodiments, the present disclosure provides a method of treating an orthopoxvirus infection in a subject comprising administering a composition to the subject, wherein administering results in an increased serum level of one or more orthopoxvirus-neutralizing antibodies in the subject.

[0053] In some embodiments, the present disclosure provides a method of preventing an orthopoxvirus infection in a subject comprising administering a combination to the subject, wherein administering results in an increased serum level of one or more orthopoxvirus-neutralizing antibodies in the subject.

[0054] In some embodiments, the present disclosure provides a method of treating an orthopoxvirus infection in a subject comprising administering a combination to the subject, wherein administering results in an increased serum level of one or more orthopoxvirus-neutralizing antibodies in the subject.

[0055] Also provided herein is a method of preventing an mpox virus infection in a subject comprising administering one or more doses of a composition to the subject, wherein the composition comprises: a therapeutically effective amount of one or more polyribonucleotides encoding one or more MPXV antigens or fragments thereof; and a pharmaceutically acceptable carrier. In some embodiments, each of the one or more polyribonucleotides or fragments thereof is fully or partially encapsulated within a lipid nanoparticle. In some embodiments, the present disclosure provides a method of treating an mpox virus infection in a subject comprising administering one or more doses of a composition to the subject, wherein the composition comprises: a therapeutically effective amount of one or more polyribonucleotides encoding one or more MPXV antigens or fragments thereof; and a pharmaceutically acceptable carrier. In some embodiments, each of the one or more polyribonucleotides or fragments thereof is fully or partially encapsulated within a lipid nanoparticle.

[0056] In some embodiments, provided compositions (e.g., pharmaceutical compositions, e.g., immunogenic compositions, e.g., vaccines) that include one or more polyribonucleotides are prepared, formulated, and / or utilized in particular LNP compositions, e.g., as described herein.

[0057] Among other things, the present disclosure provides technologies for rapid development of a pharmaceutical composition (e.g., immunogenic composition, e.g., mpox vaccine) for delivering particular mpox antigen constructs to a subject.

[0058] Additionally, the present disclosure provides, for example, nucleic acid constructs encoding mpox antigens or fragments thereof disclosed herein, expressing mpox antigens or fragments thereof disclosed herein, and various methods of production and / or use relating thereto, as well as compositions developed therewith and methods relating thereto.

[0059] The present disclosure provides technologies for preventing, characterizing, treating, and / or monitoring mpox outbreaks of orthopoxviruses (e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara) viruses) and / or infections including, e.g., various nucleic acid constructs and encoded proteins, as well as agents (e.g., antibodies) that bind to such proteins, and compositions that comprise and / or deliver them. In some embodiments, providedherein are technologies (e.g., compositions and methods) for augmenting, inducing, promoting, enhancing and / or improving an immune response against orthopoxviruses (e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara) viruses) or components thereof (e.g., a protein or portion thereof). In some embodiments, technologies provided herein are designed to augment, induce, promote, enhance and / or improve immunological memory against orthopoxviruses (e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara) viruses) or a component thereof (e.g., a protein or portion thereof). In some embodiments, technologies described herein are designed to act as an immunological boost to a primary vaccine, such as a vaccine directed to an epitope and / or epitopes of orthopoxviruses (e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara) viruses). In some embodiments, compositions of the present disclosure comprise one or more polynucleotide constructs (e.g., one or more string constructs) that encode one or more epitopes from mpox. In some embodiments, the present disclosure provides vaccines or other compositions comprising nucleic acids encoding such mpox epitopes; those skilled in the art will appreciate from context when reference to a particular polynucleotide (e.g., a DNA or RNA) as "encoding" such epitopes in fact is referencing a coding strand or its complement.BRIEF DESCRIPTION OF THE DRAWING

[0060] FIG. 1 depicts a structural representation of exemplary components of compositions provided by the present disclosure; the exemplary tetravalent Combo 4 and exemplary trivalent Combo 2. The B6 structure is predicted by AlphaFold. The A35, Ml and H3 structures shown are of the VACV orthologs (Protein Data Bank [PDB] IDs 3K7B, 2I9L, and 5EJ0).

[0061] FIGs. 2A-D depict in vitro expression of MPXV antigens from exemplary polyribonucleotide constructs of the present disclosure. HEK293T cells were transfected with 200 ng of polyribonucleotide. Cells transfected with the exemplary multivalent polyribonucleotide compositions Combo 4 and Combo 2 were compared to non-transfected cells and cells transfected with a monovalent polyribonucleotide-LNP composition. Antigen expression levels were measured by flow cytometry 18 hours post- transfection for A35 (FIG. 2A), B6 (FIG. 2B), Ml (FIG. 2C), and H3 (FIG. 2D). In (FIG. 2D), H3 analysis for exemplary Combo 2 is excluded as H3 is not included in this exemplary polyribonucleotide composition. Antigen expression is shown as median fluorescence intensity (MFI) of total live cells for both intracellular (total protein) and surface (surface protein) staining conditions. The mean of technical triplicates is shown (+SEM). Exemplary Combo 2 comprised A35, B6, and Ml antigens, and exemplary Combo 4 comprised A35, B6, Ml, and H3 antigens.

[0062] FIGs. 3A-D are line graphs depicting serum antibody levels produced by mice administered with exemplary polyribonucleotide constructs of the present disclosure. BALB / c mice were administered with 4 μg exemplary Combo 4 (squares), 4 μg exemplary Combo 2 (triangles) or with 1 μg of a polyribonucleotide encoding one antigen (circles) on days 0 and 21. Serum antibody levels for A35 (FIG. 3A), B6 (FIG. 3B), Ml (FIG. 3C), and H3 (FIG. 3D) were measured by ELISA. Geometric mean values of IgG ng / mL equivalents (±SEM) are shown. The dashed line indicates the lower limit of detection.

[0063] FIGs. 4A-E depict induction of germinal centers (GCs) following administration with exemplary polyribonucleotide constructs of the present disclosure encoding a single (e.g., monovalent) MPXV antigen. Following an intramuscular (IM) prime and boost of BALB / c mice, inguinal lymph nodes (LNs) were harvested and analyzed for the presence of GC B cells by flow cytometry. FIG. 4A is a representative dot plot depicting the gating strategy for total GC B cells (Live Dump). FIG. 4B is a representative dot plot depicting the gatingstrategy for B220+CD19+ double positive GC B cells. FIG. 4C is a representative dot plot depicting the gating strategy for GL7+CD95+ double positive GC B cells. Sequential gating events are shown left to right. FIG. 4D is a bar graph depicting the measurement of the percentage of GC B cells in the LN. FIG. 4E is a bar graph depicting the measurement of the fraction of antigen-positive cells among total GC B cells. Mean ±SEM is shown.

[0064] FIGs. 5A-D depict measurements of T cell responses to MPXV antigens after administration with exemplary polyribonucleotide constructs described herein. Mice were administered a single administration of 4 μg exemplary Combo 4 or 1 μg of single polyribonucleotides encoding one MPXV antigen. On day 7 postadministration, mice were sacrificed and antigen-specific T cell levels were measured by IFN-y ELISpot with mouse splenocytes stimulated with peptide pools spanning the antigen(s) relevant to each experimental group. Data for individual animals with median bar are shown for A35 (FIG. 5A), B6 (FIG. 5B), Ml (FIG. 5C), and H3 (FIG. 5D). For FIGs. 5A-D, statistical significance was assessed using a Kruskal-Wallis test with Dunn's multiple comparisons test: n = 4 - 5, -p < 0.05, "p < 0.01, *** <0.001; ns, not significant. Exemplary Combo 2 comprised A35, B6, and Ml antigens, and exemplary Combo 4 comprised A35, B6, Ml, and H3 antigens.

[0065] FIGs. 6A-D depict IgG responses in rats administered exemplary polyribonucleotide constructs of the present disclosure encoding a single (e.g., monovalent) MPXV antigen. Wistar rats were administered with 10 μg of an individual MPXV-antigen encoding polyribonucleotide (e.g., mRNA) on days 0 and 28. Serum antibody levels for A35 (FIG. 6A), B6 (FIG. 6B), Ml (FIG. 6C), and H3 (FIG. 6D) were measured by ELISA. Geometric mean values of IgG ng / mL equivalents (±SEM) are shown. The lower limit of detection is indicated with a dashed line and is set at half the lowest test serum dilution tested.

[0066] FIGs. 7A-D depict cluster plots of neutralizing antibody titers following administrations with exemplary polyribonucleotide constructs of the present disclosure encoding MPXV antigens. Mice were administered IM with exemplary Combo 4 (4 μg) or exemplary Combo 2 (4 μg) compositions, or polyribonucleotides encoding one MPXV antigen (1 μg), on days 0 and 21. Neutralizing antibody activities for MPXV (determined via PRNT; FIG. 7A and FIG. 7B) and for VACV (determined via FRNT; FIG. 7C and FIG. 7D) were measured both in the absence of baby rabbit complement (FIG. 7A and FIG. 7D) and with the addition of baby rabbit complement (FIG. 7B and FIG. 7C). The lower limit of detection is indicated with a dashed line and is set at half the lowest test serum dilution tested. The upper limit of detection for MPXV neutralization is shown at twice the highest dilution tested. Exemplary Combo 2 comprised A35, B6, and Ml antigens, and exemplary Combo 4 comprised A35, B6, Ml, and H3 antigens.

[0067] FIG. 8 is a cluster plot depicting neutralizing antibody responses following prime and boost administrations with exemplary polyribonucleotide constructs of the present disclosure encoding MPXV antigens. BALB / c mice were administered with exemplary Combo 4 or exemplary Combo 2 polyribonucleotide compositions on days 0 and 21 and serum VACV-neutralizing antibodies measured on day 21 and day 35 by FRNT. The lower limit of detection is indicated with a dashed line and is set at half the lowest test serum dilution tested. Exemplary Combo 2 comprised A35, B6, and Ml antigens, and exemplary Combo 4 comprised A35, B6, Ml, and H3 antigens.

[0068] FIGs. 9A-I depict in vivo studies of protection against MPXV challenge from administration with exemplary polyribonucleotide constructs of the present disclosure encoding MPXV antigens. FIG. 9A is a schematic illustrating an exemplary dosing schedule where CAST / Ei mice were administered with a combination of A35 and B6 polyribonucleotides, exemplary Combo 4, exemplary Combo 2, or negative control (mock treated with saline) on days 0 and 21. Animals were challenged intranasally (IN) with 9 x 105PFU of clade lib MPXV (high dose) 5 weeks after the last administration. FIG. 9B and FIG. 9C depict MPXV titers in the lungs ofCAST / Ei mice sacrificed on day 3 or 7 post-challenge, respectively. Lungs were collected and analyzed for viral load by TCID50 assay. The lower limit of detection is indicated by a dashed line. FIG. 9D is a schematic illustrating an exemplary dosing schedule where CAST / Ei mice were administered with a combination of A35 and B6 polyribonucleotides, exemplary Combo 4, exemplary Combo 2, or negative control (mock treated with saline) on days 0 and 21. Animals were challenged intranasally (IN) with 3 x 105PFU of clade lib MPXV (low dose) 5 weeks after the last administration. FIG. 9E and FIG. 9F depict MPXV titers in the lungs of CAST / Ei mice sacrificed on day 3 or 7 post-challenge, respectively. FIG. 9G is a schematic illustrating an exemplary dosing schedule where CAST / Ei mice were administered with polyribonucleotides encoding A35, B6, Ml, or H3 antigens of exemplary Combo 4, exemplary Combo 2, or negative control (mock treated with saline) on days 0 and 21. Animals were challenged IN with 1 x 105PFU of clade I MPXV 5 weeks after the last administration. Mice were monitored for weight loss and survival for two weeks post-challenge. FIG. 9H and FIG. 91 depict weight loss and survival results, respectively, of CAST / Ei mice administered as in FIG. 9G. Statistical significance was assessed using a Kruskal-Wallis test with Dunn's multiple comparisons test: *p < 0.05, ** < 0.01, *** < 0.001; ns, not significant. For survival data (n = 9 - 10), statistical significance was assessed using Mantel-Cox log-rank test: *p < 0.05, *mp < 0.0001; ns, not significant. Combo 2 comprises A35, B6, and Ml antigens, and Combo 4 comprises A35, B6, Ml, and H3 antigens.

[0069] FIGs. 10A-C depict exemplary in vivo studies of protection against MPXV challenge. FIG. 1OA is a schematic illustrating an exemplary dosing schedule where BALB / c mice were administered with polyribonucleotides encoding A35, B6, Ml, or H3 antigens or exemplary Combo 4, exemplary Combo 2, or negative control (mock treated with saline) on days 0 and 21. Animals were challenged IN with 5 x 104PFU of VACV-WR on day 42. FIG. 1OB and FIG. IOC depict weight loss and survival results, respectively. Statistical significance was assessed using a Kruskal-Wallis test with Dunn's multiple comparisons test: p < 0.05, "p < 0.01, *** < 0.001; ns, not significant. For survival data (n = 15 - 16), statistical significance was assessed using Mantel-Cox log-rank test: *p < 0.05, **** < 0.0001; ns, not significant. Combo 2 comprises A35, B6, and Ml antigens, and Combo 4 comprises A35, B6, Ml, and H3 antigens.

[0070] FIGs. 11A-C depict exemplary in vivo studies of protection against ECTV challenge. FIG. 11A is a schematic illustrating an exemplary dosing schedule where BALB / c mice were administered with polyribonucleotides encoding Ml, A35, B6, or H3 antigens or exemplary Combo 4, or negative control (mock treated with PBS) on days 0 and 21. Animals were challenged IN with ECTV (104PFU) on day 42. FIG. 11B and FIG. 11C depict weight loss and survival results, respectively. Combo 4 comprises A35, B6, Ml, and H3 antigens. Statistical significance was assessed using Mantel-Cox log-rank test **** < 0.0001.

[0071] FIGs. 12A-E depict exemplary in vivo studies of protection against MPXV challenge. FIG. 12A is a schematic illustrating an exemplary dosing schedule in cynomolgus macaques. Cynomolgus macaques were administered with 30 μg of exemplary Combo 4 or mock treated with saline on days 0 and 28. An intratracheal (IT) challenge with clade I MPXV was performed on day 60. FIG. 12B, FIG. 12C, FIG. 12D, and FIG. 12E, depict the measurement of serum antibody levels against A35, B6, Ml, and H3 MPXV antigens, respectively, two weeks following boost were measured by ELISA. FIG. 12F is a Kaplan-Meier survival plot depicting survival of macaques administered with exemplary Combo 4 or mock-administered with saline for 28 days post clade I MPXV challenge. FIG. 12G is a line graph depicting the weight loss of individual macaques mock-administered with saline, at 28 days post clade I MPXV challenge. FIG. 12H and FIG. 121 are line graphs depicting the weight loss of individual macaques (FIG. 12H) and mean weight loss (FIG. 121) of macaques administered with exemplary Combo 4 at 28 days post clade I MPXV challenge. FIG. 12J is a line graph depicting lesion counts ofindividual macaques mock-administered with saline, at 28 days post clade I MPXV challenge. FIG. 12K and FIG. 12L are line graphs depicting the lesion counts of individual macaques (FIG. 12K) and mean lesion counts (FIG. 12L) of macaques administered with exemplary Combo 4 at 28 days post clade I MPXV challenge. For weight loss and lesion data, plots for individual animals and averaged plots are given, with the end of observation for each animal due to death or study completion marked by a diamond and dashed lines indicated the baseline value.

[0072] FIGs. 13A-13C depict exemplary in vivo studies of protection against MPXV challenge. FIG.13A is a schematic illustrating an exemplary dosing schedule in CAST / Ei mice. CAST / Ei mice were immunized with 4 μg of exemplary Combo 2 polyribonucleotide composition, 4 μg of exemplary Combo 4 polyribonucleotide composition, an LNP incorporating a combination of polyribonucleotides encoding A35 and B6, or saline, on days 0 and 21. Mice were intranasally challenged with clade I MPXV isolate (Zaire 79 strain) on day 56. FIG. 13B is a line graph depicting the percent body weight change of individual mice over a 12-day period post-MPXV challenge. FIG. 13C is a Kaplan-Meier plot depicting the percent survival of exemplary Combo 2 and Combo 4 polyribonucleotide composition vaccinated animals compared to animals treated with saline or LNP incorporating polyribonucleotides encoding A35 and B6.

[0073] FIGs. 14A-14C depict exemplary in vivo studies of protection against VACV challenge. FIG.14A is a schematic illustrating an exemplary dosing schedule in Balb / C mice. Balb / C mice were immunized with 4 μg of exemplary Combo 4 polyribonucleotide composition, an LNP incorporating 1 μg of polyribonucleotide encoding Ml, an LNP incorporating 1 μg of polyribonucleotide encoding A35, an LNP incorporating 1 μg of polyribonucleotide encoding B6, an LNP incorporating 1 μg of polyribonucleotide encoding H3, or saline on days 0 and 21. Mice were intranasally challenged with a lethal dose of vaccinia virus (VACV) isolate 21 days following the boost dose at day 21. FIG. 14B is a line graph depicting the percent body weight change of individual mice over a 10-day period post-VACV challenge. FIG. 14C is a Kaplan-Meier plot depicting the percent survival of mice immunized as described in FIG. 14A.

[0074] FIGs. 15A-15C are schematic diagrams of the safety and immunogenicity clinical trial design of Example 10. FIG. 15A describes a staggered dosing process for substudies A, B, C, and D of Example 10. FIG. 15B describes the dosing and sample collection for substudies A and B. FIG. 15C describes the dosing and sample collection for substudies C and D of Example 10.

[0075] FIGs. 16A-16B are line graphs depicting the post-MPXV challenge blood viral loads of cynomolgus macaques vaccinated with exemplary Combo 4 polyribonucleotide composition (FIG. 16B) or saline (FIG. 16A).

[0076] FIG. 17 is a cluster plot depicting the 50% neutralization serum titers (NT50) of cynomolgus macaques vaccinated with exemplary Combo 4 polyribonucleotide composition or saline pre- and post-MPXV challenge.

[0077] FIGs. 18A-18D are line graphs depicting the percentage of cells expressing A35 (FIG. 18A),B6 (FIG. 18B), Ml (FIG. 18C), or H3 (FIG. 18D) MPXV antigens in HEK293T cells transfected with various concentrations of modified polyribonucleotide constructs encoding A35, B6, Ml, or H3 MPXV antigens, respectively.

[0078] FIGs. 19A-19D are cluster plots depicting serum anti-A35 (FIG. 19A), anti-B6 (FIG. 19B), anti-Ml (FIG. 19C), and anti-H3 (FIG. 19D) IgG 50% binding titers in BALB / c mice following administrations with exemplary Combo 4 modified polyribonucleotide formulations of the present disclosure. Mice were administered IM with Combo 4 (incorporating modified polyribonucleotides encoding A35, B6, Ml, and H3 MPXVantigens) (i) co-formulated as a combined preparation of LNPs incorporating modified polyribonucleotides in Tris buffer and sucrose (Combo 4 [T]); (ii) co-formulated as a combined preparation of LNPs incorporating modified polyribonucleotides in phosphate buffered saline (PBS) and sucrose (Combo 4 [P]); or (iii) formulated as four single LNP preparations incorporating modified polyribonucleotides, in PBS and sucrose then mixed before administration (Combo 4 (single mix)).DEFINITIONS

[0079] Compounds, compositions and constructs of this disclosure include those described generally above and are further illustrated by the classes, subclasses, and species disclosed herein. As used herein, the following definitions shall apply unless otherwise indicated. For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of Elements, CAS version, Handbook of Chemistry and Physics, 75thEd. Additionally, general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry", 5thEd., Ed.: Smith, M.B. and March, J., John Wiley & Sons, New York: 2001, the entire contents of which are hereby incorporated by reference.

[0080] Unless otherwise stated, structures depicted herein are meant to include all stereoisomeric(e.g., enantiomeric or diastereomeric) forms of the structure, as well as all geometric or conformational isomeric forms of the structure. For example, the R and S configurations of each stereocenter are contemplated as part of the disclosure. Therefore, single stereochemical isomers, as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of provided compounds are within the scope of the disclosure. For example, in some cases, provided compounds show one or more stereoisomers of a compound, and unless otherwise indicated, represents each stereoisomer alone and / or as a mixture. Unless otherwise stated, all tautomeric forms of provided compounds are within the scope of the disclosure.

[0081] Unless otherwise indicated, structures depicted herein are meant to include compounds that differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures including replacement of hydrogen by deuterium or tritium, or replacement of a carbon by 13C- or 14C -enriched carbon are within the scope of this disclosure.

[0082] As used herein, the term "exemplary" refers to an example of an embodiment. Unless otherwise indicated, the term "exemplary" is not intended to indicate that an embodiment is a "preferred" or "best" version of an embodiment.

[0083] About. The term "about", when used herein in reference to a value, refers to a value that is similar, in context to the referenced value. In general, those skilled in the art, familiar with the context, will appreciate the relevant degree of variance encompassed by "about" in that context. For example, in some embodiments, the term "about" may encompass a range of values that are within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value.

[0084] Agent. As used herein, the term "agent," may refer to a physical entity. In some embodiments, an agent may be characterized by a particular feature and / or effect. For example, as used herein, the term "therapeutic agent" refers to a physical entity has a therapeutic effect and / or elicits a desired biological and / or pharmacological effect. In some embodiments, an agent may be a compound, molecule, or entity of any chemical class including, for example, a small molecule, polypeptide, nucleic acid, saccharide, lipid, metal, or a combination or complex thereof.

[0085] Aliphatic. The term "aliphatic" refers to a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a monocyclic hydrocarbon or bicyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic (also referred to herein as "cycloaliphatic"), that has a single point or more than one points of attachment to the rest of the molecule. Unless otherwise specified, aliphatic groups contain 1-12 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms (e.g., C1-6). In some embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms (e.g., C1-5). In other embodiments, aliphatic groups contain 1-4 aliphatic carbon atoms (e.g.,In still other embodiments, aliphatic groups contain 1-3 aliphatic carbon atoms (e.g., C1-3), and in yet other embodiments, aliphatic groups contain 1-2 aliphatic carbon atoms (e.g., C1-2). Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, or alkynyl groups and hybrids thereof. A preferred aliphatic group is C1-6 alkyl.

[0086] Alkyl'. The term "alkyl," used alone or as part of a larger moiety, refers to a saturated, optionally substituted straight or branched chain hydrocarbon group having (unless otherwise specified) 1-12, 1- 10, 1-8, 1-6, 1-4, 1-3, or 1-2 carbon atoms (e.g., C1-12,C1-3, or C1-2). Exemplary alkyl groups include methyl, ethyl, propyl, butyl, pentyl, hexyl, and heptyl.

[0087] Alkylene'. The term "alkylene" refers to a bivalent alkyl group. In some embodiments,"alkylene" is a bivalent straight or branched alkyl group. In some embodiments, an "alkylene chain" is a polymethylene group, i.e., -(CH2)n-, wherein n is a positive integer, e.g., from 1 to 6, from 1 to 4, from 1 to 3, from 1 to 2, or from 2 to 3. An optionally substituted alkylene chain is a polymethylene group in which one or more methylene hydrogen atoms is optionally replaced with a substituent. Suitable substituents include those described below for a substituted aliphatic group and also include those described in the specification herein. It will be appreciated that two substituents of the alkylene group may be taken together to form a ring system. In some embodiments, two substituents can be taken together to form a 3- to 7-membered ring. The substituents can be on the same or different atoms. The suffix "-ene" or "-enyl" when appended to certain groups herein are intended to refer to a bifunctional moiety of said group. For example, "-ene" or "-enyl", when appended to "cyclopropyl" becomes "cyclopropylene" or "cyclopropylenyl" and is intended to refer to a bifunctional cyclopropyl group, e.g.,

[0088] Aikenyh The term "alkenyl", used alone or as part of a larger moiety, refers to an optionally substituted straight or branched chain or cyclic hydrocarbon group having at least one double bond and having (unless otherwise specified) 2-12, 2-10, 2-8, 2-6, 2-4, or 2-3 carbon atoms (e.g., C2-12, C2-10, C2-8, C2-6, C2-4, or C2- 3). Exemplary alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and heptenyl. The term "cycloalkenyl" refers to an optionally substituted non-aromatic monocyclic or multicyclic ring system containing at least one carbon-carbon double bond and having about 3 to about 10 carbon atoms. Exemplary monocyclic cycloalkenyl rings include cyclopentenyl, cyclohexenyl, and cycloheptenyl.

[0089] Alkynyh The term "alkynyl", used alone or as part of a larger moiety, refers to an optionally substituted straight or branched chain hydrocarbon group having at least one triple bond and having (unless otherwise specified) 2-12, 2-10, 2-8, 2-6, 2-4, or 2-3 carbon atoms (e.g., C2-12, C2-10, C2-8, C2-6, C2-4, or C2-3). Exemplary alkynyl groups include ethynyl, propynyl, butynyl, pentynyl, hexynyl, and heptynyl.

[0090] Amino acid'. In its broadest sense, as used herein, the term "amino acid" refers to a compound and / or substance that can be, is, or has been incorporated into a polypeptide chain, e.g., through formation of one or more peptide bonds. In some embodiments, an amino acid has the general structure H2N- C(H)I-COOH. In some embodiments, an amino acid is a naturally-occurring amino acid. In some embodiments, an amino acid is a non-natural amino acid; in some embodiments, an amino acid is a D-amino acid; in some embodiments, an amino acid is an L-amino acid. "Standard amino acid" refers to any of the twenty standard L- amino acids commonly found in naturally occurring peptides. "Nonstandard amino acid" refers to any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or obtained from a natural source. In some embodiments, an amino acid, including a carboxy- and / or amino-terminal amino acid in a polypeptide, can contain a structural modification as compared with the general structure above. For example, in some embodiments, an amino acid may be modified by methylation, amidation, acetylation, pegylation, glycosylation, phosphorylation, and / or substitution (e.g., of the amino group, the carboxylic acid group, one or more protons, and / or the hydroxyl group) as compared with the general structure. In some embodiments, such modification may, for example, alter the circulating half-life of a polypeptide containing the modified amino acid as compared with one containing an otherwise identical unmodified amino acid. In some embodiments, such modification does not significantly alter a relevant activity of a polypeptide containing the modified amino acid, as compared with one containing an otherwise identical unmodified amino acid. As will be clear from context, in some embodiments, the term "amino acid" may be used to refer to a free amino acid; in some embodiments it may be used to refer to an amino acid residue of a polypeptide.

[0091] Aryi\ The term "aryl" refers to monocyclic and bicyclic ring systems having a total of six to fourteen ring members (e.g., C6-C14), wherein at least one ring in the system is aromatic and wherein each ring in the system contains three to seven ring members. In some embodiments, an "aryl" group contains between six and twelve total ring members (e.g., C6-C12). The term "aryl" may be used interchangeably with the term "aryl ring". In some embodiments, "aryl" refers to an aromatic ring system which includes, but not limited to, phenyl, biphenyl, naphthyl, anthracyl and the like, which may bear one or more substituents. Unless otherwise specified, "aryl" groups are hydrocarbons. In some embodiments, an "aryl" ring system is an aromatic ring (e.g., phenyl) that is fused to a non-aromatic ring (e.g., cycloalkyl). Examples of aryl rings include that are fused include

[0092] Associated'. Two events or entities are "associated" with one another, as that term is used herein, if the presence, level, degree, type and / or form of one is correlated with that of the other. For example, a particular entity (e.g., polypeptide, genetic signature, metabolite, microbe, etc.) is considered to be associated with a particular disease, disorder, or condition, if its presence, level and / or form correlates with incidence of, susceptibility to, severity of, stage of, etc. the disease, disorder, or condition (e.g., across a relevant population). In some embodiments, two or more entities are physically "associated" with one another if they interact, directly or indirectly, so that they are and / or remain in physical proximity with one another. In some embodiments, two or more entities that are physically associated with one another are covalently linked to one another; in some embodiments, two or more entities that are physically associated with one another are not covalently linked to one another but are non-covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof.

[0093] Co-adminlstratlon: As used herein, the term "co-administration" refers to use of a composition (e.g., a pharmaceutical composition) described herein and one or more additional therapeutic agents. In some embodiments, one or more additional therapeutic agents comprises at least one polyribonucleotide. The combined use of a composition (e.g., a pharmaceutical composition) described herein and an additional therapeutic agent may be performed concurrently or separately (e.g., sequentially in any order). In some embodiments, a composition (e.g., a pharmaceutical composition) described herein and an additional therapeutic agent may be combined in one pharmaceutically-acceptable excipient, or they may be placed in separate excipient and delivered to a target cell or administered to a subject at different times. Each of these situations is contemplated as falling within the meaning of "co-administration" or "combination," provided that a composition (e.g., a pharmaceutical composition) described herein and an additional therapeutic agent are delivered or administered sufficiently close in time that there is at least some temporal overlap in biological effect(s) generated by each on a target cell or a subject being treated.

[0094] Combination therapy: As used herein, the term "combination therapy" refers to those situations in which a subject is simultaneously exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents). In some embodiments, the two or more regimens may be administered simultaneously; in some embodiments, such regimens may be administered sequentially (e.g., all "doses" of a first regimen are administered prior to administration of any doses of a second regimen); in some embodiments, such agents are administered in overlapping dosing regimens. In some embodiments, administration of combination therapy may involve administration of one or more agent(s) or modality(ies) to a subject receiving the other agent(s) or modality(ies) in the combination. For clarity, combination therapy does not require that individual agents be administered together in a single composition (or even necessarily at the same time), although in some embodiments, two or more agents, or active moieties thereof, may be administered together in a combination composition.

[0095] Comparable: As used herein, the term "comparable" refers to two or more agents, entities, situations, sets of conditions, etc., that may not be identical to one another but that are sufficiently similar to permit comparison there between so that one skilled in the art will appreciate that conclusions may reasonably be drawn based on differences or similarities observed. In some embodiments, comparable sets of conditions, circumstances, individuals, or populations are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, etc. to be considered comparable. For example, those of ordinary skill in the art will appreciate that sets of circumstances, individuals, or populations are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under or with different sets of circumstances, individuals, or populations are caused by or indicative of the variation in those features that are varied.

[0096] Corresponding to: As used herein, the term "corresponding to" refers to a relationship between two or more entities. For example, the term "corresponding to" may be used to designate the position / identity of a structural element in a compound or composition relative to another compound or composition (e.g., to an appropriate reference compound or composition). For example, in some embodiments, a monomeric residue in a polymer (e.g., an amino acid residue in a polypeptide or a nucleic acid residue in a polynucleotide) may be identified as "corresponding to" a residue in an appropriate reference polymer. For example, those of ordinary skill will appreciate that, for purposes of simplicity, residues in a polypeptide are oftendesignated using a canonical numbering system based on a reference related polypeptide, so that an amino acid "corresponding to" a residue at position 190, for example, need not actually be the 190thamino acid in a particular amino acid chain but rather corresponds to the residue found at 190 in the reference polypeptide; those of ordinary skill in the art readily appreciate how to identify "corresponding" amino acids. For example, those skilled in the art will be aware of various sequence alignment strategies, including software programs such as, for example, BLAST, CS-BLAST, CUSASW++, DIAMOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, HHpred / HHsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM, or SWIPE that can be utilized, for example, to identify "corresponding" residues in polypeptides and / or nucleic acids in accordance with the present disclosure. Those of skill in the art will also appreciate that, in some instances, the term "corresponding to" may be used to describe an event or entity that shares a relevant similarity with another event or entity (e.g., an appropriate reference event or entity). To give but one example, a gene or protein in one organism may be described as "corresponding to" a gene or protein from another organism in order to indicate, in some embodiments, that it plays an analogous role or performs an analogous function and / or that it shows a particular degree of sequence identity or homology, or shares a particular characteristic sequence element.

[0097] Cycloaliphatic. As used herein, the term "cycloaliphatic" refers to a monocyclic C3-8 hydrocarbon or a bicyclic C5-io hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point or more than one points of attachment to the rest of the molecule.

[0098] Cycloalkyh As used herein, the term "cycloalkyl" refers to an optionally substituted saturated ring monocyclic or polycyclic system of about 3 to about 10 ring carbon atoms. Exemplary monocyclic cycloalkyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl.

[0099] Derived'. In the context of an amino acid sequence (peptide or polypeptide) "derived from" a designated amino acid sequence (peptide or polypeptide), it refers to a structural analogue of a designated amino acid sequence. In some embodiments, an amino acid sequence which is derived from a particular amino acid sequence has an amino acid sequence that is identical, essentially identical or homologous to that particular sequence or a fragment thereof. Amino acid sequences derived from a particular amino acid sequence may be variants of that particular sequence or a fragment thereof.

[0100] Detecting-. The term "detecting" is used broadly herein to include appropriate means of determining the presence or absence of an entity of interest or any form of measurement of an entity of interest in a sample. Thus, "detecting" may include determining, measuring, assessing, or assaying the presence or absence, level, amount, and / or location of an entity of interest. Quantitative and qualitative determinations, measurements or assessments are included, including semi-quantitative. Such determinations, measurements or assessments may be relative, for example when an entity of interest is being detected relative to a control reference, or absolute. As such, the term "quantifying" when used in the context of quantifying an entity of interest can refer to absolute or to relative quantification. Absolute quantification may be accomplished by correlating a detected level of an entity of interest to known control standards (e.g., through generation of a standard curve). Alternatively, relative quantification can be accomplished by comparison of detected levels or amounts between two or more different entities of interest to provide a relative quantification of each of the two or more different entities of interest, i.e., relative to each other.

[0101] Dosing regimen-. Those skilled in the art will appreciate that the term "dosing regimen" (or"therapeutic regimen") may be used to refer to a set of unit doses (e.g., one or more than one) that areadministered individually to a subject, typically separated by periods of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses.

[0102] Encode-. As used herein, the term "encode" or "encoding" refers to sequence information of a first molecule that guides production of a second molecule having a defined sequence of nucleotides (e.g., a polyribonucleotide) or a defined sequence of amino acids. For example, a DNA molecule can encode an RNA molecule (e.g., by a transcription process that includes a DNA-dependent RNA polymerase enzyme). An RNA molecule can encode a polypeptide (e.g., by a translation process). Thus, a gene, a cDNA, or an RNA molecule encodes a polypeptide if transcription and translation of RNA corresponding to that gene produces the polypeptide in a cell or other biological system. In some embodiments, a coding region of a polyribonucleotide encoding a target antigen refers to a coding strand, the nucleotide sequence of which is identical to the polyribonucleotide sequence of such a target antigen. In some embodiments, a coding region of a polyribonucleotide encoding a target antigen refers to a non-coding strand of such a target antigen, which may be used as a template for transcription of a gene or cDNA.

[0103] Engineered-. In general, the term "engineered" refers to the aspect of having been manipulated by the hand of man. For example, a polynucleotide is considered to be "engineered" when two or more sequences that are not linked together in that order in nature are manipulated by the hand of man to be directly linked to one another in the engineered polynucleotide and / or when a particular residue in a polynucleotide is non-naturally occurring and / or is caused through action of the hand of man to be linked with an entity or moiety with which it is not linked in nature.

[0104] Epitope-. As used herein, the term "epitope" refers to a moiety that is specifically recognized by an immunoglobulin (e.g., antibody or receptor) binding component. For example, an epitope may be recognized by a T cell, a B cell, or an antibody. In some embodiments, an epitope is comprised of a plurality of chemical atoms or groups on an antigen. In some embodiments, such chemical atoms or groups are surface- exposed when the antigen adopts a relevant three-dimensional conformation. In some embodiments, such chemical atoms or groups are physically near to each other in space when the antigen adopts such a conformation. In some embodiments, at least some such chemical atoms are groups are physically separated from one another when the antigen adopts an alternative conformation (e.g., is linearized). Accordingly, in some embodiments, an epitope of an antigen may include a continuous or discontinuous portion of the antigen. In some embodiments, an epitope is or comprises a T cell epitope. In some embodiments, an epitope is or comprises a B cell epitope. In some embodiments, an epitope may have a length of about 5 to about 30 amino acids, or about 10 to about 25 amino acids, or about 5 to about 15 amino acids, or about 5 to 12 amino acids, or about 6 to about 9 amino acids.

[0105] Expression-. As used herein, the term "expression" of a nucleic acid sequence refers to the generation of a gene product from the nucleic acid sequence. In some embodiments, a gene product can be a transcript, e.g., a polyribonucleotide as provided herein. In some embodiments, a gene product can be a polypeptide. In some embodiments, expression of a nucleic acid sequence involves one or more of the following: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, etc.); (3) translation of an RNA into a polypeptide or protein; and / or (4) post-translational modification of a polypeptide or protein.

[0106] Fragment: As used herein, "fragment" refers a structure that is or includes a discrete portion of a reference agent (sometimes referred to as the "parent" agent). In some embodiments, a fragment lacks one or more moieties found in the reference agent. In some embodiments, a fragment is or includes one ormore moieties found in the reference agent. In some embodiments, the reference agent is a polymer such as a polynucleotide or polypeptide. In some embodiments, a fragment of a polymer is or includes at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more monomeric units (e.g., residues) of the reference polymer. In some embodiments, a fragment of a polymer is or includes at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of the monomeric units (e.g., residues) found in the reference polymer. A fragment of a reference polymer is not necessarily identical to a corresponding portion of the reference polymer. For example, a fragment of a reference polymer can be a polymer having a sequence of residues having at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity to the reference polymer. A fragment may, or may not, be generated by physical fragmentation of a reference agent. In some instances a fragment is generated by physical fragmentation of a reference agent. In some instances, a fragment is not generated by physical fragmentation of a reference agent and can be instead, for example, produced by de novo synthesis or other means.

[0107] Heteroallphatlc. The term "heteroaliphatic" or "heteroaliphatic group," as used herein, denotes an optionally substituted hydrocarbon moiety having, in addition to carbon atoms, from one to five heteroatoms, that may be straight-chain (i.e., unbranched), branched, or cyclic ("heterocyclic") and may be completely saturated or may contain one or more units of unsaturation, but which is not aromatic. The term "heteroatom" refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen. The term "nitrogen" also includes a substituted nitrogen. Unless otherwise specified, heteroaliphatic groups contain 1-10 carbon atoms wherein 1-3 carbon atoms are optionally and independently replaced with heteroatoms selected from oxygen, nitrogen, and sulfur. In some embodiments, heteroaliphatic groups contain 1-4 carbon atoms, wherein 1-2 carbon atoms are optionally and independently replaced with heteroatoms selected from oxygen, nitrogen, and sulfur. In yet other embodiments, heteroaliphatic groups contain 1-3 carbon atoms, wherein 1 carbon atom is optionally and independently replaced with a heteroatom selected from oxygen, nitrogen, and sulfur. Suitable heteroaliphatic groups include, but are not limited to, linear or branched, heteroalkyl, heteroalkenyl, and heteroalkynyl groups. For example, a 1- to 10 atom heteroaliphatic group includes the following exemplary groups: -O-CH3, -CH2-O-CH3, -O-CH2-CH2- O-CH2-CH2-O-CH3, and the like.

[0108] Heteroaryl: The terms "heteroaryl" and "heteroar-", used alone or as part of a larger moiety, e.g., "heteroaralkyl," or "heteroaralkoxy," refer to monocyclic or bicyclic ring groups having 5 to 10 ring atoms (e.g., 5- to 6-membered monocyclic heteroaryl or 9- to 10-membered bicyclic heteroaryl); having 6, 10, or 14 n- electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, pteridinyl, imidazo[1,2-a]pyrimidinyl, imidazo[1,2-a]pyridyl, imidazo[4,5- b]pyridyl, imidazo[4,5-c]pyridyl, pyrrolopyridyl, pyrrolopyrazinyl, thienopyrimidinyl, triazolopyridyl, and benzoisoxazolyl. The terms "heteroaryl" and "heteroar-", as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring (i.e., a bicyclic heteroaryl ring having 1 to 3 heteroatoms). Nonlimiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl,benzimidazolyl, benzotriazolyl, benzothiazolyl, benzothiadiazolyl, benzoxazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4 / 7— quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, pyrido[2,3-b]-l,4-oxazin-3(4H)-one, 4H-thieno[3,2- b]pyrrole, and benzoisoxazolyl. The term "heteroaryl" may be used interchangeably with the terms "heteroaryl ring," "heteroaryl group," or "heteroaromatic," any of which terms include rings that are optionally substituted.

[0109] Heteroatom-. The term "heteroatom" as used herein refers to nitrogen, oxygen, or sulfur, and includes any oxidized form of nitrogen or sulfur, and any quaternized form of a basic nitrogen.

[0110] Heterocycle-. As used herein, the terms "heterocycle," "heterocyclyl," "heterocyclic radical," and "heterocyclic ring" are used interchangeably and refer to a stable 3- to 8-membered monocyclic, a 6- to 10- membered bicyclic, or a 10- to 16-membered polycyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, such as one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes a substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur or nitrogen, the nitrogen may be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or NR+(as in N-substituted pyrrolidinyl). A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, azetidinyl, oxetanyl, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and thiamorpholinyl. A heterocyclyl group may be mono-, bi-, tri-, or polycyclic, preferably mono-, bi-, or tricyclic, more preferably mono- or bicyclic. A bicyclic heterocyclic ring also includes groups in which the heterocyclic ring is fused to one or more aryl rings. Exemplary bicyclic heterocyclic groups include indolinyl, isoindolinyl, benzodioxolyl, 1,3-dihydroisobenzofuranyl, 2,3-dihydrobenzofuranyl, and tetrahydroquinolinyl. A bicyclic heterocyclic ring can also be a spirocyclic ring system (e.g., 7- to 11-membered spirocyclic fused heterocyclic ring having, in addition to carbon atoms, one or more heteroatoms as defined above (e.g., one, two, three or four heteroatoms)). A bicyclic heterocyclic ring can also be a bridged ring system (e.g., 7- to 11-membered bridged heterocyclic ring having one, two, or three bridging atoms.

[0111] Homology. As used herein, the term "homology" or "homolog" refers to the overall relatedness between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are considered to be "homologous" to one another if their sequences are at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least85%, at least 90%, at least 95%, or at least 99% identical. In some embodiments, polynucleotide molecules(e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are considered to be "homologous" to one another if their sequences are at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% similar (e.g., containing residues with related chemical properties at corresponding positions). For example, as is well known by those of ordinary skill in the art, certain amino acids are typically classified as similar to one another as "hydrophobic" or "hydrophilic" amino acids, and / or as having "polar" or "non-polar" side chains. Substitution of one amino acid for another of the same type may often be considered a "homologous" substitution.

[0112] Identity. As used herein, the term "identity" refers to the overall relatedness between polynucleotide molecules e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In some embodiments, polynucleotide molecules e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are considered to be "substantially identical" to one another if their sequences are at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequence for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In some embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller, 1989, which has been incorporated into the ALIGN program (version 2.0). In some embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.

[0113] Increased, Induced, or Reduced: As used herein, these terms or grammatically comparable comparative terms, indicate values that are relative to a comparable reference measurement. For example, in some embodiments, an assessed value achieved with a provided composition (e.g., a pharmaceutical composition) may be "increased" relative to that obtained with a comparable reference composition.Alternatively or additionally, in some embodiments, an assessed value achieved in a subject may be "increased" relative to that obtained in the same subject under different conditions (e.g., prior to or after an event; or presence or absence of an event such as administration of a composition (e.g., a pharmaceutical composition) as described herein, or in a different, comparable subject (e.g., in a comparable subject that differs from the subject of interest in prior exposure to a condition, e.g., absence of administration of a composition (e.g., a pharmaceutical composition) as described herein.). In some embodiments, comparative terms refer to statistically relevant differences (e.g., that are of a prevalence and / or magnitude sufficient to achieve statistical relevance). Those skilled in the art will be aware, or will readily be able to determine, in a given context, a degree and / or prevalence of difference that is required or sufficient to achieve such statistical significance. In some embodiments, the term "reduced" or equivalent terms refers to a reduction in the level of an assessed value by at least 5%, at least 10%, at least 20%, at least 50%, at least 75% or higher, as compared to a comparable reference. In some embodiments, the term "reduced" or equivalent terms refers to a complete or essentially complete inhibition, i.e., a reduction to zero or essentially to zero. In some embodiments, the term "increased" or "induced" refers to an increase in the level of an assessed value by at least 10%, at least 20%, atleast 30%, at least 40%, at least 50%, at least 80%, at least 100%, at least 200%, at least 500%, or higher, as compared to a comparable reference.

[0114] In order: As used herein with reference to a polynucleotide or polyribonucleotide, "in order" refers to the order of features from 5' to 3' along the polynucleotide or polyribonucleotide. As used herein with reference to a polypeptide, "in order" refers to the order of features moving from the N-terminal-most of the features to the C-terminal-most of the features along the polypeptide. "In order" does not mean that no additional features can be present among the listed features. For example, if Features A, B, and C of a polynucleotide are described herein as being "in order, Feature A, Feature B, and Feature C," this description does not exclude, e.g., Feature D being located between Features A and B.

[0115] Ionizable-. The term "ionizable" refers to a compound or group or atom that is charged at a certain pH. In the context of an ionizable amino lipid, such a lipid or a function group or atom thereof bears a positive charge at a certain pH. In some embodiments, an ionizable amino lipid is positively charged at an acidic pH. In some embodiments, an ionizable amino lipid is predominately neutral at physiological pH values, e.g., in some embodiments about 7.0-7.4, but becomes positively charged at lower pH values. In some embodiments, an ionizable amino lipid may have a pKa within a range of about 5 to about 7.

[0116] Isolated-. The term "isolated" means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.

[0117] Lipid-. As used herein, the terms "lipid" and "lipid-like material" are broadly defined as molecules which comprise one or more hydrophobic moieties or groups and optionally also one or more hydrophilic moieties or groups. Molecules comprising hydrophobic moieties and hydrophilic moieties are also typically denoted as amphiphiles.

[0118] RNA lipid nanoparticle-, As used herein, the term "RNA lipid nanoparticle" refers to a nanoparticle comprising at least one lipid and RNA molecule(s), e.g., one or more polyribonucleotides as provided herein. In some embodiments, an RNA lipid nanoparticle comprises at least one cationic amino lipid. In some embodiments, an RNA lipid nanoparticle comprises at least one cationic amino lipid, at least one helper lipid, and at least one polymer-conjugated lipid (e.g., PEG-conjugated lipid). In various embodiments, RNA lipid nanoparticles as described herein can have an average size e.g., Z-average) of about 100 nm to 1000 nm, or about 200 nm to 900 nm, or about 200 nm to 800 nm, or about 250 nm to about 700 nm. In some embodiments of the present disclosure, RNA lipid nanoparticles can have a particle size (e.g., Z-average) of about 30 nm to about 200 nm, or about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 to about 90 nm, about 80 nm to about 90 nm, or about 70 nm to about 80 nm. In some embodiments, an average size of lipid nanoparticles is determined by measuring the average particle diameter. In some embodiments, RNA lipid nanoparticles may be prepared by mixing lipids with RNA molecules described herein.

[0119] Neutralization-. As used herein, the term "neutralization" refers to an event in which binding agents such as antibodies bind to a biological active site of a virus such as a receptor binding protein, thereby inhibiting the parasitic infection of cells. In some embodiments, the term "neutralization" refers to an event in which binding agents eliminate or significantly reduce ability of infecting cells.

[0120] Nucleic acid / Polynucleotide: As used herein, the term "nucleic acid" refers to a polymer of at least 10 nucleotides or more. In some embodiments, a nucleic acid is or comprises DNA. In some embodiments, a nucleic acid is or comprises RNA. In some embodiments, a nucleic acid is or comprises peptide nucleic acid (PNA). In some embodiments, a nucleic acid is or comprises a single stranded nucleic acid. In some embodiments, a nucleic acid is or comprises a double-stranded nucleic acid. In some embodiments, a nucleic acid comprises both single and double-stranded portions. In some embodiments, a nucleic acid comprises a backbone that comprises one or more phosphodiester linkages. In some embodiments, a nucleic acid comprises a backbone that comprises both phosphodiester and non-phosphodiester linkages. For example, in some embodiments, a nucleic acid may comprise a backbone that comprises one or more phosphorothioate or 5'-N- phosphoramidite linkages and / or one or more peptide bonds, e.g., as in a "peptide nucleic acid". In some embodiments, a nucleic acid comprises one or more, or all, natural residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine, guanine, thymine, uracil). In some embodiments, a nucleic acid comprises one or more, or all, non-natural residues. In some embodiments, a nonnatural residue comprises a nucleoside analog (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo- pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2- aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 6-O-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a non-natural residue comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'- deoxyribose, arabinose, and hexose) as compared to those in natural residues. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or polypeptide. In some embodiments, a nucleic acid has a nucleotide sequence that comprises one or more introns. In some embodiments, a nucleic acid may be prepared by isolation from a natural source, enzymatic synthesis (e.g., by polymerization based on a complementary template, e.g., in vivo or in vitro}, reproduction in a recombinant cell or system, or chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, or 20,000 or more residues or nucleotides long.

[0121] Operably linked: As used herein, "operably linked" refers to the association of at least a first element and a second element such that the component elements are in a relationship permitting them to function in their intended manner. For example, a nucleic acid sequence or amino acid sequence is operably linked with another sequence if it modifies the expression, structure, or activity of the linked sequence, e.g., in an intended manner. In many cases, two nucleic acid sequences are operably linked if they contribute to the expression, structure, or activity of a gene or encoded polypeptide. For example, a nucleic acid regulatory sequence is "operably linked" to a nucleic acid coding sequence if the regulatory sequence and coding sequence are associated in a manner that permits control of expression of the coding sequence by the regulatory sequence. In some embodiments, an "operably linked" regulatory sequence is directly or indirectly covalently associated with a coding sequence (e.g., in a single nucleic acid). In some embodiments, a regulatory sequence controls expression of a coding sequence in trans and inclusion of the regulatory sequence in the same nucleicacid as the coding sequence is a requirement of operable linkage. In many cases, two amino acid sequences are operably linked if they are expressed as a single polypeptide.

[0122] Pharmaceutically effective amount. The term "pharmaceutically effective amount" or "therapeutically effective amount" refers to the amount which achieves a desired reaction or a desired effect alone or together with further doses. In the case of the treatment of a particular disease (e.g., orthopoxvirus infection, e.g., mpox infection), a desired reaction in some embodiments relates to inhibition of the course of the disease (e.g., orthopoxvirus infection, e.g., mpox infection). In some embodiments, such inhibition may comprise slowing down the progress of a disease (e.g., orthopoxvirus infection, e.g., mpox infection) and / or interrupting or reversing the progress of the disease (e.g., orthopoxvirus infection, e.g., mpox infection). In some embodiments, a desired reaction in a treatment of a disease (e.g., orthopoxvirus infection, e.g., mpox infection) may be or comprise delay or prevention of the onset of a disease (e.g., orthopoxvirus infection, e.g., mpox infection) or a condition (e.g., an orthopoxvirus infection (e.g., mpox infection) associated condition). An effective amount of a composition (e.g., a pharmaceutical composition) described herein will depend, for example, on a disease (e.g., orthopoxvirus infection, e.g., mpox infection) or a condition (e.g., an orthopoxvirus (e.g., mpox infection) associated condition) to be treated, the severity of such a disease (e.g., orthopoxvirus infection, e.g., mpox infection) or a condition, individual parameters of the patient, including, e.g., age, physiological condition, size and weight, the duration of treatment, the type of an accompanying therapy (if present), the specific route of administration and similar factors. Accordingly, doses of a composition (e.g., a pharmaceutical composition) described herein may depend on various such parameters. In the case that a reaction in a patient is insufficient with an initial dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) may be used.

[0123] Polypeptide-. As used herein, the term "polypeptide" refers to a polymeric chain of amino acids. In some embodiments, a polypeptide has an amino acid sequence that occurs in nature. In some embodiments, a polypeptide has an amino acid sequence that does not occur in nature. In some embodiments, a polypeptide has an amino acid sequence that is engineered in that it is designed and / or produced through action of the hand of man. In some embodiments, a polypeptide may comprise or consist of natural amino acids, non-natural amino acids, or both. In some embodiments, a polypeptide may comprise or consist of only natural amino acids or only non-natural amino acids. In some embodiments, a polypeptide may comprise D- amino acids, L-amino acids, or both. In some embodiments, a polypeptide may comprise only D-amino acids. In some embodiments, a polypeptide may comprise only L-amino acids. In some embodiments, a polypeptide may include one or more pendant groups or other modifications, e.g., modifying or attached to one or more amino acid side chains, at the polypeptide's N-terminus, at the polypeptide's C-terminus, or any combination thereof. In some embodiments, such pendant groups or modifications comprise acetylation, amidation, lipidation, methylation, pegylation, etc., including combinations thereof. In some embodiments, a polypeptide may be cyclic, and / or may comprise a cyclic portion. In some embodiments, a polypeptide is not cyclic and / or does not comprise any cyclic portion. In some embodiments, a polypeptide is linear. In some embodiments, a polypeptide may be or comprise a stapled polypeptide. In some embodiments, the term "polypeptide" may be appended to a name of a reference polypeptide, activity, or structure; in such instances it is used herein to refer to polypeptides that share the relevant activity or structure and thus can be considered to be members of the same class or family of polypeptides. For each such class, the present specification provides and / or those skilled in the art will be aware of exemplary polypeptides within the class whose amino acid sequences and / or functions are known; in some embodiments, such exemplary polypeptides are reference polypeptides for the polypeptideclass or family. In some embodiments, a member of a polypeptide class or family shows significant sequence homology or identity with, shares a common sequence motif (e.g., a characteristic sequence element) with, and / or shares a common activity (in some embodiments at a comparable level or within a designated range) with a reference polypeptide of the class; in some embodiments with all polypeptides within the class). For example, in some embodiments, a member polypeptide shows an overall degree of sequence homology or identity with a reference polypeptide that is at least about 30-40%, and is often greater than about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more and / or includes at least one region (e.g., a conserved region that may in some embodiments be or comprise a characteristic sequence element) that shows very high sequence identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99%. Such a conserved region usually encompasses at least 3-4 and often up to 35 or more amino acids; in some embodiments, a conserved region encompasses at least one stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more contiguous amino acids. In some embodiments, a relevant polypeptide may comprise or consist of a fragment of a parent polypeptide.

[0124] Prevent. As used herein, the terms "prevent" or "prevention" when used in connection with the occurrence of a disease, disorder, and / or condition, refers to reducing the risk of developing the disease, disorder and / or condition and / or to delaying onset of one or more characteristics or symptoms of the disease, disorder or condition. Prevention may be considered complete when onset of a disease, disorder or condition has been delayed for a predefined period of time.

[0125] Reference-. As used herein, the term "reference" describes a standard or control relative to which a comparison is performed. For example, in some embodiments, an agent, animal, individual, population, sample, sequence or value of interest is compared with a reference or control agent, animal, individual, population, sample, sequence or value. In some embodiments, a reference or control is tested and / or determined substantially simultaneously with the testing or determination of interest. In some embodiments, a reference or control is a historical reference or control, optionally embodied in a tangible medium. Typically, as would be understood by those skilled in the art, a reference or control is determined or characterized under comparable conditions or circumstances to those under assessment. Those skilled in the art will appreciate when sufficient similarities are present to justify reliance on and / or comparison to a particular possible reference or control.

[0126] Ribonucleic acid (RNA) or Polyribonucleotide-. As used herein, the terms "ribonucleic acid," "RNA," or "polyribonucleotide" refers to a polymer of ribonucleotides. In some embodiments, an RNA is single stranded. In some embodiments, an RNA is double stranded. In some embodiments, an RNA comprises both single and double stranded portions. In some embodiments, an RNA can comprise a backbone structure as described in the definition of "Nucleic acid / Polynucleotide" above. An RNA can be a regulatory RNA (e.g., siRNA, microRNA, etc.), or a messenger RNA (mRNA). In some embodiments, an RNA is an mRNA. In some embodiments, where an RNA is a mRNA, an RNA typically comprises at its 3' end a poly(A) region. In some embodiments, where an RNA is a mRNA, an RNA typically comprises at its 5' end an art-recognized cap structure, e.g., for recognizing and attachment of a mRNA to a ribosome to initiate translation. In some embodiments, an RNA is a synthetic RNA. Synthetic RNAs include RNAs that are synthesized in vitro (e.g., by enzymatic synthesis methods and / or by chemical synthesis methods).

[0127] Ribonucleotide-. As used herein, the term "ribonucleotide" encompasses unmodified ribonucleotides and modified ribonucleotides. For example, unmodified ribonucleotides include the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). Modified ribonucleotides mayinclude one or more modifications including, but not limited to, for example, (a) end modifications, e.g., 5' end modifications (e.g., phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (e.g., conjugation, inverted linkages, etc.), (b) base modifications, e.g., replacement with modified bases, stabilizing bases, destabilizing bases, bases that base pair with an expanded repertoire of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, and (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages. The term "ribonucleotide" also encompasses ribonucleotide triphosphates including modified and non-modified ribonucleotide triphosphates.

[0128] Rlsle. As will be understood from context, "risk" of a disease, disorder, and / or condition refers to a likelihood that a particular individual will develop the disease, disorder, and / or condition. In some embodiments, risk is expressed as a percentage. In some embodiments, risk is expressed as a risk relative to a risk associated with a reference sample or group of reference samples. In some embodiments, a reference sample or group of reference samples have a known risk of a disease, disorder, condition and / or event. In some embodiments, a reference sample or group of reference samples are from individuals comparable to a particular individual. In some embodiments, risk may reflect one or more genetic attributes, e.g., which may predispose an individual toward development (or not) of a particular disease, disorder and / or condition. In some embodiments, risk may reflect one or more epigenetic events or attributes and / or one or more lifestyle or environmental events or attributes.

[0129] Secretory signal'. As used herein, the terms "secretory signal" or "signal peptide" or "signal sequence" refer to an amino acid sequence motif that targets associated polypeptides for translocation to a secretory pathway.

[0130] Selective or specific. The terms "selective" or "specific," when used herein in reference to an agent having an activity, is understood by those skilled in the art to mean that the agent discriminates between potential target entities, states, or cells. For example, in some embodiments, an agent is said to bind "specifically" to its target if it binds preferentially with that target in the presence of one or more competing alternative targets. In many embodiments, specific interaction is dependent upon the presence of a particular structural feature of the target entity (e.g., an epitope, a cleft, a binding site). It is to be understood that specificity need not be absolute. In some embodiments, specificity may be evaluated relative to that of a targetbinding moiety for one or more other potential target entities (e.g., competitors). In some embodiments, specificity is evaluated relative to that of a reference specific binding moiety. In some embodiments, specificity is evaluated relative to that of a reference non-specific binding moiety.

[0131] Stability. The terms "stability" or "desired storage stability" as used herein may refer to physicochemical stability of a product (e.g., a pharmaceutical composition described herein). In some embodiments, "stability" refers to physicochemical stability of a product (e.g., a pharmaceutical composition described herein), in unopened thawed vials for up to 24 hours at 30 °C, and in syringes for up to 24 hours at 2- 8 °C and 12 hours at 30 °C. In some embodiments, "stability" refers to shelf-life of a product (e.g., a pharmaceutical composition described herein) for 6 months or more when stored at about -90 °C to about 4°C.

[0132] Substituted or optionally substituted'. As described herein, compounds of the invention may contain "optionally substituted" moieties. In general, the term "substituted," whether preceded by the term "optionally" or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. "Substituted" applies to one or more hydrogens that are either explicit or implicit from the structureotherwise indicated, an "optionally substituted" group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. Combinations of substituents envisioned by this invention are preferably those that result in the formation of stable or chemically feasible compounds. The term "stable," as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in some embodiments, their recovery, purification, and use for one or more of the purposes provided herein. Groups described as being "substituted" preferably have between 1 and 4 substituents, more preferably 1 or 2 substituents. Groups described as being "optionally substituted" may be unsubstituted or be "substituted" as described above.

[0133] Suitable monovalent substituents on a substitutable carbon atom of an "optionally substituted" group are independently halogen; -(CH2)o-4R°; -(CH2)o-40R°; -0(CH2)o-4R°, -0-(CH2)OMC(0)OR°; -(CH2)O-4CH(OR°)2; -(CH2)CMSR°; -(CH2)o-4Ph, which may be substituted with R°; -(CH2)o^O(CH2)o-iPh which may be substituted with R°; -CH=CHPh, which may be substituted with R°; -(CH2)o^iO(CH2)o-i-pyridyl which may be substituted with R°; -NO2; -CN; -N3; -(CH2)(MN(RO)2; -(CH2)OMN(R°)C(0)R°; -N(R°)C(S)R°; -(CH2)O- 4N(R°)C(O)NR°2; -N(RO)C(S)NR°2; -(CH2)OMN(R°)C(0)OR°; - N(R°)N(R°)C(O)R°; -N(R°)N(R°)C(O)NR°2; -N(R°)N(R°)C(O)OR°; -(CH2)(MC(O)R°; C(S)R°; -(CH2)CMC(O)OR°; - (CH2)(MC(O)SR°; -(CH2)o-4C(o)OSiR03; -(CH2)(MOC(O)R°; -OC(O)(CH2)CMSR°; -(CH2)(MSC(O)R°; -(CH2)O- 4C(O)NR°2; -C(S)NRO2; -C(S)SR°; -SC(S)SR°, -(CH2)0MOC(O)NR°2; -C(O)N(OR°)R°; -C(O)C(O)R°; - C(O)CH2C(O)R°; -C(NOR°)R°; -(CH2)(MSSR°; -(CH2)0MS(O)2R°; -(CH2)(MS(O)2OR°; -(CH2)CMOS(O)2R°; - S(O)2NR°2; -(CH2)O-4S(0)R°; -N(R°)S(O)2NR°2; -N(R°)S(O)2R°; -N(OR°)R°; -C(NH)NR°2; -P(O)2R°; -P(0)RO2; -OP(O)R°2; -OP(O)(OR°)2; SiR°3; - (CIM straight or branched alkylene)O-N(R°)2; or - (CIM straight or branched alkylene)C(O)O-N(R°)2, wherein each R° may be substituted as defined below and is independently hydrogen, Ci-e aliphatic, -CH2Ph, -0(CH2)o-iPh, -CH2-(5- to 6-membered heteroaryl ring), or a 3- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R°, taken together with their intervening atom(s), form a 3- to 12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, which may be substituted as defined below.

[0134] Suitable monovalent substituents on R° (or the ring formed by taking two independent occurrences of R° together with their intervening atoms), are independently halogen, -(CH2)o-2R*, -(haloR*), - (CH2)o-2OH, -(CH2)O-2OR*, -(CH2)(WCH(OR*)2, -O(haloR*), -CN, -N3, -(CH2)(wC(0)R*, -(CH2)M2C(O)OH, - (CH2)^2C(O)OR*, -(CH2)O-2SR*, -(CH2)Q-2SH, -(CH2K2NH2, -(CH2)^2NHR*, -(CH2)O-2NR*2, -NO2, -SiR*3, - OSiR*3, -C(O)SR*, -(CM straight or branched alkylene)C(O)OR*, or -SSR* wherein each R* is unsubstituted or where preceded by "halo" is substituted only with one or more halogens, and is independently selected from Ci-4 aliphatic, -CH2Ph, -0(CH2)o-iPh, or a 3- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents on a saturated carbon atom of R° include =0 and =S.

[0135] Suitable divalent substituents on a saturated carbon atom of an "optionally substituted" group include the following: =0 ("oxo"), =S, = NNR*2, = NNHC(O)R*, =NNHC(O)OR*, = NNHS(O)2R*, = NR*, =NOR*, - O(C(R*2))2-3O-, or -S(C(R*2))2-3S-, wherein each independent occurrence of R* is selected from hydrogen, Ci- 6 aliphatic which may be substituted as defined below, or an unsubstituted 5- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an "optionally substituted" group include: -O(CR*2)2-3O-, wherein each independent occurrence of R* is selected from hydrogen, Ci-6 aliphatic which may be substituted as defined below, or an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0136] Suitable substituents on the aliphatic group of R* include halogen, -R*, -(haloR*), -OH, -OR*,-O(haloR*), -CN, -C(O)OH, -C(O)OR*, -NH2, -NHR*, -NR*2, or -NO2, wherein each R* is unsubstituted or where preceded by "halo" is substituted only with one or more halogens, and is independently Ci^ aliphatic, - CH2Ph, -0(CH2)o-iPh, or a 3- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0137] Suitable substituents on a substitutable nitrogen of an "optionally substituted" group include -R+, -NR+2, -C(O)R+, -C(O)OR+, -C(O)C(O)R+, -C(O)CH2C(O)R+, -S(O)2R+, -S(O)2NR+2, -C(S)NR+2, -C(NH)NR+2, or -N(R+)S(O)2R+; wherein each R+is independently hydrogen, Ci-6 aliphatic which may be substituted as defined below, unsubstituted -OPh, or an unsubstituted 3- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, or, notwithstanding the definition above, two independent occurrences of R+, taken together with their intervening atom(s) form an unsubstituted 3- to 12-membered saturated, partially unsaturated, or aryl mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0138] Suitable substituents on the aliphatic group of R+are independently halogen, -R*, -(haloR*), -OH, -OR*, -O(haloR*), -CN, -C(O)OH, -C(O)OR*, -NH2, -NHR*, -NR*2, or -NO2, wherein each R* is unsubstituted or where preceded by "halo" is substituted only with one or more halogens, and is independently CM aliphatic, -CH2Ph, -0(CH2)o-iPh, or a 3- to 6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur.

[0139] Subject-. As used herein, the term "subject" refers to an organism to be administered with a composition described herein, e.g., for experimental, diagnostic, prophylactic, and / or therapeutic purposes.Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, domestic pets, etc.) and humans. In some embodiments, a subject is a human subject. In some embodiments, a subject is suffering from a disease, disorder, or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, rabbitpox, etc.) infection). In some embodiments, a subject is susceptible to a disease, disorder, or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder, or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). In some embodiments, a subject displays one ormore non-specific symptoms of a disease, disorder, or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). In some embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). In some embodiments, a subject is a patient. In some embodiments, a subject is an individual to whom diagnosis and / or therapy is and / or has been administered.

[0140] Suffering fronr. An individual who is "suffering from" a disease, disorder, and / or condition(e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection) has been diagnosed with and / or displays one or more symptoms of a disease, disorder, and / or condition.

[0141] Susceptible to An individual who is "susceptible to" a disease, disorder, and / or condition(e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection) is one who has a higher risk of developing the disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection) than does a member of the general public. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection) may not have been diagnosed with the disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection) may exhibit symptoms of the disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection) may not exhibit symptoms of the disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection) will develop the disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection) will notdevelop the disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection).

[0142] Therapy. The term "therapy" refers to an administration or delivery of an agent or intervention that has a therapeutic effect and / or elicits a desired biological and / or pharmacological effect (e.g., has been demonstrated to be statistically likely to have such effect when administered to a relevant population). In some embodiments, a therapeutic agent or therapy is any substance that can be used to alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and / or reduce incidence of one or more symptoms or features of a disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). In some embodiments, a therapeutic agent or therapy is a medical intervention (e.g., surgery, radiation, phototherapy) that can be performed to alleviate, relieve, inhibit, present, delay onset of, reduce severity of, and / or reduce incidence of one or more symptoms or features of a disease, disorder, and / or condition.

[0143] Treat. As used herein, the term "treat," "treatment," or "treating" refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and / or reduce incidence of one or more symptoms or features of a disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection). In some embodiments, treatment may be administered to a subject who exhibits only early signs of the disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection), for example for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and / or condition. In some embodiments, treatment may be administered to a subject at a later-stage of disease, disorder, and / or condition (e.g., orthopoxvirus infection, e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) infection).DETAILED DESCRIPTION

[0144] The unprecedented rise in MPXV transmission in 2022 revealed an unexpected need for rapidly scalable orthopoxvirus vaccines and / or treatments to meet the demands of even a moderate size outbreak. The recent 2024 outbreak has further underscored this need. Provided herein are exemplary polyribonucleotide constructs (alone or in combination) that have the potential to fulfill this need. The successful global response to the COVID-19 pandemic utilizing polyribonucleotide constructs illustrates the power of polyribonucleotide technology to deliver an efficacious, safe vaccine and / or treatment swiftly during a fast-moving viral pandemic.

[0145] The present disclosure provides pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) for delivering particular polyribonucleotide constructs encoding mpox antigens to a subject (e.g., a patient) and related methods for inducing protective immunity to mpox viruses belonging to other clades and other orthopoxviruses (e.g., variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) viruses).I, MPOX and Other Orthopoxyiruses

[0146] Mpox virus, the causative agent of mpox disease, is a member of the orthopoxvirus genus and is related to variola virus (VARV), the causative agent of smallpox. Mpox disease generally manifests as a selflimiting infection with symptoms including fever, headache, fatigue, lymphadenopathy and skin lesions. Illness is most severe in children, pregnant women, and individuals with underlying immune deficiencies and can be associated with high case fatality rates. However, lethal disease is most frequently caused by clade I MPXV infections (case fatality rates between 6 and 15%). The 2022 international outbreak was driven by clade lib MPXV and was associated with less severe disease. The recent 2024 outbreak resulted from an upsurge of a new clade (clade lb). Orthopox viruses are DNA encoded viruses, yielding a high level of similarity between orthopoxvirus antigens, which allows immune responses raised to certain proteins from one virus to potentially provide cross-protective immunity to other viruses within the genus. Smallpox was eradicated by exploiting this potential for cross-protection through global immunization campaigns using another orthopoxvirus, vaccinia virus (VACV), as a live virus vaccine. First generation VACV immunization provided robust and durable protection against smallpox, but its unfavorable side effects and exclusion from use in certain populations encouraged the development of vaccines with an improved safety profile. VACV-derivatives with improved safety profiles but more modest durability of immune response were available for use prior to May 2022, but stockpiles and existing manufacturing capacity did not meet the demand driven by the 2022 outbreak. The development of novel, potent and safe mpox vaccines is needed, especially vaccines that can be rapidly manufactured at scale and distributed globally.

[0147] Without wishing to be bound by any theory, the design of polyribonucleotide constructs encoding mpox antigens of the present disclosure draws from the study of immune responses to live VACV vaccines that formed the basis of the successful global campaign to eradicate smallpox. VACV replication in a host exposes the immune system to the complete proteome of the virus, including greater than 30 virion surface proteins. In principle, VACV-mediated adapted immune protection could involve antibody and / or T cell responses to all or many VACV proteins. However, VACV proteins have differential immunogenicity in a host, suggesting that responses to a subset of antigens are needed for immunity.

[0148] Envelope proteins can be the targets of both protective antibody and T cell responses since they are accessible to antibodies in intact virions and infected cells. However, narrowing to mpox envelope proteins may be insufficient to define antigen inclusion, as orthopoxviruses encode dozens of envelope proteins in their large DNA genomes. This feature stands in stark contrast to other viruses like SARS-CoV-2 for which there are only one or a few potential envelope protein targets. Further complicating antigen selection are the two distinct viral forms of orthopoxviruses, extracellular virions (EVs) and mature virions (MVs).

[0149] The specific mechanisms of protection for immune responses raised to MV and EV targets vary; immune responses raised to EV and MV targets have different functional profiles in vitro and in vivo. Antibodies against MV targets like Ml can generate neutralizing antibody responses in which pre-incubation of anti-MV antibodies with MV particles can prevent infection of cells in vitro independent of Fc-mediated antibody effector functions. In contrast, in vitro neutralization of EV particles through pre-incubation with anti-A35 or anti- 66 antibodies depends on the presence of complement proteins. However, comparison of active or passive immunization against EV or MV antigens in mice demonstrates that EV antigens are targets for in vivo protection from severe disease in VACV infection models. In vivo protection provided by anti-EV antibodies depends on Fc- effector functions, including both complement cascade activation and Fc receptor-mediated functions, consistent with results from in vitro EV neutralization assays.

[0150] The present disclosure provides nucleic acids (e.g., polyribonucleotides) encoding orthopox antigens (e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.)), antigen constructs thereof, and / or pharmaceutical compositions thereof that are effective for vaccination against one or more orthopox viruses (e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, rabbitpox, etc.)). The present disclosure also provides the insight that polyribonucleotides, antigen constructs thereof, and pharmaceutical compositions thereof targeting one orthopox species may cross-protect against other orthopoxviruses. For example, in some embodiments, provided polyribonucleotides encoding mpox proteins, antigen constructs thereof, and / or pharmaceutical compositions thereof, are effective for vaccination against mpox and one or more other orthopox viruses. In some embodiments, provided polyribonucleotides encoding mpox proteins, antigen constructs thereof, and / or pharmaceutical compositions thereof are effective for vaccination against mpox and one or more of variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) viruses. In some embodiments, provided polyribonucleotides encoding mpox proteins, antigen constructs thereof, and / or pharmaceutical compositions thereof are effective for vaccination against mpox and variola virus. In some embodiments, provided polyribonucleotides encoding mpox proteins, antigen constructs thereof, and / or pharmaceutical compositions thereof are effective for vaccination against mpox and rabbitpox. In some embodiments, provided polyribonucleotides encoding mpox proteins, antigen constructs thereof, and / or pharmaceutical compositions thereof are effective for vaccination against mpox and vaccinia virus (e.g., modified vaccinia virus Ankara, etc.). In some embodiments, provided polyribonucleotides encoding mpox proteins, antigen constructs thereof, and / or pharmaceutical compositions thereof are effective for vaccination against mpox and ectromelia virus. In some embodiments, provided polyribonucleotides encoding mpox proteins, antigen constructs thereof, and / or pharmaceutical compositions thereof are effective for vaccination against mpox and a novel orthopox virus.Mpox Structure

[0151] Mpox virions are ovoid or brick-shaped particles which are enclosed by geometrically corrugated lipoprotein outer membrane. Mature mpox virions have a densely packed core containing enzymes, a double-stranded DNA genome, and transcription factors that are protected by a protein core.

[0152] The mpox genome consists of a linear double-stranded DNA (about 197 kb) covalently joined at its ends by palindromic hairpins, and the inverted terminal repeats (ITRs) are made up of a hairpin loop, tandem repeats, and some open reading frames (ORF). Although mpox virus is a DNA virus, its entire life cycle occurs in the cytoplasm of infected cells. All the proteins required for viral DNA replication, transcription, virion assembly, and egress are encoded by the mpox genome. The genes encoding for housekeeping functions are highly conserved among orthopoxviruses and are present in the central region of the genome while those that encode for the genes mediating virus-host interactions are less conserved and located in the terminal regions of the genome.

[0153] In vaccinia virus (and most likely in mpox) intracellular mature virus (MV) and extracellular- enveloped virus (EV) are two forms of infectious virions produced in poxvirus-infected cells. MV is released upon cell lysis, while EV is released from cells via interaction with actin tails, and this is said to be the cause of rapid long distance spread of the virus within the infected host. Although the aforementioned features are for VACV, it is likely that these features are common to all orthopoxviruses. Cell-associated virions (CEVs) are formed following the microtubule-mediated transport of intracellular enveloped virus (IEV) to the cell periphery, in which the outer membrane of IEV fuses with the plasma membrane and remains attached to the cell surface. CEVs aremostly responsible for cell-to-cell spread. IEV is formed when an MV is wrapped by a double membrane derived from early endosomal component or the trans-Golgi network (TGN). However, apart from IEV exocytosis, an alternative route for the formation of an EV is by the budding of the MV through the plasma membrane. In the prototype vaccinia virus, virion morphogenesis can be defective resulting in non-infectious dense particles (DPs), but this has not yet been reported for mpox. In addition, unlike some strains of cowpox virus in which MVs are occluded within A-type inclusions (ATI), mpox does not form ATIs or sequester MVs into ATIs because of truncation in the ATIP gene.Mpox Transmission

[0154] The two possible means of mpox transmission are animal-to-human transmission and human- to-human transmission. Respiratory droplets and contact with body fluids, contaminated patient's environment or items, and skin lesion of an infected person have been found to be associated with inter-human transmission. Contact between broken skin or mucous membranes and an infected patient's body fluids, respiratory droplets, or scabs is considered a "high risk" exposure that warrants post-exposure vaccination as soon as possible.Congo Basin (CB) clade (Central Africa clade) is reported to be more virulent than West Africa (WA) clade and thereby contributes more to inter-human transmission. Animal-to-human transmission, which is also known as zoonotic transmission, occurs via direct contact with any of the aforementioned natural viral hosts or consumption of these hosts. In addition, zoonotic transmission could occur by direct contact with the blood, body fluids, and inoculation from mucocutaneous lesions of an infected animal. Nosocomial transmission has been reported for CB and WA clades of mpox while sexual transmission has been speculated for infected individuals with groin and genital lesions. At present, human-to-animal transmission has not been reported. Human-to-human transmission, secondary attack rates (SARS), and serial transmission events is much higher with the CB clade compared to the WA clade. The reproduction number (Ro) for the CB clade is estimated to be in the range of 0.6-1.0. The Ro has not been estimated for the WA clade of mpox viruses, but it is presumed to be lower than that of the CB clade. The upper limit Roof 1.0 in the CB clade indicates that the viruses will not only sustain human-to-human transmission but may persist in the human population. Presumably, if as expected the RQ of the WA clade is much lower than what was estimated for the CB clade, then sustained human-to- human transmission and persistence in a human population are highly unlikely and outbreaks will be largely due to spillover events from zoonotic hosts.Mpox Treatment

[0155] Currently, there are no specific clinically proven treatments for mpox infection. As with most viral illnesses, the treatment is supportive symptom management. There are, however, prevention measures that can help prevent and / or reduce severity of an outbreak. Infected individuals should remain in isolation, wear a surgical mask, and keep lesions covered as much as reasonably possible until all lesion crusts have naturally fallen off and a new skin layer has formed. For severe cases, investigational use can be considered for compounds with demonstrated benefit against orthopoxviruses in animal studies and severe vaccinia vaccine complications. The oral DNA polymerase inhibitor brincidofovir, oral intracellular viral release inhibitor tecovirimat, and intravenous vaccinia immune globulin have unknown efficacy against the mpox virus. For individuals exposed to the virus, temperature and symptoms should be monitored twice per day for 21 days because that is the accepted upper limit of the mpox incubation period. Infectiousness aligns with symptom onset; therefore, close contacts need not isolate while asymptomatic. According to the Centers for Disease Control and Prevention (CDC), vaccination within four days of exposure may prevent disease onset, and vaccination within 14 days may reduce disease severity.Exemplary Mpox Polypeptides

[0156] Exemplary polyribonucleotide constructs of the present disclosure include nucleic acids encoding A35, B6, Ml and / or H3. In some embodiments, antigens may be from a certain mpox clade, e.g., from clade I (clade la or clade lb) MPXV, or clade II (e.g., clade Ila or clade lib) MPXV. Wild-type (WT) versions of mpox antigens provided herein can be surface-exposed, single-pass membrane proteins. Recognition of membrane proteins by the immune system can be achieved through trafficking of these proteins to the cell surface in polyribonucleotide-transfected cells. For example, WT versions of A35 and B6 are expected to traffic to the cell surface in polyribonucleotide-transfected cells. However, WT versions of MV targets, e.g., Ml and H3 are not efficiently delivered to the endoplasmic reticulum for eventual transit to the plasma membrane. During viral replication, embedding of MV proteins into the MV envelope may be distinct from the normal host cell biosynthesis pathway for integral membrane proteins and they lack native secretory signal.B6R

[0157] Mpox B6R (also referred to as MPXVgpl67) is a -35 kD polypeptide. B6R, is a type I integral membrane protein with an N-terminal ectodomain, a C-terminal transmembrane helix, and two sushi domains. B6R is classified as a membrane glycoprotein that is a component of the mpox EV envelope. B6R is also classified as being involved in negative regulation of complement activation. B6R polypeptide sequences include, e.g., UniProt accession numbers Q8V4S2, V9NQJ0, A0A0F6N8B7, each of which is incorporated herein by reference in its entirety. Exemplary B6R amino acid sequences are provided in Table 1 and Table 6 below. In some embodiments, exemplary polyribonucleotide constructs of the present disclosure comprise one or more polyribonucleotides that encode B6R. For example, in some embodiments, the encoded B6R antigen is fully WT. In some embodiments, the sequence of the fully WT B6R antigen is derived from early cases in the 2022 mpox outbreak. In some embodiments, a B6R antigen is associated with a native secretory signal.

[0158] Mpox B6R is homologous to vaccinia B5R. Vaccinia B5R (see, e.g., accession numberAAN78219.1) is a membrane protein that is essential in packaging the intracellular mature virion form intracellular enveloped virions, and is EV-specific.DOIs: https: / / doi.org / 10.1083 / jcb.200104124, https: / / doi.org / 10.1128 / jvi.68.1.130- 147.1994, https: / / doi.org / 10.1099 / 0022-1317-83-12-2915.

[0159] In some embodiments, exemplary polyribonucleotide constructs of the present disclosure comprise one or more polyribonucleotides that encode a B6R antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 21-30, 180, or 182, or an antigenic fragment thereof.A35R

[0160] Mpox A35R (also referred to as MPXV-COP-139, MPXV-SL-139, MPXV-WRAIR139) is a -20 kD polypeptide. A35R is a type II, disulfide-bonded homodimer with a C-terminal ectodomain and a N-terminal transmembrane domain. A35R is classified as a membrane protein, specifically a bifunctional EV membrane phosphoglycoprotein. A35R polypeptide sequences include, e.g., UniProt accession numbers Q8V4U4 and Q80KX2, each of which is incorporated herein by reference in its entirety. Exemplary A35R amino acid sequences are provided in Table 1 and Table 13 below. In some embodiments, exemplary polyribonucleotide compositions of the present disclosure comprise one or more polyribonucleotides that encode A35R. For example, in some embodiments, the encoded A35R antigen is fully WT. In some embodiments, the A35Rantigen sequence is derived from early cases in the 2022 mpox outbreak. In some embodiments, an A35R antigen is associated with a native secretory signal.

[0161] Mpox A35R is homologous to vaccinia A33R. Vaccinia A33R (see, e.g., accession numberAAF63733, incorporated herein by reference in its entirety) is a type II integral membrane protein found in EV (extracellular enveloped virus) but not MV, and is highly conserved among orthopoxviruses. See, e.g., DOIs: 10.1128 / jvi.72.5.4192-4204.1998.

[0162] In some embodiments, exemplary polyribonucleotide constructs of the present disclosure comprise one or more polyribonucleotides that encode a A35R antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 11-20, 172, or 174, or an antigenic fragment thereof.MIR

[0163] MPXV MIR (also referred to as MV membrane protein, MPXV-COP-074, MPXV-SL-074) is a -27 kD polypeptide. MIR is a type I integral membrane protein with an N-terminal ectodomain and a C-terminal transmembrane helix. MIR polypeptide sequences include, e.g., UniProt accession numbers Q8V502, Q80KX3, Q5IXU5, each of which is incorporated herein by reference in its entirety. Exemplary MIR amino acid sequences are provided in Table 1 and Table 13 below. In some embodiments, exemplary polyribonucleotide compositions of the present disclosure comprise one or more polyribonucleotides that encode MIR. In some embodiments, a secretory signal from HSV-1 gD can be added to the N-terminus of MIR. In some embodiments, the secretory signal can participate in trafficking MIR to the cell surface for display.

[0164] MPXV MIR is homologous to vaccinia L1R. Vaccinia L1R (see, e.g., accession numberAAF63732, incorporated herein by reference in its entirety) is a myristoylated transmembrane protein of about 250 residues that is expressed on the surface of the MVs. It is considered essential at least in that genetic deletion of L1R renders vaccinia viruses incapable of maturation. L1R appears to be required for maturation of viral particles. See, e.g., DOIs: https: / / doi.org / 10.1128 / jvi.68.10.6401-6410.1994, 10.1073 / pnas.062163799.

[0165] In some embodiments, exemplary polyribonucleotide constructs of the present disclosure comprise one or more polyribonucleotides that encode a MIR antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 31-40, or 158, or an antigenic fragment thereof.H3L

[0166] H3L (also referred to as MV heparin binding surface protein, Envelope protein H3, MPXV-COP-087, MPXV-SL-087, MPXV-WRAIR087, MPXVgpO93) is a -37.5 kD polypeptide that localizes to the mpox viral envelope. H3L is a type I integral membrane protein with an N-terminal ectodomain and a C-terminal transmembrane helix. H3L polypeptide sequences include, e.g., UniProt accession numbers, Q8V4Z2, Q3I8S1, Q5IXT2, A0A0F6N9X0, each of which is incorporated herein by reference in its entirety). Exemplary H3L amino acid sequences are provided in Table 1 and Table 13 below. In some embodiments, exemplary polyribonucleotide compositions of the present disclosure comprise one or more polyribonucleotides that encode H3L. In some embodiments, a secretory signal from HSV-1 gD can be added to the N-terminus of H3L. In some embodiments, the secretory signal can participate in trafficking H3L to the cell surface for display. Mpox H3L was found to bear high sequence similarity to vaccinia H3L.

[0167] In some embodiments, exemplary polyribonucleotide constructs of the present disclosure comprise one or more polyribonucleotides that encode a H3L antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, or 190, or an antigenic fragment thereof.II, PolyribonucleotidesA. Exemplary Polyribonucleotide Constructs

[0168] The present disclosure, among other things, utilizes polyribonucleotide (e.g., RNA) technologies as a modality to express one or more orthopoxvirus (e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) viruses) polypeptide constructs that includes one or more orthopoxvirus (e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) viruses) antigens, or one or more portions thereof, described herein.

[0169] In some embodiments, the present disclosure provides polyribonucleotides that encode one or more mpox antigens or fragments thereof. The present disclosure includes the unexpected discovery that mpox antigens provided in Table 1, and fragments thereof, are particularly advantageous for use in preventing or treating mpox infection and other orthopoxvirus infections (e.g., variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) viruses), e.g., in mpox antigen constructs and / or mpox vaccines as further disclosed herein.

[0170] In some polyribonucleotide constructs of the present disclosure, multiple polyribonucleotides are designed such that the multiple polyribonucleotides together encode multiple mpox antigens because of the many surface proteins and complex replication cycle of orthopoxviruses. Orthopoxviruses have two distinct infectious forms, mature virions (MV) and extracellular virions (EV). Each viral form has a unique set of surface antigens. While immune responses raised to any single target can offer some protection from infection, both subunit vaccine and monoclonal antibody prophylaxis studies in animals illustrate the value of combining antibodies to multiple EV and MV targets. Therefore, to effectively reduce viral replication and infectivity, exemplary polyribonucleotide constructs of the present disclosure target MPXV proteins from both EVs and MVs: A35 and B6 which are EV surface glycoproteins and Ml and H3 which are displayed on the surface of MVs. Without wishing to be bound by any particular theory, selection of this subset of antigens from the surface proteomes of MPXV virions may be guided by two factors. First, A35, B6, Ml and H3 are conserved across many orthopoxviruses, including VARV and VACV. Second, the use of these targets in protein and DNA-vectored subunit vaccines has been demonstrated to elicit protective immunity in mouse and non-human primate systems; however, protein and DNA based compositions have associated challenges. As discussed herein, polyribonucleotides and compositions provided herein can address and overcome the prior challenges.

[0171] In various embodiments, a polyribonucleotide of the present disclosure encodes a single mpox antigen of Table 1 or antigenic fragment thereof (e.g., an A35R polypeptide or antigenic fragment thereof, B6R polypeptide or antigenic fragment thereof, MIR polypeptide or antigenic fragment thereof, or H3L polypeptide or antigenic fragment thereof). In some embodiments, an exemplary polyribonucleotide of the present disclosure encodes an A35R polypeptide having a sequence of any one of the A35R sequences of Table 1, or an antigenic fragment thereof. In some embodiments, exemplary polyribonucleotide constructs of the present disclosure comprise one or more polyribonucleotides that encode an A35R antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 11-20, 172, or 174, or an antigenic fragment thereof.

[0172] In some embodiments, a polyribonucleotide of the present disclosure encodes a B6R polypeptide having a sequence of any one of the B6R sequences of Table 1, or an antigenic fragment thereof. In some embodiments, exemplary polyribonucleotide constructs of the present disclosure comprise one or more polyribonucleotides that encode a B6R antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 21-30, 180, or 182, or an antigenic fragment thereof.

[0173] In some embodiments, a polyribonucleotide of the present disclosure encodes an MIR polypeptide having a sequence of any one of the MIR sequences of Table 1, or an antigenic fragment thereof. In some embodiments, exemplary polyribonucleotide constructs of the present disclosure comprise one or more polyribonucleotides that encode a MIR antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 31-40, or 158, or an antigenic fragment thereof.

[0174] In some embodiments, a polyribonucleotide of the present disclosure encodes an H3L polypeptide having a sequence of any one of the H3L sequences of Table 1, or an antigenic fragment thereof. In some embodiments, exemplary polyribonucleotide constructs of the present disclosure comprise one or more polyribonucleotides that encode a H3L antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, or 190, or an antigenic fragment thereof.

[0175] In some embodiments, a polyribonucleotide of the present disclosure encodes two, three, or four mpox antigens of Table 1 or antigenic fragments thereof. In some embodiments, a polyribonucleotide of the present disclosure encodes two or more mpox polypeptides selected from: an A35R polypeptide or antigenic fragment thereof, a B6R polypeptide or antigenic fragment thereof, an MIR polypeptide or antigenic fragment thereof, and an H3L polypeptide or antigenic fragment thereof.

[0176] In some embodiments, a polyribonucleotide of the present disclosure encodes a B6R polypeptide having a sequence of any one of the B6R sequences of Table 1, and an MIR polypeptide having a sequence of any one of the MIR sequences of Table 1. In some embodiments, a polyribonucleotide of the present disclosure encodes a B6R antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 21-30,180, or 182, or an antigenic fragment thereof, and an MIR antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 31-40, or 158, or an antigenic fragment thereof.

[0177] In some embodiments, a polyribonucleotide of the present disclosure encodes an A35R polypeptide having a sequence of any one of the A35R sequences of Table 1, a B6R polypeptide having a sequence of any one of the B6R sequences of Table 1, and an MIR polypeptide having a sequence of any one of the MIR sequences of Table 1. In some embodiments, a polyribonucleotide of the present disclosure encodes: (i) an A35R antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 11-20, 172, or 174, or an antigenic fragment thereof; (ii) a B6R antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 21-30, 180, or 182, or an antigenic fragment thereof; and (iii) an MIR antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 31-40, or 158, or an antigenic fragment thereof.

[0178] In some embodiments, a polyribonucleotide of the present disclosure encodes an A35R polypeptide having a sequence of any one of the A35R sequences of Table 1, a B6R polypeptide having a sequence of any one of the B6R sequences of Table 1, an MIR polypeptide having a sequence of any one of the MIR sequences of Table 1, and an H3L polypeptide having a sequence of any one of the H3L sequences of Table 1. In some embodiments, a polyribonucleotide of the present disclosure encodes: (i) an A35R antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 11-20, 172, or 174, or an antigenic fragment thereof; (ii) a B6R antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 21-30, 180, or 182, or an antigenic fragment thereof; (iii) an MIR antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 31-40, or 158, or an antigenic fragment thereof; and (iv) a H3L antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, or 190, or an antigenic fragment thereof.

[0179] In some embodiments, a polyribonucleotide of the present disclosure encodes one or more MV antigens. In some embodiments, one or more MV antigens are selected from H3L and MIR. In some embodiments, a polyribonucleotide of the present disclosure encodes one or more MV-specific antigens. In some embodiments, one or more MV-specific antigens are selected from H3L and MIR.

[0180] In some embodiments, a polyribonucleotide of the present disclosure encodes one or more EV antigens. In some embodiments, one or more EV antigens are selected from A35R and B6R. In someembodiments, a polyribonucleotide of the present disclosure encodes one or more EV-specific antigens. In some embodiments, one or more EV-specific antigens are selected from A35R and B6R.

[0181] In some embodiments, a polyribonucleotide of the present disclosure encodes one or moreA35R polypeptides (e.g., an A35R antigen or one or more antigenic fragments thereof). In some embodiments, a polyribonucleotide of the present disclosure encodes one or more B6R polypeptides (e.g., a B6R antigen or one or more antigenic fragments thereof). In some embodiments, a polyribonucleotide of the present disclosure encodes one or more MIR polypeptides (e.g., an MIR antigen or one or more antigenic fragments thereof). In some embodiments, a polyribonucleotide of the present disclosure encodes one or more H3L polypeptides (e.g., an H3L antigen or one or more antigenic fragments thereof).

[0182] As described herein, in some embodiments, provided technologies involve administration of a plurality of antigens to the same subject. In some embodiments, multiple antigens are administered at the same time (e.g., in a single dose). In some embodiments, different antigens may be administered at different times (for example in different doses - e.g., a prime dose vs a boost dose). In some embodiments, multiple antigens are administered via the same composition.

[0183] For clarity, a single "antigen" polypeptide may include multiple "epitopes", which in turn may or may not be linked with one another in nature. For example, a single string construct antigen includes multiple epitopes, which may be from different parts of the same mpox protein and / or from different mpox proteins, linked together as described herein in a single polypeptide.

[0184] Thus, a single pharmaceutical composition (e.g., immunogenic composition, e.g., vaccine) as described herein may include or deliver (e.g., because the pharmaceutical composition includes a nucleic acid, such as a polyribonucleotide, that encodes the antigen and is expressed upon administration) a single antigen, which itself may comprise multiple epitopes (either in their natural arrangement relative to one another or in an engineered or constructed arrangement as described herein), or may comprise or deliver a plurality of antigens, each of which similarly may be or comprise a single epitope or multiple epitopes (either in their natural arrangement relative to one another or in an engineered or constructed arrangement as described herein). Still further, a single pharmaceutical composition (e.g., immunogenic composition, e.g., vaccine) may, for example, include multiple distinct nucleic acids (e.g., polyribonucleotides) that each encode different antigen(s) or, in some embodiments, may include a single nucleic acid that encodes (and expresses) multiple antigens. Yet further, a single pharmaceutical composition (e.g., immunogenic composition, e.g., vaccine) that includes multiple distinct nucleic acids (e.g., polyribonucleotides) encoding antigens may, in some embodiments, be prepared by mixing the polyribonucleotides and then incorporating the mixture into LNPs, or alternatively by formulating individual polyribonucleotides into LNPs and then mixing the LNPs. In some embodiments, mixtures (whether of polyribonucleotides pre-LNP preparation or of LNPs) may include the relevant polyribonucleotides in 1: 1 ratio, or in other ratios as may be preferred (e.g., to achieve a desired relative presentation of antigens or epitopes) in a subject to whom the composition is administered.

[0185] In some embodiments, two or more polyribonucleotide molecules each encoding a different polypeptide (e.g., an mpox antigen as described herein) can be mixed with particle-forming agents to form nucleic acid containing particles as described above. In alternative embodiments, two or more polyribonucleotide molecules each encoding a different polypeptide (e.g., an mpox antigen, or antigenic fragment thereof, as described herein) can be formulated into separate particle compositions, which are then mixed together. For example, in some embodiments, individual populations of nucleic acid containing particles, each population comprising a polyribonucleotide molecule encoding a different immunogenic polypeptide or antigenic fragmentthereof (e.g., an mpox antigen or antigenic fragment thereof as described herein), can be separately formed and then mixed together, for example, prior to filling into vials during a manufacturing process, or immediately prior to administration (e.g., by an administering health-care professional). Accordingly, in some embodiments, described herein is a composition comprising two or more populations of particles (e.g., in some embodiments, lipid nanoparticles), each population comprising at least one polyribonucleotide molecule encoding a different immunogenic polypeptide or antigenic fragment thereof (e.g., an mpox antigen or antigenic fragment thereof). In some embodiments, each population may be provided in a composition at a desirable proportion (e.g., in some embodiments, each population may be provided in a composition in an amount that provides the same amount of polyribonucleotide molecules).

[0186] In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic composition, e.g., vaccine) may comprise or deliver a combination comprising a polypeptide or portion thereof encoded by all or part of A35R, B6R, MIR, H3L, and / or antigenic fragments of any thereof.

[0187] In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic composition, e.g., vaccine) comprise or deliver a combination comprising one or more MV antigens (e.g., MV- specific antigens) and one or more EV antigens (e.g., EV-specific antigens). In some embodiments, one or more pharmaceutical compositions comprise or deliver a combination of mpox antigens that includes (i) one or more MV antigens (e.g., MV-specific antigens) selected from H3L, MIR, and antigenic fragments of any thereof; and (ii) one or more EV antigens (e.g., EV-specific antigens) selected from A35R, B6R, and antigenic fragments of any thereof.

[0188] In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic composition, e.g., vaccine) may comprise or deliver a combination comprising a polypeptide or portion thereof encoded by all or part of B6R, MIR, and / or antigenic fragments of any thereof. In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic composition, e.g., vaccine) may comprise or deliver a combination comprising a polypeptide or portion thereof encoded by all or part of B6R, A35R, and / or antigenic fragments of any thereof. In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic composition, e.g., vaccine) may comprise or deliver a combination comprising a polypeptide or portion thereof encoded by all or part of B6R, A35R, MIR, and / or antigenic fragments of any thereof. In some embodiments, one or more pharmaceutical compositions (e.g., immunogenic composition, e.g., vaccine) may comprise or deliver a combination comprising a polypeptide or portion thereof encoded by all or part of B6R, A35R, MIR, H3L, and / or antigenic fragments of any thereof.

[0189] In some embodiments, a provided composition includes or delivers an mpox envelope glycoprotein antigen (e.g., a full-length mpox envelope glycoprotein, a fragment thereof, or one or more epitopes thereof, for example in a string construct). In some embodiments, a provided composition includes or delivers such an mpox envelope glycoprotein antigen together with one or more B cell targets (e.g., epitopes) which may, for example, be or comprise one or more other mpox proteins (or fragments or epitopes thereof). In some embodiments, such a B cell target is or comprises an mpox protein (or fragment or epitope thereof) that is predicted or known to induce a B cell response in infected humans. For example, in some embodiments, a B cell target is or comprises an mpox protein (or fragment or B cell epitope thereof) against which sera from infected individual(s) is reactive. In some particular embodiments, a B cell target is or comprises an mpox envelope glycoprotein, or other relevant mpox protein, or a fragment or epitope thereof.

[0190] In some embodiments, a provided composition comprises or delivers a string construct antigen that includes a plurality of T cell epitopes, optionally from more than one mpox protein. In some suchembodiments, a provided composition further comprises or delivers one or more B cell targets. Alternatively or additionally, in some embodiments, a string construct antigen so utilized includes mpox sequences (e.g., one or more fragments or epitopes, e.g., T cell epitopes and / or B cell epitopes, but in some embodiments specifically T cell epitopes).

[0191] In some embodiments, a string construct antigen includes both B cell epitopes and T cell epitopes (optionally from the same mpox protein or from different mpox proteins).

[0192] In some embodiments, different antigens may be delivered by administration of different compositions, which in turn may, in some embodiments, be administered at the same time (e.g., as an admixture or otherwise substantially simultaneously) and, in some embodiments, may be administered at different times. To give but one example, in some embodiments, a particular antigen or antigen(s) may be delivered via an initial pharmaceutical composition (e.g., immunogenic composition, e.g., vaccine) dose, and one or more other antigen(s) may be delivered via one or more booster dose(s).

[0193] In some embodiments, an antigen utilized (i.e., included in and / or otherwise delivered by) a pharmaceutical composition (e.g., immunogenic composition, e.g., vaccine) described herein comprises multiple epitopes, e.g., of a single mpox protein or of multiple proteins.

[0194] In some embodiments, an antigen may comprise two or more epitopes from the same mpox protein and in their natural configuration relative to one another (e.g., in a fragment if the relevant protein). In some embodiments, however, an antigen may comprise at least two epitopes configured in a non-natural relationship relative to one another (e.g., included in a string construct).

[0195] Experience with SARS-CoV-2 has demonstrated that polyribonucleotide (e.g., RNA) administration can be a particularly effective way to deliver an infectious disease antigen. Furthermore, the present disclosure provides an insight that various features of nucleic acid formats including, for example their flexibility and amenability to rapid design and modification, including incorporation of a variety of insights (e.g., bioinformatics inputs etc.), renders them particularly attractive for use in an mpox vaccine.

[0196] In some embodiments, one or more polyribonucleotides (e.g., mRNAs) utilized in a pharmaceutical composition (e.g., immunogenic composition, e.g., vaccine) as described herein encodes a plurality of epitopes (e.g., including one or more, or two or more, sequences provided in Table 1, or antigenic fragments thereof), optionally wherein each of the plurality is predicted by an H LA binding and presentation prediction algorithm to be of high likelihood to be presented by a protein encoded by an H LA to a T cell for eliciting an immune response. In some embodiments, the plurality of epitopes comprises epitopes from a single mpox protein. In some embodiments, the plurality of epitopes comprises epitopes from multiple mpox proteins.

[0197] In some embodiments, one or more polyribonucleotides (e.g., mRNAs) utilized in a pharmaceutical composition (e.g., immunogenic composition, e.g., vaccine) as described herein include a first polyribonucleotide that encodes an mpox antigen expressed prior to cell infiltration or infection and includes one or more portions expected or known to interface with host cytoplasm. In some embodiments, an mpox antigen encoded by a first polyribonucleotide is or comprises an mpox antigen, fragment, or epitope, e.g., an A35R, B6R, MIR, and / or H3L, or antigenic fragments thereof, epitopes thereof, and / or a combination thereof. In some embodiments, one or more polyribonucleotides (e.g., mRNAs) utilized in a pharmaceutical composition (e.g., immunogenic composition, e.g., vaccine) as described herein includes a second polyribonucleotide that encodes a multi-epitopic (e.g., polyepitopic) antigen. In some embodiments, a multi-epitopic antigen comprises two or more antigens found in Table 1 or antigenic fragments thereof or epitopes thereof. In some embodiments, amulti-epitopic antigen comprises two or more antigens listed in Table 1, and / or antigenic fragments and / or epitopes thereof.

[0198] In some embodiments, a polyribonucleotide construct can include an internal ribosome entry site (IRES), e.g., between two sequences encoding antigens or fragments thereof engineered for expression from a polyribonucleotide as distinct polypeptides. Internal ribosome entry sites (IRESs) are cis-acting elements that can recruit the small ribosomal subunits to an internal initiator codon in a polyribonucleotide in conjunction with cellular trans-acting factors. The ability of internal ribosome entry site (IRES) elements to promote internal initiation of translation of polyribonucleotide sequences can facilitate or permit expression of two or more polypeptides from a polycistronic polyribonucleic acid. An exemplary IRES is the encephalomyocarditis virus (EMCV) IRES.

[0199] In some embodiments, a multi-epitope polyribonucleotide encoding a super-motif-bearing or motif-bearing polypeptide, together with a helper epitope (e.g., a heterologous helper epitope) and an endoplasmic reticulum-translocating signal sequence. See, for example, in An & Whitton J. Virol. 71:2292, 1997; Thomson, eta / ., J. Immuno! 157:822, 1996; Whitton, eta!., J. Virol 67 :348, 1993; Hanke, et a!., Vaccine 16:426, 1998.

[0200] Additionally, polyribonucleotides described herein, in some embodiments, include other elements such as described below, including, a secretion signal-encoding region, a 5' Cap, a Cap proximal sequence, a 5' UTR, a 3' UTR, and / or a polyA tail. In some embodiments, polyribonucleotides described herein can comprise a secretion signal-encoding region. In some embodiments, epitopes encoded in a string construct may be flanked by a secretory signal sequence, e.g., SP1 sequence (HSV-1 gD secretory signal / secretory domain, SEQ ID NO: 143). In some embodiments, polyribonucleotides described herein can comprise a nucleotide sequence that encodes a 5' UTR of interest and / or a 3' UTR of interest. In some embodiments, a polynucleotide comprises a dEarl-hAg sequence (SEQ ID NO: 155). In some embodiments, the polyribonucleotide (e.g., mRNA) comprises a 5 'UTR and a 3' UTR. In some embodiments, a 3' UTR comprises a poly A sequence. In some embodiments, a poly A sequence comprises between 50-200 nucleotides. In some embodiments, a poly A tail of a string construct may comprise about 150 A residues. In some embodiments, a poly A tail may comprise 120 residues or less. In some embodiments, a poly A tail of a string construct may comprise about 120 A residues. In some embodiments, a poly A tail of a string construct may comprise about 100 A residues. In some embodiments, a poly A tail of a string construct comprises a "split" or "interrupted" poly A tail (e.g., as described in W02016 / 005324). In some embodiments, polyribonucleotides described herein may comprise a 5' cap, which may be incorporated during transcription, or joined to a polyribonucleotide posttranscription.1. Secretory Signals

[0201] In some embodiments, a polyribonucleotide described herein comprises a sequence encoding a human secretory signal. For example, in some embodiments, such a human secretory signal may be or comprises the amino acid sequence of MDWIWRILFLVGAATGAHS (husec2; SEQ ID NO: 142). In some embodiments, a ribonucleic acid sequence encoding a secretory signal included in a polyribonucleotide consists of or comprises a nucleotide sequence that encodes a non-human secretory signal. In some embodiments, a polyribonucleotide encodes a human secretory signal where the secretory signal comprises the amino acid sequence MDWIWRILFLVGAATGAHS (husec2; SEQ ID NO: 142).

[0202] In some embodiments, an RNA sequence encodes an orthopoxvirus (e.g., mpox) antigen or antigenic fragment thereof that may comprise or otherwise be linked to a secretory signal (e.g., a secretorysequence), such as those listed in Table 2, or a sequence having 1, 2, 3, 4, or 5 amino acid differences relative thereto. In some embodiments, a secretory signal such as MRVMAPRTLILLLSGALALTETWAGS (SEQ ID NO: 157), or a sequence having 1, 2, 3, 4, or at the most 5 amino acid differences relative thereto is utilized.

[0203] In some embodiments, a secretory signal is selected from those included in Table 2 below:Table 2: Exemplary Secretory Signal Sequences2. 5' Cap

[0204] A structural feature of mRNAs is a cap structure at the five-prime end (S'). Natural eukaryotic mRNA comprises a 7-methylguanosine cap linked to the mRNA via a 5 ' to 5 '-triphosphate bridge resulting in capO structure (m7GpppN). In most eukaryotic mRNA and some viral mRNA, further modifications can occur at the 2'-hydroxy-group (2'-0H) (e.g., the 2'-hydroxyl group may be methylated to form 2'-0-Me) of the first and subsequent nucleotides producing "capl" and "cap2" five-prime ends, respectively). Diamond, et al., (2014) Cytokine & Growth Factor Reviews, 25:543-550 reported that capO-mRNA cannot be translated as efficiently as capl-mRNA in which the role of 2'-O-Me in the penultimate position at the mRNA 5' end is determinant. Lack of the 2'-O-met has been shown to trigger innate immunity and activate an IFN response. Daffis, et al. (2010) Nature, 468:452-456; and Ziist et al. (2011) Nature Immunology, 12: 137-143.

[0205] RNA capping is well researched and is described, e.g., in Decroly E., et al. (2012) NatureReviews 10: 51-65; and in Ramanathan A., et al., (2016) Nucleic Acids Res, 44(16): 7511-7526, the entire contents of each of which is hereby incorporated by reference. For example, in some embodiments, a 5'-cap structure which may be suitable in the context of the present invention is a capO (methylation of the first nucleobase, e.g. m7GpppN), capl (additional methylation of the ribose of the adjacent nucleotide of m7GpppN), cap2 (additional methylation of the ribose of the 2nd nucleotide downstream of the m7GpppN), cap3 (additional methylation of the ribose of the 3rd nucleotide downstream of the m7GpppN), cap4 (additional methylation of the ribose of the 4th nucleotide downstream of the m7GpppN), ARCA ("anti-reverse cap analogue"), modified ARCA (e.g. phosphothioate modified ARCA), inosine, N1 -methyl-guanosine, 2'-fluoro-guanosine, 7-deaza- guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0206] The term "5'-cap" as used herein refers to a structure found on the 5'-end of an RNA, e.g., mRNA, and generally includes a guanosine nucleotide connected to an RNA, e.g., mRNA, via a 5'- to 5'- triphosphate linkage (also referred to as Gppp or G(5')ppp(5')). In some embodiments, a guanosine nucleoside included in a 5' cap may be modified, for example, by methylation at one or more positions (e.g., at the 7- position) on a base (guanine), and / or by methylation at one or more positions of a ribose. In some embodiments, a guanosine nucleoside included in a 5' cap comprises a 3'0 methylation at a ribose (3'0MeG). In some embodiments, a guanosine nucleoside included in a 5' cap comprises methylation at the 7-position of guanine (m7G). In some embodiments, a guanosine nucleoside included in a 5' cap comprises methylation at the 7-position of guanine and a 3' 0 methylation at a ribose (m7(3'OMeG)). It will be understood that the notation used in the above paragraph, e.g., "(m27'3 O)G" or "m7(3'OMeG)", applies to other structures described herein.

[0207] In some embodiments, providing an RNA with a 5'-cap disclosed herein may be achieved by in vitro transcription, in which a 5'-cap is co-transcriptionally expressed into an RNA strand, or may be attached to an RNA post-transcriptionally using capping enzymes. In some embodiments, co-transcriptional capping with a cap disclosed improves the capping efficiency of an RNA compared to co-transcriptional capping with an appropriate reference comparator. In some embodiments, improving capping efficiency can increase a translation efficiency and / or translation rate of an RNA, and / or increase expression of an encoded polypeptide. In some embodiments, alterations to polynucleotides generates a non-hydrolyzable cap structure which can, for example, prevent de-capping and increase RNA half-life.

[0208] In some embodiments, T7 RNA polymerase prefers G as the initial site. Accordingly, in some such embodiments, the present disclosure provides caps (e.g., trinucleotide and tetranucleotide caps described herein) wherein the 3'end of the trinucleotide (e.g., N2) or tetranucleotide cap (e.g., N3) is G.

[0209] In some embodiments, it will be appreciated that all compounds or structures (e.g., 5' caps) provided herein encompass the free base or salt form (e.g., an Na+salt) comprising a suitable counterion (e.g., Na+). Compounds or structures (e.g., 5' caps) depicted as a salt also encompass the free base and include suitable counterions (e.g., Na+).

[0210] In some embodiments, a utilized 5' cap is a capO, a capl, or cap2 structure. See, e.g., Fig. 1 ofRamanathan A., et al., and Fig. 1 of Decroly E., et al., each of which is incorporated herein by reference in its entirety. See, e.g., Fig. 1 of Ramanathan A., et al., and Fig. 1 of Decroly E., et al., each of which is incorporated herein by reference in its entirety. In some embodiments, an RNA described herein comprises a capl structure. In some embodiments, an RNA described herein comprises a cap2.

[0211] In some embodiments, an RNA described herein comprises a capO structure. In some embodiments, a capO structure comprises a guanosine nucleoside methylated at the 7-position of guanine ((m7)G). In some embodiments, such a capO structure is connected to an RNA via a 5'- to 5'-triphosphate linkage and is also referred to herein as (m7)Gppp. In some embodiments, a capO structure comprises a guanosine nucleoside methylated at the 2'-position of the ribose of guanosine. In some embodiments, a capO structure comprises a guanosine nucleoside methylated at the 3'-position of the ribose of guanosine. In some embodiments, a guanosine nucleoside included in a 5' cap comprises methylation at the 7-position of guanine and at the 2'-position of the ribose ((m272°)G). In some embodiments, a guanosine nucleoside included in a 5' cap comprises methylation at the 7-position of guanine and at the 2'-position of the ribose ((m273°)G).

[0212] In some embodiments, a capl structure comprises a guanosine nucleoside methylated at the7-position of guanine ((m7)G) and optionally methylated at the 2' or 3' position pf the ribose, and a 2'0 methylated first nucleotide in an RNA ((m2' °)Ni). In some embodiments, a capl structure comprises a guanosinenucleoside methylated at the 7-position of guanine ((m7)G) and the 3' position of the ribose, and a 2'0 methylated first nucleotide in an RNA ((m2' °)Ni). In some embodiments, a capl structure is connected to an RNA via a 5'- to 5'-triphosphate linkage and is also referred to herein as, e.g., ((m7)Gppp(2' °)Ni) or(m27'3 O)Gppp(2' °)Ni), wherein Ni is as defined and described herein. In some embodiments, a capl structure comprises a second nucleotide, N2, which is at position 2 and is chosen from A, G, C, or U, e.g.,(m7)Gppp(2' °)NipN2 or (m27'3' °)Gppp(2'0)NipN2, wherein each of Ni and N2is as defined and described herein.

[0213] In some embodiments, a cap2 structure comprises a guanosine nucleoside methylated at the7-position of guanine ((m7)G) and optionally methylated at the 2' or 3' position of the ribose, and a 2'0 methylated first and second nucleotides in an RNA ((m2' °)Nip(m2' °)N2). In some embodiments, a cap2 structure comprises a guanosine nucleoside methylated at the 7-position of guanine ((m7)G) and the 3' position of the ribose, and a 2'0 methylated first and second nucleotide in an RNA. In some embodiments, a cap2 structure is connected to an RNA via a 5'- to 5'-triphosphate linkage and is also referred to herein as, e.g.,((m7)Gppp(2'0)Nip(2'0)N2) or (m27'3'0)Gppp(2'0)Nip(2, 0)N2), wherein each of Ni and N2is as defined and described herein.

[0214] In some embodiments, a 5' cap is a dinucleotide cap structure. In some embodiments, a 5' cap is a dinucleotide cap structure comprising Ni, wherein Ni is as defined and described herein. In some embodiments, a 5' cap is a dinucleotide cap G*Ni, wherein Ni is as defined above and herein, and:G* comprises a structure of formula (I):or a salt thereof, wherein each R2and R3is -OH or -OCH3; and X is 0 or S.

[0215] In some embodiments, R2is -OH. In some embodiments, R2is -OCH3. In some embodiments,R3is -OH. In some embodiments, R3is -OCH3. In some embodiments, R2is -OH and R3is -OH. In some embodiments, R2is -OH and R3is -CH3. In some embodiments, R2is -CH3 and R3is -OH. In some embodiments, R2is -CH3 and R3is -CH3.

[0216] In some embodiments, X is 0. In some embodiments, X is S.

[0217] In some embodiments, a 5' cap is a dinucleotide capO structure (e.g., (m7)GpppNi,(m27'2' °)GpppNi, (m27'3' °)GpppNi, (m7)GppSpNi, (m27'2' °)GppSpNi, or (m27'3' °)GppSpNi), wherein Ni is as defined and described herein. In some embodiments, the 5' cap is a dinucleotide capO structure (e.g., (m7)GpppNi, (m27'2' °)GpppNi, (m27'3' °)GpppNi, (m7)GppSpNi, (m27'2' °)GppSpNi, or (m27'3' °)GppSpNi), wherein Ni is G. In some embodiments, the 5' cap is a dinucleotide capO structure (e.g., (m7)GpppNi, (m27'2' °)GpppNi, (m27'3' °)GpppNi, (m7)GppSpNi, (m27'2' °)GppSpNi, or (m27'3' °)GppSpNi), wherein Ni is A, U, or C. In some embodiments, a 5' cap is a dinucleotide capl structure (e.g., (m7)Gppp(m2' °)Ni, (m27'2' °)Gppp(m2' °)Ni, (m27'3'- °)Gppp(m2' °)Ni, (m7)GppSp(m2' °)Ni, (m27'2' °)GppSp(m2' °)Ni, or (m27'3' °)GppSp(m2' °)Ni), wherein Ni is as defined and described herein. In some embodiments, the 5' cap is selected from the group consisting of(m7)GpppG C'EcapO"), (m7)Gppp(m2' °)G ("Ecapl"), (m27-3' °)GpppG ("ARCA" or "DI"), and (m27-2' °)GppSpG("beta-S-ARCA"). In some embodiments, the 5' cap is (m7)GpppG ("EcapO"), having a structure:or a salt thereof.

[0218] In some embodiments, a 5' cap is (m7)Gppp(m2' °)G ("Ecapl"), having a structure:or a salt thereof.

[0219] In some embodiments, a 5' cap is (m27-3' °)GpppG ("ARCA" or "DI"), having a structure:or a salt thereof.

[0220] In some embodiments, a 5' cap is (m27'2' °)GppSpG ("beta-S-ARCA"), having a structure:or a salt thereof.

[0221] In some embodiments, a 5' cap is a trinucleotide cap structure. In some embodiments, a 5' cap is a trinucleotide cap structure comprising NipN2, wherein Ni and N2are as defined and described herein. In some embodiments, a 5' cap is a trinucleotide cap G*NipN2, wherein Ni and N2are as defined above and herein, and:G* comprises a structure of formula (I):or a salt thereof, wherein R2, R3, and X are as defined and described herein.

[0222] In some embodiments, a 5' cap is a trinucleotide capO structure (e.g. (m7)GpppNipN2, (m27 2 -°)GpppNipN2, or (m27'3' °)GpppNipN2), wherein Ni and N2 are as defined and described herein). In some embodiments, a 5' cap is a trinucleotide capl structure (e.g., (m7)Gppp(m2' °)NipN2, (m27'2 O)Gppp(m2' °)NipN2, (m27'3' °)Gppp(m2' °)NipN2), wherein Ni and N2 are as defined and described herein. In some embodiments, a 5' cap is a trinucleotide cap2 structure (e.g., (m7)Gppp(m2' °)Nip(m2' °)N2, (m27'2' °)Gppp(m2'0)Nip(m2' °)N2, (m27'3'- °)Gppp(m2'0)Nip(m2' °)N2), wherein Ni and N2 are as defined and described herein. In some embodiments, a 5' cap is selected from the group consisting of (m27'3' °)Gppp(m2' °)ApG ("CleanCap AG 3' OMe", "CC413"), (m27'3'- °)Gppp(m2' °)GpG ("CleanCap GG"), (m7)Gppp(m2' °)ApG, (m7)Gppp(m2' °)GpG, (m27'3' °)Gppp(m25'2' °)ApG, and (m7)Gppp(m2' °)ApU. In some embodiments, a 5' cap is selected from the group consisting of (m27'3' °)Gppp(m2'_°)ApG ("CleanCap AG", "CC413"), (m27-3'0)Gppp(m2'-0)GpG ("CleanCap GG"), (m7)Gppp(m2' °)ApG, and (m27-3'- °)Gppp(m25'2' °)ApG, (m7)Gppp(m2' °)ApU, and (m27'3' °)Gppp(m2' °)CpG.

[0223] In some embodiments, a 5' cap is (m27'3' °)Gppp(m2' °)ApG ("CleanCap AG 3' OMe", "CC413"), having a structure:or a salt thereof.

[0224] In some embodiments, a 5' cap is (m27'3' °)Gppp(m2' °)GpG ("CleanCap GG"), having a structure:or a salt thereof.

[0225] In some embodiments, a 5' cap is (m7)Gppp(m2' °)ApG, having a structure:or a salt thereof.

[0226] In some embodiments, a 5' cap is (m7)Gppp(m2' °)GpG, having a structure:or a salt thereof.

[0227] In some embodiments, a 5' cap is (m27'3' °)Gppp(m25'2' °)ApG, having a structure:or a salt thereof.

[0228] In some embodiments, a 5' cap is (m7)Gppp(m2' °)ApU, having a structure:or a salt thereof.

[0229] In some embodiments, a 5' cap is (m27'3' °)Gppp(m2' °)CpG, having a structure:or a salt thereof.

[0230] In some embodiments, a 5' cap is a tetranucleotide cap structure. In some embodiments, a 5' cap is a tetranucleotide cap structure comprising NipN2pN3, wherein Ni, N2, and N3 are as defined and described herein. In some embodiments, a 5' cap is a tetranucleotide cap G*NipN2pN3, wherein Ni, N2, and N3 are as defined above and herein, and:G* comprises a structure of formula (I):or a salt thereof, wherein R2, R3, and X are as defined and described herein.

[0231] In some embodiments, a 5' cap is a tetranucleotide capO structure (e.g., (m7)GpppNipN2pN3,(m27'2' °)GpppNipN2pN3, or (m27'3' °)GpppNiN2pN3), wherein Ni, N2, and N3 are as defined and described herein). In some embodiments, a 5' cap is a tetranucleotide Capl structure (e.g., (m7)Gppp(m2' °)NipN2pN3, (m27'2’ °)Gppp(m2' °)NipN2pN3, (m27'3' °)Gppp(m2' °)NipN2N3), wherein Ni, N2, and N3 are as defined and described herein. In some embodiments, a 5' cap is a tetranucleotide Cap2 structure (e.g., (m7)Gppp(m2' °)Nip(m2'_°)N2pN3, (m27'2'0)Gppp(m2' °)Nip(m2' °)N2pN3, (m27'3'0)Gppp(m2' °)Nip(m2' °)N2pN3), wherein Ni, N2, and N3 are as defined and described herein. In some embodiments, a 5' cap is selected from the group consisting of (m27 3 >0)Gppp(m2' °)Ap(m2' °)GpG, (m27'3'0)Gppp(m2' °)Gp(m2' °)GpC, (m7)Gppp(m2' °)Ap(m2' °)UpA, and (m7)Gppp(m2 -°)Ap(m2'0)GpG.

[0232] In some embodiments, a 5' cap is (m27'3'0)Gppp(m2' °)Ap(m2' °)GpG, having a structure:or a salt thereof.

[0233] In some embodiments, a 5' cap is (m27'3'0)Gppp(m2' °)Gp(m2' °)GpC, having a structure:or a salt thereof.

[0234] In some embodiments, a 5' cap is (m7)Gppp(m2' °)Ap(m2' °)UpA, having a structure:or a salt thereof.

[0235] In some embodiments, a 5' cap is (m7)Gppp(m2' °)Ap(m2' °)GpG, having a structure:or a salt thereof.

[0236] In some embodiments, Ni is A or an analog thereof. In some embodiments, Ni is adenosine.In some embodiments, Ni is modified adenosine. In some embodiments, Ni is 6-methyladenosine. In some embodiments, Ni is:wherein % represents the point of attachment to G*.

[0237] In some embodiments, N2is U or an analog thereof. In some embodiments, N2is a modifiedU. In some embodiments, N2is 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5- hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5- oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1- carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 1-ethyl- pseudouridine, 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5- carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5- taurinomethyl-uridine (Tm5U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine(Tm5s2U), 1- taurinomethyl-4-thio-pseudouridine), 5-methyl-2-thio-uridine (m5s2U), l-methyl-4-thio-pseudouridine (m1s4ψ), 4-thio-l-methyl-pseudouridine, 3-methyl-pseudouridine (m3ψ ), 2-thio-l-methyl-pseudouridine, 1-methyl-l-deaza- pseudouridine, 2-thio-l-methyl-l-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6- dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy- uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, Nl-methyl- pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), l-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3i ), 5-(isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a- thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (ipm), 2-thio- 2'-O-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O- methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl- uridine (m3Um), 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2'-F- ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, 5-[3-(l-E-propenylamino)uridine, or any other modified uridine known in the art.

[0238] In some embodiments, N2is of formula (II):or a salt thereof, wherein: each = is independently a single or double bond, as allowed by valency;Y1is 0 or S;Y2is N, C, or CH;Y3is N, NRal, CRal, or CHRal;Y4is NRa2or CHRa2; each of Ralor Ra2is independently hydrogen or Ci-6 aliphatic;R4is -OH or -OMe; and# represents the point of attachment to p of Nip.

[0239] In some embodiments, Y1is 0. In some embodiments, Y1is S.

[0240] In some embodiments, Y2is N. In some embodiments, Y2is C or CH. In some embodiments,Y2is C. In some embodiments, Y2is CH.

[0241] In some embodiments, Y3is N or CRal. In some embodiments, Y3is N. In some embodiments,Y3is CRal. In some embodiments, Y3is CH or C(CH3). . In some embodiments, Y3is CH. In some embodiments, Y3is C(CH3). In some embodiments, Y3is NRalor CHRal. In some embodiments, Y3is NH or N(CH3). In some embodiments, Y3is NH, In some embodiments, Y3is N(CHs). In some embodiments, Y3is CH2or CH(CH3). In some embodiments, Y3is CH2. In some embodiments, Y3is CH(CH3).

[0242] In some embodiments, Y4is NRa2. In some embodiments, Y4is NH or NCH3. In some embodiments, Y4is NH. In some embodiments, Y4is NCH3. In some embodiments, Y4is CHRa2. In some embodiments, Y4is CH2or CH(CH3). In some embodiments, Y4is CH2. In some embodiments, Y4is CH(CH3).

[0243] In some embodiments, Ralis hydrogen. In some embodiments, Ralis C1-6 aliphatic. In some embodiments, Ralis methyl, ethyl, n-propyl, or isopropyl. In some embodiments, Ralis methyl.

[0244] In some embodiments, Ra2is hydrogen. In some embodiments, Ra2is C1-6 aliphatic. In some embodiments, Ra2is methyl, ethyl, n-propyl, or isopropyl. In some embodiments, Ra2is methyl.

[0245] In some embodiments, R4is -OH. In some embodiments, R4is -OMe.

[0246] In some embodiments, N2is of formula (Ila):or a salt thereof, wherein each of Y1, Y3, R4, and # is as defined above and described herein.

[0247] In some embodiments, N2is of formula (lib) :or a salt thereof, wherein each of Y1, Y3, R4, and # is as defined above and described herein.

[0248] In some embodiments, N2is uridine, 1-methylpsuedouridine, 2-thio-uridine, or 5-methyluridine.

[0249] In some embodiments N2 is:or a salt thereof, wherein # represents the point of attachment to p of Nip.

[0250] In some embodiments N2is:or a salt thereof, wherein # represents the point of attachment to p of Nip.

[0251] In some embodiments, p is -P(=O)(OH)-, or a salt thereof.

[0252] In some embodiments, a 5' cap is (m7-2'0)Gppp(m2' °)AipU2, (m7'3' °)Gppp(m2' °)AipU2, (m7-2'-°)Gppp(m2' °)Aip4J2, (m7'3'0)Gppp(m2' °)Aip4J2, (m7'2' °)Gppp(m2' °)Aip(m1)4J2, (m7'3' °)Gppp(m2' °)Aip(m1)4J2, (m7'2' °)Gppp(m2' °)AipS2U2, (m7'3' °)Gppp(m2' °)AipS2U2, (m7'2' °)Gppp(m2' °)Aip(m5)U2, or (m7'3' °)Gppp(m2'_°)Aip(m5)U2.

[0253] In some embodiments, a 5' cap is (m7'2' °)Gppp(m5'2' °)AipU2, (m7'3' °)Gppp(m5'2' °)AipU2, (m7'2'0)Gppp(m5'2' °)A1pψ 2, (m7'3'0)Gppp(m5'2' °)Aip4J2, (m7'2' °)Gppp(m5'2' °)Aip(m1)4J2, (m7'3' °)Gppp(m5'2'_°)Aip(m1)ψ 2, (m7'2' °)Gppp(m5'2' °)AipS2U2, (m7'3' °)Gppp(m5'2' °)AipS2U2, (m7'2' °)Gppp(m5'2' °)Aip(m5)U2, or (m7'3' °)Gppp(m5'2' °)Aip(m5)U2.

[0254] In some embodiments a 5' cap is (m7'2' °)Gppp(m2' °)AipU2 having a structure: or a salt thereof.

[0255] In some embodiments, a 5' cap is (m7'3' °)Gppp(m2' °)AipU2,or a salt thereof.

[0256] In some embodiments, a 5' cap is (m7-3'0)Gppp(m2'°)Aip4J2,or a salt thereof.

[0257] In some embodiments, a 5' cap is (m7-2'0)Gppp(m2'°)Aip4J2,or a salt thereof.

[0258] In some embodiments, a 5' cap is (m7'2'0)Gppp(m2'0)Aip(m1)ψ2,or a salt thereof.

[0259] In some embodiments, a 5' cap is (m7'3'0)Gppp(m2'0)Aip(m1)ψ2,or a salt thereof.

[0260] In some embodiments, a 5' cap is (m7'3'°)Gppp(m2'°)AipS2U2,or a salt thereof.

[0261] In some embodiments, a 5' cap is (m7'2'°)Gppp(m2'°)AipS2U2,or a salt thereof.

[0262] In some embodiments, a 5' cap is (m7'3' °)Gppp(m2' °)Aip(m5)U2,or a salt thereof.

[0263] In some embodiments, a 5' cap is (m7'2' °)Gppp(m2' °)Aip(m5)U2, or a salt thereof.

[0264] In some embodiments, it will be appreciated that the disclosure of 5' caps above and herein encompasses 5' caps themselves or as part of a larger molecule (e.g., an RNA). For example, the structures drawn above encompass a 3' ether linkage to the next nucleotide or as a free -OH.

[0265] In some embodiments, it will be appreciated that any of the structures above may exist in a salt form. For example, each of the phosphate groups may be deprotonated, e.g., -0P(=0)(0 )-, and be associated with an appropriate counterion.3. Cap Proximal Sequences

[0266] In some embodiments, a 5' UTR utilized in accordance with the present disclosure comprises a cap proximal sequence, e.g., as disclosed herein. In some embodiments, a cap proximal sequence comprises a sequence adjacent to a 5' cap. In some embodiments, a cap proximal sequence comprises nucleotides in positions +1, +2, +3, +4, and / or +5 of an RNA polynucleotide.

[0267] In some embodiments, a cap structure comprises one or more polynucleotides of a cap proximal sequence. In some embodiments, a cap structure comprises an m7Guanosine cap and nucleotide +1 (N i) of an RNA polynucleotide. In some embodiments, a cap structure comprises an m7Guanosine cap and nucleotide +2 (N2) of an RNA polynucleotide. In some embodiments, a cap structure comprises an m7Guanosine cap and nucleotides +1 and +2 (Ni and N2) of an RNA polynucleotide. In some embodiments, a cap structure comprises an m7Guanosine cap and nucleotides +1, +2, and +3 (Ni, N2, and N3) of an RNA polynucleotide.

[0268] Those skilled in the art, reading the present disclosure, will appreciate that, in some embodiments, one or more residues of a cap proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) may be included in an RNA by virtue of having been included in a cap entity (e.g., a capl or cap2 structure, etc); alternatively, in some embodiments, at least some of the residues in a cap proximal sequence may be enzymatically added (e.g., by a polymerase such as a T7 polymerase). For example, in certain exemplified embodiments where a m27'3' °Gppp(mi2' °)ApG cap is utilized, +1 (i.e., Ni) and +2 (i.e., N2) are the (mi2' °)A and G residues of the cap, and +3, +4, and +5 are added by polymerase (e.g., T7 polymerase).

[0269] In some embodiments, a 5' cap is a dinucleotide cap structure, wherein the cap proximal sequence comprises Ni of the 5' cap, where Ni is any nucleotide, e.g., A, C, G or U. In some embodiments, a 5' cap is a trinucleotide cap structure (e.g., the trinucleotide cap structures described above and herein), wherein the cap proximal sequence comprises Ni and N2 of the 5' cap, wherein Ni and N2 are independently any nucleotide, e.g., k, C, G or U. In some embodiments, a 5' cap is a tetranucleotide cap structure (e.g., the trinucleotide cap structures described above and herein), wherein the cap proximal sequence comprises Ni, N2, and N3 of the 5' cap, wherein Ni, N2, and N3 are any nucleotide, e.g., A, C, G or U.

[0270] In some embodiments, e.g., where a 5' cap is a dinucleotide cap structure, a cap proximal sequence comprises Ni of a the 5' cap, and N2, N3, N4 and N5, wherein Ni to Ns correspond to positions +1, +2, +3, +4, and / or +5 of an RNA polynucleotide. In some embodiments, e.g., where a 5' cap is a trinucleotide cap structure, a cap proximal sequence comprises Ni and N2 of a the 5' cap, and N3, N4 and Ns, wherein Ni to Ns correspond to positions +1, +2, +3, +4, and / or +5 of an RNA polynucleotide. In some embodiments, e.g., where a 5' cap is a tetranucleotide cap structure, a cap proximal sequence comprises Ni, N2, and N3 of a the 5' cap, and N4and Ns, wherein Ni to Ns correspond to positions +1, +2, +3, +4, and / or +5 of an RNA polynucleotide.

[0271] In some embodiments, Ni is A. In some embodiments, Ni is C. In some embodiments, Ni isG. In some embodiments, Ni is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U. In some embodiments, N3 is A. In some embodiments, N3 is C. In some embodiments, N3 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N4 is C. In some embodiments, N4 is G. In some embodiments, N4 is U. In some embodiments, N5is A. In some embodiments, N5 is C. In some embodiments, Ns is G. In some embodiments, N5is U. It will be understood that, each of the embodiments described above and herein (e.g., for Ni through N5) may be taken singly or in combination and / or may be combined with other embodiments of variables described above and herein (e.g., 5' caps).4. 5' UTR

[0272] In some embodiments, a nucleic acid (e.g., DNA, RNA) utilized in accordance with the present disclosure comprises a 5'-UTR. In some embodiments, a 5'-UTR may comprise a plurality of distinct sequence elements; in some embodiments, such plurality may be or comprise multiple copies of one or more particularsequence elements (e.g., as may be from a particular source or otherwise known as a functional or characteristic sequence element). In some embodiments, a 5' UTR comprises multiple different sequence elements.

[0273] The term "untranslated region" or "UTR" is commonly used in the art to refer to a region in aDNA molecule which is transcribed but is not translated into an amino acid sequence, or to the corresponding region in an RNA polynucleotide, such as an mRNA molecule. An untranslated region (UTR) can be present 5' (upstream) of an open reading frame (5'-UTR) and / or 3' (downstream) of an open reading frame (3'-UTR). As used herein, the terms "five prime untranslated region" or "5' UTR" refer to a sequence of a polyribonucleotide between the 5' end of the polyribonucleotide (e.g., a transcription start site) and a start codon of a coding region of the polyribonucleotide. In some embodiments, "5' UTR" refers to a sequence of a polyribonucleotide that begins at the 5' end of the polyribonucleotide (e.g., a transcription start site) and ends one nucleotide (nt) before a start codon (usually AUG) of a coding region of the polyribonucleotide, e.g., in its natural context. In some embodiments, a 5' UTR comprises a Kozak sequence. A 5'-UTR is downstream of the 5'-cap (if present), e.g., directly adjacent to the 5'-cap. In some embodiments, a 5' UTR disclosed herein comprises a cap proximal sequence, e.g., as defined and described herein. In some embodiments, a cap proximal sequence comprises a sequence adjacent to a 5' cap.

[0274] Exemplary 5' UTRs include a human alpha globin (hAg) 5'UTR or a fragment thereof, a TEV 5'UTR or a fragment thereof, a HSP70 5' UTR or a fragment thereof, or a c-Jun 5' UTR or a fragment thereof.

[0275] In some embodiments, an RNA disclosed herein comprises a hAg 5' UTR or a fragment thereof.

[0276] In some embodiments, an RNA disclosed herein comprises a 5' UTR having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to a 5' UTR with the sequence according to SEQ ID NO: 155 (AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC). In some embodiments, an RNA disclosed herein comprises a 5' UTR provided in SEQ ID NO: 155.

[0277] In some embodiments, an RNA disclosed herein comprises a 5' UTR having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to a 5' UTR with the sequence AACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC (SEQ ID NO: 272)(hAg-Kozak / 5'UTR). In some embodiments, an RNA disclosed herein comprises a 5' UTR provided in SEQ ID NO: 272.5. PolyA Tail

[0278] In some embodiments, a polynucleotide (e.g., DNA, RNA) disclosed herein comprises a polyadenylate (polyA) sequence, e.g., as described herein. In some embodiments, a polyA sequence is situated downstream of a 3'-UTR, e.g., adjacent to a 3'-UTR.

[0279] As used herein, the term "poly(A) sequence" or "poly-A tail" refers to an uninterrupted or interrupted sequence of adenylate residues which is typically located at the 3'-end of an RNA polynucleotide. Poly(A) sequences are known to those of skill in the art and may follow the 3'-UTR in the RNAs described herein. An uninterrupted poly(A) sequence is characterized by consecutive adenylate residues. In nature, an uninterrupted poly(A) sequence is typical. In some embodiments, polynucleotides disclosed herein comprise an uninterrupted Poly(A) sequence. In some embodiments, polynucleotides disclosed herein comprise interrupted Poly(A) sequence. In some embodiments, RNAs disclosed herein can have a poly(A) sequence attached to the free 3'-end of the RNA by a template-independent RNA polymerase after transcription or a poly(A) sequence encoded by DNA and transcribed by a template-dependent RNA polymerase.

[0280] It has been demonstrated that a poly(A) sequence of about 120 A nucleotides has a beneficial influence on the levels of RNA in transfected eukaryotic cells, as well as on the levels of protein that is translated from an open reading frame that is present upstream (S') of the poly(A) sequence (Holtkamp et al., 2006, Blood, vol. 108, pp. 4009-4017, which is herein incorporated by reference).

[0281] In some embodiments, a poly(A) sequence in accordance with the present disclosure is not limited to a particular length; in some embodiments, a poly(A) sequence is any length. In some embodiments, a poly(A) sequence comprises, essentially consists of, or consists of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 A nucleotides, and, in particular, about 120 A nucleotides. In this context, "essentially consists of" means that most nucleotides in the poly(A) sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% by number of nucleotides in the poly(A) sequence are A nucleotides, but permits that remaining nucleotides are nucleotides other than A nucleotides, such as U nucleotides (uridylate), G nucleotides (guanylate), or C nucleotides (cytidylate). In this context, "consists of" means that all nucleotides in the poly(A) sequence, i.e., 100% by number of nucleotides in the poly(A) sequence, are A nucleotides. The term "A nucleotide" or "A" refers to adenylate.

[0282] In some embodiments, a poly(A) sequence is attached during RNA transcription, e.g., during preparation of in vitro transcribed RNA, based on a DNA template comprising repeated dT nucleotides (deoxythymidylate) in the strand complementary to the coding strand. The DNA sequence encoding a poly(A) sequence (coding strand) is referred to as a poly(A) cassette.

[0283] In some embodiments, a poly(A) cassette present in a coding strand of DNA essentially consists of dA nucleotides, but is interrupted by a random sequence of the four nucleotides (dA, dC, dG, and dT). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length. Such a cassette is disclosed in WO 2016 / 005324 Al, hereby incorporated by reference. Any poly(A) cassette disclosed in WO 2016 / 005324 Al may be used in accordance with the present disclosure. A poly(A) cassette that essentially consists of dA nucleotides, but is interrupted by a random sequence having an equal distribution of the four nucleotides (dA, dC, dG, dT) and having a length of e.g., 5 to 50 nucleotides shows, on a DNA level, constant propagation of plasmid DNA in £ co / / and is still associated, on an RNA level, with the beneficial properties with respect to supporting RNA stability and translational efficiency is encompassed. In some embodiments, a poly(A) sequence contained in an RNA polynucleotide described herein essentially consists of A nucleotides, but is interrupted by a random sequence of the four nucleotides (A, C, G, U). Such random sequence may be 5 to 50, 10 to 30, or 10 to 20 nucleotides in length.

[0284] In some embodiments, no nucleotides other than A nucleotides flank a poly(A) sequence at its3'-end, i.e., the poly(A) sequence is not masked or followed at its 3'-end by a nucleotide other than A.

[0285] In some embodiments, a poly(A) sequence may comprise at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, a poly(A) sequence may essentially consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, a poly(A) sequence may consist of at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, a poly(A) sequence comprises at least 100 nucleotides. In some embodiments, the poly(A) sequence comprises about 150 nucleotides. In some embodiments, a poly(A) sequence comprises about 120 nucleotides.

[0286] In some embodiments, a poly A tail comprises a specific number of adenosines, such as about50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 120, or about 150 or about 200. In some embodiments a poly A tail of a string construct may comprise 200 A residues or less. In some embodiments, a poly A tail of a string construct may comprise about 200 A residues. In some embodiments, a poly A tail of a string construct may comprise 180 A residues or less. In some embodiments, a poly A tail of a string construct may comprise about 180 A residues. In some embodiments, a poly A tail may comprise 150 residues or less.

[0287] In some embodiments, a poly(A) tail comprises a plurality of A residues interrupted by a linker.In some embodiments, a linker comprises the nucleotide sequence GCATATGAC (SEQ ID NO: 156).

[0288] In some embodiments, a polyribonucleotide of the present disclosure comprises a poly(A) sequence comprising the nucleotide sequence of SEQ ID NO: 268, or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the nucleotide sequence of SEQ ID NO: 268.6. 3' UTR

[0289] In some embodiments, a polyribonucleotide utilized in accordance with the present disclosure comprises a 3'-UTR. As used herein, the terms "three prime untranslated region," "3' untranslated region," or "3' UTR" refer to a sequence of an mRNA molecule that begins following a stop codon of a coding region of an open reading frame sequence. In some embodiments, a 3' UTR begins immediately after a stop codon of a coding region of an open reading frame sequence, e.g., in its natural context. In other embodiments, a 3' UTR does not begin immediately after the stop codon of the coding region of an open reading frame sequence, e.g., in its natural context. The term "3'-UTR" preferably does not include the poly(A) sequence. Thus, a 3'-UTR is upstream of the poly(A) sequence (if present), e.g., directly adjacent to the poly(A) sequence.

[0290] In some embodiments, an RNA disclosed herein comprises a 3' UTR comprising an F element and / or an I element. In some embodiments, a 3' UTR or a proximal sequence thereto comprises a restriction site. In some embodiments, a restriction site is a BamHI site. In some embodiments, a restriction site is a Xhol site.

[0291] In some embodiments, an RNA construct comprises an F element. In some embodiments, a F element sequence is a 3'-UTR of amino-terminal enhancer of split (AES).

[0292] In some embodiments, an RNA disclosed herein comprises a 3' UTR.

[0293] In some embodiments, a 3'UTR is an FI element as described in W02017 / 060314, which is herein incorporated by reference in its entirety.7. Multimerization Elements

[0294] In some embodiments, an mpox antigen utilized as described herein includes a multimerization element (e.g., a heterologous multimerization element). In some embodiments, a heterologous multimerization element comprises a dimerization, trimerization or tetramerization element.

[0295] In some embodiments, a multimerization element is one described in W02017 / 081082 (e.g., sequences of SEQ ID NOs: 1116-1167 of W02017 / 081082, or fragments or variants thereof).

[0296] Exemplary trimerization and tetramerization elements include, but are not limited to, engineered leucine zippers, fibritin foldon domain from enterobacteria phage T4, GCN4pll, GCN4-pll, and p53.

[0297] In various embodiments, an antigen construct of the present disclosure includes, and / or a polyribonucleotide of the present disclosure encodes, an antigen operably linked with a multimerization element such as a foldon domain. In various embodiments an antigen construct of the present disclosure includes,and / or a polyribonucleotide of the present disclosure encodes, an antigen operably linked with a foldon domain according to SEQ ID NO: 256 and / or encoded by a sequence according to SEQ ID NO: 257.

[0298] In some embodiments, a provided antigen is able to form a trimeric complex. For example, a utilized antigen may comprise a domain allowing formation of a multimeric complex, such as for example a trimeric complex of an amino acid sequence comprising an orthopoxvirus (e.g., mpox) antigen as described herein. In some embodiments, a domain allowing formation of a multimeric complex comprises a trimerization domain, for example, a trimerization domain as described herein.

[0299] In some embodiments, an orthopoxvirus (e.g., mpox) antigen can be modified by addition of aT4-fibritin-derived "foldon" trimerization domain, for example, to increase its immunogenicity.8. Membrane Association Elements

[0300] In some embodiments, an orthopoxvirus (e.g., mpox) antigen as described herein includes a membrane association element (e.g., a heterologous membrane association element), such as a transmembrane domain.

[0301] A transmembrane domain can be N-terminal, C-terminal, or internal to an antigen. A coding sequence of a transmembrane element is typically placed in frame (i.e., in the same reading frame), 5', 3', or internal to coding sequences (e.g., mpox antigen coding sequences) with which it is to be linked.

[0302] In some embodiments, a transmembrane domain comprises or is a transmembrane domain ofHemagglutinin (HA) of Influenza virus, Env of HIV-1, equine infectious anaemia virus (EIAV), murine leukaemia virus (MLV), mouse mammary tumor virus, G protein of vesicular stomatitis virus (VSV), Rabies virus, or a seven transmembrane domain receptor.

[0303] In some embodiments, an antigen construct of the present disclosure includes, and / or a polyribonucleotide of the present disclosure encodes, an antigen operably linked with a transmembrane domain. In various embodiments an antigen construct of the present disclosure includes, and / or a polyribonucleotide of the present disclosure encodes, an antigen operably linked with a HSV-1 gD transmembrane domain (TM) domain according to SEQ ID NO: 254 and / or encoded by a sequence according to SEQ ID NO: 255.B. RNA Formats

[0304] At least three distinct formats useful for RNA compositions (e.g., pharmaceutical compositions) have been developed, namely non-modified uridine containing mRNA (uRNA), nucleoside-modified mRNA (modRNA), and self-amplifying mRNA (saRNA). Each of these platforms displays unique features. In general, in all three formats, RNA is capped, contains open reading frames (ORFs) flanked by untranslated regions (UTR), and have a polyA-tail at the 3' end. An ORF of an uRNA and modRNA vector encodes an antigen or fragment thereof. An saRNA has multiple ORFs.

[0305] In some embodiments, an RNA described herein may have modified nucleosides. In some embodiments, the RNA comprises a modified nucleoside in place of at least one (e.g., every) uridine.

[0306] The term "uracil," as used herein, describes one of the nucleobases that can occur in the nucleic acid of RNA. The structure of uracil is:

[0307] The term "uridine," as used herein, describes one of the nucleosides that can occur in RNA.The structure of uridine is:

[0308] UTP (uridine 5'-triphosphate) has the following structure:

[0309] Pseudo-UTP (pseudouridine 5'-triphosphate) has the following structure:

[0310] "Pseudouridine" is one example of a modified nucleoside that is an isomer of uridine, where the uracil is attached to the pentose ring via a carbon-carbon bond instead of a nitrogen-carbon glycosidic bond.

[0311] Another exemplary modified nucleoside is Nl-methyl-pseudouridine (mlQJ), which has the structure:

[0312] Nl-methyl-pseudo-UTP has the following structure:

[0313] Another exemplary modified nucleoside is 5-methyl-uridine (m5U), which has the structure:

[0314] In some embodiments, one or more uridine in an RNA described herein is replaced by a modified nucleoside. In some embodiments, the modified nucleoside is a modified uridine.

[0315] In some embodiments, an RNA described herein comprises a modified nucleoside in place of at least one uridine. In some embodiments, an RNA described herein comprises a modified nucleoside in place of each uridine.

[0316] In some embodiments, a modified nucleoside is independently selected from pseudouridine(ip), Nl-methyl-pseudouridine (mlip), and 5-methyl-uridine (m5U). In some embodiments, a modified nucleoside comprises pseudouridine (ip). In some embodiments, a modified nucleoside comprises Nl-methyl-pseudouridine (mlip). In some embodiments, a modified nucleoside comprises 5-methyl-uridine (m5U). In some embodiments, RNA may comprise more than one type of modified nucleoside, and the modified nucleosides are independently selected from pseudouridine (ip), Nl-methyl-pseudouridine (mlip), and 5-methyl-uridine (m5U). In some embodiments, modified nucleosides comprise pseudouridine (ip) and Nl-methyl-pseudouridine (mlip). In some embodiments, modified nucleosides comprise pseudouridine (ip) and 5-methyl-uridine (m5U). In some embodiments, modified nucleosides comprise Nl-methyl-pseudouridine (mlip) and 5-methyl-uridine (m5U). In some embodiments, modified nucleosides comprise pseudouridine (ip), Nl-methyl-pseudouridine (mlip), and 5- methyl-uridine (m5U).

[0317] In some embodiments, a modified nucleoside replacing one or more, e.g., all, uridine in theRNA may be any one or more of 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), 5-aza-uridine, 6-aza- uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio- pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo- uridine), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl- uridine (cm5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5- carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5- methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5- methylaminomethyl-uridine (mnm5U), 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5- propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine (Tm5U), 1-taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine(Tm5s2U), l-taurinomethyl-4-thio-pseudouridine), 5-methyl-2-thio-uridine (m5s2U), l-methyl-4-thio-pseudouridine (mls4ψ ), 4-thio-l-methyl-pseudouridine, 3-methyl-pseudouridine (m3ψ ), 2-thio- 1-methyl-pseudouridine, 1-methyl-l-deaza-pseudouridine, 2-thio-l-methyl-l-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2- thio-pseudouridine, Nl-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), l-methyl-3-(3- amino-3-carboxypropyl)pseudouridine (acp3 ψ ), 5-(isopentenylaminomethyl)uridine (inm5U), 5- (isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyl- uridine (m5Um), 2'-O-methyl-pseudouridine (ψ m), 2-thio-2'-O-methyl-uridine (s2Um), 5- methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5- carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um), 5- (isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F- uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, 5-[3-(l-E-propenylamino)uridine, or any other modified uridine known in the art.

[0318] In some embodiments, an RNA of the present disclosure comprises other modified nucleosides or comprises further modified nucleosides, e.g., modified cytidine. For example, in some embodiments, in an RNA of the present disclosure 5-methylcytidine is substituted partially or completely, preferably completely, for cytidine. In some embodiments, an RNA of the present disclosure comprises 5-methylcytidine and one or more selected from pseudouridine (ψ ), Nl-methyl-pseudouridine (m1ψ ), and 5-methyl-uridine (m5U). In some embodiments, an RNA of the present disclosure comprises 5-methylcytidine and Nl-methyl-pseudouridine (mlip). In some embodiments, an RNA of the present disclosure comprises 5-methylcytidine in place of each cytidine and Nl-methyl-pseudouridine (m1ψ ) in place of each uridine.

[0319] In some embodiments of the present disclosure, an RNA is "replicon RNA" or simply a"replicon," in particular "self-replicating RNA" or "self-amplifying RNA." In one particularly preferred embodiment, the replicon or self-replicating RNA is derived from or comprises elements derived from a single- stranded (ss) RNA virus, in particular a positive-stranded ssRNA virus, such as an alphavirus. Alphaviruses are typical representatives of positive-stranded RNA viruses. Alphaviruses replicate in the cytoplasm of infected cells (for a review of the alphaviral life cycle see Jose et al., Future Microbiol., 2009, vol. 4, pp. 837-856, which is incorporated herein by reference in its entirety). The total genome length of many alphaviruses typically ranges between 11,000 and 12,000 nucleotides, and the genomic RNA typically has a 5'-cap, and a 3' poly(A) tail. The genome of alphaviruses encodes non-structural proteins (involved in transcription, modification and replication of viral RNA and in protein modification) and structural proteins (forming the virus particle). There are typically two open reading frames (ORFs) in the genome. The four non-structural proteins (nsPl-nsP4) are typically encoded together by a first ORF beginning near the 5' terminus of the genome, while alphavirus structural proteins are encoded together by a second ORF which is found downstream of the first ORF and extends near the 3' terminus of the genome. Typically, the first ORF is larger than the second ORF, the ratio being roughly 2: 1. In cells infected by an alphavirus, only the nucleic acid sequence encoding non-structural proteins is translated from the genomic RNA, while the genetic information encoding structural proteins is translatable from a subgenomic transcript, which is an RNA molecule that resembles eukaryotic messenger RNA (mRNA; Gould et al., 2010, Antiviral Res., vol. 87 pp. 111-124, herein incorporated by reference in its entirety). Following infection, i.e., atearly stages of the viral life cycle, the (+) stranded genomic RNA directly acts like a messenger RNA for the translation of the open reading frame encoding the non-structural poly-protein (nsP1234).

[0320] Alphavirus-derived vectors have been proposed for delivery of foreign genetic information into target cells or target organisms. In simple approaches, a first ORF encodes an alphavirus-derived RNA- dependent RNA polymerase (replicase), which upon translation mediates self-amplification of the RNA. A second ORF encoding alphaviral structural proteins is replaced by an open reading frame encoding a protein of interest, e.g., an antigen or fragment thereof. Alphavirus-based trans-replication systems rely on alphavirus nucleotide sequence elements on two separate nucleic acid molecules: one nucleic acid molecule encodes a viral replicase, and the other nucleic acid molecule is capable of being replicated by said replicase in trans (hence the designation trans-replication system). Trans-replication requires the presence of both these nucleic acid molecules in a given host cell. The nucleic acid molecule capable of being replicated by the replicase in trans must comprise certain alphaviral sequence elements to allow for recognition and RNA synthesis by the alphaviral replicase.

[0321] Features of a non-modified uridine platform may include, for example, one or more of an intrinsic adjuvant effect, good tolerability, and improved safety. Features of modified uridine (e.g., pseudouridine) platform may include a reduced adjuvant effect, blunted immune innate immune sensor activating capacity, good tolerability and improved safety. Features of a self-amplifying platform may include, for example, long duration of protein expression, good tolerability and safety, and a higher likelihood for efficacy with a very low vaccine dose.

[0322] The present disclosure provides particular RNA constructs optimized, for example, for improved manufacturability, encapsulation, expression level (and / or timing), etc. Certain components are discussed below, and certain preferred embodiments are exemplified herein.C. Codon Optimization and GC Enrichment

[0323] As used herein, the term "codon-optimized" refers to alteration of codons in a coding region of a nucleic acid molecule (e.g., a polyribonucleotide) to reflect the typical codon usage of a host organism (e.g., a subject receiving a nucleic acid molecule (e.g., a polyribonucleotide)) without preferably altering the amino acid sequence encoded by the nucleic acid molecule. Within the context of the present disclosure, in some embodiments, coding regions are codon-optimized for optimal expression in a subject to be treated using the RNA molecules described herein. In some embodiments, codon-optimization may be performed such that codons for which frequently occurring tRNAs are available are inserted in place of "rare codons." In some embodiments, codon-optimization may include increasing guanosine / cytosine (G / C) content of a coding region of RNA described herein as compared to the G / C content of the corresponding coding sequence of a wild-type RNA, wherein the amino acid sequence encoded by the RNA is preferably not modified compared to the amino acid sequence.

[0324] In some embodiments, a coding sequence (also referred to as a "coding region") is codon optimized for expression in the subject to whom a composition (e.g., a pharmaceutical composition) is to be administered (e.g., a human). Thus, in some embodiments, sequences in such a polynucleotide (e.g., a polyribonucleotide) may differ from wild type sequences encoding the relevant antigen or fragment or epitope thereof, even when the amino acid sequence of the antigen or fragment or epitope thereof is wild type.

[0325] In some embodiments, a coding sequence is codon optimized for expression in a relevant subject (e.g., a human), and even, in some cases, for expression in a particular cell or tissue.

[0326] Various species exhibit particular bias for certain codons of a particular amino acid. Without wishing to be bound by any one theory, codon bias (differences in codon usage between organisms) oftencorrelates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell may generally be a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes may be tailored for optimal gene expression in a given organism based on codon optimization. Codon usage tables are available, for example, at the "Codon Usage Database" available at www.kazusa.orjp / codon / and these tables may be adapted in a number of ways. Computer algorithms for codon optimizing a particular sequence for expression in a particular subject or its cells are also available, such as Gene Forge (Aptagen; Jacobus, PA), are also available.

[0327] In some embodiments, a polynucleotide (e.g., a polyribonucleotide) of the present disclosure is codon optimized, wherein the codons in the polynucleotide (e.g., the polyribonucleotide) are adapted to human codon usage (herein referred to as "human codon optimized polynucleotide"). Codons encoding the same amino acid occur at different frequencies in a subject, e.g., a human. Accordingly, in some embodiments, the coding sequence of a polynucleotide of the present disclosure is modified such that the frequency of the codons encoding the same amino acid corresponds to the naturally occurring frequency of that codon according to the human codon usage, e.g., as shown in Table 3. For example, in the case of the amino acid Ala, the wild type coding sequence is preferably adapted in a way that the codon "GCC" is used with a frequency of 0.40, the codon "GCT" is used with a frequency of 0.28, the codon "GCA" is used with a frequency of 0.22 and the codon "GCG" is used with 30 a frequency of 0.10 etc. (see Table 3). Accordingly, in some embodiments, such a procedure (as exemplified for Ala) is applied for each amino acid encoded by the coding sequence of a polynucleotide to obtain sequences adapted to human codon usage.Table 3: Human codon usage table with frequencies indicated for each amino acid.

[0328] Certain strategies for codon optimization and / or G / C enrichment for human expression are described in W02002 / 098443, which is incorporated by reference herein in its entirety. In some embodiments, a coding sequence may be optimized using a multiparametric optimization strategy. In some embodiments, optimization parameters may include parameters that influence protein expression, which can be, for example, impacted on a transcription level, an mRNA level, and / or a translational level. In some embodiments, exemplary optimization parameters include, but are not limited to transcription-level parameters (including, e.g., GC content, consensus splice sites, cryptic splice sites, SD sequences, TATA boxes, termination signals, artificial recombination sites, and combinations thereof); mRNA-level parameters (including, e.g., RNA instability motifs, ribosomal entry sites, repetitive sequences, and combinations thereof); translation-level parameters (including, e.g., codon usage, premature poly(A) sites, ribosomal entry sites, secondary structures, and combinations thereof); or combinations thereof. In some embodiments, a coding sequence may be optimized by a GeneOptimizer algorithm as described in Fath et al. "Multiparameter RNA and Codon Optimization: A Standardized Tool to Assess and Enhance Autologous Mammalian Gene Expression" PLoS ONE^ySy. el7596; Rabb et al., "The GeneOptimizer Algorithm: using a sliding window approach to cope with the vast sequence space in multiparameter DNA sequence optimization" Systems and Synthetic Biology (2010) 4:215-225; and Graft et al. "Codon-optimized genes that enable increased heterologous expression in mammalian cells and elicit efficient immune responses in mice after vaccination of naked DNA" Methods Moi Med (2004) 94: 197-210, the entire content of each of which is incorporated herein for the purposes described herein. In some embodiments, a coding sequence may be optimized by Eurofins' adaption and optimization algorithm "GENEius" as described in Eurofins' Application Notes: Eurofins' adaption and optimization software "GENEius" in comparison to other optimization algorithms, the entire content of which is incorporated by reference for the purposes described herein.

[0329] In some embodiments, a coding sequence utilized in accordance with the present disclosure has G / C content of which increased compared to a wild type coding sequence.

[0330] Without wishing to be bound by any particular theory, it is proposed that GC enrichment may improve translation of a payload sequence. Typically, sequences having an increased G (guanosine) / C (cytidine) content are more stable than sequences having an increased A (adenosine) / U (uridine) content. In respect to the fact that several codons code for one and the same amino acid (so-called degeneration of the genetic code), the most favorable codons for the stability can be determined (so-called alternative codon usage). Depending on the amino acid to be encoded by a polyribonucleotide, there are various possibilities for modification of the ribonucleic acid sequence, compared to its wild-type sequence. In particular, codons which contain A and / or U nucleosides can be modified by substituting these codons by other codons, which code for the same amino acids but contain no A and / or U or contain a lower content of A and / or U nucleosides.

[0331] In some embodiments, G / C content of a coding region of a polyribonucleotide described herein is increased by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, or even more compared to the G / C content of the coding region prior to codon optimization, e.g., of the wild-type RNA. In some embodiments, G / C content of a coding region of a polyribonucleotide described herein is decreased by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, or even more compared to the G / C content of the coding region prior to codon optimization, e.g., of the wild-type RNA.

[0332] In some embodiments, stability and translation efficiency of a polyribonucleotide may incorporate one or more elements established to contribute to stability and / or translation efficiency of the polyribonucleotide; exemplary such elements are described, for example, in PCT / EP2006 / 009448 incorporated herein by reference. In some embodiments, to increase expression of a polyribonucleotide used according to the present disclosure, a polyribonucleotide may be modified within the coding region, i.e., the sequence encoding the expressed peptide or protein, without altering the sequence of the expressed peptide or protein, for example so as to increase the GC-content to increase mRNA stability and / or to perform a codon optimization and, thus, enhance translation in cells.D. Exemplary Polyribonucleotide Sequences

[0333] The present disclosure includes certain exemplary antigen constructs and polyribonucleotides useful, e.g., in vaccination against orthopoxvirus (e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) virus) and / or treatment of orthopoxvirus infection, that encode and / or express one or more mpox antigens. In some embodiments, a polyribonucleotide, as described herein has one of the following structures: cap-hAg-Kozak-Antigen-FI-A30L70 cap-hAg-Kozak-sec-Antigen-FI-A30L70 where cap refers to a 5' cap as described above; hAg-Kozak refers to a 5' UTR human alpha-globin; sec refers to a secretory signal; Antigen refers to a nucleotide sequence comprising a sequence that encodes an mpox antigen described herein; FI refers to a 3'-UTR as described above, and A30L70 refers to a polyA sequence. In some embodiments, hAg 5' UTR comprises a nucleotide sequence of SEQ ID NO: 155. In some embodiments, A30L70 comprises 30 adenine nucleotides followed by 70 adenine nucleotides, wherein the 30 adenine nucleotides and 70 adenine nucleotides are separated by a linker sequence.1. Exemplary B Cell Antigen Polyribonucleotide Sequences

[0334] The present disclosure includes certain exemplary antigen constructs and polyribonucleotides useful, e.g., in vaccination against orthopox virus (e.g., mpox, variola, borealpox, ectromelia, cowpox, volepox, buffalopox, camelpox, rabbitpox, or vaccinia (e.g., modified vaccinia virus Ankara, etc.) virus), that encode and / or express one or more antigens according to Table 1 or antigenic fragments thereof. In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-type antigen sequence. In some embodiments, a polyribonucleotide of the present disclosure encodes an orthopoxvirus antigen comprising an amino acid sequence at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to an orthopoxvirus antigen amino acid sequence in Table 1. In some embodiments, a polyribonucleotide of the present disclosure encodes an antigen polypeptide operably linked to an N-terminal viral secretory signal. Without wishing to be bound by any particular theory, inclusion of a viral secretory signal can be useful, e.g., because mpox antigens do not naturally include conventional secretory signals and / or because inclusion of the viral secretory signal may allow for enhanced surface expression of the operably linked antigen on vaccinated cells.

[0335] Exemplary antigens of the present disclosure (e.g., H3L, and B6R or fragments thereof) can further include substitution of unpaired cysteine residues present in corresponding reference sequences. Without wishing to be bound by any particular scientific theory, the present disclosure includes that such cysteines, if left unpaired, carry a high risk of causing protein misfolding and / or aggregation and that this risk is mitigated byalanine substitutions. Exemplary substitutions can include positions C71A and / or C72A of A29L, C140A of B6R, and / or C86A and / or C90A of H3L.

[0336] For the avoidance of doubt, the present disclosure includes exemplary polypeptide sequences and polyribonucleic acid sequences as described herein and / or as set forth in sequence identification numbers of the present disclosure, as well as sequences having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity thereto.

[0337] In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-type MIR polypeptide. In some embodiments, a wild-type MIR polypeptide has or includes a sequence according to SEQ ID NO: 158 and / or the polyribonucleotide has or includes a sequence according to SEQ ID NO: 159. In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-type MIR polypeptide operably linked with a secretory signal such as an HSV / gD secretory signal (HSV / gDsec) according to SEQ ID NO: 160, optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, a wild-type MIR polypeptide operably linked with an HSV / gD secretory signal has or includes a sequence according to SEQ ID NO: 162 and / or the encoding polyribonucleotide has or includes a sequence according to SEQ ID NO: 162.

[0338] In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-type MIR polypeptide. In some embodiments, a wild-type MIR polypeptide has or includes a sequence according to SEQ ID NO: 258 and / or the polyribonucleotide encoding the wild-type MIR polypeptide has or includes a sequence according to SEQ ID NO: 259. In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-type MIR polypeptide operably linked with a secretory signal such as an HSV / gD secretory signal (HSV / gDsec) according to SEQ ID NO: 160, optionally encoded by a sequence according to SEQ ID NO: 161.

[0339] In some embodiments, a polyribonucleotide of the present disclosure encodes a soluble form of the ectodomain of A35R. Without wishing to be bound by any particular scientific theory, a soluble form of the ectodomain of A35R would function independently of membrane insertion, reducing the potential need or requirement for membrane insertion of an A35R antigen or fragment thereof. The A35R ectodomain disclosed herein can have or include a sequence according to SEQ ID NO: 174. The boundaries of the ectodomain were informed by two X-ray crystallography studies defining the structure of this region of the protein. The present inventors selected amino acids 89-181 for use in this design at least in part because the selected amino acids span the resolved region of the protein elucidated by these studies. A35R forms a dimer that is partially dependent on a disulfide bond between residues not included in this ectodomain. To compensate for the absence of this disulfide, the present inventors engineered a construct that includes two copies of the ectodomain sufficient to form the dimer with a linker between them. Without wishing to be limited or bound by any particular scientific theory, linker size (10 amino acids) was selected based on the measured distance between the C-terminus of one ectodomain and the N-terminus of its binding partner in the crystal structure of the ectodomain, while those of skill in the art will appreciate that the linker could be larger or smaller, and any linker disclosed herein could be used.

[0340] In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-typeA35R polypeptide. In some embodiments, a wild-type A35R polypeptide has or includes a sequence according to SEQ ID NO: 172 and / or the polyribonucleotide encoding said A35R polypeptide has or includes a sequence according to SEQ ID NO: 173. In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-type A35R ectodomain (ECD) fragment that has or includes a sequence according to SEQ ID NO: 174 and / or the encoding polyribonucleotide has or includes a sequence according to SEQ ID NO: 175. In someembodiments, a polyribonucleotide of the present disclosure encodes a first wild-type A35R ECD fragment and a second wild-type A35R ECD fragment, where the first wild-type A35R ECD fragment has or includes a sequence according to SEQ ID NO: 174 and / or is encoded by a sequence according to SEQ ID NO: 175 and the second wild-type A35R ECD fragment has or includes a sequence according to SEQ ID NO: 174 and / or is encoded by a sequence according to SEQ ID NO: 175, optionally wherein the first wild-type A35R fragment and the second wild-type A35R fragment are operably linked via linker (e.g., a linker according to SEQ ID NO: 176 and / or encoded by SEQ ID NO: 177). In some embodiments, a polyribonucleotide of the present disclosure encodes a first wild-type A35R fragment and a second wild-type A35R fragment, where the first wild-type A35R fragment and the second wild-type A35R fragment are operably linked by a linker, and where the first and second wildtype A35R fragments are operably linked with a secretory signal such as an HSV / gD secretory signal (HSV / gDsec) according to SEQ ID NO: 160, optionally encoded by a sequence according to SEQ ID NO: 161. In certain such embodiments, a polypeptide encoded by a polyribonucleotide has or includes a sequence according to SEQ ID NO: 178 and / or the encoding polyribonucleotide has or includes a sequence according to SEQ ID NO: 179.

[0341] In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-type B6R polypeptide. In some embodiments, a wild-type B6R polypeptide has or includes a sequence according to SEQ ID NO: 180 and / or the polyribonucleotide encoding said B6R polypeptide has or includes a sequence according to SEQ ID NO: 181. In some embodiments, a polyribonucleotide of the present disclosure encodes an B6R polypeptide that includes a substitution of C to A at position 140 corresponding to SEQ ID NO: 182 (substitution C140A as compared to a corresponding reference sequence). In some embodiments, a B6R polypeptide including a C140A substitution has or includes a sequence according to SEQ ID NO: 182 and / or the encoding polyribonucleotide has or includes a sequence according to SEQ ID NO: 183.

[0342] In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-type H3L polypeptide. In some embodiments, a wild-type H3L polypeptide has or includes a sequence according to SEQ ID NO: 184 and / or the polyribonucleotide encoding said H3L polypeptide has or includes a sequence according to SEQ ID NO: 185. In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-type H3L polypeptide operably linked with a secretory signal such as an HSV / gD secretory signal (HSV / gDsec) according to SEQ ID NO: 160, optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, a wild-type H3L polypeptide operably linked with an HSV / gD secretory signal has or includes a sequence according to SEQ ID NO: 186 and / or the encoding polyribonucleotide has or includes a sequence according to SEQ ID NO: 187.

[0343] In some embodiments, a polyribonucleotide of the present disclosure encodes an H3L polypeptide that includes a substitution of C to A at positions 86 and 90 corresponding to SEQ ID NO: 188 (substitutions C86A and C90A as compared to a corresponding reference sequence). In some embodiments, an H3L polypeptide including C86A and C90A substitutions has or includes a sequence according to SEQ ID NO: 188 and / or the polyribonucleotide encoding said H3L polypeptide has or includes a sequence according to SEQ ID NO: 189. In some embodiments, a polyribonucleotide of the present disclosure encodes an H3L polypeptide including C86A and C90A substitutions operably linked with a secretory signal such as an HSV / gD secretory signal (HSV / gDsec) according to SEQ ID NO: 160, optionally encoded by a sequence according to SEQ ID NO: 161. In some embodiments, an H3L polypeptide including C86A and C90A substitutions operably linked with an HSV / gD secretory signal sequence has or includes a sequence according to SEQ ID NO: 190 and / or the encoding polyribonucleotide has or includes a sequence according to SEQ ID NO: 191.

[0344] In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-type H3L polypeptide. In some embodiments, a wild-type H3L polypeptide has or includes a sequence according to SEQ ID NO: 260 and / or the polyribonucleotide encoding said H3L polypeptide has or includes a sequence according to SEQ ID NO: 261. In some embodiments, a polyribonucleotide of the present disclosure encodes a wild-type H3L polypeptide operably linked with a secretory signal such as an HSV / gD secretory sequence (HSV / gDsec) according to SEQ ID NO: 160, optionally encoded by a sequence according to SEQ ID NO: 161.

[0345] In some embodiments, a polyribonucleotide of the present disclosure encodes an H3L polypeptide that includes a substitution of C to A at positions 86 and 90 corresponding to SEQ ID NO: 262 (substitutions C86A and C90A as compared to a corresponding reference sequence). In some embodiments, an H3L polypeptide including C86A and C90A substitutions has or includes a sequence according to SEQ ID NO: 262 and / or the polyribonucleotide encoding said H3L polypeptide has or includes a sequence according to SEQ ID NO: 263. In some embodiments, a polyribonucleotide of the present disclosure encodes an H3L polypeptide including C86A and C90A substitutions operably linked with a secretory signal such as an HSV / gD secretory sequence (HSV / gDsec) according to SEQ ID NO: 160, optionally encoded by a sequence according to SEQ ID NO: 161.III. RNA Delivery Technologies

[0346] Provided polyribonucleotides may be delivered for therapeutic applications described herein using any appropriate methods known in the art, including, e.g., delivery as naked polyribonucleotides (e.g., RNAs), or delivery mediated by viral and / or non-viral vectors, polymer-based vectors, lipid-based vectors, nanoparticles (e.g., lipid nanoparticles, polymeric nanoparticles, lipid-polymer hybrid nanoparticles, etc.), and / or peptide-based vectors. See, e.g., Wadhwa et al. "Opportunities and Challenges in the Delivery of mRNA-Based Vaccines" Pharmaceutics (2020) 102 (27 pages), the content of which is incorporated herein by reference, for information on various approaches that may be useful for delivery of polyribonucleotides described herein.

[0347] In some embodiments, one or more polyribonucleotides can be formulated with lipid nanoparticles for delivery (e.g., administration).

[0348] In some embodiments, lipid nanoparticles can be designed to protect polyribonucleotides from extracellular RNases and / or engineered for systemic delivery of the RNA to target cells (e.g., liver cells). In some embodiments, such lipid nanoparticles may be particularly useful to deliver polyribonucleotides when polyribonucleotides are intravenously or intramuscularly administered to a subject.A. Lipid Compositions1. Lipids and Lipid-Like Materials

[0349] The terms "lipid" and "lipid-like material" are broadly defined herein as molecules which comprise one or more hydrophobic moieties or groups and optionally also one or more hydrophilic moieties or groups. Molecules comprising hydrophobic moieties and hydrophilic moieties are also frequently denoted as amphiphiles. Lipids are usually poorly soluble in water. In an aqueous environment, the amphiphilic nature allows the molecules to self-assemble into organized structures and different phases. One of those phases consists of lipid bilayers, as they are present in vesicles, multilamellar / unilamellar liposomes, or membranes in an aqueous environment. Hydrophobicity can be conferred by the inclusion of a polar groups that include, but are not limited to, long-chain saturated and unsaturated aliphatic hydrocarbon groups and such groups substituted by one or more aromatic, cycloaliphatic, or heterocyclic group(s). The hydrophilic groups may comprise polar and / or charged groups and include carbohydrates, phosphate, carboxylic, sulfate, amino, sulfhydryl, nitro, hydroxyl, and other like groups.

[0350] Often, an amphiphilic compound has a polar head attached to a long hydrophobic tail. In some embodiments, the polar portion is soluble in water, while the non-polar portion is insoluble in water. In addition, the polar portion may have either a formal positive charge, or a formal negative charge. Alternatively, the polar portion may have both a formal positive and a negative charge, and be a zwitterion or inner salt. For purposes of the disclosure, the amphiphilic compound can be, but is not limited to, one or a plurality of natural or non-natural lipids and lipid-like compounds.

[0351] A "lipid-like material" is a substance that is structurally and / or functionally related to a lipid but may not be considered a lipid in a strict sense. For example, the term includes compounds that are able to form amphiphilic layers as they are present in vesicles, multilamellar / unilamellar liposomes, or membranes in an aqueous environment and includes surfactants, or synthesized compounds with both hydrophilic and hydrophobic moieties. Generally speaking, the term refers to molecules, which comprise hydrophilic and hydrophobic moieties with different structural organization, which may or may not be similar to that of lipids.

[0352] Specific examples of amphiphilic compounds that may be included in an amphiphilic layer include, but are not limited to, phospholipids, aminolipids and sphingolipids.

[0353] Generally, lipids may be divided into eight categories: fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, polyketides (derived from condensation of ketoacyl subunits), sterols and prenol lipids (derived from condensation of isoprene subunits). Although the term "lipid" is sometimes used as a synonym for fats, fats are a subgroup of lipids called triglycerides. Lipids also encompass molecules such as fatty acids and their derivatives (including tri-, di-, monoglycerides, and phospholipids), as well as sterol- containing metabolites such as cholesterol.

[0354] Fatty acids are a diverse group of molecules made of a hydrocarbon chain that terminates with a carboxylic acid group; this arrangement confers the molecule with a polar, hydrophilic end, and a nonpolar, hydrophobic end that is insoluble in water. The carbon chain, typically between four and 24 carbons long, may be saturated or unsaturated, and may be attached to functional groups containing oxygen, halogens, nitrogen, and sulfur. If a fatty acid contains a double bond, there is the possibility of either a cis or trans geometric isomerism, which significantly affects the molecule's configuration. Cis-double bonds cause the fatty acid chain to bend, an effect that is compounded with more double bonds in the chain. Other major lipid classes in the fatty acid category are the fatty esters and fatty amides.

[0355] Glycerolipids are composed of mono-, di-, and tri-substituted glycerols, the best-known being the fatty acid triesters of glycerol, called triglycerides. The word "triacylglycerol" is sometimes used synonymously with "triglyceride". In these compounds, the three hydroxyl groups of glycerol are each esterified, typically by different fatty acids. Additional subclasses of glycerolipids are represented by glycosylglycerols, which are characterized by the presence of one or more sugar residues attached to glycerol via a glycosidic linkage.

[0356] Glycerophospholipids are amphipathic molecules (containing both hydrophobic and hydrophilic regions) that contain a glycerol core linked to two fatty acid-derived "tails" by ester linkages and to one "head" group by a phosphate ester linkage. Examples of glycerophospholipids, usually referred to as phospholipids (though sphingomyelins are also classified as phospholipids) are phosphatidylcholine (also known as PC, GPCho or lecithin), phosphatidylethanolamine (PE or GPEtn) and phosphatidylserine (PS or GPSer).

[0357] Sphingolipids are members of a complex family of compounds that share a common structural feature, a sphingoid base backbone. The major sphingoid base in mammals is commonly referred to as sphingosine. Ceramides (N-acyl-sphingoid bases) are a major subclass of sphingoid base derivatives with an amide-linked fatty acid. The fatty acids are typically saturated or mono-unsaturated with chain lengths from 16 to 26 carbon atoms.The major phosphosphingolipids of mammals are sphingomyelins (ceramide phosphocholines), whereas insects contain mainly ceramide phosphoethanolamines and fungi have phytoceramide phosphoinositols and mannosecontaining headgroups. The glycosphingolipids are a diverse family of molecules composed of one or more sugar residues linked via a glycosidic bond to the sphingoid base. Examples of these are the simple and complex glycosphingolipids such as cerebrosides and gangliosides.

[0358] Sterols, such as cholesterol and its derivatives, or tocopherol and its derivatives, are important components of membrane lipids, along with the glycerophospholipids and sphingomyelins.

[0359] Saccharolipids are compounds in which fatty acids are linked directly to a sugar backbone, forming structures that are compatible with membrane bilayers. In the saccharolipids, a monosaccharide substitutes for the glycerol backbone present in glycerolipids and glycerophospholipids. The most familiar saccharolipids are the acylated glucosamine precursors of the Lipid A component of the lipopolysaccharides in Gram-negative bacteria. Typical lipid A molecules are disaccharides of glucosamine, which are derivatized with as many as seven fatty-acyl chains. The minimal lipopolysaccharide required for growth in E. coli is Kdo2-Lipid A, a hexa-acylated disaccharide of glucosamine that is glycosylated with two 3-deoxy-D-manno-octulosonic acid (Kdo) residues.

[0360] Polyketides are synthesized by polymerization of acetyl and propionyl subunits by classic enzymes as well as iterative and multimodular enzymes that share mechanistic features with the fatty acid synthases. They comprise a large number of secondary metabolites and natural products from animal, plant, bacterial, fungal and marine sources, and have great structural diversity. Many polyketides are cyclic molecules whose backbones are often further modified by glycosylation, methylation, hydroxylation, oxidation, or other processes.

[0361] Lipids and lipid-like materials may be cationic, anionic or neutral. Neutral lipids or lipid-like materials exist in an uncharged or neutral zwitterionic form at a selected pH.

[0362] In some embodiments, suitable lipids or lipid-like materials for use in the present disclosure include those described in W02020 / 128031 and US20200163878, the entire contents of each of which are incorporated herein by reference for the purposes described herein.2. Cationic or cationically ionizable lipids or lipid-like materials

[0363] In some embodiments cationic or cationically ionizable lipids or lipid-like materials contemplated for use herein include any cationic or cationically ionizable lipids or lipid-like materials which are able to electrostatically bind nucleic acid. In one embodiment, cationic or cationically ionizable lipids or lipid-like materials contemplated for use herein can be associated with nucleic acid, e.g., by forming complexes with the nucleic acid or forming vesicles in which the nucleic acid is enclosed or encapsulated.

[0364] Cationic lipids or lipid-like materials are characterized in that they have a net positive charge(e.g., at a relevant pH). Cationic lipids or lipid-like materials bind negatively charged nucleic acid by electrostatic interaction. Generally, cationic lipids possess a lipophilic moiety, such as a sterol, an acyl chain, a diacyl or more acyl chains, and the head group of the lipid typically carries the positive charge.

[0365] In certain embodiments, a cationic lipid or lipid-like material has a net positive charge only at certain pH, in particular acidic pH, while it has preferably no net positive charge, preferably has no charge, i.e., it is neutral, at a different, preferably higher pH such as physiological pH. This ionizable behavior is thought to enhance efficacy through helping with endosomal escape and reducing toxicity as compared with particles that remain cationic at physiological pH.

[0366] In some embodiments, a cationic or cationically ionizable lipid or lipid-like material comprises a head group which includes at least one nitrogen atom (N) which is positive charged or capable of being protonated.

[0367] Examples of cationic lipids include, but are not limited to 1,2-dioleoyl-3-trimethylammonium propane (DOTAP); N,N-dimethyl-2,3-dioleyloxypropylamine (DODMA), 1,2-di-O-octadecenyl-3- trimethylammonium propane (DOTMA), 3-(N— (N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), dimethyldioctadecylammonium (DDAB); 1,2-dioleoyl-3-dimethylammonium-propane (DODAP); 1,2-diacyloxy-3- dimethylammonium propanes; 1,2-dialkyloxy-3-dimethylammonium propanes; dioctadecyldimethyl ammonium chloride (DODAC), 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 2,3-di(tetradecoxy)propyl-(2- hydroxyethyl)-dimethylazanium (DMRIE), 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine (DMEPC), 1,2- dimyristoyl-3-trimethylammonium propane (DMTAP), 1,2-dioleyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide (DORIE), and 2,3-dioleoyloxy- N-[2(spermine carboxamide)ethyl]-N,N-dimethyl-l-propanamium trifluoroacetate (DOSPA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N- dimethylaminopropane (DLenDMA), dioctadecylamidoglycyl spermine (DOGS), 3-dimethylamino-2-(cholest-5-en- 3-beta-oxybutan-4-oxy)-l-(cis,cis-9,12-oc-tadecadienoxy)propane (CLinDMA), 2-[5'-(cholest-5-en-3-beta-oxy)-3'- oxapentoxy)-3-dimethyl-l-(cis,cis-9',12'-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4- dioleyloxybenzylamine (DMOBA), 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), 2,3-Dilinoleoyloxy-N,N-dimethylpropylamine (DLinDAP), 1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), 1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP), 2,2-dilinoleyl-4- dimethylaminomethyl-[l,3]-dioxolane (DLin-K-DMA), 2,2-dilinoleyl-4-dimethylaminoethyl-[l,3]-dioxolane (DLin-K- XTC2-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31- tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DMA), N-(2-Hydroxyethyl)-N,N-dimethyl-2,3- bis(tetradecyloxy)-l-propanaminium bromide (DMRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(cis-9- tetradecenyloxy)-l-propanaminium bromide (GAP-DMORIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3- bis(dodecyloxy)-l-propanaminium bromide (GAP-DLRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3- bis(tetradecyloxy)-l-propanaminium bromide (GAP-DMRIE), N-(2-Aminoethyl)-N,N-dimethyl-2,3- bis(tetradecyloxy)-l-propanaminium bromide (PAE-DMRIE), N-(4-carboxybenzyl)-N,N-dimethyl-2,3- bis(oleoyloxy)propan-l-aminium (DOBAQ), 2-({8-[(3P)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-l-amine (Octyl-CLinDMA), 1,2-dimyristoyl-3-dimethylammonium- propane (DMDAP), 1,2-dipalmitoyl-3-dimethylammonium-propane (DPDAP), Nl-[2-((lS)-1-[(3- aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5), 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC), 2,3-bis(dodecyloxy)-N-(2-hydroxyethyl)-N,N- dimethylpropan-l-amonium bromide (DLRIE), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)propan-l- aminium bromide (DMORIE), di((Z)-non-2-en-l-yl) 8,8'-((((2(dimethylamino)ethyl)thio)carbonyl)azanediyl)dioctanoate (ATX), N,N-dimethyl-2,3-bis(dodecyloxy)propan-1- amine (DLDMA), N,N-dimethyl-2,3-bis(tetradecyloxy)propan-l-amine (DMDMA), Di((Z)-non-2-en-l-yl)-9-((4- (dimethylaminobutanoyl)oxy)heptadecanedioate (L319), N-Dodecyl-3-((2-dodecylcarbamoyl-ethyl)-{2-[(2- dodecylcarbamoyl-ethyl)-2-{(2-dodecylcarbamoyl-ethyl)-[2-(2-dodecylcarbamoyl-ethylamino)-ethyl]-amino}- ethylamino)propionamide (lipidoid 98N12-5), l-[2-[bis(2-hydroxydodecyl)amino]ethyl-[2-[4-[2-[bis(2 hydroxydodecyl)amino]ethyl]piperazin-l-yl]ethyl]amino]dodecan-2-ol (lipidoid C12-200), LIPOFECTIN® (commercially available cationic liposomes comprising DOTMA and 1 ,2-dioleoyl-sn-3phosphoethanolamine (DOPE), from GIBCO / BRL, Grand Island, N.Y.); LIPOFECTAMINE® (commercially available cationic liposomes comprising N-(1 -(2,3dioleyloxy)propyl)-N-(2-(sperminecarboxamido)ethyl)-N,N-dimethylammoniumtrifluoroacetate (DOSPA) and (DOPE), from GIBCO / BRL); and TRANSFECTAM® (commercially available cationic lipids comprising dioctadecylamidoglycyl carboxyspermine (DOGS) in ethanol from Promega Corp., Madison, Wis.) or any combination of any of the foregoing. Further suitable cationic lipids for use in the present disclosure include those described in W02020 / 128031 and US20200163878, the entire contents of each of which are incorporated herein by reference for the purposes described herein. Further suitable cationic lipids for use in the present disclosure include those described in W02010 / 053572 (including Cl 2-200 described at paragraph

[0225] ) and W02012 / 170930, both of which are incorporated herein by reference for the purposes described herein. Additional suitable cationic lipids for use in the present disclosure include HGT4003, HGT5000, HGTS001, HGT5001, HGT5002 (see US20150140070A1, which is incorporated herein by reference in its entirety).

[0368] In some embodiments, formulations that are useful for pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) compositions as described herein can comprise at least one cationic lipid. Representative cationic lipids include, but are not limited to, 1 ,2-dilinoleyoxy-3- (dimethylamino)acetoxypropane (DLin-DAC), 1 ,2-dilinoleyoxy-3morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3- dimethylaminopropane (DLinDAP), 1 ,2-dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA), 1 -linoleoyl-2- linoleyloxy-3dimethylaminopropane (DLin-2-DMAP), 1 ,2-dilinoleyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.CI), 1 ,2-dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.CI), 1 ,2-dilinoleyloxy-3-(N- methylpiperazino)propane (DLin-MPZ), 3-(N,Ndilinoleylamino)-l ,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-l ,2-propanediol (DOAP), 1 ,2-dilinoleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), and 2,2- dilinoleyl-4-dimethylaminomethyl-[l ,3]-dioxolane (DLin-K-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l ,3]- dioxolane (DLin-KC2-DMA); dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA); MC3 (US20100324120, which is incorporated herein by reference in its entirety).

[0369] In some embodiments, amino or cationic lipids useful in accordance with the present disclosure have at least one protonatable or deprotonatable group, such that the lipid is positively charged at a pH at or below physiological pH (e.g., pH 7.4), and neutral at a second pH, preferably at or above physiological pH. It will, of course, be understood that the addition or removal of protons as a function of pH is an equilibrium process, and that the reference to a charged or a neutral lipid refers to the nature of the predominant species and does not require that all of lipids have to be present in the charged or neutral form. Lipids having more than one protonatable or deprotonatable group, or which are zwitterionic, are not excluded and may likewise be suitable in the context of the present invention.

[0370] In some embodiments, a protonatable lipid has a pKa of the protonatable group in the range of about 4 to about 11, e.g., a pKa of about 5 to about 7.

[0371] In some embodiments, a cationic lipid may comprise from about 10 mol % to about 100 mol %, about 20 mol % to about 100 mol %, about 30 mol % to about 100 mol %, about 40 mol % to about 100 mol %, or about 50 mol % to about 100 mol % of total lipid present in a lipid composition utilized in accordance with the present disclosure.3. Additional lipids or lipid-like materials

[0372] In some embodiments, formulations utilized in accordance with the present disclosure may comprise lipids or lipid-like materials other than cationic or cationically ionizable lipids or lipid-like materials, i.e., non-cationic lipids or lipid-like materials (including non-cationically ionizable lipids or lipid-like materials). Collectively, anionic and neutral lipids or lipid-like materials are referred to herein as non-cationic lipids or lipid-like materials. In some embodiments, optimizing a formulation of nucleic acid particles by addition of other hydrophobicmoieties, such as cholesterol and lipids, in addition to an ionizable / cationic lipid or lipid-like material may, for example, enhance particle stability and efficacy of nucleic acid delivery.

[0373] In some embodiments, a lipid or lipid-like material may be incorporated which may or may not affect the overall charge of particles. In certain embodiments, such lipid or lipid-like material is a non-cationic lipid or lipid-like material.

[0374] In some embodiments, a non-cationic lipid may comprise, e.g., one or more anionic lipids and / or neutral lipids. An "anionic lipid" is negatively charged (e.g., at a selected pH).

[0375] A "neutral lipid" exists either in an uncharged or neutral zwitterionic form (e.g., at a selected pH). In some embodiments, a formulation comprises one of the following neutral lipid components: (1) a phospholipid, (2) cholesterol or a derivative thereof; or (3) a mixture of a phospholipid and cholesterol or a derivative thereof. Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'- hydroxybutyl ether, tocopherol and derivatives thereof, and mixtures thereof.

[0376] Specific exemplary phospholipids that can be used include, but are not limited to, phosphatidylcholines, phosphatidylethanolamines, phosphatidylglycerols, phosphatidic acids, phosphatidylserines or sphingomyelin. Such phospholipids include in particular diacylphosphatidylcholines, such as distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), dipentadecanoylphosphatidylcholine, dilauroylphosphatidylcholine, dipalmitoylphosphatidylcholine (DPPC), diarachidoylphosphatidylcholine (DAPC), dibehenoylphosphatidylcholine (DBPC), ditricosanoylphosphatidylcholine (DTPC), dilignoceroylphatidylcholine (DLPC), palmitoyloleoyl-phosphatidylcholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), l-oleoyl-2- cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), l-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC) and phosphatidylethanolamines, in particular diacylphosphatidylethanolamines, such as dioleoylphosphatidylethanolamine (DOPE), distearoyl-phosphatidylethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoyl-phosphatidylethanolamine (DMPE), dilauroylphosphatidylethanolamine (DLPE), diphytanoyl-phosphatidylethanolamine (DPyPE), and further phosphatidylethanolamine lipids with different hydrophobic chains.

[0377] In certain embodiments, a formulation utilized in accordance with the present disclosure includesDSPC or DSPC and cholesterol.

[0378] In certain embodiments, formulations utilized in accordance with the present disclosure include both a cationic lipid and an additional (non-cationic) lipid.

[0379] In some embodiments, formulations herein include a polymer conjugated lipid such as a pegylated lipid. "Pegylated lipids" comprise both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art.

[0380] Without wishing to be bound by theory, the amount of (total) cationic lipid compared to the amount of other lipid(s) in formulation may affect important characteristics, such as charge, particle size, stability, tissue selectivity, and bioactivity of the nucleic acid. In some embodiments, the molar ratio of the at least one cationic lipid to the at least one additional lipid is from about 10:0 to about 1:9, about 4: 1 to about 1:2, or about 3: 1 to about 1: 1.

[0381] In some embodiments, a non-cationic lipid, in particular a neutral lipid, (e.g., one or more phospholipids and / or cholesterol) may comprise from about 0 mol % to about 90 mol %, from about 0 mol % toabout 80 mol %, from about 0 mol % to about 70 mol %, from about 0 mol % to about 60 mol %, or from about 0 mol % to about 50 mol %, of the total lipid present in a formulation.4. Lipoplex Particles

[0382] In certain embodiments of the present disclosure, the RNA described herein may be present inRNA lipoplex particles.

[0383] An "RNA lipoplex particle" contains lipid, in particular cationic lipid, and RNA. Electrostatic interactions between positively charged liposomes and negatively charged RNA results in complexation and spontaneous formation of RNA lipoplex particles. Positively charged liposomes may be generally synthesized using a cationic lipid, such as DOTMA, and additional lipids, such as DOPE. In one embodiment, an RNA lipoplex particle is a nanoparticle.

[0384] In certain embodiments, RNA lipoplex particles include both a cationic lipid and an additional lipid. In an exemplary embodiment, the cationic lipid is DOTMA and the additional lipid is DOPE.

[0385] In some embodiments, the molar ratio of the at least one cationic lipid to the at least one additional lipid is from about 10:0 to about 1:9, about 4: 1 to about 1:2, or about 3: 1 to about 1: 1. In specific embodiments, the molar ratio may be about 3: 1, about 2.75: 1, about 2.5: 1, about 2.25: 1, about 2: 1, about 1.75: 1, about 1.5: 1, about 1.25: 1, or about 1: 1. In an exemplary embodiment, the molar ratio of the at least one cationic lipid to the at least one additional lipid is about 2: 1.

[0386] In some embodiments, RNA lipoplex particles have an average diameter that in one embodiment ranges from about 200 nm to about 1000 nm, from about 200 nm to about 800 nm, from about 250 to about 700 nm, from about 400 to about 600 nm, from about 300 nm to about 500 nm, or from about 350 nm to about 400 nm. In specific embodiments, the RNA lipoplex particles have an average diameter of about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1000 nm. In an embodiment, the RNA lipoplex particles have an average diameter that ranges from about 250 nm to about 700 nm. In another embodiment, the RNA lipoplex particles have an average diameter that ranges from about 300 nm to about 500 nm. In an exemplary embodiment, the RNA lipoplex particles have an average diameter of about 400 nm.

[0387] RNA lipoplex particles and compositions comprising RNA lipoplex particles described herein are useful for delivery of RNA to a target tissue after parenteral administration, in particular after intravenous administration. The RNA lipoplex particles may be prepared using liposomes that may be obtained by injecting a solution of the lipids in ethanol into water or a suitable aqueous phase. In one embodiment, the aqueous phase has an acidic pH. In one embodiment, the aqueous phase comprises acetic acid, e.g., in an amount of about 5 mM. Liposomes may be used for preparing RNA lipoplex particles by mixing the liposomes with RNA. In one embodiment, the liposomes and RNA lipoplex particles comprise at least one cationic lipid and at least one additional lipid. In one embodiment, the at least one cationic lipid comprises 1,2-di-O-octadecenyl-3- trimethylammonium propane (DOTMA) and / or 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP). In one embodiment, the at least one additional lipid comprises 1,2-di-(9Z-octadecenoyl)-sn-glycero-3- phosphoethanolamine (DOPE), cholesterol (Choi) and / or 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC). In one embodiment, the at least one cationic lipid comprises 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA) and the at least one additional lipid comprises 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE). In one embodiment, the liposomes and RNA lipoplex particles comprise 1,2-di-O- octadecenyl-3-trimethylammonium propane (DOTMA) and 1,2-di-(9Z-octadecenoyl)-sn-glycero-3- phosphoethanolamine (DOPE).

[0388] Spleen targeting RNA lipoplex particles are described in WO 2013 / 143683, herein incorporated by reference. It has been found that RNA lipoplex particles having a net negative charge may be used to preferentially target spleen tissue or spleen cells such as antigen-presenting cells, in particular dendritic cells. Accordingly, following administration of the RNA lipoplex particles, RNA accumulation and / or RNA expression in the spleen occurs. Thus, RNA lipoplex particles of the disclosure may be used for expressing RNA in the spleen. In an embodiment, after administration of the RNA lipoplex particles, no or essentially no RNA accumulation and / or RNA expression in the lung and / or liver occurs. In one embodiment, after administration of the RNA lipoplex particles, RNA accumulation and / or RNA expression in antigen presenting cells, such as professional antigen presenting cells in the spleen occurs. Thus, RNA lipoplex particles of the disclosure may be used for expressing RNA in such antigen presenting cells. In one embodiment, the antigen presenting cells are dendritic cells and / or macrophages.5. Lipid Nanoparticles (LNPs)

[0389] In some embodiments, nucleic acid such as RNA described herein is administered in the form of lipid nanoparticles (LNPs). In some embodiments, LNPs may comprise any lipid capable of forming a particle to which the one or more nucleic acid molecules are attached, or in which the one or more nucleic acid molecules are encapsulated.

[0390] In some embodiments, an LNP comprises one or more cationic lipids, and one or more stabilizing lipids. Stabilizing lipids include neutral lipids and pegylated lipids.

[0391] In some embodiments, an LNP comprises a cationic lipid, a neutral lipid, a sterol, a polymer conjugated lipid; and an RNA, encapsulated within or associated with the lipid nanoparticle.

[0392] In some embodiments, a neutral lipid is selected from the group consisting of DSPC, DPPC,DMPC, DOPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE, DSPE, and SM. In some embodiments, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In some embodiments, the neutral lipid is DSPC.

[0393] In some embodiments, a sterol is cholesterol.

[0394] In some embodiments, a polymer conjugated lipid is a pegylated lipid. In some embodiments, a pegylated lipid has the following structure:or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein:R12and R13are each independently a straight or branched, saturated or unsaturated alkyl chain containing from 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds; and w has a mean value ranging from 30 to 60. In some embodiments, R12and R13are each independently straight, saturated alkyl chains containing from 12 to 16 carbon atoms. In some embodiments, w has a mean value ranging from 40 to 55. In some embodiments, the average w is about 45. In some embodiments, R12and R13are each independently a straight, saturated alkyl chain containing about 14 carbon atoms, and w has a mean value of about 45.

[0395] In some embodiments, a pegylated lipid is DMG-PEG 2000, e.g., having the following structure:

[0396] In some embodiments, a cationic lipid component of LNPs has the structure of Formula (III):or a pharmaceutically acceptable salt, tautomer, prodrug or stereoisomer thereof, wherein: one of L1or L2is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O)X-, -S-S-, -C(=O)S-, SC(=O)-, -NRaC(=O)-, -C(=O)NRa- , NRaC(=O)NRa-, -OC(=O)NRa- or -NRaC(=O)O-, and the other of L1or L2is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, - S(O)X-, -S-S-, -C(=O)S-, SC(=O)-, -NRaC(=O)-, -C(=O)NRa-, NRaC(=O)NRa-, -OC(=O)NRa- or -NRaC(=O)O- or a direct bond;G1and G2are each independently unsubstituted C1-C12 alkylene or C1-C12 alkenylene;G3is C1-C24 alkylene, C1-C24 alkenylene, C3-C8 cycloalkylene, C3-C8 cycloalkenylene;Rais H or C1-C12 alkyl;R1and R2are each independently C6-C24 alkyl or C6-C24 alkenyl;R3is H, OR5, CN, -C(=O)OR4, -OC(=O)R4or -NR5C(=O)R4;R4is C1-C12 alkyl;R5is H or C Ce alkyl; and x is 0, 1 or 2.

[0397] In some of the foregoing embodiments of Formula (III), the lipid has one of the following structures (IIIA) or (IIIB): wherein:A is a 3 to 8-membered cycloalkyl or cycloalkylene ring;R5is, at each occurrence, independently H, OH or C1-C24 alkyl; n is an integer ranging from 1 to 15.

[0398] In some of the foregoing embodiments of Formula (III), the lipid has structure (IIIA), and in other embodiments, the lipid has structure (IIIB).

[0399] In other embodiments of Formula (III), the lipid has one of the following structures (IIIC) or(HID):(IIIC) (HID) wherein y and z are each independently integers ranging from 1 to 12.

[0400] In any of the foregoing embodiments of Formula (III), one of L1or L2is -0(C=0)-. For example, in some embodiments each of L1and L2are -0(C=0)-. In some different embodiments of any of the foregoing, L1and L2are each independently -(C=0)0- or -0(C=0)-. For example, in some embodiments each of L1and L2is -(C=0)0-.

[0401] In some different embodiments of Formula (III), the lipid has one of the following structures(HIE) or (IIIF):(HIE) (IIIF)

[0402] In some of the fore...

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A method of preventing or treating an orthopoxvirus infection in a subject comprising administering a composition or combination to the subject, wherein the composition or combination comprises: a therapeutically effective amount of one or more polyribonucleotides encoding one or more mpox virus antigens or antigenic fragments thereof; and a pharmaceutically acceptable carrier.

2. The method of claim 1, wherein the composition or combination comprises at least three polyribonucleotides, and wherein each of the at least three polyribonucleotides encodes a different mpox virus antigen or antigenic fragment thereof.

3. The method of claim 1, wherein the composition or combination comprises three polyribonucleotides, and wherein each of the three polyribonucleotides encodes a different mpox virus antigen or antigenic fragment thereof.

4. The method of claim 2 or 3, wherein: a first polyribonucleotide encodes a B6R antigen, or antigenic fragment thereof; a second polyribonucleotide encodes an MIR antigen, or antigenic fragment thereof; and a third polyribonucleotide encodes an A35R antigen, or antigenic fragment thereof.

5. The method of claim 4, wherein: the B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182; the MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158; and the A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174.

6. The method of any one of claims 1 to 5, wherein the composition or combination comprises at least four polyribonucleotides, and wherein each of the at least four polyribonucleotides encodes a different mpox virus antigen or antigenic fragment thereof.

7. The method of any one of claims 1 to 6, wherein the composition or combination comprises four polyribonucleotides, and wherein each of the four polyribonucleotides encodes a different mpox virus antigen or antigenic fragment thereof.

8. The method of claim 6 or 7, wherein: a first polyribonucleotide encodes a B6R antigen, or antigenic fragment thereof; a second polyribonucleotide encodes an MIR antigen, or antigenic fragment thereof; a third polyribonucleotide encodes an A35R antigen, or antigenic fragment thereof; and a fourth polyribonucleotide encodes an H3L antigen, or antigenic fragment thereof.

9. The method of claim 8, wherein: the B6R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 21-30, 180, and 182;the MIR antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 31-40, and 158; the A35R antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 11-20, 172, and 174; and the H3L antigen comprises an amino acid sequence at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to any one of SEQ ID NOs: 51-60, 184, 188, and 190.

10. The method of any one of claims 1 to 9, wherein the orthopoxvirus infection comprises an mpox infection, a vaccinia infection, an ectromelia infection, a variola infection, a borealpox infection, a cowpox infection, a volepox infection, a buffalopox infection, or a camelpox infection.

11. The method of any one of claims 1 to 10, wherein the orthopoxvirus infection is a clade I mpox infection.

12. The method of claim 11, wherein the orthopoxvirus infection is a clade la or clade lb mpox infection.

13. The method of any one of claims 1 to 10, wherein the orthopoxvirus infection is a clade II mpox infection.

14. The method of claim 13, wherein the orthopoxvirus infection is a clade Ila or clade lib mpox infection.

15. The method of any one of claims 1 to 14, wherein the one or more polyribonucleotides are purified.

16. The method of any one of claims 1 to 15, wherein the one or more polyribonucleotides are single-stranded.

17. The method of any one of claims 1 to 16, wherein the one or more polyribonucleotides comprise a 5'-cappedNl-methylpseudouridine.

18. The method of any one of claims 1 to 17, wherein each of the one or more polyribonucleotides are fully or partially encapsulated within a lipid nanoparticle.

19. The method of claim 18, wherein the lipid nanoparticle targets liver cells.

20. The method of claim 18 or 19, wherein the lipid nanoparticle targets secondary lymphoid organ cells.

21. The method of any one of claims 18 to 20, wherein the lipid nanoparticle is a cationic lipid nanoparticle.

22. The method of any one of claims 18 to 21, wherein the lipid nanoparticle comprises:(a) a polymer-conjugated lipid;(b) a cationic lipid; and(c) one or more neutral lipids.

23. The method of claim 22, wherein the polymer-conjugated lipid comprises a PEG-conjugated lipid.

24. The method of claim 22 or 23, wherein the one or more neutral lipids comprise 1,2-Distearoyl-sn-glycero-3- phosphocholine (DPSC).

25. The method of any one of claims 22 to 24, wherein the one or more neutral lipids comprise cholesterol.

26. The method of any one of claims 22 to 25, wherein the lipid nanoparticle comprises:(a) the polymer-conjugated lipid at about 1-2.5 mol% of the total lipids;(b) the cationic lipid at 35-65 mol% of the total lipids; and(c) the one or more neutral lipids are present in 35-65 mol% of the total lipids.

27. The method of any one of claims 22 to 26, wherein the lipid nanoparticles have an average diameter of about 50-150 nm.

28. The method of any one of claims 1 to 27, comprising administering the composition or combination in one or more doses to the subject.

29. The method of claim 28, wherein the one or more doses comprises about 10 μg, about 30 μg, or about 60 μg of the one or more polyribonucleotides.

30. The method of claim 28 or 29, comprising administering two doses of the composition or combination, wherein a second dose of the composition or combination is administered to the subject about 31 days after a first dose of the composition or combination is administered to the subject.

31. The method of any one of claims 28 to 30, wherein the one or more doses are administered to the subject intramuscularly.

32. The method of any one of claims 28 to 31, wherein administering the composition or combination comprises mixing the one or more polyribonucleotides and wherein each of the one or more doses is administered as a single injection.

33. The method of any one of claims 1 to 32, wherein administering the composition or combination to the subject results in an increased serum level of one or more orthopoxvirus-neutralizing antibody in the subject.

Images