Compositions and methods for treating bone and muscle injuries

An ex vivo hematoma with isolated whole blood, sodium citrate, and calcium chloride, combined with mRNA-based therapies, addresses the limitations of current VML treatments by effectively promoting muscle and bone regeneration through efficient delivery of growth factors, offering a quick and effective solution for VML.

WO2025166131A9PCT designated stage Publication Date: 2026-07-16BOARD OF RGT THE UNIV OF TEXAS SYST +1

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
BOARD OF RGT THE UNIV OF TEXAS SYST
Filing Date
2025-01-31
Publication Date
2026-07-16

AI Technical Summary

Technical Problem

Current treatments for volumetric muscle loss (VML) are limited by donor site availability, morbidity, motor dysfunction, and rehabilitation failures, and existing regenerative medicine strategies face challenges such as immune rejection and poor tissue integration due to the use of xenogeneic materials.

Method used

The use of an ex vivo hematoma composed of isolated whole blood, sodium citrate, and calcium chloride, combined with thrombin and mRNA-based therapeutic compositions, delivered via mineral-coated microparticles, to promote muscle and bone regeneration.

Benefits of technology

This approach enhances muscle and bone healing by mimicking natural healing processes, efficiently delivering growth factors and promoting functional regeneration without side effects, and can be quickly synthesized and stored for off-the-shelf use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025013987_16072026_PF_FP_ABST
    Figure US2025013987_16072026_PF_FP_ABST
Patent Text Reader

Abstract

The disclosure relates to compositions and biomimetic scaffolds and methods of using to treat improve, promote and accelerate the healing of bone regeneration, muscle regeneration, or a combination thereof in a subject. The methods comprise implanting said compositions and biomimetic scaffolds in a subject.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Attorney’s Docket No.: 21105.0097P1

[0002] COMPOSITIONS AND METHODS FOR TREATING BONE AND MUSCLE INJURIES

[0003] CROSS REFERENCE TO RELATED APPLICATIONS

[0004] This application claims the benefit of the filing date of U.S. Provisional Application No. 63 / 548,718, filed on February71, 2024. The content of this earlier filed application is hereby incorporated by reference in its entirety.

[0005] INCORPORATION OF THE SEQUENCE LISTING

[0006] The present application contains a sequence listing that is submitted concurrent with the filing of this application, containing the file name “21105_0097Pl_SL” which is 24,576 bytes in size, created on January 29, 2025. and is herein incorporated by reference in its entirety7pursuant to 37 C.F.R. § 1.52(e)(5).

[0007] BACKGROUND

[0008] Volumetric muscle loss (VML) is currently a challenging clinical problem with limited treatment options. VML typically occurs as a result of high velocity trauma from blast injuries, motor vehicle accidents, muscle resection for cancer treatment, or to treat tissue necrosis. Therapeutic modalities include surgical debridement, bracing, extensive rehabilitation, and free muscle transfer, which is the most effective modality. However, these interventions are severely limited by constraints like donor site availability, morbidity, motor dysfunction, and frequent rehabilitation failures leading to limb loss through amputation. The limitations of current therapies underscore the need for the development of new treatments for VML.

[0009] Despite the intrinsic healing capacity7of skeletal muscle, significant muscle loss strips vital elements like the basal lamina, blood supply, satellite cells, and other progenitor cells from the injury7site, thereby eliminating the muscle's regenerative capacity. Efforts to regenerate muscle defects have focused on scaffolds, cells, protein or gene signals, and various combination approaches. However, regenerative medicine strategies face limited success, primarily due to the use of xenogeneic materials, which pose risks such as immune rejection, infection, and poor tissue integration. Consequently, there is a clear and unmet need to develop more effective treatment strategies for these catastrophic injuries.Attorney’s Docket No.: 21105.0097P1

[0010] SUMMARY

[0011] Disclosed herein are compositions comprising: an ex vivo hematoma, wherein the ex vivo hematoma comprises: (a) isolated whole blood; (b) sodium citrate; and (c) calcium chloride; thrombin; or thrombin and calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition.

[0012] Disclosed herein are multi-compartment devices comprising a first chamber comprising isolated whole blood; a second chamber comprising calcium chloride; thrombin; or thrombin and calcium chloride; and a third chamber comprising a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition.

[0013] Disclosed herein are biomimetic scaffolds comprising a scaffold and an ex vivo hematoma, wherein the ex vivo hematoma comprises: (a) isolated whole blood; (b) sodium citrate; and (c) calcium chloride; thrombin; or thrombin and calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition.

[0014] Disclosed herein are methods of constructing an implant, the methods comprising: a) dimensioning a depot implant in at least one of a shape and a size that facilitates implantation of the depot implant into a bone defect; and b) structuring the depot implant to have a scaffold by introducing: (i) isolated whole blood and sodium citrate; (ii) calcium chloride; thrombin; or thrombin and calcium chloride; and (iii) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition.

[0015] Disclosed herein are methods of constructing a biomimetic scaffold, the methods comprising: a) dimensioning a scaffold in at least one of a shape and a size that facilitates implantation of the scaffold into a bone defect; and b) combining the scaffold in a) with an ex vivo hematoma comprising: (i) isolated whole blood and sodium citrate; (ii) calcium chloride; thrombin; or thrombin and calcium chloride; to create the biomimetic scaffold; c) combining the biomimetic scaffold in b) with a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition.

[0016] Other features and advantages of the present compositions and methods are illustrated in the description below, the drawings, and the claims.Attorney’s Docket No.: 21105.0097P1

[0017] BRIEF DESCRIPTION OF THE DRAWINGS FIGS. 1 A-D show an overview of the healing muscle (FIGS. 1 A. 1C) indicating the location of magnified areas (FIGS. IB, ID). Masson’s Trichrome stained sections (FIGS. 1A, IB) ex vivo hematoma alone; (FIGS. 1C, ID) RSPO2 mRNA LNP + FC MCM + ex vivo hematoma.

[0018] FIG. 2 shows scanning electron microscopy images illustrating the architectural changes of the ex vivo hematoma (e.g., biomimetic hematoma (BH)) with introduced mRNA LNP (BH+LNP) or MCMs (BH+MCM) compared to the ex vivo hematoma alone (BH).

[0019] FIG. 3 provides and ovendew of WNT and R-Spondin signaling. R-Spondins bind LGRs and prevent the ubiquitin ligases ZNRF3 / RNF43 from promoting degradation of the WNT receptor (LRPs). R- Spondin-2 / 3, but not RSPO-1 / 4 contain a domain that inhibits BMP receptors.

[0020] FIG. 4 shows an ovendew of the in vitro methods used in Example 2. Mineral coated microparticles were created with a ratio of 0.5X (Ca2+:PC>43' ) and 5mM citric acid, 1 mM NaF mRNA for Gaussia Luciferase (G.Luc), Bone morphogenetic protein-2 (BMP-2), RSPO-2 and RSPO-1 were created and encapsulated in lipoplexes prior to delivery. RSPOs mRNA + / - BMP-2 mRNA was delivered to human mesenchymal stromal cells (hMSC) for 14 days and assayed by alizarin red staining. C2C12 myoblasts were treated with RSPO-2 mRNA, GLuc mRNA or rWNT3 A and differentiated for two weeks.

[0021] FIG. 5 shows the scanning electron microscopy of PTCP core material (left) and F-Cit MCMs (right). 300 nm scale shown.

[0022] FIG. 6 A shows that Mineral coatings (MCM) improve transfection of G.Luc mRNA compared to uncoated core material or free mRNA complexes alone. FIG. 6B shows RSPO-2 ELISA: RSPO-2 mRNA delivery via MCMs over expresses RSPO-2 mRNA. EDTA was used to dissolve MCMs and release any bound RSPO-2. Significance by ANOVA. **** pO.OOOL

[0023] FIGS. 7A-L show alizarin red staining of hMSCs on d!4 following mRNA treatment + / - MCMs. Top row: mRNA complexes alone, Bottom row: mRNA complexes + MCMs. BMP-2 (FIGS. 7A-B). RSPO-2 (FIGS. 7C-D). RSPO-2 with a mutant TSP-1 domain from RSPO-1 lacking BMP-R binding domain (FIGS. 7E-F). RSPO-2 (TSP-1) mRNA with equalAttorney’s Docket No.: 21105.0097P1

[0024] dose of BMP-2 mRNA (FIGS. 7G-H). RSPO-1 mRNA (FIGS. 71- J). Osteogenic (Os) media (FIGS. 7K-L).

[0025] FIGS. 8A-H show myosin heavy chain staining (MYHC) on d!4 of myogenic differentiation of murine C2C12 cells. Top row: control treatment, bottom row: MCM treatment. FIGS. 8A-B show negative control. FIGS. 8C-D show RSPO-2 mRNA delivery. FIGS. 8E-F show GLuc mRNA delivery'. FIGS. 8G-H show rWNT3A delivery'.

[0026] FIGS. 9A-D gene expression data by RT-qPCR for pro-myogenic factors. FIG. 9A shows myogenin (myog). FIG.9B shows Myf5 (myf5). FIG. 9C shows WNT marker Axin2. FIG. 9D show myostatin.

[0027] FIGS. 10A-E show the in vivo methods and results. FIG. 10A shows a schematic overview of an ex vivo hematoma comprising mRNA. mRNA was encapsulated in SM-102 LNPs and bound to MCMs that were mixed with isolated whole blood and clotting factors. FIG. 10B show rat tibialis anterior (TA) volumetric muscle loss (VML) model. 30% of the TA was excised and an ex vivo hematoma comprising mRNA was implanted for 2 weeks. FIG. 10C shows the ex vivo hematoma implant 2 days after surgery'. FIG. 10D shows 2 weeks post-surgery. Gross inspection of ex vivo hematoma alone (-) or the ex vivo hematoma comprising the mRNA (+RSPO-2+MCM). FIG. 10E shows Masson's tri chrome staining of TA muscles 2 weeks after surgery. Scale: 500 microns.

[0028] FIGS. 11A-D show Alizarin red staining of hMSCs on d21 of differentiation after treatment with mRNA WT-RSPO-2 (FIGS. 11 A-B) or Mut-RSPO-2 (FIGS. 11C-D) without (top row) or with (bottom row) MCM treatment. FIGS. 11E-H show myosin heavy chain (MYHC) and nuclear (DAPI) staining of C2C 12 cells on d7 of differentiation after treatment with FIG. HE shows negative control. FIG. 1 IF shows MCM alone. FIG. 11G shows RSPO2 mRNA alone. FIG. 11H shows RSPO2 mRNA + MCM. FIGS. 1 II- J shows gene expression on d7 of myogenic differentiation from C2C12 cells for myf5 (FIG. Ill) and myostatin (FIG.

[0029] 11J).

[0030] DETAILED DESCRIPTION

[0031] The present disclosure can be understood more readily by reference to the following detailed description of the invention, the figures and the examples included herein.

[0032] Before the present compositions and methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also toAttorney’s Docket No.: 21105.0097P1

[0033] be understood that the terminology' used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, example methods and materials are now described.

[0034] Moreover, it is to be understood that unless otherwise expressly stated, it is in no way intended that any method set forth herein be construed as requiring that its steps be performed in a specific order. Accordingly, where a method claim does not actually recite an order to be followed by its steps or it is not otherwise specifically stated in the claims or descriptions that the steps are to be limited to a specific order, it is in no way intended that an order be inferred, in any respect. This holds for any possible non-express basis for interpretation, including matters of logic with respect to arrangement of steps or operational flow, plain meaning derived from grammatical organization or punctuation, and the number or type of aspects described in the specification.

[0035] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided herein can be different from the actual publication dates, which can require independent confirmation.

[0036] Definitions

[0037] As used in the specification and the appended claims, the singular forms “a,” '‘an’’ and “the” include plural referents unless the context clearly dictates otherwise.

[0038] The word “or” as used herein means any one member of a particular list and also includes any combination of members of that list.

[0039] Throughout the description and claims of this specification, the word “comprise” and variations of the word, such as “comprising” and “comprises,” means “including but not limited to,” and is not intended to exclude, for example, other additives, components, integers or steps. In particular, in methods stated as comprising one or more steps or operations it is specifically contemplated that each step comprises what is listed (unless that step includes a limiting term such as “consisting of’), meaning that each step is not intended to exclude, for example, other additives, components, integers or steps that are not listed in the step.Attorney’s Docket No.: 21105.0097P1

[0040] Ranges can be expressed herein as from “about” or “approximately” one particular value, and / or to “about” or “approximately” another particular value. When such a range is expressed, a further aspect includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” or “approximately,” it will be understood that the particular value forms a further aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. It is also understood that there are a number of values disclosed herein and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that each unit between two particular units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0041] As used herein, the terms “optional” or “optionally” mean that the subsequently described event or circumstance may or may not occur and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0042] As used herein, the term “subject” refers to the target of administration, e g., a human. Thus, the subject of the disclosed methods can be a vertebrate, such as a mammal, a fish, a bird, a reptile, or an amphibian. The term “subject” also includes domesticated animals (e.g., cats, dogs, etc.), livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, fruit fly, etc.). In one aspect, a subject is a mammal. In another aspect, the subject is a human. The term does not denote a particular age or sex. Thus, adult, child, adolescent and newborn subjects, as well as fetuses, whether male or female, are intended to be covered.

[0043] As used herein, the term “patient” refers to a subject afflicted with a disease or disorder or condition. The term "patient" includes human and veterinary subjects. In some aspects of the disclosed methods, the “patient” has been diagnosed with a need for treatment for healing of bone injuries or the healing of muscle injuries, such as, for example, prior to the administering step.

[0044] As used herein, the term “treating” refers to partially or completely alleviating, ameliorating, relieving, delaying onset of, inhibiting or slowing progression of. reducing severity of, and / or reducing incidence of one or more symptoms or features of a particular disease, disorder, and / or condition. Treatment can be administered to a subject who does notAttorney’s Docket No.: 21105.0097P1

[0045] exhibit signs of a disease, disorder, and / or condition and / or to a subject who exhibits only early signs of a disease, disorder, and / or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and / or condition. For example, the disease, disorder, and / or condition can be a bone injury, a bone fracture, muscle loss, or muscle injury.

[0046] As used herein, an effective amount, a therapeutically effective amount, a prophylactically effective amount and a diagnostically effective amount can refer to an amount of RNA or mRNA adsorbed to or incorporated into the mineral layer of the mineral coated microparticle needed to elicit the desired biological response following administration.

[0047] As used herein, “mRNA complexes” refer to complexes of mRNA with a complexing agent such as a lipopolyplex or a lipid nanoparticle complexing agent.

[0048] A “complexing agent”, as used herein, refers to a transfection agent that binds to mRNA and promotes cell transfection efficiency. Complexing agents used herein include, but are not limited to, lipopolyplexes and lipid nanoparticles.

[0049] “Lipopolyplex”, as used herein, refers to a core-shell structure composed of nucleic acid, polycation, and lipid.

[0050] A “microparticle”, as used herein, refers to a particle that has a particle size in the micrometer range (or a particle size between about 0.2 um and about 1000 um).

[0051] As used herein, a “mineral-coated substrate” is a substrate coated with a mineral coating layer containing at least calcium, phosphate, and carbonate.

[0052] “Complex formation” as used herein refers to the complex formation between mRNA and the complexing agent.

[0053] Injuries in various tissues, including muscle, begin with hematoma formation (blood / fibrin clot), a step initiating the healing process and significantly influencing tissue repair. Autologous blood products have proven successful in various orthopedic and soft tissue applications, such as meniscal tears, microfracture in subchondral bone, large bone defects, and pressure ulcers. Significant differences exist in structural properties and gene expression betw een hematomas in normally heating and non-healing bone defects. An ex vivo hematoma, also referred to herein as a “Biomimetic Hematoma” or “BH”, can be designed to mimic the naturally healing fracture hematoma, serving as a carrier to effectively deliver growth factors and mRNA. Preclinical studies in small and large animals, and a clinical study, have demonstrated that the ex vivo hematoma disclosed herein is the onlyAttorney’s Docket No.: 21105.0097P1

[0054] known carrier capable of efficiently delivering much lower doses of rhBMP-2. The ex vivo hematoma can consistently and robustly initiate the natural bone repair cascade, successfully- reconstructing large bone defects without side effects.

[0055] Annually, 65.8 million Americans experience musculoskeletal injuries, with treatment costs exceeding 176 billion dollars (Agency for Healthcare Research and Quality DoHaHS. Medical Expenditures Panel Survey (MEPS) 1996-2011; Agency for Healthcare Research and Quality: Rockville, MD, USA, 2011; Control CfD. National Hospital Discharge Survey (NHDS); Center for Disease Control: Atlanta. GA, USA, 2010; Control CfD. National Hospital Ambulatory Medical Care Survey Emergency Department (NHAMCS_ED); Center for Disease Control: Atlanta, GA, USA, 2010; Control. CfD. National Hospital Ambulatory Medical Care Survey Outpatient Department (NHAMCS_OP); Center for Disease Control: Atlanta, GA, USA. 2010; and Control. CfD. National Ambulatory Medical Care Survey (NAMCS); Center for Disease Control: Atlanta, GA, USA, 2010). Despite therapeutic interventions, patients with VML still face reduced mobility, motor dysfunction, and rehabilitation failures, often resulting in limb amputation (Corona BT, et al. 2015. J Rehabil Res Dev: 52:785-92; Grogan BF, Hsu JR, Skeletal Trauma Research C. 2011 J Am Acad Orthop Surg: 19 Suppl ES35-7; Krueger CA, et al. 2012. J Trauma Acute Care Surg:

[0056] 73:8438-44; and Stinner DJ. 2016. Mil Med: 181:26-9). While not typically life-threatening, these injuries significantly diminish patients' quality of life. Musculoskeletal conditions rank as highly debilitating, representing the second-highest global volume of years lived with disability (Disease GBD, Injury I, Prevalence C. 2017. Lancet: 390:1211-59). The repercussions extend to an estimated additional $326 billion annually in lost productivity (Corso P, et al. 2015. Inj Prev:21:434-40). Between 2003-2007, combat veterans were frequently retired from the battlefield due to orthopedic injuries (Corona BT, et al. 2015. J Rehabil Res Dev: 52:785-92). VML contributed to 65% of total disability and 90% of muscle conditions leading to long-term disability in retired veterans (Corona BT. et al. 2015. J Rehabil Res Dev:52:785-92). The cost of a single veteran disabled with VML was estimated to be $444,000 over their lifetime (Corona BT, et al. 2015. J Rehabil Res Dev:52:785-92).

[0057] While small-scale injuries or strains allow for muscle's inherent regenerative capacity and full functional restoration, this capability diminishes in VML. The absence of native biophysical and biochemical signaling cues impedes regeneration in VML, exacerbated by denervation and the destruction of native vasculature. Owing to the intricate and extensiveAttorney’s Docket No.: 21105.0097P1

[0058] nature of VML injuries, current treatment options are insufficient and have substantial disadvantages (Beattie AJ, et al. 2009. Tissue Eng Part A: 15:1119-25; Lin C-H, et al. 2007. Plast Reconstr Surg: 119:2118-26; Moneim MS, Omer GE. 1986. J Hand Surg Am: 11:135-9; and Reing JE, et al. 2009. Tissue Eng Part A: 15:605-14). The current standard of care and the most effective modality for VML is a muscle flap extracted from an unaffected muscle and transplanted into the injured area (Grogan BF, Hsu JR, 2011. J Am Acad Orthop Surg: 19 Suppl LS35-7; Lin C-H, et al. 2007. Plast Reconstr Surg: 119:2118-26; and Doi K, et al. 2002. Clin Plast Surg: 29:483-95, v-vi). While moderately successful in preserving limbs and partially restoring muscle function, none of the current clinical strategies have fully restored muscle function. To overcome the limitations of current treatments for VML injuries, tissue-engineered and regenerative medicine therapeutic strategies are being developed. These approaches aim to repair and replace damaged muscle using instructive biomaterial scaffolds, biologically active molecules, and cells (Langer R, Vacanti JP. 1993. Science: 260:920-6; and Nakayama KH, et al. 2019. Adv Healthc Mater:8:el801168). The goal of these approaches is to prevent scar tissue formation and promote enhanced functional muscle regeneration.

[0059] However, a notable drawback in these constructs is the absence of nerve supply (innervation). Consequently, there is a pressing need for the exploration and assessment of alternative approaches for VML treatment.

[0060] Injured muscle rapidly experiences local swelling and hematoma formation, contributing to further muscle degeneration (Huard J, et al. 2002. J Bone Joint Surg Am: 84:822-32). Following this, the necrotic area is infiltrated by small blood vessels, mononuclear cells, activated macrophages, and T-lymphocytes. These activated lymphocytes release various cytokines and growth factors, playing diverse roles in the inflammation process (Carnes ME, Pins GD. 2020. Bioengineering (Basel): 7: 85). The secretion of substances like adhesion molecules (e.g., P-selectin. L-selectin, and E-selectin) and cytokines (e.g.. interleukins [IL-8, IL-6, IL-1] and tumor necrosis factor-a [TNF-a]) influences local blood flow, vascular permeability, and accelerates the inflammatory response (Carnes ME, Pins GD. 2020. Bioengineering (Basel):7:85). Additionally, the release of growth factors such as insulin-like growth factor- 1 (IGF-1), hepatocy te growth factor (HGF), transforming growth factors (TGF-a and TGF-[3), and platelet-derived growth factors (PDGF-AA and PDGF-BB) at the injured site regulates myoblast proliferation and differentiation, thereby promoting muscle regeneration and repair. The important sequential events are set in motionAttorney’s Docket No.: 21105.0097P1

[0061] during clot formation, and the resultant hematoma possesses important components to initiate the muscle repair process. Biomaterial scaffolds employed to deliver biologically active molecules or cells lack these components that are present in a naturally formed hematoma. This deficiency may explain why these therapeutic approaches face challenges in achieving successful regeneration of functional muscle and seamless integration with the surrounding native muscle tissue.

[0062] Utilizing an autologous scaffold, the ex vivo hematoma disclosed herein can mimic the properties of a naturally healing muscle hematoma, and enhance the effectiveness of delivered biologically active molecules for the functional regeneration of VML. The ex vivo hematoma closely resembles the structural and biological characteristics of normally healing fracture hematoma and can be used to efficiently deliver growth factors to stimulate bone repair. Preclinical studies in small (Woloszyk A, et al. 2023. Biomater Adv: 148:213366) and large animals, along with a clinical study (Glatt V, Tetsworth K. 2023. J Orthop Trauma: 37: S33-S9), have confirmed that the ex vivo hematoma can be used as a carrier capable of efficiently delivering much lower doses of rhBMP-2 which can augment and accelerate the normal regenerative capacity of bone without side effects.

[0063] Disclosed herein are compositions and methods for healing defects involving muscle, bone, and bone with overlying muscle injury. For example, an ex vivo hematoma can comprise mRNA that can be delivered to the injury site using, for example, lipid nanoparticles with mineral coated microparticles (MCM) to promote regeneration. In some aspects, mRNA for R-spondin-2, Bone Morphogenetic Protein-2, or Bone Morphogenetic protein-2 / -7 can be used. R-spondin-2 is a WNT agonist involved in muscle differentiation, neuromuscular junction formation, and bone mineralization. Bone morphogenetic proteins (BMP) are intrinsically involved in bone formation, mineralization and repair with BMP-2 and BMP-2 / -7 heterodimers among the most potent. As disclosed herein, mRNA and biomimetic and biocompatible mineral coated microparticles were used and combined within a biomimetic hematoma to deliver to a target site (site of injury) to repair large muscle, bone, and / or composite defects. The results demonstrate beneficial improvements in muscle and bone differentiation in vitro. The results described herein also show robust healing of a large rat tibialias anterior muscle defect in vivo and ectopic bone formation in vivo.

[0064] High velocity trauma or blast injuries to musculoskeletal tissues typically result in large defects without capacity to regenerate. Few therapeutic options are available clinicallyAttorney’s Docket No.: 21105.0097P1

[0065] with stabilization of the defect and tissue grafting, the latter which is limited by availability of autologous tissue grafts for large defects. Biological and tissue engineering

[0066] strategies have been extensively researched but few products have been translated clinically with no FDA approved therapies specific to large volumetric muscle loss injuries. Proper healing of tissues requires 1) a signal to orchestrate regeneration; 2) cells to differentiate and construct new tissues; and 3) a scaffold to stabilize the tissue defect and remodel into the desired tissues.

[0067] The disclosed compositions and methods have advantages over existing therapies. For example, the disclosed compositions and methods can be used for treating bone defects, as a recombinant protein therapy, and to deliver bone morphogenetic protein-2 (BMP-2), which can be used to initiate native repair of bone defects. However, extensive side effects related to supraphysiologic dosages and a poor delivery vehicle, an absorbable collagen sponge, have limited adoption clinically. Gene delivery via mRNA administered using the disclosed ex vivo hematoma can improve the potency of BMP-2 since this allows for local translation, native folding and post-translational modifications. Additionally, co-delivery or substitutions of different genes is simple since the packing and delivery mechanisms of mRNA with lipid nanoparticles (LNPs) are universally translatable between mRNA gene sequences.

[0068] Conversely, production of recombinant proteins is more challenging, uses ex vivo mammalian, yeast, or bacterial cells to produce which may introduce impurities, and protein specific manufacturing is needed to ensure proper protein folding. One major challenge with mRNA therapeutics is stability and storage since mRNA LNPs are prone to hydrolysis and degradation. Current mRNA vaccines have to be shipped and stored frozen and used within days of thaw ing to maximize efficacy that limit translation and increase expenses.

[0069] Using mineral coated microparticles (MCMs) can improve the storage and delivery of therapeutic mRNA. MCMs improve the storage of mRNA complexes with freeze-drying and promote long-term room temperature storage of the mRNA complexes up to 6 months.

[0070] Additionally MCMs improve the transfection of mRNA lipid nanoparticles.

[0071] Intrinsic bone healing involves the formation of a hematoma that uses blood cells, migrating cells, and a fibrin scaffold to remodel into native bone. Described herein is the use of mRNA lipid nanoparticles with biocompatible mineral coated microparticles which are combined with or within an ex vivo hematoma to deliver to an injury site to promote and enhance muscle and / or bone healing. These compositions and methods compared to otherAttorney’s Docket No.: 21105.0097P1

[0072] research grade technologies has the advantage of being quick to synthesize, simple and flexible without need for ex vivo expansion of cells or other materials. This technology can also address reconstructive challenges associated with composite musculoskeletal defects. Bone fractures with overlying muscle loss is a challenging clinical scenario and is recalcitrant to healing by' BMP-2. As described herein, a dual mRNA ex vivo hematoma can be used to promote muscle and bone formation with the inhibition of spillover bone formation in the muscle (heterotopic ossification) through native actions of R-spondin-2 mRNA.

[0073] As disclosed herein, mRNA for R-Spondin-2 (RSPO-2), or bone morphogenetic proteins can be used to promote bone and / or muscle regeneration at an injury site. R-spondin-2 is a WNT agonist involved in muscle and bone formation. Another advantage of RSPO-2 is that it is involved in neuromuscular junction formation which is required for proper muscle integration and function in tandem with the nervous system.

[0074] While RSPO-2 promotes muscle differentiation, wild type (WT) RSPO-2 inhibits signaling, and subsequent mineralization induced by BMP -2. Conversely, a mutant RSPO-2 with the TSP-1 domain from RSPO-1 has been shown to promote BMP -2 signaling and improve osteogenesis. Therefore, for composite musculoskeletal defect healing wild type RSPO-2 can be used to regenerate native muscle and prevent heterotopic ossification, while mutant RSPO-2 mRNA can be used in tandem with BMP mRNA to promote bone defect healing, and these effectshave been demonstrated in vitro (see Examples). Furthermore, RSPO-2 mRNA can be used to heal a large muscle defect in a rodent within two weeks. Comparable approaches demonstrate maximal healing by 6-8 weeks with less robust healing than the disclosed compositions and methods. For bone regeneration, BMP heterodimers have been shown to be useful for bone healing with lOx the potency of BMP homodimers, and the data show s that they improve osteogenic differentiation with MCMs. In sum, the use of mRNA and MCMs combined with an ex vivo hematoma can be used for bone and muscle healing, including composite musculoskeletal injuries.

[0075] The compositions and methods disclosed herein can be used for civilian or battlefield treatment of bone and muscle defects. The compositions and methods disclosed herein are simple and can be applied within a single surgical window; wherein blood from the patient, or blood bank, can be harvested. This blood can then be mixed with mRNA lipid nanoparticles with or without mineral coated microparticles, and clotting factors to form a composition comprising mRNA combined with ex vivo hematoma which can be achievedAttorney’s Docket No.: 21105.0097P1

[0076] within 20 minutes, followed by directly implanting the ex vivo hematoma into the defect site. , Using mineral coated microparticles can allow for a freeze-dried mRNA product to be generated permitting an "off-the-shelf mRNA therapy to be manufactured and stored for months prior to operation.

[0077] The compositions disclosed herein can be produced, packaged in a kit and used for muscle and bone regeneration. For example, the compositions disclosed herein takes advantage of the patient's own cells, in the blood, without need for external expansion or complicated manipulation. Other approaches require synthesis of exogenous materials and combination with cells that need to be harvested and expanded for weeks to months prior to therapeutic application. Total combination of the materials for this therapeutic can be created in 20 minutes, within a single surgical window7. Blood can be harvest from the patient directly or from a blood bank and combined with the other materials on demand. The blood is combined with simple, FDA approved materials to form a blood clot (e.g., ex vivo hematoma) that can be made to fit the musculoskeletal defect architecture. mRNA lipid nanoparticles and MCMs can be stored frozen over months. Furthermore, mRNA LNPs with MCMs can be stored at room temperature with MCMs allowing for an ‘off-the-shelf product immediately available for use in the operating room. The compositions and methods disclosed herein can be adapted for other regenerative medicine applications by changing the mRNA sequence without impacting deliver}' characteristics within the blood clot.

[0078] Compositions

[0079] Disclosed herein are compositions comprising: an ex vivo hematoma, wherein the ex vivo hematoma comprises: (a) isolated whole blood; (b) sodium citrate; and (c) ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride; and a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the compositions can further comprise a bone substitute. Also disclosed herein are compositions comprising: an ex vivo hematoma, wherein the ex vivo hematoma comprises: (a) platelet rich plasma, plasma, or plasma with red blood cells; and (b) ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride; and a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the composition can further comprise a bone substitute. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodiumAttorney’s Docket No.: 21105.0097P1

[0080] citrate; and (c) ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) calcium chloride; thrombin; or thrombin and calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) calcium chloride; thrombin; or thrombin and calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) thrombin. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) thrombin; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) thrombin and calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) thrombin and calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) platelet rich plasma, plasma, or plasma with red blood cells; and (b) ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride. In some aspects, the ex vivo hematoma can further comprise sodium citrate. In some aspects, the ex vivo hematomas can comprise fibrin fibers having a thickness of at least 150-300 nm± 10%. In some aspects, the ex vivo hematomas can comprise fibrin fibers having a thickness of 100-400 nm ± 10%.

[0081] In some aspects, the phrase “plasma with red blood cells” means plasma without platelets. In some aspects, the ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride can result in the formation of one or more fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the phrase “plasma with red blood cells” means plasma without platelets. In some aspects, the ecarin; oscutarinAttorney’s Docket No.: 21105.0097P1

[0082] and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride can result in the formation of one or more fibrin fibers having a thickness of 100-400 nm ± 10%.

[0083] The term “ex vivo"’ as used herein refers to a hematoma that can be formed outside of an organism, for example, in an external environment. In some aspects, the ex vivo hematoma can comprise (a) isolated whole blood and sodium citrate; platelet rich plasma, plasma alone, plasma with red blood cells (without platelets) or other blood products; and (b) one or more coagulating factors. In some aspects, the ex vivo hematomas can comprise whole blood and one or more coagulating factors.

[0084] As used herein, the terms “whole blood” and “blood” are used here to mean blood that can be draw n directly from the body from which none of the components, including plasma or platelets, have been removed. In some aspects, the whole blood or blood can be from the subject or patient that will be the receipt of any of the compositions described herein or any of the ex vivo hematomas described herein. In some aspects, the whole blood or blood can be from a donor subject or patient. Whole blood is made up of red blood cells, white blood cells, platelets and plasma. In some aspects, a fibrin gel can be used in place of whole blood.

[0085] One of ordinary skill in the art will appreciate that blood is a specialized body fluid that delivers important substances such as nutrients and oxygen to the cells and transports metabolic waste products away from those same cells. In vertebrates, blood is composed of blood cells suspended in blood plasma. Blood can comprise different components, for example, plasma, red blood cells (ery throcytes), platelets (thrombocytes) and white blood cells (leukocytes). Plasma is the main component, making up about 55%, of blood, consisting of mostly water with ions, proteins, nutrients and wastes. Plasma can contain some of every protein produced by the body. For example, plasma can comprise about 90% water and 10% of a mix of the following: ions (Na+, K+, Mg+2, Ca+2, Cl’, HCOv. HPOy2. SOT2) (Nezafati et al., 2012); proteins (e.g., mainly albumin-55%, globulin, growth factors, enzymes, hormones, antibodies); clotting factors (Factors I-XI1I) (labtestsonline.org.au); sugars (glucose); lipids (cholesterols); minerals (sodium, calcium, magnesium, potassium, iron, zinc, copper, and selenium) (Harrington et al., 2014); waste products; and dissolved gases. Red blood cells (erythrocytes) are responsible for carrying oxygen and carbon dioxide. They are about 7-8 pm in size, contain no mitochondria or nucleus when mature, and have an average life span of 120 days. Women have about 3.6-5.0 million / mm3red blood cells, and men have about 4.2-5.4 million / mm3red blood cells. Platelets (thrombocytes) areAttorney’s Docket No.: 21105.0097P1

[0086] responsible for blood clotting. A normal platelet count ranges from about 150,000 to 450,000 / mm3. White blood cells (WBCs; leukocytes) are part of the immune system and function in immune responses. About 1% of the cells are found in blood. They are larger in size than red blood cells, and contain a normal nucleus and mitochondria. A normal white blood cell count ranges from about 5, 000-10, 000 / mm3. White blood cells can be divided into 5 major types that are further divided into two different groups: Granulocytes: Neutrophils: 60-70% of WBCs or 3, 000-7, 000 / mm3, Eosinophils: 1-3% of WBCs or 50-400 / mm3. and Basophils: 0.3-0.5% of WBCs or 25-200 / mm3; and Agranulocytes: Lymphocytes: 20- 30% of WBCs or 1,000-4, 000 / mm3, and Monocytes: 3-8% of WBCs or 100-600 / mm3.

[0087] As used herein, the term “platelet rich plasma” (also know n as autologous conditioned plasma) refers to a concentrated form of platelet rich plasma protein that is derived from whole blood. For example, whole blood can be centrifuged to remove red blood cells. In some aspects, the term “blood plasma alone”, “plasma alone” or “plasma” can refer to a yellowish liquid component derived from whole blood that normally holds blood cells in whole blood in suspension. For example, blood plasma can be separated from whole blood by centrifuging blood until the blood cells fall to the bottom of the tube, and then the plasma can be drawn off from the top of the tube. In some aspects, the term “plasma with red blood cells” can refer to “plasma alone” with added red blood cells. For example, red blood cells can be derived by centrifuging whole blood until they fall to the bottom of the tube, and are retrieved after removing plasma, white blood cell and platelets from the top of the tube.

[0088] In some aspects, the mRNA-loaded lipid nanoparticles can be combined with a mineral coated microparticle. In some aspects, the mineral coated microparticle comprises a mineral coating layer containing at least calcium, phosphate, and carbonate. In some aspects, the mRNA-loaded lipid nanoparticles bind to the mineral coated microparticle. In some aspects, “microparticle” can refer to a particle that has a particle size in the micrometer range (or a particle size between 0.2 pm and about 100 pm). In some aspects, the mRNA-loaded lipid nanoparticles can be adsorbed to the mineral coating layer of the mineral coated microparticle.

[0089] In some aspects, the messenger ribonucleic acid (mRNA)-based therapeutic composition, comprises: a mineral-coated substrate; a mRNA complex(es) bound to the mineral-coated substrate, wherein the mRNA complexes include mRNA complexed with aAttorney’s Docket No.: 21105.0097P1

[0090] DOTAP-substituted lipid nanoparticle; and a lyoprotectant, wherein the mRNA-based therapeutic composition is lyophilized to a dry powder.

[0091] In some aspects, the ribonucleic acid (RNA)-based therapeutic composition, comprises: a mineral-coated substrate; an RNA complex(es) bound to the mineral-coated substrate, wherein the RNA complexes include RNA complexed with a DOTAP-substituted lipid nanoparticle; and a lyoprotectant, wherein the RNA-based therapeutic composition is lyophilized to a dry powder.

[0092] In some aspects, the mRNA complex can comprise mRNA. In some aspects, the mRNA-loaded lipid nanoparticles can comprise mRNA.

[0093] In some aspects, the mRNA-based therapeutic composition comprises a mineral-coated substrate; a mRNA complex(es) bound to the mineral-coated substrate, wherein the mRNA complexes include mRNA complexed with lipid nanoparticle.

[0094] In some aspects, the mRNA-based therapeutic composition can further comprise a ly coprotectant. In some aspects, the mRNA-based therapeutic composition can be lyophilized to a dr ' powder.

[0095] In some aspects, the mRNA-based therapeutic compositions can comprise mRNA. In some aspects, the mRNA can be a therapeutic mRNA. In some aspects, the mRNA or the therapeutic mRNA can include an mRNA complex formed of mRNA complexed with a complexing agent (e.g., lipid nanoparticle (LNP)), and a mineral coated microparticle (MCM) having one or more mineral coating layers that stabilize the mRNA complexes and improve transfection efficiency of the composition after freeze drying / lyophilization. Further included in the composition can be one or more lyoprotectants that protect the mRNA complexes from damage that may occur during freeze drying / lyophilization. The resulting composition can be provided as a dry medication or powder that is reconstituted in solution prior to administration to a subj ect.

[0096] The complexing agent can be a transfection reagent that forms a complex with the mRNA and improves transfection efficiency. Suitable complexing agents may include positively charged lipid-based complexes such as lipopolyplexes (LPP) and lipid nanoparticles (LNP). Such an LNP may comprise DLin-MC3-DMA, DMG-PEG(2000), and 1,2-DSPC (LNP-MC3 Exploration Kit, Cayman Chemical). SM-102. DMG-PEG(2000). 1,2-DSPC (LNP- 102 Exploration Kit, Cayman Chemical), or any other suitable lipids.Attorney’s Docket No.: 21105.0097P1

[0097] The lyoprotectant can be a disaccharide that interacts with the polar head groups of the complexing agent to prevent damage during lyophilization and help with long term storage of the composition. Preferred lyoprotectants include trehalose or sucrose. In some embodiments, the therapeutic composition may contain from about 5 millimolar (mM) to about 1 molar (M), or about 30 mM to about 1 M of the disaccharide (prior to lyophilization). In one specific embodiment, the composition may contain about 150 mM trehalose. In another embodiment, the composition may contain about 250 mM or about 254 mM sucrose. Other types of lyoprotectants may also be used including, but not limited to, glucose, maltose, lactose, inositol, dextran, hydroxypropyl-P-cyclodextrin, polyethylene glycol, and combinations thereof.

[0098] The MCMs can include at least one mineral coating layer. The mineral coating layer may have different ratios of calcium, phosphate, and carbonate. The calcium: phosphate ratio in the mineral coating layer can vary from about 0.1 to about 10, or from about 2 to about 5. The carbonate concentration of the mineral coating layer can vary from about 1 mM to about 150 mM, or from about 3 mM to about 100 mM. Other ratios / concentrations of calcium, phosphate, and carbonate may be used in alternative embodiments. Different morphologies of the mineral coating layer (e.g.. plate-like, spherulite-like, etc.) may be achieved by varying the amounts and ratios of calcium, phosphate, and carbonate. For example, a high carbonate concentration may result in a mineral coating layer having a platelike structure, whereas a low carbonate concentration may result in a mineral coating layer having a spherulite-like structure.

[0099] In some aspects, the MCM can include a core material in the form of a microparticle coated with the mineral coating layer. Suitable core materials on which the mineral coating layer is formed may include polymers, ceramics, metals, glass, and combinations thereof in the form of microparticles. Non-limiting examples of suitable microparticles include ceramics (e.g.. hydroxyapatite, beta-tricalcium phosphate (0-TCP). magnetite, neodymium), plastics (e g., polystyrene, poly-caprolactone), hydrogels (e.g., polyethylene glycol, poly(lactic-co-glycolic acid) and the like, and combinations thereof. Particularly suitable core materials include those that are dissolved in vivo such as P-TCP and hydroxyapatite. The mRNA complexes can be adsorbed to the mineral coating layer of the MCM. Upon cell transfection or administration, the mRNA complexes adsorbed to the mineral coating layer may be released as the mineral coating layer degrades. Upon introduction to the cytoplasmAttorney’s Docket No.: 21105.0097P1

[0100] (via endocytosis, micropinocytosis or other mechanism), the mRNAs may proceed to translation for protein production. After translation and processing, the MCMs used for initial delivery of the mRNA complexes may bind and sequester the secreted protein. The protein may be released from the MCM over time back to the cell, prolonging the biological response.

[0101] The mRNA can include any therapeutically active mRNA. In some aspects, the mRNA can encode a protein of interest. The mRNAs can encode any protein of interest. For example, the mRNAs can encode proteins including growth factors and reporters. Suitable reporters can be, for example, green fluorescent protein, chloramphenicol acetyl -transferase, P-galactosidase, P-glucuronidase, and luciferase. U.S. Patent No. 11,779,542 is incorporated by reference herein for its disclosure of compositions and making of compositions that include mineral coated microparticles having a mineral layer and a ribonucleic acid.

[0102] In some aspects, the mRNA used in the disclosed compositions can encode roof platespecific sondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), transforming growth factors (e.g., TGF-a and TGF-P), and platelet-derived growth factors (e.g., PDGF-AA and PDGF-BB), insulin-like growth factor-1 (IGF-1), tumor necrosis factor-a (TNF-a), vascular endothelial growth factor (e.g.. VEGF A and B). or basic fibroblast growth factor (bFGF). In some aspects, the mRNA can encode bone morphogenetic protein-2 (BMP-2), BMP-2 / BMP-4, BMP-2 / BMP-7, BMP-4 / BMP-7, BMP-6, or BMP-9. In some aspects, the mRNA can encode roof plate-specific spondin-2 (RSPO-2). In some aspects, the mRNA can encode a growth factor. In some aspects, the growth factor is roof plate-specific spondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), a transforming growth factors (TGF-a and TGF-P), and a platelet-derived growth factor (PDGF-AA and PDGF-BB), insulin-like growth factor- 1 (IGF-1), tumor necrosis factor-a [TNF-a]), a vascular endothelial growth factor (VEGF A and B), basic fibroblast growth factor (bFGF; known as FGF-2) bone morphogenetic protein 2 (BMP-2), BMP-7, BMP-4. BMP-6, BMP-9. BMP-14, or BMP-2 / -7. In some aspects, the growth factor can be BMP-2 or BMP-2 / -7.

[0103] In some aspects, the mRNA sequences can comprise or consist of a 5’ cap 5’ untranslated region (UTR), coding sequence, 3’ UTR and polyA tail. In some aspects, the 5’ Cap can be commercially available, such as Clean Cap M6 or Clean Cap AG (Trilink Biotechnologies) or ARCA Cap (New England Biosciences). In some aspects, the beta-globin 5’ UTRA sequence can be: acatttgcttctgacacaactgtgttcactagcaacctcaaacagacacc (SEQ ID NO:Attorney’s Docket No.: 21105.0097P1

[0104] 1). In some aspects, the beta-globin 3’ UTR sequence can be: gctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaactactaaactgggggatattatgaagggccttgagcat ctggattctgcctaataaaaaacatttattttcattgcaa (SEQ ID NO: 2). In some aspects, the polyA-tail sequence can be: (120 As): (AAA)40. In some aspects, the mRNA coding sequences (CDS) can be any of the following listed below for human: RSPO-2, RSPO-1, RSPO2(dTSP-l) a mutant version of RSPO-2 with the TSP-1 domain from RSPO-1, hBMP-2, hBMP-7, hBMP-2-P2A-hBMP-7, hBMP-2-(GSG)4-hBMP-7. hBMP-6, hBMP-2-(GSG)4-hBMP-6. P2A and (GSG)4 sequences (e.g., BMP-2 -P2A-BMP-7) are bicistronic sequences with a single mRNA encoding for 2 growth factors with stoichiometric expression (P2A) or linked together using 4 glycine-serine-glycine amino acid spacers. Therefore, functional mRNA sequences for the coding sequences below would have following structure:

[0105] Cap-5’UTR-CDS-3’UTR-Tail

[0106] 5’ Cap-Bg-(hRSPO-2)-Bg-(AAA)40

[0107] The mRNA coding sequence for hRSPO-2 is:

[0108] ATGCAGTTTCGCCTTTTCTCCTTTGCCCTCATCATTCTGAACTGCATGGATTACAG CCACTGCCAAGGCAACCGATGGAGACGCAGTAAGCGAGCTAGTTATGTATCAAA TCCCATTTGCAAGGGTTGTTTGTCTTGTTCAAAGGACAATGGGTGTAGCCGATGT CAACAGAAGTTGTTCTTCTTCCTTCGAAGAGAAGGGATGCGCCAGTATGGAGAG TGCCTGCATTCCTGCCCATCCGGGTACTATGGACACCGAGCCCCAGATATGAACA GATGTGCAAGATGCAGAATAGAAAACTGTGATTCTTGCTTTAGCAAAGACTTTTG TACCAAGTGCAAAGTAGGCTTTTATTTGCATAGAGGCCGTTGCTTTGATGAATGT CCAGATGGTTTTGCACCATTAGAAGAAACCATGGAATGTGTGGAAGGATGTGAA GTTGGTCATTGGAGCGAATGGGGAACTTGTAGCAGAAATAATCGCACATGTGGA TTTAAATGGGGTCTGGAAACCAGAACACGGCAAATTGTTAAAAAGCCAGTGAAA GACACAATACTGTGTCCAACCATTGCTGAATCCAGGAGATGCAAGATGACAATG AGGCATTGTCCAGGAGGGAAGAGAACACCAAAGGCGAAGGAGAAGAGGAACAA GAAAAAGAAAAGGAAGCTGATAGAAAGGGCCCAGGAGCAACACAGCGTCTTCC TAGCTACAGACAGAGCTAACCAA (SEQ ID NO: 3).

[0109] The mRNA coding sequence for hRSPO-1 is: atgcggcttgggctgtgtgtggtggccctggttctgagctggacgcacctcaccatcagcagccgggggatcaaggggaaaaggca gaggcggatcagtgccgaggggagccaggcctgtgccaaaggctgtgagctctgctctgaagtcaacggctgcctcaagtgctcac ccaagctgttcatcctgctggagaggaacgacatccgccaggtgggcgtctgcttgccgtcctgcccacctggatacttcgacgcccgAttorney’s Docket No.: 21105.0097P1

[0110] caaccccgacatgaacaagtgcatcaaatgcaagatcgagcactgtgaggcctgctcagccataacttctgcaccaagtgtaaggag ggcttgtacctgcacaagggccgctgctatccagctgtcccgagggctcctcagctgccaatggcaccatggagtgcagtagtcctg cgcaatgtgaaatgagcgagtggtctccgtgggggccctgctccaagaagcagcagctctgtggttccggaggggctccgaggag cggacacgcagggtgctacatgcccctgtgggggaccatgctgcctgctctgacaccaaggagacccggaggtgcacagtgagga gagtgccgtgtcctgaggggcagaagaggaggaagggaggccagggccggcgggagaatgccaacaggaacctggccaggaa ggagagcaaggaggcgggtgctggctctcgaagacgcaaggggcagcaacagcagcagcagcaagggacagtggggccactc acatctgcagggcctgcctag (SEQ ID NO: 4).

[0111] The mRNA coding sequence for hRSPO-2 (dTSP-1) is:

[0112] ATGCAGTTTCGCCTTTTCTCCTTTGCCCTCATCATTCTGAACTGCATGGATTACAG CCACTGCCAAGGCAACCGATGGAGACGCAGTAAGCGAGCTAGTTATGTATCAAA TCCCATTTGCAAGGGTTGTTTGTCTTGTTCAAAGGACAATGGGTGTAGCCGATGT CAACAGAAGTTGTTCTTCTTCCTTCGAAGAGAAGGGATGCGCCAGTATGGAGAG TGCCTGCATTCCTGCCCATCCGGGTACTATGGACACCGAGCCCCAGATATGAACA GATGTGCAAGATGCAGAATAGAAAACTGTGATTCTTGCTTTAGCAAAGACTTTTG TACCAAGTGCAAAGTAGGCTTTTATTTGCATAGAGGCCGTTGCTTTGATGAATGT CCAGATGGTTTTGCACCATTAGAAGAAACCATGGAATGTGTGGAAcaalglgaaalgagc gagtggtctccgtgggggccctgctccaagaagcagcagctctgtggttccggaggggctccgaggagcggacacgcagggtgc tacatgcccctgtgggggaccatgctgcctgctctgacaccaaggagacccggaggtgcacagtgaggagagtgccgtgtcctgG GAGGGAAGAGAACACCAAAGGCGAAGGAGAAGAGGAACAAGAAAAAGAAAAG GAAGCTGATAGAAAGGGCCCAGGAGCAACACAGCGTCTTCCTAGCTACAGACAG AGCTAACCAA (SEQ ID NO: 5).

[0113] The mRNA coding sequence for hBMP-2 is:

[0114] ATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGTCCTCCTGG GCGGCGCGGCTGGCCTCGTACCGGAGCTGGGCCGCAGGAAGTTCGCTGCTGCGT CCTCGGGCCGGCCCTCATCCCAGCCCTCTGATGAGGTCCTGAGCGAGTTCGAGCT GCGGCTGCTCTCCATGTTTGGCCTGAAGCAGAGACCAACCCCAAGCAGAGACGC CGTGGTGCCCCCATACATGCTGGACCTGTATCGCCGCCACTCAGGTCAGCCGGGT TCACCTGCCCCAGACCACCGGCTGGAGAGGGCAGCCAGCCGAGCCAACACTGTG CGCTCCTTCCACCATGAAGAGTCTTTGGAAGAGCTCCCAGAAACGAGTGGGAAA ACAACCCGGAGATTCTTCTTTAATTTAAGTTCTATCCCCACGGAGGAGTTTATCA CCTCAGCAGAGCTGCAGGTTTTCCGAGAACAGATGCAAGATGCTTTAGGAAACA ATAGCAGTTTCCATCACCGAATTAATATTTATGAAATCATAAAGCCTGCAACAGCAttorney’s Docket No.: 21105.0097P1

[0115] CAACTCCAAATTCCCAGTGACCAGACTTTTGGACACCAGGCTAGTGAATCAGAAT GCAAGCAGGTGGGAATCTTTTGATGTCACACCCGCTGTGATGCGGTGGACTGCAC AGGGACACGCCAACCATGGATTTGTGGTGGAAGTGGCCCACTTGGAGGAGAAGC AAGGTGTCTCCAAGAGACATGTTAGGATAAGCAGGTCTCTCCACCAAGATGAGC ATAGCTGGTCACAGATCAGGCCACTGCTAGTAACTTTTGGCCATGATGGAAAAG GCCACCCTCTCCACAAAAGAGAAAAACGTCAAGCCAAACACAAACAGCGGAAA CGTCTTAAGTCCAGCTGTAAGAGACACCCTCTCTACGTGGACTTCAGTGACGTGG GGTGGAATGATTGGATTGTAGCTCCCCCCGGGTATCACGCCTTTTACTGCCACGG AGAATGCCCTTTTCCTCTGGCTGATCATCTGAACTCCACTAATCATGCCATTGTTC AGACATTGGTCAACTCTGTTAACTCTAAGATCCCTAAGGCATGCTGTGTCCCGAC AGAACTCAGTGCTATCTCGATGCTGTACCTTGACGAGAATGAAAAGGTCGTATTA AAGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGCCGC (SEQ ID NO: 6).

[0116] The mRNA coding sequence for hBMP-7 is: atgcacgtgcgctcactgcgagctgcggcgccgcacagcttcgtggcgctctgggcacccctgttcctgctgcgctccgccctggcc gacttcagcctggacaacgaggtgcactcgagctcatccaccggcgcctccgcagccaggagcggcgggagatgcagcgcgag atcclctccalttlgggcttgccccaccgcccgcgcccgcacctccagggcaagcacaaclcggcacccatgtlcatgclggacctgta caacgccatggcggtggaggagggcggcgggcccggcggccagggctctcctacccctacaaggccgtcttcagtacccaggg cccccctctggccagcctgcaagatagccatttcctcaccgacgccgacatggtcatgagctcgtcaacctcgtggaacatgacaag gaattctccacccacgctaccaccatcgagagtccggtttgatcttccaagatcccagaaggggaagctgtcacggcagccgaatt ccggatctacaaggactacatccgggaacgctcgacaatgagacgttccggatcagcgttatcaggtgctccaggagcacttgggc agggaatcggatctctcctgctcgacagccgtaccctctgggcctcggaggagggctggctggtgttgacatcacagccaccagca accactgggtggtcaatccgcggcacaacctgggcctgcagctctcggtggagacgctggatgggcagagcatcaaccccaagtg gcgggcctgattgggcggcacgggccccagaacaagcagccctcatggtggcttctcaaggccacggaggtccacttccgcag catccggtccacggggagcaaacagcgcagccagaaccgctccaagacgcccaagaaccaggaagccctgcggatggccaacg tggcagagaacagcagcagcgaccagaggcaggcctgtaagaagcacgagctgtatgtcagcttccgagacctgggctggcagga ctggatcatcgcgcctgaaggctacgccgcctactactgtgagggggagtgtgcctccctctgaactcctacatgaacgccaccaac cacgccatcgtgcagacgctggtccactcatcaacccggaaacggtgcccaagccctgctgtgcgcccacgcagctcaatgccatc tccgtcctctacttcgatgacagctccaacgtcatcctgaagaaatacagaaacatggtggtccgggcctgtggctgccac (SEQ ID NO: 7).

[0117] The mRNA coding sequence for hBMP-2-P2A-hBMP-7 is:

[0118] ATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGTCCTCCTGG GCGGCGCGGCTGGCCTCGTACCGGAGCTGGGCCGCAGGAAGTTCGCTGCTGCGTAttorney’s Docket No.: 21105.0097P1

[0119] CCTCGGGCCGGCCCTCATCCCAGCCCTCTGATGAGGTCCTGAGCGAGTTCGAGCT GCGGCTGCTCTCCATGTTTGGCCTGAAGCAGAGACCAACCCCAAGCAGAGACGC CGTGGTGCCCCCATACATGCTGGACCTGTATCGCCGCCACTCAGGTCAGCCGGGT TCACCTGCCCCAGACCACCGGCTGGAGAGGGCAGCCAGCCGAGCCAACACTGTG CGCTCCTTCCACCATGAAGAGTCTTTGGAAGAGCTCCCAGAAACGAGTGGGAAA ACAACCCGGAGATTCTTCTTTAATTTAAGTTCTATCCCCACGGAGGAGTTTATCA CCTCAGCAGAGCTGCAGGTTTTCCGAGAACAGATGCAAGATGCTTTAGGAAACA ATAGCAGTTTCCATCACCGAATTAATATTTATGAAATCATAAAGCCTGCAACAGC CAACTCCAAATTCCCAGTGACCAGACTTTTGGACACCAGGCTAGTGAATCAGAAT GCAAGCAGGTGGGAATCTTTTGATGTCACACCCGCTGTGATGCGGTGGACTGCAC AGGGACACGCCAACCATGGATTTGTGGTGGAAGTGGCCCACTTGGAGGAGAAGC AAGGTGTCTCCAAGAGACATGTTAGGATAAGCAGGTCTCTCCACCAAGATGAGC ATAGCTGGTCACAGATCAGGCCACTGCTAGTAACTTTTGGCCATGATGGAAAAG GCCACCCTCTCCACAAAAGAGAAAAACGTCAAGCCAAACACAAACAGCGGAAA CGTCTTAAGTCCAGCTGTAAGAGACACCCTCTCTACGTGGACTTCAGTGACGTGG GGTGGAATGATTGGATTGTAGCTCCCCCCGGGTATCACGCCTTTTACTGCCACGG AGAATGCCCTTTTCCTCTGGCTGATCATCTGAACTCCACTAATCATGCCATTGTTC AGACATTGGTCAACTCTGTTAACTCTAAGATCCCTAAGGCATGCTGTGTCCCGAC AGAACTCAGTGCTATCTCGATGCTGTACCTTGACGAGAATGAAAAGGTCGTATTA AAGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGCCGCGGAAGCGGAGCT ACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT

[0120] atgcacgtgcgctcactgcgagctgcggcgccgcacagctcgtggcgctctgggcacccctgttcctgctgcgctccgccctggcc gacttcagcctggacaacgaggtgcactcgagctcatccaccggcgcctccgcagccaggagcggcgggagatgcagcgcgag atcctctccatttgggcttgccccaccgcccgcgcccgcacctccagggcaagcacaactcggcacccatgttcatgctggacctgta caacgccatggcggtggaggagggcggcgggcccggcggccagggctctcctacccctacaaggccgtcttcagtacccaggg cccccctctggccagcctgcaagatagccattcctcaccgacgccgacatggtcatgagctcgtcaacctcgtggaacatgacaag gaattcttccacccacgctaccaccatcgagagttccggtttgatctttccaagatcccagaaggggaagctgtcacggcagccgaatt ccggatctacaaggactacatccgggaacgctcgacaatgagacgttccggatcagcgtttatcaggtgctccaggagcacttgggc agggaatcggatctctcctgctcgacagccgtaccctctgggcctcggaggagggctggctggtgttgacatcacagccaccagca accactgggtggtcaatccgcggcacaacctgggcctgcagctctcggtggagacgctggatgggcagagcatcaaccccaagtg gcgggcctgatgggcggcacgggccccagaacaagcagcccttcatggtggcttctcaaggccacggaggtccacttccgcag catccggtccacggggagcaaacagcgcagccagaaccgctccaagacgcccaagaaccaggaagccctgcggatggccaacgAttorney’s Docket No.: 21105.0097P1

[0121] tggcagagaacagcagcagcgaccagaggcaggcctgtaagaagcacgagctgtatgtcagctccgagacctgggctggcagga ctggatcatcgcgcctgaaggctacgccgcctactactgtgagggggagtgtgcctccctctgaactcctacatgaacgccaccaac cacgccatcgtgcagacgctggtccactcatcaacccggaaacggtgcccaagccctgctgtgcgcccacgcagctcaatgccatc tccgtcctctacttcgatgacagctccaacgtcatcctgaagaaatacagaaacatggtggtccgggcctgtggctgccac (SEQ ID NO: 8).

[0122] The mRNA coding sequence for hBMP-2-(GSG)4-hBMP7 is:

[0123] ATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGTCCTCCTGG GCGGCGCGGCTGGCCTCGTACCGGAGCTGGGCCGCAGGAAGTTCGCTGCTGCGT CCTCGGGCCGGCCCTCATCCCAGCCCTCTGATGAGGTCCTGAGCGAGTTCGAGCT GCGGCTGCTCTCCATGTTTGGCCTGAAGCAGAGACCAACCCCAAGCAGAGACGC CGTGGTGCCCCCATACATGCTGGACCTGTATCGCCGCCACTCAGGTCAGCCGGGT TCACCTGCCCCAGACCACCGGCTGGAGAGGGCAGCCAGCCGAGCCAACACTGTG CGCTCCTTCCACCATGAAGAGTCTTTGGAAGAGCTCCCAGAAACGAGTGGGAAA ACAACCCGGAGATTCTTCTTTAATTTAAGTTCTATCCCCACGGAGGAGTTTATCA CCTCAGCAGAGCTGCAGGTTTTCCGAGAACAGATGCAAGATGCTTTAGGAAACA ATAGCAGTTTCCATCACCGAATTAATATTTATGAAATCATAAAGCCTGCAACAGC CAACTCCAAATTCCCAGTGACCAGACTTTTGGACACCAGGCTAGTGAATCAGAAT GCAAGCAGGTGGGAATCTTTTGATGTCACACCCGCTGTGATGCGGTGGACTGCAC AGGGACACGCCAACCATGGATTTGTGGTGGAAGTGGCCCACTTGGAGGAGAAGC AAGGTGTCTCCAAGAGACATGTTAGGATAAGCAGGTCTCTCCACCAAGATGAGC ATAGCTGGTCACAGATCAGGCCACTGCTAGTAACTTTTGGCCATGATGGAAAAG GCCACCCTCTCCACAAAAGAGAAAAACGTCAAGCCAAACACAAACAGCGGAAA CGTCTTAAGTCCAGCTGTAAGAGACACCCTCTCTACGTGGACTTCAGTGACGTGG GGTGGAATGATTGGATTGTAGCTCCCCCCGGGTATCACGCCTTTTACTGCCACGG AGAATGCCCTTTTCCTCTGGCTGATCATCTGAACTCCACTAATCATGCCATTGTTC AGACATTGGTCAACTCTGTTAACTCTAAGATCCCTAAGGCATGCTGTGTCCCGAC AGAACTCAGTGCTATCTCGATGCTGTACCTTGACGAGAATGAAAAGGTCGTATTA AAGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGCCGCggtggtggaggaagtggag gtggaggtagtggaggaggtggtagtggtggaggtggaagtgacttcagcctggacaacgaggtgcactcgagcttcatccaccgg cgcctccgcagccaggagcggcgggagatgcagcgcgagatcctctccattttgggctgccccaccgcccgcgcccgcacctcca gggcaagcacaactcggcacccatgtcatgctggacctgtacaacgccatggcggtggaggagggcggcgggcccggcggcca gggctctcctacccctacaaggccgtcttcagtacccagggcccccctctggccagcctgcaagatagccatttcctcaccgacgccAttorney’s Docket No.: 21105.0097P1

[0124] gacatggtcatgagcttcgtcaacctcgtggaacatgacaaggaatctccacccacgctaccaccatcgagagtccggttgatctt ccaagatcccagaaggggaagctgtcacggcagccgaatccggatctacaaggactacatccgggaacgcttcgacaatgagacg tccggatcagcgttatcaggtgctccaggagcactgggcagggaatcggatctctcctgctcgacagccgtaccctctgggcctc ggaggagggctggctggtgttgacatcacagccaccagcaaccactgggtggtcaatccgcggcacaacctgggcctgcagctct cggtggagacgctggatgggcagagcatcaaccccaagttggcgggcctgattgggcggcacgggccccagaacaagcagccct tcatggtggctttcttcaaggccacggaggtccacttccgcagcatccggtccacggggagcaaacagcgcagccagaaccgctcc aagacgcccaagaaccaggaagccctgcggalggccaacgtggcagagaacagcagcagcgaccagaggcaggcclglaagaa gcacgagctgtatgtcagctccgagacctgggctggcaggactggatcatcgcgcctgaaggctacgccgcctactactgtgaggg ggagtgtgcctccctctgaactcctacatgaacgccaccaaccacgccatcgtgcagacgctggtccactcatcaacccggaaacg gtgcccaagccctgctgtgcgcccacgcagctcaatgccatctccgtcctctactcgatgacagctccaacgtcatcctgaagaaata cagaaacatggtggtccgggcctgtggctgccac (SEQ ID NO: 9).

[0125] The mRNA coding sequence for hBMP-6 is:

[0126] ATGCCGGGGCTGGGGCGGAGGGCGCAGTGGCTGTGCTGGTGGTGGGGGCTGCTG TGCAGCTGCTGCGGGCCCCCGCCGCTGCGGCCGCCCTTGCCCGCTGCCGCGGCCG CCGCCGCCGGGGGGCAGCTGCTGGGGGACGGCGGGAGCCCCGGCCGCACGGAG CAGCCGCCGCCGTCGCCGCAGTCCTCCTCGGGCTTCCTGTACCGGCGGCTCAAGA CGCAGGAGAAGCGGGAGATGCAGAAGGAGATCTTGTCGGTGCTGGGGCTCCCGC ACCGGCCCCGGCCCCTGCACGGCCTCCAACAGCCGCAGCCCCCGGCGCTCCGGC AGCAGGAGGAGCAGCAGCAGCAGCAGCAGCTGCCTCGCGGAGAGCCCCCTCCCG GGCGACTGAAGTCCGCGCCCCTCTTCATGCTGGATCTGTACAACGCCCTGTCCGC CGACAACGACGAGGACGGGGCGTCGGAGGGGGAGAGGCAGCAGTCCTGGCCCC ACGAAGCAGCCAGCTCGTCCCAGCGTCGGCAGCCGCCCCCGGGCGCCGCGCACC CGCTCAACCGCAAGAGCCTTCTGGCCCCCGGATCTGGCAGCGGCGGCGCGTCCC CACTGACCAGCGCGCAGGACAGCGCCTTCCTCAACGACGCGGACATGGTCATGA GCTTTGTGAACCTGGTGGAGTACGACAAGGAGTTCTCCCCTCGTCAGCGACACCA CAAAGAGTTCAAGTTCAACTTATCCCAGATTCCTGAGGGTGAGGTGGTGACGGCT GCAGAATTCCGCATCTACAAGGACTGTGTTATGGGGAGTTTTAAAAACCAAACTT TTCTTATCAGCATTTATCAAGTCTTACAGGAGCATCAGCACAGAGACTCTGACCT GTTTTTGTTGGAOAGGGGTGTAGTATGGGOGTGAGAAGAAGGGTGGGTGGAATTT GACATCACGGCCACTAGCAATCTGTGGGTTGTGACTCCACAGCATAACATGGGG CTTCAGCTGAGCGTGGTGACAAGGGATGGAGTCCACGTCCACCCCCGAGCCGCA GGCCTGGTGGGCAGAGACGGCCCTTACGACAAGCAGCCCTTCATGGTGGCTTTCTAttorney’s Docket No.: 21105.0097P1

[0127] TCAAAGTGAGTGAGGTGCACGTGCGCACCACCAGGTCAGCCTCCAGCCGGCGCC GACAACAGAGTCGTAATCGCTCTACCCAGTCCCAGGACGTGGCGCGGGTCTCCA GTGCTTCAGATTACAACAGCAGTGAATTGAAAACAGCCTGCAGGAAGCATGAGC TGTATGTGAGTTTCCAAGACCTGGGATGGCAGGACTGGATCATTGCACCCAAGG GCTATGCTGCCAATTACTGTGATGGAGAATGCTCCTTCCCACTCAACGCACACAT GAATGCAACCAACCACGCGATTGTGCAGACCTTGGTTCACCTTATGAACCCCGAG TATGTCCCCAAACCGTGCTGTGCGCCAACTAAGCTAAATGCCATCTCGGTTCTTT ACTTTGATGACAACTCCAATGTCATTCTGAAAAAATACAGGAATATGGTTGTAAG AGCTTGTGGATGCCACTAA (SEQ ID NO: 10)

[0128] The mRNA coding sequence for hBMP-2-(GSG)4-hBMP-6 is:

[0129] ATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGTCCTCCTGG GCGGCGCGGCTGGCCTCGTACCGGAGCTGGGCCGCAGGAAGTTCGCTGCTGCGT CCTCGGGCCGGCCCTCATCCCAGCCCTCTGATGAGGTCCTGAGCGAGTTCGAGCT GCGGCTGCTCTCCATGTTTGGCCTGAAGCAGAGACCAACCCCAAGCAGAGACGC CGTGGTGCCCCCATACATGCTGGACCTGTATCGCCGCCACTCAGGTCAGCCGGGT TCACCTGCCCCAGACCACCGGCTGGAGAGGGCAGCCAGCCGAGCCAACACTGTG CGCTCCTTCCACCATGAAGAGTCTTTGGAAGAGCTCCCAGAAACGAGTGGGAAA ACAACCCGGAGATTCTTCTTTAATTTAAGTTCTATCCCCACGGAGGAGTTTATCA CCTCAGCAGAGCTGCAGGTTTTCCGAGAACAGATGCAAGATGCTTTAGGAAACA ATAGCAGTTTCCATCACCGAATTAATATTTATGAAATCATAAAGCCTGCAACAGC CAACTCCAAATTCCCAGTGACCAGACTTTTGGACACCAGGCTAGTGAATCAGAAT GCAAGCAGGTGGGAATCTTTTGATGTCACACCCGCTGTGATGCGGTGGACTGCAC AGGGACACGCCAACCATGGATTTGTGGTGGAAGTGGCCCACTTGGAGGAGAAGC AAGGTGTCTCCAAGAGACATGTTAGGATAAGCAGGTCTCTCCACCAAGATGAGC ATAGCTGGTCACAGATCAGGCCACTGCTAGTAACTTTTGGCCATGATGGAAAAG GCCACCCTCTCCACAAAAGAGAAAAACGTCAAGCCAAACACAAACAGCGGAAA CGTCTTAAGTCCAGCTGTAAGAGACACCCTCTCTACGTGGACTTCAGTGACGTGG GGTGGAATGATTGGATTGTAGCTCCCCCCGGGTATCACGCCTTTTACTGCCACGG AGAATGCCCTTTTCCTCTGGCTGATCATCTGAACTCCACTAATCATGCCATTGTTC AGACATTGGTCAACTCTGTTAACTCTAAGATCCCTAAGGCATGCTGTGTCCCGAC AGAACTCAGTGCTATCTCGATGCTGTACCTTGACGAGAATGAAAAGGTCGTATTA AAGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGCCGCggtggtggaggaagtggagAttorney’s Docket No.: 21105.0097P1

[0130] gtggaggtagtggaggaggtggtagtggtggaggtggaagtTGCTGCGGGCCCCCGCCGCTGCGGCCGC CCTTGCCCGCTGCCGCGGCCGCCGCCGCCGGGGGGCAGCTGCTGGGGGACGGCG GGAGCCCCGGCCGCACGGAGCAGCCGCCGCCGTCGCCGCAGTCCTCCTCGGGCT TCCTGTACCGGCGGCTCAAGACGCAGGAGAAGCGGGAGATGCAGAAGGAGATCT TGTCGGTGCTGGGGCTCCCGCACCGGCCCCGGCCCCTGCACGGCCTCCAACAGCC GCAGCCCCCGGCGCTCCGGCAGCAGGAGGAGCAGCAGCAGCAGCAGCAGCTGC CTCGCGGAGAGCCCCCTCCCGGGCGACTGAAGTCCGCGCCCCTCTTCATGCTGGA TCTGTACAACGCCCTGTCCGCCGACAACGACGAGGACGGGGCGTCGGAGGGGGA GAGGCAGCAGTCCTGGCCCCACGAAGCAGCCAGCTCGTCCCAGCGTCGGCAGCC GCCCCCGGGCGCCGCGCACCCGCTCAACCGCAAGAGCCTTCTGGCCCCCGGATCT GGCAGCGGCGGCGCGTCCCCACTGACCAGCGCGCAGGACAGCGCCTTCCTCAAC GACGCGGACATGGTCATGAGCTTTGTGAACCTGGTGGAGTACGACAAGGAGTTC TCCCCTCGTCAGCGACACCACAAAGAGTTCAAGTTCAACTTATCCCAGATTCCTG AGGGTGAGGTGGTGACGGCTGCAGAATTCCGCATCTACAAGGACTGTGTTATGG GGAGTTTTAAAAACCAAACTTTTCTTATCAGCATTTATCAAGTCTTACAGGAGCA TCAGCACAGAGACTCTGACCTGTTTTTGTTGGACACCCGTGTAGTATGGGCCTCA GAAGAAGGCTGGCTGGAATTTGACATCACGGCCACTAGCAATCTGTGGGTTGTG ACTCCACAGCATAACATGGGGCTTCAGCTGAGCGTGGTGACAAGGGATGGAGTC CACGTCCACCCCCGAGCCGCAGGCCTGGTGGGCAGAGACGGCCCTTACGACAAG CAGCCCTTCATGGTGGCTTTCTTCAAAGTGAGTGAGGTGCACGTGCGCACCACCA GGTCAGCCTCCAGCCGGCGCCGACAACAGAGTCGTAATCGCTCTACCCAGTCCC AGGACGTGGCGCGGGTCTCCAGTGCTTCAGATTACAACAGCAGTGAATTGAAAA CAGCCTGCAGGAAGCATGAGCTGTATGTGAGTTTCCAAGACCTGGGATGGCAGG ACTGGATCATTGCACCCAAGGGCTATGCTGCCAATTACTGTGATGGAGAATGCTC CTTCCCACTCAACGCACACATGAATGCAACCAACCACGCGATTGTGCAGACCTTG GTTCACCTTATGAACCCCGAGTATGTCCCCAAACCGTGCTGTGCGCCAACTAAGC TAAATGCCATCTCGGTTCTTTACTTTGATGACAACTCCAATGTCATTCTGAAAAA ATACAGGAATATGGTTGTAAGAGCTTGTGGATGCCACTAA (SEQ ID NO: 11).

[0131] In some aspects, the mRNA can comprise the any of nucleic acid sequences of SEQ ID NOs: 3. 4, 5, 6, 7. 8, 9, 10, or 11.

[0132] In some aspects, the composition can comprise one or more bone substitutes. In some aspects, the one or more bone substitutes can be derived from biological products, can be aAttorney’s Docket No.: 21105.0097P1

[0133] synthetic bone substitute or a combination thereof. Examples of bone substitutes derived from biological products include but are not limited to demineralized bone matrix (DBM), bone morphogenetic proteins (BMPs), hydroxyapatite (HA) and corals, allogeneic cancellous bone chips, or bone marrow aspirate concentrate (BMAC), including bone graft from long bones harvested using the reamer irrigation aspirator (RIA). In some aspects, the one or more bone substitutes can be derived from a biological product, wherein the biological product can be bone morphogenetic proteins (BMPs), platelet derived growth factor (PDGF), vascular endothelial growth factor (VEGF). demineralized bone matrix (DBM), hydroxyapatite (HA), corals, allogeneic cancellous bone chips, or bone marrow aspirate concentrate (BMAC), including bone graft from long bones harvested using the reamer irrigation aspirator (RIA). In some aspects, the bone substitutes can be synthetic bone substitutes. Examples of synthetic bone substitutes can include but not are limited to calcium sulfate, calcium phosphate cements, beta-tri-calcium phosphate (TCP) ceramics, biphasic calcium phosphates (Hydroxyapatite (HA) and Beta-TCP ceramics), bioactive glasses, and polymer-based bone substitutes. Further examples of synthetic bone substitutes include but are not limited to Cal cigen® S Calcium Sulfate Bone Void Filler, STIMULAN® Beads, HydroSet Injectable Bone Substitute (calcium phosphate), Ossilix calcium phosphate cement. Syntoss Synthetic Beta-Tricalcium Phosphate Bone Graft Material, CERASORB® Tri-Calcium Phosphate Bone Graft, GL1894P / -2058S BIOACTIVE GLASS, UniGraft Bioactive Glass 200-600um, BonAlive (BonAlive Biomaterials Ltd, Finland), Cerament (bone void filler) and Cerament G (Bonesupport Holding AB, Lund Sweden). Examples of polymers include but are not limited to collagen, gelatin, chitosan, and synthetic polymers such as poly(lactic acid) (PLA), poly(glycolic acid) (PGA), poly caprolactone (PCL) - GalaFlex P4HB biopolymer, and the like. In some aspects, the bone substitutes can be available in a variety7of forms including but not limited to dry, moldable or injectable forms, and pastes, powders, putty, granules, gels, sponges, or strips. In some aspects, the bone substitute can be a commercially available product. In some aspects, the bone substitute can be demineralized bone matrix (DBX; MTF Biologies, Edison, NJ), RegenaVate DBM, Puros DBM, StaGraft DBM, or FiberStack DBM (Zimmer Biomet; Warsaw, IN). In some aspects, the DBM can be an allograft cancellous or cortical bone that has been decalcified to produce a product of collagen and non-collagenous protein. Examples of DBMs include but are not limited to Grafton DBM (Osteotech, Inc, Eatontown. New Jersey), Allosource (Denver, Colorado), Dynagraft II (Integra LifeSciences,Attorney’s Docket No.: 21105.0097P1

[0134] Plainsboro, New Jersey), DBX (Musculoskeletal Transplant Foundation and Synthes, Paoli, Pennsylvania), Osteofil (Medtronic Sofamor Danek, Minneapolis, Minnesota). Examples of corals include but are not limited to animalia, coelenterate, scleractenia, poratidae, porites species, and gonioporas species; each of which can be used for developing coralline hydroxyapatite (CHA) bone substitute. In some aspects, the bone substitute is not BMP, rhBMP-2 or BMP-2.

[0135] In some aspects, the ratio of the ex vivo hematoma to bone substitute can be from 1000: 1 to 1: 1000 or any ratio in between. In some aspects, the ratio of the ex vivo hematoma to bone substitute can be 1:1, 1:2, 1:3, 1 :4, 1:5, 1:6, 1 :7, 1:8, 1:9, or 1:10. In some aspects, the ratio ofthe bone substitute to ex vivo hematoma can be 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, or 1:10.

[0136] In some aspects, the composition, ex vivo hematoma, bone substitute or biomimetic scaffold can comprise one or more growth factors. In some aspects, the one or more growth factors can be one or more of the bone morphogenetic proteins. Examples of BMPs include but are not limited to BMP -2, BMP-7, BMP-4, BMP-6, BMP-9, and BMP- 14 (also known as GDF5). Any BMPs are contemplated, including BMP-1 through BMP-18. In some aspects, the one or more growth factors can be platelet-derived growth factor. In some aspects, the one or more growth factors can be vascular endothelial growth factor. In some aspects, the one or more grow th factors can be fibroblast growth factor 2. In some aspects, the one or more growth factors can be one or more of the bone morphogenetic proteins, platelet-derived growth factor, vascular endothelial growth factor, fibroblast growth factor 2, or a combination thereof. In some aspects, the composition, ex vivo hematoma, bone substitute or biomimetic scaffold can further comprise BMP -2. In some aspects, the one or more grow th factors can be BMP-2. In some aspects, the one or more growth factors is not BMP, rhBMP-2, BMP-2, BMP-7. BMP-4, BMP-6, BMP-9, or BMP-14.

[0137] In some aspects, the whole blood can comprise viable cells. In some aspects, about 50% to 70% of the viable cells of the whole blood remain viable after formation of the ex vivo hematoma. In some aspects, at least 50% of the viable cells of the whole blood remain viable after formation of the hematoma. In some aspects, at least 60% of the viable cells of the whole blood remain viable after formation of the hematoma. In some aspects, at least 70% of the viable cells of the whole blood remain viable after formation of the ex vivo hematoma. In some aspects, at least 80% of the viable cells of the whole blood remain viableAttorney’s Docket No.: 21105.0097P1

[0138] after formation of the ex vivo hematoma. In some aspects, at least 90% of the viable cells of the whole blood remain viable after formation of the ex vivo hematoma. In some aspects, more than 90% of the viable cells of the whole blood remain viable after formation of the ex vivo hematoma.

[0139] In some aspects, the whole blood can comprise one or more biological factors. In some aspects, the term “biological factors’’ or “other biological factors” refers to the plasma component of whole blood excluding water. Examples of other biological factors include but are not limited to ions, proteins, clotting factors, sugars, lipids, and minerals.

[0140] In some aspects, the one or more biological factors present in the whole blood can be endogenous biological factors. Platelets are present in whole blood. Many grow th factors can be found in platelets. Growth factors in platelet-rich plasma platelet a-granules have been shown to contain mitogenic and chemotactic growth factors along with associated healing molecules in an inactive form, which are important in wound healing, including but not limited to platelet-derived growth factor (PDGF), transforming growth factors 01, 02, 03 (TGF-01, TGF-02, TGF-03, platelet-derived angiogenesis factor (PDAF), insulin-like growth factor 1 (IGF-1), platelet factor 4 (PF-4), epidermal growth factor (EGF), epithelial cell grow factor (ECGF). vascular endothelial cell growth factor (VEGF). basic fibroblast growth factor (bFGF) and other cytokines. Additionally, plasma fluid also contains a number of biologically active proteins such as growth factor IGF-I and hepatocyte growth factor (HGF). During normal wound healing, trapped platelets become activated and degranulate, resulting in the release of the a-granule content. Examples of growth factors present in platelets include but are not limited to platelet-derived growth factors, transforming growth factors 01, 02, 03, platelet-derived angiogenesis factor, insulin-like growth factor 1, platelet factor 4, epidermal growth factor, epithelial cell growth factor, vascular endothelial cell growth factor, basic fibroblast growth factor, and others cytokines; as well as platelet-derived endothelial growth factor (PDEGF). interleukin 1. osteocalcin and osteonectin. Growth factors present in plasma fluid include but are not limited to insulin-like growth factor 1, and hepatocyte growth factor.

[0141] In some aspects, the ex vivo hematoma can comprise whole blood, ecarin and sodium citrate. In some aspects, the ex vivo hematoma can comprise whole blood, calcium chloride and sodium citrate. In some aspects, the ex vivo hematoma can comprise platelet rich plasma and ecarin. In some aspects, the ex vivo hematoma can comprise platelet rich plasma andAttorney’s Docket No.: 21105.0097P1

[0142] calcium chloride. In some aspects, the ex vivo hematoma can comprise whole blood; calcium chloride; or oscutarin and calcium chloride; and sodium citrate. In some aspects, a combination of one of (a) isolated whole blood and sodium citrate; platelet rich plasma, or plasma with red blood cells can be combined with one of (b) ecarin, oscutarin and calcium chloride, or calcium chloride. In some aspects, a combination of one of (a) isolated whole blood and sodium citrate; platelet rich plasma, or plasma with red blood cells can be combined with one of (b) thrombin or thrombin and calcium chloride. In some aspects, any of the ex vivo hematoma combinations described herein can further comprise one or more antibiotics.

[0143] In some aspects, the concentration of calcium chloride present in the ex vivo hematoma can be in the range of 1 mM to 20 rnM. In some aspects, the concentration of calcium chloride can be 1, 2. 3, 4, 5, 6, 7, 8, 9. 10. 11. 12, 13, 14, 15, 16, 17, 18, 19, 20 mM or any number in between. In some aspects, the concentration of calcium chloride can be about 10 mM.

[0144] In some aspects, the concentration of thrombin can be in the range of 0.1 to 1 U / mL. In some aspects, the concentration of thrombin present in the ex vivo hematoma can be 0.05.

[0145] 0.1, 0.2, 0.3, 0.4. 0.5, 0.6, 0.7, 0.8. 0.9, 1 U / mL or any number in between or higher. In some aspects, the concentration of thrombin present in the ex vivo hematoma can be 0.5 U / mL In some aspects, the concentration of ecarin present in the ex vivo hematoma can be at least 0.05 U / mL. In some aspects, the concentration of ecarin present in the ex vivo hematoma can be 0.05, 0.1, 0.2, 0.3. 0.4, 0.5, 0.6, 0.7. 0.8, 0.9, 1, 1.1. 1.2, 1.3, 1.4, 1.5. 1.6, 1.7, 1.8, 1.9, 2 U / mL or any number in between or higher. In some aspects, the concentration of ecarin present in the ex vivo hematoma can be 0.3 U / mL. In some aspects, the concentration of ecarin present in the ex vivo hematoma can be 0.6 U / mL. In some aspects, the concentration of ecarin present in the ex vivo hematoma can be 0.75 U / mL. In some aspects, the concentration of ecarin present in the ex vivo hematoma can be any value (rational or irrational) between 0 and 2.

[0146] In some aspects, the ex vivo hematomas, bone substitutes, biomimetic scaffolds or compositions described herein can further comprise BMP-2. In some aspects, the BMP -2 can be a recombinant BMP -2. In some aspects, the recombinant BMP-2 can comprise human BMP-2. In some aspects, the dose of BMP-2 present in the ex vivo hematoma, bone substitute, composition, or biomimetic scaffold can be at least 0.01 mg. In some aspects, theAttorney’s Docket No.: 21105.0097P1

[0147] dose of BMP-2 present in the ex vivo hematoma, bone substitute, composition, or biomimetic scaffold can be 0.01 to 5 mg. In some aspects, the dose of BMP-2 present in the ex vivo hematoma, bone substitute, composition, or biomimetic scaffold can be 0.01, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0 mg or any number in between. In some aspects, recombinant BMP -2 can be used at a dose of about 0.01 mg to about 12 mg. In some aspects, recombinant BMP -2 can be used at a dose of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5. 10.0, 10.5, 11.0, 11.5, 12.0 mg or any number in between. In some aspects, recombinant BMP-2 can be used at a dose higher than 12.0 mg. In some aspects, dose of BMP-2 can be about 1 mg to 5 mg. In some aspects, the dose of BMP-2 present in the ex vivo hematoma, bone substitute, composition, or biomimetic scaffold can be at least 0.01 pg. In some aspects, the dose of BMP-2 present in the ex vivo hematoma, bone substitute, composition, or biomimetic scaffold can be 0.01 to 5 pg. In some aspects, the dose of BMP-2 present in the ex vivo hematoma, bone substitute, composition, or biomimetic scaffold can be 0.01, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0 pg or any number in between. In some aspects, recombinant BMP -2 can be used at a dose of about 0.01 pg to about 12 pg. In some aspects, recombinant BMP-2 can be used at a dose of 0.1. 0.2, 0.3, 0.4, 0.5. 0.6, 0.7, 0.8, 0.9, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10.0, 10.5, 11.0, 11.5, 12.0 pg or any number in between. In some aspects, recombinant BMP-2 can be used at a dose higher than 12.0 pg. In some aspects, dose of BMP -2 can be about 1 pg to 5 pg. In some aspects, the dose of BMP -2 present in the ex vivo hematoma, bone substitute, composition, or biomimetic scaffold can be between 0.3 and 0.4 pg. In some aspects, the dose of BMP-2 present in the ex vivo hematoma, bone substitute, composition, or biomimetic scaffold can be lower than the standard dose. In some aspects, the dose of BMP -2 present in the ex vivo hematoma, bone substitute, composition, or biomimetic scaffold can be 10-50 times lower than the standard dose or the lowest effective dose of BMP-2 / ACS.

[0148] In some aspects, the amount of the ecarin present in the ex vivo hematoma can be at least 0.05 U / mL; and the amount of BMP-2 present in the ex vivo hematoma can be at least 0.01 mg.

[0149] In some aspects, the amount of the ecarin present in the ex vivo hematoma can be at least 0.05 U / mL; and the amount of BMP-2 present in the ex vivo hematoma can be at least 0.01 pg.Attorney’s Docket No.: 21105.0097P1

[0150] In some aspects, the concentration of sodium citrate can be about 3.2 to 4 mg / ml. In some aspects, the solution is about 3.2 to 4% (weight / volume) sodium citrate, in which one part of this solution can then be mixed with nine parts whole blood.

[0151] In some aspects, the ex vivo hematomas or compositions described herein can further comprise one or more therapeutic agents. In some aspects, the therapeutic agent can be a grow th factor. In some aspects, the therapeutic agent can be BMP -2. In some aspects, the therapeutic agent can be recombinant BMP -2. In some aspects, the therapeutic agent can be stem cells or pre-differentiated stem cells, including but not limited to mesenchymal stem cells, adipose stem cells, and induced pluripotent stem cells. In some aspects, the therapeutic agent can be ecarin.

[0152] In some aspects, the ex vivo hematoma, biomimetic scaffolds or compositions disclosed herein can be formulated as a liquid or a gel. In some aspects, the ex vivo hematoma, biomimetic scaffolds or compositions disclosed herein can be formulated as a paste or a putty7. In some aspects, the ex vivo hematomas can be formulated as a lyophilized or powder form. Said lyophilized or powder forms can make the ex vivo hematoma more stable for storage. In some aspects, the ex vivo hematoma, biomimetic scaffolds or compositions disclosed herein can be formulated as a liquid, a gel, a powder, granules, a paste or a putty7. In some aspects, the composition can be formulated as a lyophilized or powder form. Said lyophilized or powder forms can make the ex vivo hematoma, biomimetic scaffolds or compositions disclosed herein more stable for storage. In some aspects, the growth factors (BMPs and others), coagulating factors (ecarin, calcium chloride, etc.) and sodium citrate can be available as a lyophilized or powder forms. In some aspects, compounds used for making the ex vivo hematomas disclosed herein can be dissolved in sterile distilled water prior to mixing w ith whole blood or other blood products (e.g., PRP, plasma, etc.). The diluent is sterile distilled water. No additional components are needed for preparation or storage. Whole blood (or other blood products) can be drawn from a patient before (e g., immediately before) the surgery, and citrated to prevent clotting. In some aspects, donor blood can be used, for example, for patients with a blood disorder or diseases including but not limited to anemia, hemophilia, leukemia, HIV, etc. The remainder of the components of the ex vivo hematoma do not require any additional stabilizers for storage. For example, BMP-2 is commercially available in a bottle, ready to use; and CaCL is available in a powder form, and in some cases may already be dissolved in sterile distilledAttorney’s Docket No.: 21105.0097P1

[0153] water (it is very stable after it is dissolved). Both BMP -2 and CaCh can be stored at room temperature. Ecarin is available in a lyophilized form (freeze-dried), stored at -20°C, and can be dissolved in sterile distilled water prior to use. The ex vivo hematoma can be prepared relatively simply, using the components described herein in amounts based on the volume of the defect to fill. For this, after the components are prepared, they can be mixed together in a tube / mold. Generally, the ex vivo hematoma will form in about 30 to 45 minutes and then can be inserted (or implanted) into the bone defect. In some aspects, the ex vivo hematomas described herein can be stored, for example, using a ‘"smart storage system’" that uses radiofrequency identification-based system (e.g., Smartstorage™) which involves a near real-time tissue tracking system that can streamline inventory7management including keeping accurate usage history and temperature logs.

[0154] Scaffolds

[0155] Disclosed herein are biomimetic scaffolds. The biomimetic scaffolds can comprise any of the scaffolds described herein and any of the ex vivo hematomas described herein.

[0156] Disclosed herein are biomimetic scaffolds comprising a scaffold and an ex vivo hematoma, wherein the ex vivo hematoma comprises: (a) isolated whole blood; (b) sodium citrate; and (c) ecarin; oscutarin and calcium chloride: calcium chloride; thrombin; or thrombin and calcium chloride. Disclosed herein are biomimetic scaffolds comprising a scaffold and an ex vivo hematoma, wherein the ex vivo hematoma comprises: (a) platelet rich plasma, plasma, or plasma with red blood cells; and (b) ecarin; oscutarin and calcium chloride; calcium chloride: thrombin; or thrombin and calcium chloride. In some aspects, the ex vivo hematoma can comprise fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the ex vivo hematoma can comprise fibrin fibers having a thickness of 100-400 nm ± 10%. In some aspects, the biomimetic scaffold further comprises one or more bone substitutes. In some aspects, the ex vivo hematoma of the biomimetic scaffold comprises one or more bone substitutes.

[0157] Disclosed herein are biomimetic scaffolds comprising a scaffold and an ex vivo hematoma, wherein the ex vivo hematoma comprises: (a) isolated whole blood; (b) sodium citrate; (c) calcium chloride; thrombin; or thrombin and calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematoma can comprise fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the ex vivoAttorney’s Docket No.: 21105.0097P1

[0158] hematoma can comprise fibrin fibers having a thickness of 100-400 nm ± 10%. In some aspects, the biomimetic scaffold further comprises one or more bone substitutes. In some aspects, the ex vivo hematoma of the biomimetic scaffold comprises one or more bone substitutes. In some aspects, the mRNA-loaded lipid nanoparticles can be combined with a mineral coated microparticle. In some aspects, the mRNA-loaded lipid nanoparticles can comprise mRNA. In some aspects, the messenger ribonucleic acid (mRNA)-based therapeutic composition can comprise mRNA. In some aspects, the mRNA can encode a protein of interest. The mRNAs can encode any protein of interest. In some aspects, the mRNA can encode roof plate-specific sondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), transforming grow th factors (e.g., TGF-a and TGF-0), and platelet-derived grow th factors (e.g., PDGF-AA and PDGF-BB), insulin-like growth factor-1 (IGF-1), tumor necrosis factor-a (TNF-a), vascular endothelial growth factor (e.g., VEGF A and B), or basic fibroblast growth factor (bFGF). In some aspects, the mRNA can encode bone morphogenetic protein-2 (BMP-2), BMP-2 / BMP-4, BMP-2 / BMP-7, BMP-4 / BMP-7, BMP-6, or BMP-9. In some aspects, the mRNA can encode roof plate-specific spondin-2 (RSPO-2). In some aspects, the mRNA can encode a grow th factor. In some aspects, the growth factor is roof plate-specific spondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2). a transforming growth factors (TGF-a and TGF-0), and a platelet-derived growth factor (PDGF-AA and PDGF-BB), insulin-like growth factor- 1 (IGF-1), tumor necrosis factor-a [TNF-a]), a vascular endothelial growth factor (VEGF A and B), basic fibroblast growth factor (bFGF; known as FGF-2) bone morphogenetic protein 2 (BMP-2), BMP-7, BMP-4, BMP-6, BMP-9, BMP- 14, or BMP-2 / -7. In some aspects, the growth factor can be BMP-2 or BMP-2 / -7. In some aspects, the mRNA can comprise the any of nucleic acid sequences of SEQ ID NOs: 3, 4, 5, 6, 7, 8, 9, 10, or 11.

[0159] Disclosed herein are biomimetic scaffolds comprising a scaffold and an ex vivo hematoma, wherein the ex vivo hematoma comprises: (a) isolated whole blood; (b) sodium citrate; (c) ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition . Disclosed herein are biomimetic scaffolds comprising a scaffold and an ex vivo hematoma, wherein the ex vivo hematoma comprises: (a) platelet rich plasma, plasma, or plasma with red blood cells; (b) ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin andAttorney’s Docket No.: 21105.0097P1

[0160] calcium chloride; (c) and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematoma can comprise fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the ex vivo hematoma can comprise fibrin fibers having a thickness of 100-400 nm ± 10%. In some aspects, the biomimetic scaffold further comprises one or more bone substitutes. In some aspects, the ex vivo hematoma of the biomimetic scaffold comprises one or more bone substitutes. In some aspects, the mRNA-loaded lipid nanoparticles can be combined with a mineral coated microparticle. In some aspects, the mRNA-loaded lipid nanoparticles can comprise mRNA. In some aspects, the messenger ribonucleic acid (mRNA)-based therapeutic composition can comprise mRNA. In some aspects, the mRNA can encode a protein of interest. The mRNAs can encode any protein of interest. In some aspects, the mRNA can encode roof plate-specific sondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), transforming grow th factors (e.g., TGF-a and TGF-P), and platelet-derived growth factors (e.g., PDGF-AA and PDGF-BB), insulinlike growth factor-1 (IGF-1), tumor necrosis factor-a (TNF-a), vascular endothelial grow th factor (e.g., VEGF A and B), or basic fibroblast growth factor (bFGF). In some aspects, the mRNA can encode bone morphogenetic protein-2 (BMP-2), BMP-2 / BMP-4. BMP-2 / BMP-7, BMP-4 / BMP-7, BMP-6, or BMP-9. In some aspects, the mRNA can encode roof platespecific spondin-2 (RSPO-2). In some aspects, the mRNA can encode a grow th factor. In some aspects, the growth factor is roof plate-specific spondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), a transforming growth factors (TGF-a and TGF-P), and a platelet-derived growth factor (PDGF-AA and PDGF-BB), insulin-like growth factor- 1 (IGF-1), tumor necrosis factor-a [TNF-a]), a vascular endothelial growth factor (VEGF A and B), basic fibroblast growth factor (bFGF; known as FGF-2) bone morphogenetic protein 2 (BMP-2), BMP-7, BMP-4. BMP-6, BMP-9, BMP- 14. or BMP-2 / -7. In some aspects, the growth factor can be BMP -2 or BMP-2 / -7. In some aspects, the mRNA can comprise the any of nucleic acid sequences of SEQ ID NOs: 3, 4, 5, 6, 7, 8, 9, 10, or 11.

[0161] In some aspects, the ex vivo hematomas described herein can further be combined with a carrier such as a scaffold. For example, the carrier can be a biodegradable biomaterial scaffold (e.g., silk fibroin scaffolds, poly(lactide-co-glycolide (PLGA), or other similar resorbable products or materials). Such carrier can be used to provide additional mechanical support of the ex vivo hematoma. Examples of scaffolds for use in the disclosed biomimeticAttorney’s Docket No.: 21105.0097P1

[0162] scaffolds, include, but are not limited to a biocompatible scaffold, an osteoconductive scaffold, a three-dimensionally printed scaffold, collagen, absorbable collagen scaffold (collagen type 1 bovine or porcine), collagen bovine membrane, or collagens derived from other mammalian or non-mammalian (such as marine) sources, chitins, bioabsorbable polymers such PLA, or nonabsorbable polymers such as PEEK, or titanium or other biocompatible metallic alloys such as resorbable magnesium (such as magnesium calcium alloys) or a three-dimensionally printed scaffold.

[0163] In some aspects, the scaffolds that can be combined with the ex vivo hematomas described herein can be biocompatible and biodegradable. For instance, the scaffold should elicit a negligible immune reaction in order to prevent it from causing such a severe inflammatory' response that it might reduce healing or cause rejection by the body. In some aspects, the scaffold is amendable to cells adhering to it and so that the cells can function normally and migrate to the surface and eventually through the scaffold to proliferate. The scaffold disclosed herein can also be biodegradable to that cells can produce their own extracellular matrix. The by-products of this degradation can also be non-toxic and able to exit the body without interference from other organs.

[0164] In some aspects, the scaffold can have mechanical properties that are consistent with the anatomical site into which it is to be implanted and strong enough to allow surgical handling during implantation. Further, the scaffold can be sufficient to allow cell infiltration and vascularization. In designing the appropriate scaffold, it is important to consider the architecture of the scaffold. For instance, the scaffolds can be have an interconnected pore structure and high porosity to ensure cellular penetration and adequate diffusion of nutrients to cells. A porous interconnected structure is important to allow- diffusion of waste products out of the scaffold, and the products of scaffold degradation should be able to exit the body without interference with other organs and surrounding tissues.

[0165] In some aspects, the scaffold can be a three-dimensionally printed scaffold. In some aspects, the three-dimensionally printed scaffold can be custom produced.

[0166] The three-dimensional scaffold can be produced using a 3-D printing technique referred to as robotic deposition or direct write (DW) technology. This technique uses a computer controlled printing process and colloidal inks to form three-dimensional structures. These structures can form on the self-components or can be custom formed for filling individual bone defects from tomographic data (X-ray, sonographic or MRI).Attorney’s Docket No.: 21105.0097P1

[0167] Ink fabrication and the printing system itself uses water-based Theologically controlled inks that become solid as they leave the print nozzle. These inks consist of finely controlled ceramic particles in a water-based slurry containing organic chemicals that control the handling characteristics of the colloidal ink. This allows 3-D lattice-like structures to be printed, in layers, without or with minimal sag of unsupported structural elements.

[0168] Using this system, the elements of the first layer can be printed by forcing the ink through a small (~50-400 pm diameter) nozzle onto a support plate, using the x and y coordinate control system of an x-y-z control gantry system. Then the z control system is used to move the nozzle up slightly less than 1 nozzle diameter. Then the next layer is printed over the first layer. This is continued layer-by-layer until the entire 3-D structure is finished.

[0169] The entire structure can be printed in an oil bath to prevent dry ing. The system can have 3 nozzles and ink reservoirs so that up to three materials can be used to print a single structure. Fugitive inks, inks consisting entirely of material that bum off during firing, can also be used as part of the printing process. These can be used to print support structures for complex parts requiring temporary’ supports.

[0170] The resulting structures are then removed from the oil bath, dried, and fired in a programmable furnace to produce the final ceramic structure. Firing is currently done at approximately 1100° C for about four hours, which substantially bums off the organic components, sintering the ceramic particles together into a solid structure. This may cause a small amount of predictable shrinkage that can be calculated into the printing process to produce precise and predictable structures.

[0171] The print nozzles can be routinely cylindrical producing cylindrical rod printed structures. However, nozzles can be made that are shaped to produce non-cylindrical structures or structures with surface striations of sizes designed to control cell migration, growth, and differentiation.

[0172] In some aspects, a variety of biomaterials can be used to fabricate the scaffolds disclosed herein. In some aspects, the biomaterials can be ceramics, synthetic polymers and / or natural polymers or combinations thereof. Examples of ceramics include but are not limited hydroxyapatite (HA) and tri-calcium phosphate (TCP). Examples of synthetic polymers include but are not limited to polystyrene, poly-l-lactic acid (PLLA), polyglycolic acid (PGA) and poly-dl-lactic-co-glycolic acid (PLGA). Examples of natural polymers include but are not limited to collagen, various proteoglycans, alginate-based substrates andAttorney’s Docket No.: 21105.0097P1

[0173] chitosan. The advantage of using natural polymers is that they are biologically active and typically promote excellent cell adhesion and grow th. Furthermore, they are also biodegradable and so allow host cells, over time, to produce their own extracellular matrix and replace the degraded scaffold. In some aspects, the scaffold can be made of a combination of biomaterials. In some aspects, collagen can be combined with a polysaccharide (e.g., glycosaminoglycan). In some aspects, the scaffolds can be prepared by using chemical cross-linking methods.

[0174] In some aspects, the compositions or biomimetic scaffolds comprising the scaffold and ex vivo hematoma can be formulated for local administration. In some aspects, the compositions (e.g., liquid form) or ex vivo hematomas (e.g., gel form) disclosed herein can be combined with any of the carriers or scaffolds disclosed herein and administered locally or implanted surgically or injected percutaneously. In some aspects, the liquid formulation can be delivered through a syringe to the scaffold. In some aspects, the gel formulation can be implanted into the bone defect site. The gel formulation can be prepared using a mold outside of the body that corresponds to the bone size and shape for implantation into the bone defect site. In some aspects, the formulation can be in an intermediate form, between liquid and gel. In some aspects, an intermediate formulation can be applied to a solid scaffold or carrier to bridge gaps that may be present in the solid scaffold itself (e.g., large gaps) while also providing mechanical support independently. Examples of a solid scaffold includes but is not limited to titanium cages or other porous metallic implants. Such scaffolds can be used to reconstruct a skeletal defect or to achieve spinal fusion. The formulations disclosed herein can be used to augment healing when PEEK spinal cages are used for interbody spinal fusions, considering PEEK is itself biologically inert and has no intrinsic bone healing capacity7. Alternatively, any of the formulations disclosed herein can be infused or applied topically to resorbable scaffolds as may be used to reconstruct skeletal defects, segmental or subsegmental. When used in conjunction with either metallic porous implants or resorbable scaffolds, this would also include opening wedge osteotomies (of the femur, tibia, or other long bones), distraction arthrodesis sites, and bone defects related to arthroplasty7.

[0175] Furthermore, any of the biomimetic scaffolds, compositions and ex vivo hematoma formulations disclosed herein can be applied in the same fashion to other arthrodesis sites with bone defects such as the ankle, knee, wrist, shoulder, hip, or other smaller joints, including but not limited to the Lisfranc joint, smaller joints in the hand, wrist, or foot, andAttorney’s Docket No.: 21105.0097P1

[0176] extends to include applications to fill bone defects created when harvesting bone grafts for transposition to a secondary anatomic location.

[0177] Devices

[0178] Disclosed herein are multi-compartment devices for delivering any of the compositions and / or ex vivo hematomas described herein. In some aspects, the multicompartment device can comprise two or more chambers or two or more syringes can be used to deliver components of the ex vivo hematoma, a messenger ribonucleic acid (mRNA)-based therapeutic composition (or mRNA or mRNA-loaded lipid nanoparticles or mRNA-loaded lipid nanoparticles combined with mineral coated microparticles) or a ribonucleic acid (RNA)-based therapeutic composition, and / or the bone substitutes separately. In some aspects, a first chamber or syringe can comprise the coagulants (e.g., calcium chloride, calcium chloride and thrombin, or ecarin) at pre-determined concentrations. In some aspects, a second chamber or syringe can comprise whole blood alone. In some aspects, a second chamber or syringe can comprise whole blood in combination with exogenous growth factors (e.g., BMP2, PDGF, VEGF). In some aspects, a second chamber or syringe can comprise whole blood in combination with bone substitutes (e.g.. DBM, allogeneic cancellous bone chips). In some aspects, a second chamber or syringe can comprise whole blood in combination with exogenous growth factors (e.g., BMP2, PDGF, VEGF) bone substitutes. In some aspects, a third chamber or syringe can comprise exogenous growth factors and additional bone substitutes. In some aspects, a third chamber or syringe can comprise exogenous growth factors. In some aspects, a third chamber or syringe can comprise one or more bone substitutes. In some aspects, a first chamber can comprise isolated whole blood; a second chamber can comprise calcium chloride; thrombin; or thrombin and calcium chloride; and a third chamber can comprise a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, a fourth chamber or syringe can comprise one or more bone substitutes.

[0179] Methods

[0180] Disclosed herein are methods of promoting bone healing. Also disclosed herein are methods of producing bone replacement material. Further disclosed herein are methods of producing implants or biomimetic scaffolds or any of the compositions described herein. In some aspects, the compositions comprising the ex vivo hematoma can also serve as aAttorney’s Docket No.: 21105.0097P1

[0181] scaffold. It some aspects, the compositions comprising the ex vivo hematoma can be combined with a scaffold to form or create a biomimetic scaffold. In some aspects, the methods disclosed herein can be combined. Disclosed herein are methods of promoting bone healing, producing bone replacement material, producing implants, compositions comprising ex vivo hematomas, biomimetic scaffolds or a combination thereof. Also disclosed herein are methods of treating a volumetric muscle loss injury in a subject. Further disclosed herein are methods promoting muscle healing, bone healing, or a combination thereof in a subj ect. Disclosed herein are methods of promoting muscle regeneration, bone regeneration, or a combination thereof.

[0182] Disclosed herein are methods of promoting muscle regeneration, bone regeneration, or a combination thereof. In some aspects, the methods comprise administering to a subject in need thereof a therapeutically effective amount of any of the compositions disclosed herein. In some aspects, the methods can comprise administering to a subject in need thereof a therapeutically effective amount of a composition comprising the ex vivo hematoma disclosed herein. In some aspects, the compositions can further comprise one or more bone substitutes. In some aspects, the methods comprise implanting any of the biomimetic scaffolds described herein into a site of interest in the subject. In some aspects, the biomimetic scaffold can further comprise one or more bone substitutes. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) calcium chloride; thrombin; or thrombin and calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) calcium chloride; thrombin; or thrombin and calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) thrombin. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) thrombin; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolatedAttorney’s Docket No.: 21105.0097P1

[0183] whole blood; (b) sodium citrate; and (c) thrombin and calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) thrombin and calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the ex vivo hematomas can comprise fibrin fibers having a thickness of 100-400 nm± 10%.

[0184] Disclosed herein are methods of treating a volumetric muscle loss (VML) injury in a subject. In some aspects, the methods comprise administering to the subject in need thereof a therapeutically effective amount of any of the compositions disclosed herein. In some aspects, the methods can comprise administering to a subject in need thereof a therapeutically effective amount of a composition comprising the ex vivo hematoma disclosed herein. In some aspects, the compositions can further comprise one or more bone substitutes. In some aspects, the methods comprise implanting any of the biomimetic scaffolds described herein into a site of interest in the subject. In some aspects, the biomimetic scaffold can further comprise one or more bone substitutes. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) calcium chloride; thrombin; or thrombin and calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) calcium chloride; thrombin; or thrombin and calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) thrombin. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) thrombin; and (d) a messenger ribonucleic acid (mRNAj-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) thrombin and calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) thrombin andAttorney’s Docket No.: 21105.0097P1

[0185] calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the ex vivo hematomas can comprise fibnn fibers having a thickness of 100-400 nm± 10%.

[0186] Disclosed herein are methods of promoting muscle healing, bone healing, or a combination thereof. In some aspects, the methods comprise administering to the subject in need thereof a therapeutically effective amount of any of the compositions disclosed herein. In some aspects, the methods can comprise administering to a subject in need thereof a therapeutically effective amount of a composition comprising the ex vivo hematoma disclosed herein. In some aspects, the compositions can further comprise one or more bone substitutes. In some aspects, the methods comprise implanting any of the biomimetic scaffolds described herein into a site of interest in the subject. In some aspects, the biomimetic scaffold can further comprise one or more bone substitutes. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) calcium chloride; thrombin; or thrombin and calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) calcium chloride; thrombin; or thrombin and calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) thrombin. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) thrombin; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) thrombin and calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; (c) thrombin and calcium chloride; and (d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, theAttorney’s Docket No.: 21105.0097P1

[0187] ex vivo hematomas can comprise fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the ex vivo hematomas can comprise fibrin fibers having a thickness of 100-400 nm± 10%.

[0188] Disclosed herein are methods of promoting bone healing or producing bone replacement material or implants. In some aspects, the methods comprise administering to a subj ect in need thereof a therapeutically effective amount of any of the compositions disclosed herein. In some aspects, the methods can comprise administering to a subject in need thereof a therapeutically effective amount of a composition comprising the ex vivo hematoma disclosed herein and one or more bone substitutes. In some aspects, the methods comprise implanting any of the biomimetic scaffold described herein into a site of interest in the subject. In some aspects, the biomimetic scaffold can further comprise one or more bone substitutes.

[0189] In some aspects, the ex vivo hematomas can comprise: (a) isolated whole blood; (b) sodium citrate; and (c) ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride. In some aspects, the ex vivo hematomas can comprise: (a) platelet rich plasma, plasma, or plasma with red blood cells; and (b) ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride. In some aspects, the ex vivo hematoma can further comprise sodium citrate. In some aspects, the ex vivo hematomas can comprise fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the ex vivo hematomas can comprise fibrin fibers having a thickness of 100-400 nm ± 10%. In some aspects, the ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride can result in the formation of one or more fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride can result in the formation of one or more fibrin fibers having a thickness of 100-400 nm ± 10%. In some aspects, the ex vivo hematoma can comprise (a) isolated whole blood and sodium citrate platelet rich plasma, plasma alone, plasma with red blood cells (without platelets) or other blood products; and (b) one or more coagulating factors. In some aspects, the ex vivo hematomas can comprise whole blood and one or more coagulating factors. In some aspects, the whole blood can comprise one or more viable cells. In some aspects, the whole blood can comprise one or more biological factors. In some aspects, the ex vivo hematoma can comprise whole blood, ecarin, and sodium citrate. In some aspects, the ex vivo hematoma canAttorney’s Docket No.: 21105.0097P1

[0190] comprise whole blood, calcium chloride, and sodium citrate. In some aspects, the ex vivo hematoma can comprise platelet rich plasma and ecarin. In some aspects, the ex vivo hematoma can comprise platelet rich plasma and calcium chloride. In some aspects, the ex vivo hematoma can comprise plasma and ecarin. In some aspects, the ex vivo hematoma can comprise plasma and calcium chloride. In some aspects, the ex vivo hematoma can comprise plasma with red blood cells and ecarin. In some aspects, the ex vivo hematoma can comprise plasma with red blood cells and calcium chloride. In some aspects, the ex vivo hematoma can comprise plasma with oscutarin and calcium chloride. In some aspects, the ex vivo hematoma can comprise plasma with thrombin and calcium chloride. In some aspects, the ex vivo hematoma can further comprise bone morphogenetic protein 2 (BMP -2). In some aspects, the BMP -2 can be recombinant BMP -2. In some aspects, the recombinant BMP -2 can comprise human BMP -2. In some aspects, the composition can further comprise one or more growth factors, one or more platelets, and one or more cells. In some aspects, the composition can be formulated as a clot or as a scaffold. In some aspects, the scaffold can be chemotactic. In some aspects, the scaffold can attract endogenous grow th factors conducive to bone healing.

[0191] In some aspects, the one or more bone substitutes can be derived from biological products, be a synthetic bone substitute or a combination thereof. Examples of bone substitutes derived from biological products include but are not limited to demineralized bone matrix (DBM), bone morphogenetic proteins (BMPs), hydroxyapatite (HA) and corals, allogeneic cancellous bone chips, or bone marrow aspirate concentrate (BMAC). including bone graft from long bones harvested using the reamer irrigation aspirator (RIA). In some aspects, the one or more bone substitutes can be derived from a biological product, wherein the biological product can be bone morphogenetic proteins (BMPs), platelet derived growth factor (PDGF). vascular endothelial growth factor (VEGF), demineralized bone matrix (DBM), hydroxyapatite (HA), corals, allogeneic cancellous bone chips, or bone marrow aspirate concentrate (BMAC), including bone graft from long bones harvested using the reamer irrigation aspirator (RIA). In some aspects, the bone substitutes can be synthetic bone substitutes. Examples of synthetic bone substitutes can include but not are limited to calcium sulfate, calcium phosphate cements, beta-tri-calcium phosphate (TCP) ceramics, biphasic calcium phosphates (Hydroxyapatite (HA) and Beta-TCP ceramics), bioactive glasses, and polymer-based bone substitutes. Further examples of synthetic bone substitutes include butAttorney’s Docket No.: 21105.0097P1

[0192] are not limited to Calcigen® S Calcium Sulfate Bone Void Filler, STIMULAN® Beads, HydroSet Injectable Bone Substitute (calcium phosphate), Ossilix calcium phosphate cement, Syntoss Synthetic Beta-Tricalcium Phosphate Bone Graft Material, CERASORB® Tri-Calcium Phosphate Bone Graft, GL1894P / -2058S BIO ACTIVE GLASS, UniGraft Bioactive Glass 200-600um, BonAlive (BonAlive Biomaterials Ltd, Finland), Cerament (bone void filler) and Cerament G (Bonesupport Holding AB, Lund Sweden). Examples of polymers include but are not limited to collagen, gelatin, chitosan, and synthetic polymers such as poly(lactic acid) (PLA), poly(glycolic acid) (PGA), poly caprolactone (PCL) - GalaFIex P4HB biopolymer, and the like. In some aspects, the bone substitutes can be available in a variety of forms including but not limited to dry. moldable or injectable forms, and pastes, powders, putty, granules, gels, sponges, or strips. In some aspects, the bone substitute can be a commercially available product. In some aspects, the bone substitute can be demineralized bone matrix (DBX; MTF Biologies, Edison, NJ), RegenaVate DBM, Puros DBM, StaGraft DBM, or FiberStack DBM (Zimmer Biomet; Warsaw, IN). In some aspects, the DBM can be an allograft cancellous or cortical bone that has been decalcified to produce a product of collagen and non-collagenous protein. Examples of DBMs include but are not limited to Grafton DBM (Osteotech, Inc. Eatontown, New Jersey), Allosource (Denver, Colorado). Dynagraft II (Integra LifeSciences, Plainsboro, New Jersey), DBX (Musculoskeletal Transplant Foundation and Synthes, Paoli, Pennsylvania), Osteofil (Medtronic Sofamor Danek, Minneapolis, Minnesota). Examples of corals include but are not limited to animalia, coelenterate, scleractenia, poratidae. porites species, and gonioporas species; each of which can be used for developing coralline hydroxyapatite (CHA) bone substitute. In some aspects, the bone substitute is not BMP, rhBMP-2 or BMP-2.

[0193] In some aspects, the subject can be a human. In some aspects, the subject has a skeletal defect. In some aspects, the skeletal defect can be a large segmental bone defect. In some aspects, the skeletal defect can be a nonunion. In some aspects, the skeletal defect can be a small segmental bone defect. In some aspects, the skeletal defect can be independent of the size or volume of the defect regardless of whether the defect is complete or incomplete. In some aspects, the subject has a dental bone defect. In some aspects, the subject has a musculoskeletal injury. In some aspects, the subject has a volumetric muscle loss injury.Attorney’s Docket No.: 21105.0097P1

[0194] In some aspects, the subject has one or more bone fractures. In some aspects, the subject has one or more bone injuries. In some aspects, the subject has one or more muscle injuries.

[0195] In some aspects, the subject has one or more bone injuries and one or more muscle injuries. Examples of muscle injuries include but are not limited to volumetric muscle loss (e.g., loss of a significant volume of muscle tissue due to trauma, surgery', blast injuries or other causes); large muscle defects (e.g., injuries that result in the removal or loss of a substantial portion of a muscle; extensive muscle trauma (e.g., injuries involving severe damage to a wide area of muscle tissue; complex muscle injuries (e.g., injuries that affect multiple layers and regions of a muscle, requiring a comprehensive approach to repair; severe contusions or crush injuries (e.g., high-impact injuries that cause extensive damage to the muscle structure); extensive surgical resections (e.g., removal of a significant portion of muscle tissue during surgery, often to address medical conditions such as tumors); and degloving injuries (e.g., injuries that involve the separation of skin and subcutaneous tissue from the underlying muscle, leading to volumetric muscle loss).

[0196] In some aspects, the composition can be formulated as a clot or a scaffold. In some aspects, the composition can be formulated for local administration and combined with any of the scaffolds disclosed herein. In some aspects, the composition can be administered locally via a carrier or a scaffold. In some aspects, the composition can be administered locally without a carrier or a scaffold. In some aspects, the composition can be implanted or delivered percutaneously. In some aspects, the composition can be implanted. In some aspects, the composition can be implanted either directly or indirectly. In some aspects, the composition can be delivered by a surgeon or by any autonomous or semi-autonomous delivery' device acting on behalf of a human or robotic / semi-autonomous agent. In some aspects, the composition can be delivered percutaneously.

[0197] Disclosed herein are methods of constructing an implant. In some aspects, the methods can comprise: a) dimensioning a depot implant in at least one of a shape and a size that facilitates implantation of the depot implant into a bone defect; and b) structuring the depot implant to have a scaffold by introducing: (i) isolated whole blood and sodium citrate; or platelet rich plasma, plasma, or plasma with red blood cells; (ii) ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride; and (iii) a bone substitute to create the scaffold. In some aspects, the scaffold can have a porosity of 55Attorney’s Docket No.: 21105.0097P1

[0198] to 75%. In some aspects, the scaffold can comprise fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the scaffold can comprise fibrin fibers having a thickness of 100-400 nm ± 10%. In some aspects, the shape of the depot implant can be that of a cylinder or a sphere or any other shape. In some aspects, the scaffold can be constructed as a clot. In some aspects, one or more grow th factors can be introduced into the scaffold. In some aspects, the one or more growth factors can be bone morphogenetic protein 2 (BMP-2), BMP-7, BMP-4, BMP-6, BMP-9, BMP- 14, platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF). fibroblast growth factor 2 (FGF-2), or a combination thereof. In some aspects, the BMP-2 can be introduced into the scaffold. In some aspects, the amount of ecarin present in the scaffold can be at least 0.05 U / mL; and the amount of BMP -2 present in the scaffold can be at least 0.01 mg. In some aspects, the ratio of the ex vivo hematoma to bone substitute can be from 1000:1 to 1:1000. In some aspects, the scaffold can resemble the size and shape of a given bone defect. In some aspects, the scaffold can be chemotactic. In some aspects, the scaffold can comprise viable blood cells and appropriate biological factors. In some aspects, the bone substitute can be demineralized bone matrix. In some aspects, the bone substitute can be derived from a biological product, a synthetic bone substitute or a combination thereof. In some aspects, the biological product can be a demineralized bone matrix, hydroxyapatite, or a coral. In some aspects, the synthetic bone substitute can be calcium sulfate, a calcium phosphate cement, P-tri-calcium phosphate ceramics, bioactive glasses, or a polymer. In some aspects, the one or more growth factors is not BMP, rhBMP-2, BMP-2, BMP-7, BMP-4. BMP-6, BMP-9, or BMP- 14.

[0199] Also disclosed herein are methods of constructing an implant. In some aspects, the methods can comprise: a) dimensioning a depot implant in at least one of a shape and a size that facilitates implantation of the depot implant into a bone defect; and b) structuring the depot implant to have a scaffold by introducing: (i) isolated whole blood and sodium citrate; or platelet rich plasma, plasma, or plasma with red blood cells; (ri) ecarin; oscutann and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride; and (iii) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition to create the scaffold. In some aspects, the step b) can further comprise a bone substitute to create the scaffold. In some aspects, the scaffold can have a porosity7of 55 to 75%. In some aspects, the scaffold can comprise fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the scaffold can comprise fibrinAttorney’s Docket No.: 21105.0097P1

[0200] fibers having a thickness of 100-400 nm ± 10%. In some aspects, the shape of the depot implant can be that of a cylinder or a sphere or any other shape. In some aspects, the scaffold can be constructed as a clot. In some aspects, one or more growth factors can be introduced into the scaffold. In some aspects, the one or more growth factors can be bone morphogenetic protein 2 (BMP-2), BMP-7, BMP-4, BMP-6, BMP-9, BMP-14, platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), fibroblast growth factor 2 (FGF-2), or a combination thereof. In some aspects, the BMP-2 can be introduced into the scaffold. In some aspects, the amount of ecarin present in the scaffold can be at least 0.05 U / mL; and the amount of BMP-2 present in the scaffold can be at least 0.01 mg. In some aspects, the ratio of the ex vivo hematoma to bone substitute can be from 1000: 1 to 1 : 1000. In some aspects, the scaffold can resemble the size and shape of a given bone defect. In some aspects, the scaffold can be chemotactic. In some aspects, the scaffold can comprise viable blood cells and appropriate biological factors. In some aspects, the bone substitute can be demineralized bone matrix. In some aspects, the bone substitute can be derived from a biological product, a synthetic bone substitute or a combination thereof. In some aspects, the biological product can be a demineralized bone matrix, hydroxyapatite, or a coral. In some aspects, the synthetic bone substitute can be calcium sulfate, a calcium phosphate cement, P-tri-calcium phosphate ceramics, bioactive glasses, or a polymer. In some aspects, the one or more growth factors is not BMP, rhBMP-2, BMP -2, BMP-7, BMP -4, BMP-6, BMP -9, or BMP- 14. In some aspects, the mRNA-loaded lipid nanoparticles can be combined with a mineral coated microparticle. In some aspects, the mRNA-loaded lipid nanoparticles can comprise mRNA. In some aspects, the messenger ribonucleic acid (mRNA)-based therapeutic composition can comprise mRNA. In some aspects, the mRNA can encode a protein of interest. The mRNAs can encode any protein of interest. In some aspects, the mRNA can encode roof plate-specific sondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), transforming growth factors (e.g., TGF-a and TGF-[3), and platelet-derived growth factors (e.g., PDGF-AA and PDGF-BB), insulin-like growth factor-1 (IGF-1), tumor necrosis factor-a (TNF-a), vascular endothelial growth factor (e.g., VEGF A and B), or basic fibroblast growth factor (bFGF). In some aspects, the mRNA can encode bone morphogenetic protein-2 (BMP-2), BMP-2 / BMP-4, BMP-2 / BMP-7, BMP-4 / BMP-7, BMP-6, or BMP-9. In some aspects, the mRNA can encode roof plate-specific spondin-2 (RSPO-2). In some aspects, the mRNA can encode a growth factor. In some aspects, the growth factor is roof plate-specific spondin-2 (RSPO-2),Attorney’s Docket No.: 21105.0097P1

[0201] nuclear factor erythroid 2-related factor 2 (NRF2), a transforming grow th factors (TGF-a and TGF-P), and a platelet-derived growth factor (PDGF-AA and PDGF-BB), insulin-like growth factor- 1 (IGF-1), tumor necrosis factor-a [TNF-a]), a vascular endothelial growth factor (VEGF A and B), basic fibroblast growth factor (bFGF; known as FGF-2) bone morphogenetic protein 2 (BMP-2), BMP-7, BMP-4, BMP-6, BMP -9, BMP-14, or BMP-2 / -7. In some aspects, the growth factor can be BMP-2 or BMP-2 / -7. In some aspects, the mRNA can comprise the any of nucleic acid sequences of SEQ ID NOs: 3, 4. 5, 6, 7, 8, 9, 10, or 11.

[0202] Also, disclosed herein are methods of constructing a biomimetic scaffold. In some aspects, the methods can comprise: a) dimensioning a scaffold in at least one of a shape and a size that facilitates implantation of the scaffold into a bone defect; and b) combining the scaffold in a) with an ex vivo hematoma comprising: (i) isolated whole blood and sodium citrate; or platelet rich plasma, plasma, or plasma with red blood cells; and (ii) ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride to create the biomimetic scaffold. In some aspects, the scaffold can have a porosity of 55 to 75%. In some aspects, the scaffold can comprise fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the scaffold can comprise fibrin fibers having a thickness of 100-400 nm ± 10%. In some aspects, the shape of the scaffold can be that of a cylinder or a sphere or any other shape. In some aspects, the shape of the scaffold can be that any and all other geometric shape or shapes that could theoretically occupy a discrete subset or volume within Euclidean space. In some aspects, the scaffold can be collagen, chitins, bioabsorbable polymers, nonabsorbable polymers such as PEEK, or titanium or a metallic alloy. In some aspects, one or more growth factors can be introduced into the scaffold or ex vivo hematoma. In some aspects, the one or more grow th factors can be bone morphogenetic protein 2 (BMP -2), BMP-7, BMP -4, BMP-6, BMP-9, BMP-14, platelet-derived growth factor (PDGF). vascular endothelial growth factor (VEGF), fibroblast growth factor 2 (FGF-2), or a combination thereof. In some aspects, the BMP-2 can be introduced into the scaffold or ex vivo hematoma. In some aspects, the amount of ecarin present in the scaffold or ex vivo hematoma can be at least 0.05 U / mL; and the amount of BMP -2 present in the scaffold or ex vivo hematoma can be at least 0.01 mg. In some aspects, the ratio of the ex vivo hematoma to bone substitute can be from 1000: 1 to 1 : 1000. In some aspects, the ex vivo hematoma can comprise viable blood cells and appropriate biological factors. In some aspects, the bone substitute can be demineralized bone matrix. In some aspects, the bone substitute can beAttorney’s Docket No.: 21105.0097P1

[0203] derived from a biological product, a synthetic bone substitute or a combination thereof. In some aspects, the biological product can be a demineralized bone matrix, hydroxyapatite, or a coral. In some aspects, the synthetic bone substitute can be calcium sulfate, a calcium phosphate cement, P-tri-calcium phosphate ceramics, bioactive glasses, or a polymer. In some aspects, the scaffold can resemble the size and shape of a given bone defect. In some aspects, the scaffold can be chemotactic. Additionally, the scaffold can be biodegradable such that it degrades without the necessity of surgical removal. In some aspects, the one or more growth factors is not BMP, rhBMP-2, BMP-2, BMP-7, BMP-4. BMP-6, BMP-9, or BMP-14.

[0204] Further disclosed herein are methods of constructing a biomimetic scaffold. In some aspects, the methods can comprise: a) dimensioning a scaffold in at least one of a shape and a size that facilitates implantation of the scaffold into a bone defect; b) combining the scaffold in a) with an ex vivo hematoma comprising: (i) isolated whole blood and sodium citrate; or platelet rich plasma, plasma, or plasma with red blood cells; and (ii) ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride to create the biomimetic scaffold; c) combining the biomimetic scaffold in b) with a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition. In some aspects, the scaffold can have a porosity of 55 to 75%. In some aspects, the scaffold can comprise fibrin fibers having a thickness of at least 150-300 nm ± 10%. In some aspects, the scaffold can comprise fibrin fibers having a thickness of 100-400 nm ± 10%. In some aspects, the shape of the scaffold can be that of a cylinder or a sphere or any other shape. In some aspects, the shape of the scaffold can be that any and all other geometric shape or shapes that could theoretically occupy a discrete subset or volume within Euclidean space. In some aspects, the scaffold can be collagen, chitins, bioabsorbable polymers, nonabsorbable polymers such as PEEK, or titanium or a metallic alloy. In some aspects, one or more growth factors can be introduced into the scaffold or ex vivo hematoma. In some aspects, the one or more growth factors can be bone morphogenetic protein 2 (BMP-2), BMP-7, BMP -4, BMP-6, BMP-9, BMP- 14, platelet-derived growth factor (PDGF), vascular endothelial grow th factor (VEGF), fibroblast growth factor 2 (FGF-2), or a combination thereof. In some aspects, the BMP -2 can be introduced into the scaffold or ex vivo hematoma. In some aspects, the amount of ecarin present in the scaffold or ex vivo hematoma can be at least 0.05 U / mL; and the amount of BMP -2 present in the scaffold or ex vivo hematoma can be at least 0.01 mg. In some aspects, the ratio of the ex vivo hematoma toAttorney’s Docket No.: 21105.0097P1

[0205] bone substitute can be from 1000:1 to 1:1000. In some aspects, the ex vivo hematoma can comprise viable blood cells and appropriate biological factors. In some aspects, the bone substitute can be demineralized bone matrix. In some aspects, the bone substitute can be derived from a biological product, a synthetic bone substitute or a combination thereof. In some aspects, the biological product can be a demineralized bone matrix, hydroxyapatite, or a coral. In some aspects, the synthetic bone substitute can be calcium sulfate, a calcium phosphate cement, P-tri-calcium phosphate ceramics, bioactive glasses, or a polymer. In some aspects, the scaffold can resemble the size and shape of a given bone defect. In some aspects, the scaffold can be chemotactic. Additionally, the scaffold can be biodegradable such that it degrades without the necessity of surgical removal. In some aspects, the one or more growth factors is not BMP, rhBMP-2, BMP-2, BMP-7, BMP-4, BMP-6, BMP-9, or BMP-14. In some aspects, the mRNA-loaded lipid nanoparticles can be combined with a mineral coated microparticle. In some aspects, the mRNA-loaded lipid nanoparticles can comprise mRNA. In some aspects, the messenger ribonucleic acid (mRNA)-based therapeutic composition can comprise mRNA. In some aspects, the mRNA can encode a protein of interest. The mRNAs can encode any protein of interest. In some aspects, the mRNA can encode roof plate-specific sondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2). transforming growth factors (e.g., TGF-a and TGF-P), and platelet-derived growth factors (e.g., PDGF-AA and PDGF-BB), insulin-like growth factor-1 (IGF-1), tumor necrosis factor-a (TNF-a), vascular endothelial growth factor (e.g., VEGF A and B), or basic fibroblast growth factor (bFGF). In some aspects, the mRNA can encode bone morphogenetic protein-2 (BMP-2), BMP-2 / BMP-4, BMP-2 / BMP-7, BMP-4 / BMP-7, BMP-6, or BMP-9. In some aspects, the mRNA can encode roof plate-specific spondin-2 (RSPO-2). In some aspects, the mRNA can encode a grow th factor. In some aspects, the growth factor is roof plate-specific spondin-2 (RSPO-2), nuclear factor ery throid 2-related factor 2 (NRF2), a transforming growth factors (TGF-a and TGF-P), and a platelet-derived growth factor (PDGF-AA and PDGF-BB), insulin-hke growth factor-1 (IGF-1), tumor necrosis factor-a [TNF-a]), avascular endothelial growth factor (VEGF A and B), basic fibroblast growth factor (bFGF; known as FGF-2) bone morphogenetic protein 2 (BMP-2), BMP-7, BMP-4. BMP-6, BMP -9, BMP-14, or BMP-2 / -7. In some aspects, the growth factor can be BMP-2 or BMP-2 / -7. In some aspects, the mRNA can comprise the any of nucleic acid sequences of SEQ ID NOs: 3, 4, 5, 6, 7, 8, 9, 10, or 11.Attorney’s Docket No.: 21105.0097P1

[0206] In some aspects, the composition can be implanted as all or part of a biomimetic scaffold. In some aspects, the composition can be injected with a syringe into a carrier or scaffold. In some aspects, the amount of the ecarin present in the composition can be at least 0.05 U / mL; and the amount of BMP-2 present in the composition can be at least 0.01-5 mg or any amount in between. In some aspects, the amount of the ecarin present in the composition can be at least 0.05 U / mL and the amount of BMP -2 present in the composition can be at least 0.01-1 pg or any amount in between. In some aspects, the ratio of the ex vivo hematoma to bone substitute can be from 1000:1 to 1:1000 or any ratio in between.

[0207] In some aspects, the treatment regimen can be a standard treatment regimen for treating any bone defect. Briefly, the defect wound can be debrided, fixed with an internal plate, external fixator or intramedullary nail. The compositions; compositions and scaffolds; and biomimetic scaffolds and ex vivo hematomas described herein can then be inserted as a unit into the skeletal defect before closing the wound. In some aspects, the components of the compositions; the components of the compositions and the scaffolds; and biomimetic scaffolds and the components of the ex vivo hematomas described herein can then be inserted as separately into the skeletal defect before closing the wound. For example, a multicompartment device comprising two or more chambers or two or more syringes can be used to deliver components of the ex vivo hematoma and the bone substitutes separately. In some aspects, a first chamber or syringe can comprise the coagulants (e.g., calcium and thrombin, or ecarin) at pre-determined concentrations. In some aspects, a second chamber or syringe can comprise whole blood alone. In some aspects, a second chamber or syringe can comprise whole blood in combination with exogenous growth factors (e.g., BMP2, PDGF, VEGF). In some aspects, a second chamber or syringe can comprise whole blood in combination with bone substitutes (e.g., DBM, allogeneic cancellous bone chips). In some aspects, a second chamber or syringe can comprise whole blood in combination with exogenous grow th factors (e.g.. BMP2. PDGF. VEGF) bone substitutes. In some aspects, a third chamber or synnge can comprise exogenous growth factors and additional bone substitutes. In some aspects, a third chamber or syringe can comprise exogenous growth factors. In some aspects, a third chamber or syringe can comprise one or more bone substitutes. In some aspects, a fourth chamber or syringe can comprise one or more bone substitutes. In some aspects, the one or more growth factors is not BMP, rhBMP-2, BMP-2, BMP-7, BMP-4, BMP-6, BMP-9, or BMP- 14.Attorney’s Docket No.: 21105.0097P1

[0208] The treatment regimen can be consistent and invariant provided there is no infection present and the defect is otherwise ready for definitive treatment. The compositions or biomimetic scaffold (or implant) disclosed herein can be inserted into bone areas by entering the body through the skin or through a body cavity or an anatomical opening to minimize any additional damage to nearby structures. Selection of the type, including size and shape, of the compositions, biomimetic scaffold, scaffold or implant can be based upon many factors, including, but not limited to, the shape and / or size of the bone into which the compositions, biomimetic scaffold, scaffold or implant is to be implanted; the percentage of bone density (i.e., the porousness of the remaining bone); and / or the desired rate and distribution of diffusion of the scaffold or implant into the bone; or a combination of such factors. In some aspects, the shape of the compositions, biomimetic scaffold, scaffold or implant can be constructed to match the shape of the bone or vertebral body and thus allow for a more uniform distribution of the compositions, biomimetic scaffold, implant or ex vivo hematoma or the components present in the composition, scaffold, biomimetic scaffold, implant or ex vivo hematoma. Application of the composition, biomimetic scaffold or implant can occur at the time of surgery or in any other suitable manner.

[0209] In some aspects, the shape of the depot implant or scaffold can be that of a sphere or cylinder. In some aspects, the shape of the depot implant or scaffold can be of any shape. In some aspects, the shape of the depot implant or scaffold can be that of a sphere or any other patient specific geometries, forms, or shapes as dictated by clinical exigency. In some aspects, the cylinder shape can be at least 5 mm to about 30 cm (or more) in length. In some aspects, the cylinder shape can be at least 1 mm to about 60 mm (or more) in diameter. In some aspects, the cylinder shape can be straight, and / or curved. In some aspects, the cylinder shape can be a straight rod or a curved rod. The cylinder or rod shape can be any shape with a longitudinal axis that can be longer along one direction than in other directions. The cross-sectional shape of the depot across the longitudinal axis can be any shape. In some aspects, the cross-section shape can be elliptical, circular, trefoil, or any other shape. In some aspects, the depot or scaffold can be either straight or curved in such longitudinal direction. The end surface of the depot or scaffold can be shaped such that it is either flat, rounded or convoluted in shape.

[0210] The dimensions of the implant depot or scaffold or ex vivo hematoma can depend on the size of the bone defect and the anatomical site treated. In some aspects, the scaffold canAttorney’s Docket No.: 21105.0097P1

[0211] be approximately 20% longer than the actual size of the defect, so that it tightly fits and completely fills the volume of the missing bone. For example, if the size of the bone defect is 3 cm. and it is an adult midshaft femur, the implant depot or scaffold or ex vivo hematoma will likely need to be constructed with dimensions, for example, that are about 3-4 cm in diameter and 3.6 cm in length. In some aspects, the implant depot or scaffold or ex vivo hematoma can resemble the size and shape of a given bone defect. In some aspects, the implant depot or scaffold can be chemotactic.

[0212] Also disclosed herein are methods of using any of the compositions described herein and combining said compositions with any of the scaffolds described herein to initiate or enhance bone healing. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to reconstruct segmental bone defects. Also disclosed herein are methods of using any of the biomimetic scaffold and compositions described herein to reconstruct segmental bone defects resulting from tumors, trauma, or infection, using ecarin to create a biomimetic scaffold or biomimetic scaffold that initiates the normal fracture healing cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0213] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat fractures at risk (e.g., in the osteoporotic, diabetic, elderly, or smokers). Also disclosed herein are methods of using any of the biomimetic scaffolds and compositions described herein to treat fractures at risk using ecarin to initiate the normal fracture healing cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0214] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat aty pical femur fractures. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat atypical femur fractures percutaneously using ecarin to create an ex vivo hematoma that initiates the normal fracture healing cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0215] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat minimally’ displaced femoral neck fractures. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat minimally displaced femoral neck fractures percutaneously using ecarin toAttorney’s Docket No.: 21105.0097P1

[0216] create an ex vivo hematoma that initiates the normal fracture healing cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous grow th factors locally.

[0217] Also disclosed herein are methods of using any of the biomimetic scaffolds and compositions described herein to treat osteoporotic insufficiency fractures (pelvis, spine). Also disclosed herein are methods of using any of the biomimetic scaffolds and compositions described herein to treat osteoporotic insufficiency fractures (e.g., pelvis, spine) percutaneously using ecarm to create an ex vivo hematoma that initiates the normal fracture healing cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0218] Also disclosed herein are methods of using any of the compositions described herein to augment spinal fusion procedures in conjunction with scaffolds such as spinal cages (either ceramic, PEEK, or metallic alloys). Also disclosed herein are methods of using any of the compositions described herein to augment spinal fusion procedures in conjunction with scaffolds such as spinal cages (either ceramic, PEEK, or metallic alloys) that allow full immediate weight-bearing, provide more stable fixation, and enhance postoperative recovery, using ecarm to induce local formation of an ex vivo hematoma embedded on the substrate comprising the cage (scaffold), that initiates a bone healing cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous grow th factors locally.

[0219] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat delayed union of long bone fractures (percutaneously or open). Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat delayed union of long bone fractures (percutaneously or open) using ecarin to create an ex vivo hematoma, that initiates a fracture healing cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0220] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat established non-unions of long bone fractures (percutaneously or open). Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat established non-unions of long bone fractures (percutaneously or open) using ecarin to create an ex vivo hematoma, that initiates aAttorney’s Docket No.: 21105.0097P1

[0221] fracture healing cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0222] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to improve (e.g. accelerate) healing of long bone fractures. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to improve (e.g., accelerate) healing of long bone fractures in selected candidates (such as high-performance athletes) to facilitate more rapid recovery, by using ecarin to create an ex vivo hematoma, that initiates a fracture healing cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0223] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to accelerate healing of long bone fractures in selected veterinary candidates (such as thoroughbred racehorses). Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to accelerate healing of long bone fractures in selected veterinary candidates (such as thoroughbred racehorses) to facilitate more rapid recovery, by using ecarin to create an ex vivo hematoma, that initiates a fracture healing cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0224] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to facilitate more rapid and predictable dental and maxilla-facial reconstructions. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to facilitate more rapid and predictable dental and maxilla-facial reconstructions by using ecarin to create an ex vivo hematoma that initiates a bone formation cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0225] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to and reverse conditions resulting in spontaneous jaw bone resorption. Also disclosed herein are methods of using any of the compositions described herein to and reverse conditions resulting in spontaneous jaw bone resorption, using ecarin to create an ex vivo hematoma to regenerate bone locally.

[0226] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat and / or reverse conditions resulting in spontaneousAttorney’s Docket No.: 21105.0097P1

[0227] osteonecrosis. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to and reverse conditions resulting in spontaneous osteonecrosis, using ecarin to create an ex vivo hematoma delivered percutaneously or open (such as Kienbock’s disease, avascular necrosis of the femoral head, and osteonecrosis of various other anatomic locations including, but not limited to, the femoral condyles).

[0228] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat and / or reverse conditions resulting in spontaneous avascular necrosis of the femoral head where the femoral head has collapsed. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat and / or reverse conditions resulting in spontaneous avascular necrosis of the femoral head where the femoral head has collapsed, using ecarin to create an ex vivo hematoma delivered in an open procedure following surgical dislocation of the hip.

[0229] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat osteonecrosis resulting from chemotherapy, alcoholism, smoking, or other exogenous agents. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to treat osteonecrosis resulting from chemotherapy, alcoholism, smoking, or other exogenous agents, using ecarin to create an ex vivo hematoma delivered percutaneously or open.

[0230] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to augment any standard fusion procedures. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to augment any standard fusion procedures (e.g., hip, knee, ankle, wrist, elbow, shoulder, subtalar joint, any of the limited fusions in the carpus or midfoot, fusions in any of the smaller joints such as the hallux, pollex, or lesser digits, either toes or fingers), using ecarin to create an ex vivo hematoma, that initiates a bone formation cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0231] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to accelerate healing of scaphoid waist fractures. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to accelerate healing of scaphoid waist fractures to facilitate more rapid recovery, by using ecarin to create an ex vivo hematoma that initiates a fracture healing cascade byAttorney’s Docket No.: 21105.0097P1

[0232] delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0233] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to reconstruct complex skeletal defects. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to reconstruct complex skeletal defects in the skull, whether resulting from trauma, tumour, or infection, by using ecarin to create an ex vivo hematoma that initiates a bone formation cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0234] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to accelerate healing of sternotomies. Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein to accelerate healing of sternotomies associated with open heart surgery to facilitate more rapid recovery, by using ecarin to create an ex vivo hematoma that initiates a fracture healing cascade by delivering catalytic amounts of BMP or one or more bone substitutes that then hyperactivates endogenous growth factors locally.

[0235] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein in joint arthroplasty’ components w ith specially adapted bone ingrow th surfaces augmented with ecarin to induce local formation of an ex vivo hematoma embedded on a structural substrate, that more rapidly initiates a bone healing cascade.

[0236] Also disclosed herein are methods of using any of the compositions and biomimetic scaffolds described herein with osseointegration stems and components with specially adapted bone ingrowth surfaces augmented with ecarin to induce local formation of an ex vivo hematoma embedded on a structural substrate, that more rapidly initiates a bone healing cascade.

[0237] In some aspects, the one or more bone substitutes is not BMP. rhBMP-2, BMP-2. BMP-7, BMP-4, BMP-6, BMP-9, or BMP-14.

[0238] As used herein, the term “biomimetic hematoma” can be used to refer to an “ex vivo hematoma”.

[0239] Also disclosed herein are methods of using any of the compositions described herein to reduce bleeding or manage bleeding.Attorney’s Docket No.: 21105.0097P1

[0240] Also disclosed herein are methods of using any of the compositions described herein to manage widespread venous bleeding / ooze during surgical procedures. In some aspects, in the methods disclosed herein any of the compositions described herein can be formulated to be sprayed on topically as an aqueous aerosol (using an atomizer for ecarin distribution to affected areas).

[0241] Also disclosed herein are methods of using any of the compositions described herein to manage bleeding or stop bleeding from individual injured vessels (e.g., massive bleeder) intra-operatively or in an emergency casualty situation. In some aspects, in the methods disclosed herein any of the compositions described herein can be administered on a bead (e g. magnetic bead). In some aspects, in the methods disclosed herein any of the compositions described herein can be applied as a clamp / clamshell on the end of a vessel to simultaneously clamp off and deliver ecarin locally, restricting the application to the specific injured vessel end. The clamp or clamp element can constrict the adjacent injured vessel adjacent, and can eliminate or minimize the risk of systemic administration of the compositions.

[0242] Also disclosed herein are methods of using any of the compositions described herein as a selective embolization. In some aspects, in the methods disclosed herein any of the compositions described herein can be delivered via an interventional radiologist to one or more targeted blood vessels to manage or stop intra-pelvic / intra-abdominal / oesophageal / intra-cranial bleeding using a long radiographically directed catheter that then allows selective and highly specific administration of ecarin limited to discrete pathology as indicated (e.g., similar to methods carried out using angiographic coils).

[0243] Also disclosed herein are methods of using any of the compositions described herein to treat menometrorrhagia. In some aspects, the methods disclosed herein can be used to direct the installation or placement of any of the compositions described herein into the uterus in affected women. In some aspects, ecarin can be formulated to be delivered as part of a bio-degradable collagen bead(s).

[0244] Also disclosed herein are methods of using any of the compositions described herein to treat hemophiliac associated spontaneous hemarthrosis. In some aspects, ecarin can be formulated to be delivered as part of a bio-degradable collagen bead(s).

[0245] Also disclosed herein are methods of using any of the compositions described herein to treat spontaneous hemarthrosis related to an anti-coagulant overdose (e.g., warfarin,Attorney’s Docket No.: 21105.0097P1

[0246] coumadin, etc.). In some aspects, ecarin can be formulated to be delivered as part of a biodegradable collagen bead(s).

[0247] Also disclosed herein are methods of using any of the compositions described herein to treat spontaneous intra-muscular bleeds related to an anti-coagulant overdose (e.g., warfarin, coumadin, etc.). In some aspects, in the methods disclosed herein any of the compositions described herein can be used as a selective embolization.

[0248] Also disclosed herein are methods of using any of the compositions described herein to treat spontaneous intra-muscular bleeds related to haemophilia. In some aspects, in the methods disclosed herein any of the compositions described herein can be used as a selective embolization.

[0249] Also disclosed herein are methods of using any of the compositions described herein to treat post-operative hemarthrosis in any elective total knee replacement. In some aspects, ecarin can be formulated to be delivered as part of a bio-degradable collagen bead(s) or nanoparticle(s). In some aspects, the bio-degradable collagen bead(s) or nanoparticle(s) can be delivered or sprinkled liberally into the joint immediately prior to closure of the wound.

[0250] Also disclosed herein are methods of using any of the compositions described herein to treat epistaxis. In some aspects, ecarin can be formulated to be delivered as part of a biodegradable collagen bead(s). In some aspects, the bio-degradable collagen bead(s) can be embedded in a fabric packing material or enclosed within a fabric sheath to limit their distribution and contain them locally. In some aspects, ecarin can be delivered in the form of a nasal pack, such that the ecarin is formulated to be a part of a bio-degradable collagen bead(s) that is embedded in a fabric packing material or enclosed within a fabric sheath.

[0251] Also disclosed herein are methods of using any of the compositions described herein to treat retinal haemorrhage. In some aspects, in the methods disclosed herein any of the compositions described herein can be used as a selective embolization. In some aspects, ecarin can be formulated to be delivered as part of a bio-degradable collagen bead(s) or nanoparticle(s). In some aspects, the bio-degradable collagen bead or nanoparticle formulation can be used to create a Velcro-type effect by creating a self-adherent geometry' to minimize the risk of recurrence and actively address retinal detachment.

[0252] In some aspects, "bleeding" can be a hemorrhage. In some aspects, blood can be escaping the circulatory system from one or more damaged blood vessels. In some aspects, bleeding can be internal or external.Attorney’s Docket No.: 21105.0097P1

[0253] ARTICLES OF MANUFACTURE

[0254] The compositions and biomimetic scaffolds described herein can be packaged in a suitable container labeled, for example, for use as a therapy to treat bone defects or any of the methods disclosed herein. In some aspects, the composition comprising the ex vivo hematomas described herein can be packaged in a suitable container labeled, for example, for use as a therapy to treat bone defects or any of the methods disclosed herein, and can be packaged separately from the scaffold portion of the biomimetic scaffold. Accordingly, packaged products (e.g., scaffolds, sterile containers containing the compositions including the individual components of any of the compositions or ex vivo hematomas described herein and packaged for storage, shipment, or sale at concentrated or ready-to-use concentrations) and kits, including at least isolated whole blood and sodium citrate; or platelet rich plasma, plasma, or plasma with red blood cells; and ecarin; oscutarin and calcium chloride; calcium chloride; thrombin; or thrombin and calcium chloride; and a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition as described herein and instructions for use, are also w ithin the scope of the disclosure. A product can include a container (e g., a vial, jar, bottle, bag. or the like) containing the biomimetic scaffold or composition or ex vivo hematomas described herein. In addition, an article of manufacture further may include, for example, packaging materials, instructions for use, syringes, buffers or other control reagents for treating or monitoring the condition for which prophylaxis or treatment is required. The product may also include a legend (e.g., a printed label or insert or other medium describing the product's use (e.g., an audio- or videotape). The legend can be associated with the container (e.g., affixed to the container) and can describe the manner in which the biomimetic scaffold, compositions or ex vivo hematomas therein should be administered (e.g., the frequency and route of administration), indications therefore, and other uses. The biomimetic scaffolds or compositions or ex vivo hematomas can be ready for administration (e.g., present in dose-appropriate units), and may include a pharmaceutically acceptable adjuvant, carrier or other diluent. Alternatively, the compounds can be provided in a concentrated form with a diluent, with accompanying instructions for dilution.Attorney’s Docket No.: 21105.0097P1

[0255] EXAMPLES

[0256] Example 1: Ex-vivo Hematoma for Musculoskeletal Regeneration.

[0257] The disclosed ex vivo hematomas or biomimetic hematoma scaffolds can be used to deliver growth factors for VML regeneration. Both muscle and bone inj uries begin with hematoma formation. Experiments were performed to investigate whether the ex vivo hematoma disclosed herein can act as a delivery vehicle for mRNA, for example mRNA encoding roof plate-specific spondin-2 (RSPO-2), to regenerate volumetric muscle defects. mRNA lipid nanoparticles encoding for RSPO-2 w ere delivered via a mineral-coated microparticle (MCM) system to ensure efficient, localized delivery. RSPO-2. implicated in myogenic differentiation and neuromuscular junction formation, can promote myogenesis through leucine-rich repeat-containing G-protein coupled receptors (LGRs). Following skeletal muscle injury. LGR5 is upregulated in myogenic progenitors, contributing to muscle regeneration and satellite cell renewal. The results demonstrated successful regeneration in a VML defect (30% of the tibialis anterior muscle) using 25 pg RSPO-2 mRNA LNPs + MCMs after 2 weeks. Histological assessment revealed morphology and revascularization resembling native muscle in a rat model of volumetric muscle loss. Thus, the ex vivo hematomas comprising mRNA RSPO-2 LNPs can be used as a treatment strategy7for promoting muscle regeneration.

[0258] These results are significant because it is the first to use an autologous scaffold, the ex vivo hematoma (biomimetic hematoma) w hich can replicate the properties of naturally healing muscle hematoma. Previous treatment strategies and recently developed biomaterial scaffolds have overlooked the innate hematoma formed at the injury7site, an important player in initiating the healing process.

[0259] Disclosed herein are experiments to study the impact of RSPO-2 mRNA LNPs have on changes of the architecture of the ex vivo hematoma and gene expression. Using and / or administering the ex vivo hematoma disclosed herein can enhance the effectiveness of delivered biologically active molecules for the functional regeneration of volumetric muscle defect. It will be tested whether a structurally well-organized fibrin clot will initiate muscle regeneration by serving as a temporary reservoir for continuous release of growth factors, and by providing adequate space to facilitate cell infiltration, proliferation, and differentiation. Additionally. R-Spondin-2, known for its role in myogenic differentiation and neuromuscular junction formation, has not been previously explored as a treatment strategy for VMLAttorney’s Docket No.: 21105.0097P1

[0260] regeneration. The use of mRNA enables modular and straightforward co-deli very of multiple growth factors with native folding, post-translational modifications, and translation of multiple protein isoforms. Moreover, MCM-mediated delivery of growth factors within the ex vivo hematoma disclosed herein can further amplify myogenic and neurogenic signaling, enhancing muscle regeneration. Unlike other biomaterials, an added benefit of the ex vivo hematoma is that the delivered RSPO-2 mRNA LNPs + MCMs is securely contained within the scaffold, eliminating and / or minimizing adverse effects, such as immune rejection, infection, and poor tissue integration, as it constitutes an autologous scaffold.

[0261] Determine the biological activity) of RSPO-2 mRNA LNPs within an ex vivo hematoma to enhance regeneration in a volumetric muscle defect model in rat. It will be tested w hether RSPO-2 mRNA LNPs will be superior to an ex vivo hematoma alone to promote muscle regeneration. The minimal dose of RSPO-2 mRNA LNPs + / - MCMs to initiate muscle defect regeneration will also be determined, and RSPO-2 mRNA LNPs gene transfection levels will be evaluated over time in vivo in rats. The impact of RSPO-2 mRNA LNPs on changes of the ex vivo hematoma on architecture and gene expression will also be determined.

[0262] The ability of the ex vivo hematoma to effectively deliver a mRNA encoding roof plate-specific spondin 2 (RSPO-2) to stimulate the regeneration of volumetric muscle defects in a rat model was evaluated. RSPO-2 was selected as the bioactive molecule because R-Spondins are implicated in myogenic differentiation (Han XH, et al. 2011. The Journal of Biological Chemistry:286: 10649-59; Kazanskaya O, et al. 2004. Dev Cell:7:525-34; and Knight MN, Hankenson KD. 2014. Matrix Biol:37: 157-61) and neuromuscular junction formation (Li J, et al. 2018. Sci Rep:8: 13577; and Nakashima H, et al. 2016. Sci Rep:6:28512). They promote myogenesis through their receptor the leucine rich repeatcontaining G-protein coupled receptors (LGRs). Following skeletal muscle injury LGR5 is upregulated in myogenic progenitors and LGR5+cells contribute to muscle regeneration and renewal of satellite cells (Leung C, et al. 2020. Cell Reports:33: 108535). Additionally.

[0263] RSPO-2, the most potent R-Spondin (de Lau WBM, et al. 2012. Genome Biol: 13:242), actively antagonizes bone morphogenetic protein signaling, an important driver of heterotopic ossification (Arzeno A, et al. 2018. Arthroplast Today :4: 162-8; Lee H, et al. 2020. Nat Commun: 11:5570; Lee H, et al. 2022. The Journal of Biological Chemistry:298:101586; and Shi S, et al. 2013. Cell Mol Life Sci:70:407-23). Moreover, R-Spondins activate and amplify WNT signaling by blocking the degradation of the WNTAttorney’s Docket No.: 21105.0097P1

[0264] ligand receptor the lipoprotein receptor-related proteins (LRPs) by sequestering the ubiquitin ligases ZNRF3 and RNF43 (Zebisch M, et al. 2013. Nat Commun:4:2787). WNT / p-catenin signaling is implicated in muscle formation and regeneration (Girardi F, Le Grand F. Chapter Five - Wnt Signaling in Skeletal Muscle Development and Regeneration. In: Larrain J, Olivares G, Larrain J, Olivares G, editors. Progress in Molecular Biology and Translational Science 2018. p. 157-79), however, many WNT agonists are highly hydrophobic making them difficult therapeutic targets whereas R-Spondins are hydrophilic along with other advantages (Dhamdhere GR, et al. 2014. PLoS One:9). This establishes RSPO-2 as a suitable target molecule for muscle regeneration delivered within the ex vivo hematoma. The results demonstrate that an ex vivo hematoma comprising 25 pg RSPO-2 mRNA LNPs + MCMs can successfully initiate regeneration in a VML defect (30% of the tibialis anterior muscle) after 2 weeks. Histological assessment revealed morphology and revascularization resembling native muscle, further indicating that the regeneration process is ongoing (FIGS. 1C, ID). In contrast, a fibrotic ring around the defect site was observed in the group treated with ex vivo alone (FIGS. 1A, IB).

[0265] mRNA will be used to deliver RSPO-2 within the ex vivo hematoma. mRNA delivery is a method for non-viral delivery of nucleic acids allowing for higher efficacy than recombinant proteins and with improved safety over viral delivery (Chen C-Y, et al. 2020. Mol Ther Nucleic Acids:20:534-44; and Wadhwa A, et al. 2020. Pharmaceutics: 12). mRNA lipid nanoparticles (LNP) have been shown to be highly efficacious with vaccination against SARS-CoV-2 globally (Baden LR, et al. 2021. New England Journal of Medicine:384:403-16; and Polack FP, et al. 2020. New England Journal of Medicine:383:2603-15). Still, the stability of mRNA LNPs and transient nature of the mRNA may require repetitive dosing that limit some mRNA approaches (Crommelin DJA, et al. 2021. Journal of Pharmaceutical Sciences:! 10:997-1001; and Ramaswamy S. 2017. Proc Natl Acad Sci: 114: 1941-50).

[0266] Mineral coated microparticles (MCMs) have been developed that can improve the local delivery of mRNA complexes (Choi S, Murphy WL. 2010. Acta Biomater: 6: 3426-35; and Khalil AS, et al. 2022. Adv Healthc Mater: e2200206). MCMs extend the biological effect of produced proteins through sequestration and have shown to be therapeutically effective with a single dose in a diabetic wound healing and spinal cord injury model. MCMs are also biomimetic and dissolve overtime (Choi S, Murphy WL. 2010. Acta Biomater: 6: 3426-35; Khalil AS, et al. 2022. Adv Healthc Mater: e2200206; Choi S, et al. 2013. Sci Rep: 3: 1567-93;Attorney’s Docket No.: 21105.0097P1

[0267] Hellenbrand DJ, et al. 2019. J Neuroinflammation: 16:93; Khalil AS, et al. 2020. Science Advances:6:eaba2422; YuX. 2017. Adv Mater:ll; andYu X, et al. 2014. Adv Funct Mater:24: 3082-93). The results disclosed herein demonstrate that the structural properties of the ex vivo hematoma remain unaltered after the addition of the MCMs. In contrast, the addition of LNPs resulted in thicker fibrin fibers and larger pores in the ex vivo hematoma alone (FIG. 2), resembling characteristics of non-healing fracture hematomas. Based on these findings, ex vivo hematomas disclosed herein comprising MCMs can be used to deliver RSPO-2 encoding mRNA and will be superior in to at least an ex vivo hematoma alone to promote functional muscle regeneration in a rat model of volumetric muscle loss.

[0268] Severe musculoskeletal injuries can lead to volumetric muscle loss (VML), characterized by extensive damage that results in permanent loss of function. VML injuries, which are composite skeletal muscle injuries, overwhelm the regenerative potential of muscle, preventing proper mobilization of regenerative cells and growth factors and leading to increased inflammation. Particularly when these injuries comprise 15-20% or more of the muscle belly, they exhibit poor regeneration and extensive fibrosis, resulting in chronic functional deficits (Corona BT, et al. 2015. J Rehabil Res Dev:52:785-92; Grogan BF, Hsu JR. 2011. J Am Acad Orthop Surg: 19 Suppl LS35-7; Anderson SE, et al. 2019. Tissue Eng Part C Methods:25:59-70). Following VML, the downregulation of myogenic factors and upregulation of profibrotic factors limit strength and functional recovery, especially in the absence of scaffold placement (Grasman JM, et al. 2015. Acta Biomater:25:2-15; and Nuutila K, et al. 2017. Wound Repair Regen: 25:408- 13). Consequently, various biomaterial scaffolds have been investigated to deliver bioactive molecules and cells for stimulating muscle defect regeneration. Biomaterial scaffolds may recapitulate the biological and physical properties of the extracellular matrix to assist with muscle regeneration, support cellular infiltration, proliferation, and differentiation, and promote the distribution of nutrients and oxygen (Mostafavi A, et al. 2021. Appl Phys Rev:8:041415; Mulbauer GD. Matthew HWT. 2019. Discoveries (Craiova): 7: e90; and Panayi AC, et al. 2020). A porous collagen-GAG scaffold promotes muscle regeneration following volumetric muscle loss injury. Wound Repair Regen:28:61-74 (Mostafavi A. et al. 2021. Appl Phys Rev:8:041415; Mulbauer GD, Matthew HWT. 2019. Discoveries (Craiova): 7: e90; and Panayi AC, et al. 2020). However, functional recovery of injured muscle treated with this technique was shown to be limited by poor tissue ingrowth and limited induction of muscle regeneration within the scaffold itself (Russell CS,Attorney’s Docket No.: 21105.0097P1

[0269] et al. 2020. ACS Appl Bio Mater:3: 1568-79). Musculoskeletal injuries, including muscle, commence with hematoma formation, an important step that initiates the biological cascade of the healing process. After muscle injury’, blood vessels contract to prevent sustained blood loss, followed by a coagulation cascade that leads to the formation of a hematoma, or blood clot, which serves as a natural scaffold. Depending on the severity of the injury and the size of the defect, there are distinct differences in the structural and biological properties of the formed hematoma. The structural parameters in fibrin clots can be characterized by the fiber diameter, density, the number of branch points, distances between branch points, and dimension of the pores (Weisel JW, Litvinov RI. 2013. Blood: 121: 1712-9). The diameter and density of fibers has an impact on the porosity and surface area of fibrin clots (Pham QP, et al. 2006. Biomacromolecules:7:2796-805) and is responsible for the biological functions of stem cells, such as adhesion, proliferation, and differentiation (Badami AS. et al. 2006.

[0270] Biomaterials:27:596-606). For example, low thrombin concentrations (<1 nM) generate a porous network of thick fibrin fibers that are highly susceptible to fibrinolysis, whereas high concentrations of thrombin result in thin fibers that form a poorly permeable fibrin network that is relatively resistant to fibrinolysis (Gabriel DA, et al. 1992. J Biol Chem:267:24259-63). Moreover, although an individual thick fiber has a higher mechanical strength (stiffness), a fibrin clot composed of thick fibers often has lower mechanical strength as a result of a reduced number of fibers (Carlisle CR, et al. 2010. Acta Biomater: 6:2997-3003; and Liu W.

[0271] 2012. Adv Healthc Mater: 1 : 10-25).

[0272] In view of the results described herein using a VML model, the ex vivo hematoma will deliver mRNA RSPO-2 LNPs to the injury site and be expressed or translated in the desired cell type or target site, initiating muscle regeneration. Therefore, it will be tested whether RSPO-2 encoding mRNA will activate cells at the target site when delivered to an injury’ site as part of an ex vivo hematoma to promote muscle regeneration.

[0273] To determine the minimal dose of RSPO-2 mRNA LNPs + / - MCMs required to initiate muscle defect regeneration, an established 30% full thickness of the tibialis anterior (TA) muscle defect model in male Fischer 344 rats of 200-250 g (= 10-12 yveeks old) will be used. Rats will be divided in 3 groups (n=5 / group): 1) 25 pg mRNA RSPO-2 + MCMs + ex vivo hematoma; 2) 25 pg mRNA RSPO-2 + ex vivo hematoma; 3) ex vivo alone. Animals will be sacrificed 4 weeks after the surgery to assess yvhether using MCMs as a delivery method for mRNA resulted in a superior healing outcome compared to the group yvithoutAttorney’s Docket No.: 21105.0097P1

[0274] MCMs, and both groups will be compared to the uninjured contralateral TA muscle. The 4-week time point was selected because the remodeling phase of the muscle typically occurs between 2-6 weeks. This duration allows for adequate evaluation of which treatment group initiated superior vascularization and reinnervation.

[0275] After we establish whether MCMs are indeed superior at delivering RSPO-2 mRNA LNPs, the following experiments will be carried out to determine the minimal dose of RSPO-2 mRNA delivered within the ex vivo hematoma that is needed to initiate the healing of muscle defects in rats. To do this, a group of animals using a range of doses (1.25, 12.5 and 25 pg) of mRNA RSPO-2 delivered via the ex vivo hematoma will be conducted to determine the minimum dose that consistently and efficiently stimulates muscle regeneration in the TA muscle defect. These doses were chosen based on the finding that MCMs delivering 25 pg mRNA RSPO-2 were able to initiate muscle regeneration in rat model (FIG.

[0276] 1). Animals will be sacrificed at 5, 10 and 21 days to determine the progress of muscle regeneration. These specific time points were selected based on the muscle regeneration phases. For instance, active muscle degeneration and inflammation occurs in the first few days' post injury, whereas muscle regeneration usually occurs 7 to 10 days after injury. The formation of scar tissue (fibrosis) between the second and third weeks post injury, and it increases in size overtime. Rats will be divided in 5 different groups (n=8-10 / group): ex vivo hematoma + 2.5 pg mRNA RSPO-2, ex vivo hematoma + 12.5 pg mRNA RSPO-2, ex vivo hematoma + 25 pg mRNA RSPO-2, ex vivo hematoma alone, empty defect, healing defect (less than 5% VML). and the contralateral TA will be used as a control. Rats will be sacrificed at 5, 10, and 21 days, and the samples will be used to assess structural and biological properties of the regenerating muscle defects. At the end of either 5, 10 and 21 days, the excised TA will be used to assess vascularization and neuromuscular regeneration.

[0277] To assess vascularization, TA muscle will be dissected from fixed, Microfil perfused rats and imaged using MicroCT. A desktop MicroCT imaging system (Bruker Skyscan 1173, Belgium) equipped with a microfocus X-ray tube with a <5 pm spot size will be used, and the samples will be scanned at 5 pm isotropic voxel size using 60 kV, 167 pA, 0.5 mm. To assess vascularization in the regenerated muscle, the vessel volume fraction (VV / TV, %), vessel thickness (Vs. Th, pm), vessel number (Vs.N, mm’1), vessel separation (Tb.Sp, mm’1) and connectivity density (ConnD, l / mm3) will be used.Attorney’s Docket No.: 21105.0097P1

[0278] Following microCT analysis, muscle samples will be fixed and embedded for paraffin sections and stained with Hematoxylin and Eosin and Gomori’s Trichrome to determine overall tissue morphology. Furthermore, immunostaining muscle antibodies will be used, including von Willebrand factor (vWF; endothelial cells), CD68 (macrophage marker), embryonic myosin heavy' chain (eMHC, protein expressed during muscle development) and Pax7 (myogenic progenitor cells) as well as dissected muscle will be stained with a-bungarotoxin conjugated with Alexa Fluor 647 to assess neuromuscular regeneration. The PI has extensive expertise in utilizing MicroCT, histology, and immunohistochemistry techniques in musculoskeletal tissues.

[0279] To evaluate whether RSPO-2 mRNA LNPs gene transfection levels change over time in vivo in rats, using the conditions identified herein, transfection kinetics of translated mRNA will be determined by in vivo imaging using an IVIS® Spectrum machine (PerkinElmer, Waltham, USA). Reporter (Firefly Luciferase or eGFP) mRNA LNP functionalized clots, labeled w ith DiR, will be implanted into the rat VML model. DiR fluorescence images will be captured under the excitation and emission w avelengths of 745 and 800 nm, respectively. Alternatively, animals will receive an IP injection of 150 mg / kg of D-Luciferin, and bioluminescence activity of the Firefly Luciferase will be recorded with IVIS on days 1, 3, 5, 7, and 14 following implantation. Peak luminescent activity' over 20 minutes will be recorded and used for subsequent experiments. The luminescence or fluorescence intensities in each region of interest (ROIs) will be quantified using Living Image 3.0 software (PerkinElmer, Waltham. USA). To determine the amount of RSPO-2 produced in the defect site, RSPO-2 mRNA LNPs will be delivered within an ex vivo hematoma disclosed herein into the defect site. The ex vivo hematoma will be recovered after 1, 3, and 7 days, and tissue explants will be homogenized. RSPO-2 will then be detected using a commercially available ELISA kit (Thermo Fisher Scientific, Waltham, USA).

[0280] Determination of eGFP mRNA transfected cell types will be done by flow cytometry after explanation of the ex vivo hematoma on day 1 following transfection. The following markers will be used to distinguish blood cells (CD45+) and muscle cells: leukocytes (CD32), T-cells (CD3), neutrophils (CD43), B-cells (CD45R), muscle stem cells (VCAM-1), skeletal muscle (FABP3).

[0281] The impact of RSPO-2 mRNA LNPs on changes of the architecture of the ex vivo hematoma and gene expression will be determined. It has been w ell established that theAttorney’s Docket No.: 21105.0097P1

[0282] outcome of wound healing depends largely on the fibrin structure, such as the thickness of the fibers, the number of branch points, the porosity, and the permeability' (Woloszyk A, et al. 2022. Biomater Adv: 139:213027; Laurens N, et al. 2006. Journal of Thrombosis and Haemostasis:4:932-9; Wang X, et al. 2017. J Tissue Eng Regen Med: 11:2864-75; and Wang X, et al. 2016. Sci Rep:6:35645). The structure of the fibrin matrix (hematoma) affects its biological function (Woloszy k A, et al. 2022. Biomater Adv: 139:213027; and Laurens N, et al. 2006. Journal of Thrombosis and Haemostasis:4:932-9). The binding of fibrin(ogen) to hemostasis proteins and platelets as well as to several different cells such as endothelial cells, smooth muscle cells, fibroblasts, leukocytes, and keratinocytes is indispensable during the process of wound repair (Laurens N, et al. 2006. Journal of Thrombosis and Haemostasis:4:932-9). It has also been demonstrated that in vivo hematomas isolated from non-healing bone defects had 53% thicker fibrin fibers, 60% higher fiber density, 41% lower fiber density and 96% larger pores compared to normally healing defects 3 days after surgery (Woloszy k A, et al. 2022. Biomater Adv: 139:213027). This led to the development of ex vivo hematoma, replicating structural and biological properties of naturally healing fracture hematoma to use as a deliver vehicle for growth factors. Therefore, the differences in the structural and biological properties of the regenerating muscle tissue will be investigated. To assess this, the animal model, treatment groups, and time points as described herein will be used. To determine structural parameters, a set of samples (n=5 / group) will be fixed in 4% paraformaldehyde (PF A) for 48 h, washed in phosphate buffered saline (PBS), post-fixed in 4% osmium tetroxide, washed again in PBS, and dehydrated through a gradient of ethanol solutions (25-100%). The muscle tissue slices will be dried using a Critical Point Dry' er and will be sputter-coated with gold525 palladium before imaging using a scanning electron microscopy (SEM) at a magnification of 10,000x. SEM images of the hematomas, such as thickness, density’, and porosity of the muscle fibers will be used for quantitative image analysis, in ImageJ, to turn micrographs into quantitative measurements. Furthermore, a different set of samples (n=5 / group) collected at 5-, 10-, and 21 -days post-surgery will be used to analyze differentially expressed genes involved in the initiation of the muscle repair process, and then compared to the control group (muscle tissue from the contralateral leg) using RNA-sequencing. Retrieved muscle samples will be collected into microcentrifuge tubes, immediately snap-frozen in liquid nitrogen and stored at -80°C. RNA extractions will be performed using the Qiagen RNeasy Plus Universal Tissue Mini. The concentration andAttorney’s Docket No.: 21105.0097P1

[0283] quality of the RNA will be determined using a nanodrop spectrophotometer, and RNA integrity7will be assessed using an Agilent 2100 Bioanalyzer. The global transcriptome analysis will be utilized to identify up-regulated and / or down-regulated genes that have a major influence on the initiation process of muscle repair. RNA-sequencing will be performed at the Genome Sequencing Core Facility (GSCF) of the Greehey Children’s Cancer Research Institute at UT Health San Antonio. The RNA data will be analyzed using Qiagen’s Ingenuity Pathway Analysis. To quantify the relative expression levels of distinct inflammatory7cell types, the CIBERSORT tool (Newman AM, et al. 2015. Nat Methods: 12:453-7) will be utilized. Upstream regulator analyses will be generated from the differential expression gene data set acquired from RNA-sequencing analysis using Ingenuity7Pathway Analysis (IP A, Qiagen Inc, Germantown, MD. Furthermore, histology7and immunohistochemistry (IHC) will also be performed to characterize the tissues and confirm the presence of important proteins involved in the initiation of the repair process, as described herein.

[0284] The overall outcome of these experiments will be a comprehensive understanding of the structural and biological properties of the ex vivo hematoma required to stimulate volumetric muscle loss (VML) regeneration. Furthermore, the minimal dose that consistently initiates regeneration in VML will be established. If the lowest suggested dose as described herein demonstrates consistent and efficacious VML regeneration, this dose will be further reduced until regeneration fails. It is also expected that MCMs delivering RSPO-2 mRNA LNPs will amplify VML regeneration. Additionally, it is expected that the use of the ex vivo hematoma as a delivery vehicle will result in efficacious VML regeneration without side effects. These results described herein demonstrate successful regeneration in a VML defect using 25 pg RSPO-2 mRNA LNPs + MCMs after 2 weeks. The major outcome measures that will be used are MicroCT, SEM. RNAseq, and histology / IHC.

[0285] It will also be investigated whether the optimal dose of mRNA encoding RSPO-2, delivered within the ex vivo hematoma, can consistently and predictably regenerate volumetric muscle defects in a rat model.

[0286] It will be tested whether the ex vivo hematoma delivering mRNA encoding RSPO-2 can mitigate inflammation and facilitate functional muscle regeneration in a volumetric muscle defect. RSPO-2 will play an important role in myogenesis and reinnervation. TheAttorney’s Docket No.: 21105.0097P1

[0287] time for functional muscle regeneration using mRNA encoding RSPO-2 delivered within the ex vivo hematoma will be determined.

[0288] Neurovascular regeneration during remodeling phase will also be characterized. Muscle strength and function recovery will be determined using biomechanical studies.

[0289] Extensive muscle loss, along with damage to neuromuscular components, can overwhelm the remarkable regenerative capacity7of muscles. The loss of nervous and vascular tissue exacerbates further damage and atrophy. Therefore, implementing a combined treatment approach addressing both neuromuscular junction (NMJ) and volumetric muscle regeneration can be carried out. Research has demonstrated that scaffolds replicating the extracellular matrix environment and microarchitecture of the tissue yield favorable outcomes. The repair and regeneration of tissues lost from VML injuries require the activation, proliferation, and differentiation of a resident pool of stem cells known as satellite cells (Aguilar CA, et al. 2018. Cell Death Discov:4:33; Laumonier T, Menetrey J. 2016. J Exp Orthop:3:15; and Schamer J, Zammit PS. 2011. Skelet Muscle:l:28). These cells are activated for myofiber regeneration following inflammation or hematoma formation following muscle injury. Thus, utilizing a combination of suitable stem cells and growth factors within a microenvironment mirroring the extracellular matrix of muscle should be beneficial for enhancing the regeneration of skeletal muscle tissue. A naturally formed hematoma during minor muscle injury' contains the essential components to regenerate functional tissue, including cells, growth factors, and extracellular matrix or a scaffold. The structurally well-organized innate hematoma (scaffold) serves as a temporary reservoir for the continuous release of grow th factors and provides a suitable environment that encourages cell infiltration, proliferation, and differentiation from the surrounding tissues. However, the structural and biological properties of hematomas in large volumetric muscle defects are disrupted and unable to initiate the natural healing cascade.

[0290] The sequential phases of tissue healing using the disclosed ex vivo hematoma will be carried out. The ex vivo hematoma disclosed herein will be assessed in a VML model for its ability7to provide functional muscle regeneration. Therefore, it will be tested whether the ex vivo hematoma disclosed herein comprising mRNA encoding R-Spondin-2 can mitigate inflammation and facilitate functional muscle regeneration in a volumetric muscle defect. R-Spondin-2 will play an important role in myogenesis and reinnervation.Attorney’s Docket No.: 21105.0097P1

[0291] The time required for functional muscle regeneration using mRNA encoding RSPO-2 delivered within the ex vivo hematoma will be determined using the same VML rat model described herein The optimal dose of mRNA encoding RSPO-2 will be delivered either with or without MCMs. Rats will be randomly assigned to four groups (n=8-10 / group): optimal mRNA RSPO-2 LNPs + ex vivo hematoma, ex hematoma alone, Empty defect. Healing defect (less than 5% VML), and the contralateral TA will serve as a control. At 4 and 8 weeks, animals will be euthanized for various outcome measures to determine the time required for the muscle to regain full function. The selection of the 4-week time point is based on the understanding that scar tissue (fibrosis) typically begins around the third week post-injury and increases in size over time. If fibrosis is present at 4 weeks. the muscle is unlikely to regain function. By 8 weeks, the muscle defects should show almost complete muscle revascularization and reinnervation. Power calculations were performed using the data described herein, comparing mRNA RSPO-2 within the ex vivo hematoma (13±5%) vs. the ex vivo hematoma alone (7±3%) in a rat model. A minimum of six rats per group will be required for this aim at 80% pow er.

[0292] To characterize the neurovascular regeneration during remodeling phase, the set of samples from each group will be utilized as described herein. To assess vascularization, the tibialis anterior muscle will be dissected from fixed, Mi crofil -perfused rats and imaged using MicroCT. Following the MicroCT analysis, muscle samples will undergo analysis for vasculature and neuromuscular regeneration using histology' and IHC.

[0293] To determine muscle strength and function recovery using biomechanical studies, a set of samples from each group as described herein will be employed to assess the function of the regenerated muscle at 4 and 8 weeks. In vivo functional measurements will be conducted using a methodology similar to that described for rats (Wu X, et al. 2010. J Surg

[0294] Res: 164:e243-51). A nerve cuff will be implanted in each leg around the peroneal nerve. The foot will be secured using silk surgical tape to a foot plate attached to a dual-mode muscle lever system (Aurora Scientific, Inc., Mod. 305b). The knee will be stabilized on either side using a custom-made mounting system, positioning the knee and ankle at right angles. Peak isometric torque will be determined by stimulating the peroneal nerve with a Grass stimulator (S88) at 150 Hz with a pulse-width of 0.1 msec across a range of voltages (2-8 V). Isometric mechanical properties in the predominantly fast-twitch plantaris muscle (PL) and the predominantly slow-twitch soleus muscle (SL) will be measured using two dual-mode servoAttorney’s Docket No.: 21105.0097P1

[0295] muscle lever systems (Aurora Scientific, Inc., Mod. 305b-LR). The nen e will be stimulated at twice the voltage required to elicit maximal twitch tension (Pt) at a pulse width of 50 ps using an isolated pulse stimulator (A-M Systems, Inc. Mod. 2100). Measurements will be made with the muscles set at optimal length (Lo), determined from Pt using an automated routine. Starting in a slack position, the muscle will be stimulated at 1 Hz for a set of 8 twitches; the last two twitches will be averaged, and the Pt will be stored. The lever will then be moved 0.1 mm, and the routine will be repeated 2 seconds later. This procedure will continue until the average Pt does not change by more than 2% between 3 consecutive twitch sets. Optimal length will be defined as the second of the three twitch sets.

[0296] It is expected that mRNA RSPO-2 + MCMs + ex vivo hematoma will achieve functional muscle regeneration at the end of 8 weeks. Additionally, it is expected that regenerated muscle will have similar neurovascular characteristics and seamless reintegration with the native muscle. If muscle regeneration is not be complete by 8 weeks, the study endpoint will be extended to 12 weeks. If natural regeneration in an empty VML defect, representing a 30% resection of the tibialis anterior (TA) full muscle, occurs by 8 w eeks, defect size will be increased to a 50% resection of the TA.

[0297] Statistical Analysis . Scanning electron microscopy, gene expression (RNASeq), MicroCT imaging data, histological, IHC and mechanical data will be assessed by a multiple means’ comparison test like an ANOVA or non-parametric equivalent Post-hoc tests will used for multiple pairwise comparisons. Tukey’s Honestly Significant Difference method will be used to control type I error and statistical significance will be observed at a 95% confidence interval with p < 0.05. The data will be presented as mean ± standard deviation. The statistical analyses will be performed using GraphPad Prism 9.0 software (CA, USA).

[0298] The significance of the disclosed compositions and methods of use thereof is the development of advanced and improved treatment strategies for large segmental or volumetric muscle loss. The delivery' of RSPO-2 encoding mRNA within the ex vivo hematoma can be used as a therapy for volumetric muscle defects, which currently lack effective treatments. The versatility of the mRNA strategy' and the ex vivo hematoma can provide a singular platform for repairing damage across various tissue types.Attorney’s Docket No.: 21105.0097P1

[0299] Example 2: Ex-vivo Hematoma- Implanted Microparticles Deliver R-Spondin-2 mRNA and Enhances Osteogenesis and Myogenesis.

[0300] Large traumatic musculoskeletal (MSK) injuries involving muscle and bone and bone defects with overlying muscle injury have limited treatment options and often result in amputation. Protein based therapies, like bone morphogenetic protein-2 (BMP-2), promote regeneration of large bone defects. WNT and BMP (bone morphogenetic protein) signaling work synergistically in MSK repair and are a target of therapeutic interest (J.

[0301] Biol. Chem. (2011) 286). Composite bone and muscle injuries are recalcitrant to BMP-2 treatment (Bone Res (2018) 6, 24). New strategies are needed to address polytraumatic injuries addressing both muscle and bone regeneration. Gene delivery with biomaterials can be used to repair tissue defects. Calcium phosphate mineral-coated microparticles can be used to improve delivery of therapeutic mRNA and sequester cell-secreted proteins (Khalil. A. S. et al. Sci. Rep. 7, 14211 (2017); and Khalil, A. S. et al. Sci. Adv. 6, eaba2422 (2020)). This localizes and prolongs the activity' of the transgene, which is important for regenerative medicine applications.

[0302] WNT / P-catenin signaling is involved in musculoskeletal healing. R-Spondins (RSPO) are WNT agonists involved in myogenic and osteogenic regeneration. RSPO-2 but not RSPO-1 contains a BMP-R inhibitory domain in the TSP-1 domain (Nat Commun 11, 5570 (2020). However, RSPO-1 does not impact BMP-R activity' but has reduced potency (Lee, H., et al. Nat. Commun. 11, 5570 (2020)). Mutant RSPO-2 with the TSP-1 domain from RSPO-1 is functionally active ((Lee, H., et al. Nat. Commun. 11, 5570 (2020)) and may promote BMP signaling when combined with BMPs. The use of “myogenic RSPO-2” (native RSPO-2) and “osteogenic RSPO-2” (RSPO-2dTSP-l (RSPO-1)) with BMP-2 can promote muscle and bone regeneration. Further, the anti-BMP-R activity' of WT-RSPO-2 can inhibit heterotopic ossification from the underlying regenerating bone while actively inhibiting heterotopic ossification. Mineral coated microparticles improve mRNA delivery and prolong the expression of the protein product and can be injected (Adv Mater. 2017 Sep;29(33)). The ex vivo hematomas disclosed herein can be used as scaffolds for MSK repair (Biomater Adv. 2024 May;148:213). Described herein is the development of biomaterial and a therapeutic mRNA approach to promote regeneration of composite muscle and bone defects. It was tested whether that a single dose of mRNA for R-SpondinsAttorney’s Docket No.: 21105.0097P1

[0303] using mineral-coated microparticles to deliver the mRNA via an ex vivo hematoma can be used promote myogenesis and osteogenesis.

[0304] Methods. Synthetic mRNA for RSPO-2, RSPO-1, RSPO-2dTSP-l (RSPO-1) and BMP-2 were created by cloning the coding sequences into a plasmid DNA expression vector flanked by 5’ and 3' untranslated regions from the beta-globin gene. DNA templates were created using PCR with an appended 120 nt long polydT tail in the 3’ primer. mRNA were synthesized with co-transcriptional capping using CleanCap-AG (Trilink Biotechnologies) and uridine were fully substituted with N1 -methylpseudouridine.

[0305] Lipofectamine™ Messenger Max (Thermofisher Scientific) was used as the transfection reagent. Mineral-coated microparticles (MCM) were synthesized by incubation in a modified simulated body fluid solution with the addition of 5mM citric acid and ImM NaF(Khalil. A. S. et al. Set. Rep. 7. 14211 (2017). mRNA complexes were bound to MCMs at a ratio of 125 pg MCM per pg of mRNA for 30 minutes under constant vertical rotation.

[0306] MCMs were centrifuged and resuspended to deliver the bound mRNA complexes.

[0307] Myogenesis Muman H9 embry onic stem cells or murine C2C12 myoblasts were cultured in growth media (DMEM, 1% Pen / Strep. 10% FBS) until 75% confluence, then were cultured in low serum media: DMEM, 1% Pen / Strep, 2% B-27 supplement (Gibco). RSPO-2 mRNA + / - MCMs were delivered two days after myogenic induction and were fixed on d7 or dl4 and stained for myosin heavy chain expression (MYHC). On d7 mRNA was extracted for gene expression for myog, myf5. myostatin or axin2.

[0308] Osteogenesis. Human mesenchymal stromal cells (hMSC) were grown to 100% confluence prior to treatment with 1 : 1 mut / WT RSPO-2 + BMP -2 mRNA. Cells were fixed on d21 and stained with Alizarin red for calcification. N=3 biological replicates were used for each assay and were analyzed by one-way ANOVA when applicable.

[0309] The results show that both WT and mut-RSPO-2 mRNA delivered via MCMs resulted in robust calcification, as assessed by alizarin red staining after 21 days of culture (FIGS. 11C-D). Conversely, without MCMs only mut-RSPO-2 delivery resulted in calcification (FIG. 11C), while WT-RSPO-2 mRNA produced no calcification (FIG. 11 A). To investigate myogenesis, RSPO-2 Mma w as delivered to C2C12 cells. MYHC+myotubes formed in culture after 7 days of differentiation (FIG. 1 IE). Treatment with MCMs increased MYHC+cells and myotube fusion (FIG. 1 IF), which were further enhanced with RSPO-2 mRNA with (FIG. 11G) or without MCMs (FIG. 11H). RSPO-2Attorney’s Docket No.: 21105.0097P1

[0310] mRNA delivery increased myf5 expression in differentiating C2C12 cells after 7 days (FIG. Ill) but only RSPO-2 mRNA delivered with MCMs decreased expression myostatin (FIG.

[0311] 11 J).

[0312] Mineral coated microparticles localized and improved the delivery of reporter and RSPO-2 mRNA (FIG. 6). Osteogenesis'. Viral overexpression of RSPO-2 has been shown to enhance BMP -2 mediated osteogenesis (Bone Res (2018) 6, 24). TSP-1 domain of RSPO-2 antagonizes the BMP-R (Nat Commun 11, 5570 (2020)). Interestingly, a single dose of WT-RSPO-2+BMP-2 mRNA without MCMs had no effect on mineralization but had calcification with MCMs (FIG. 7). Mut-RSPO-2 with TSP-1 from RSPO-1 without BMP-R antagonist activity completely calcified the culture regardless of the presence of MCM (FIGS. 7G-H). Myogenesis'. RSPO-2 mRNA + MCMs enhanced myotube formation, cell fusion and MYHC staining in C2C12 cells (FIG. 8). MCMs alone improved myotube formation (FIG. 8B). RSPO-2 mRNA+MCMs increased axin2 and myf5 gene expression and decreased myostatin expression, an inhibitory gene (FIG. 9).

[0313] MCM treatment resulted in less myog expression in cells treated with RSPO-2 mRNA and MCMs which could be an indicator of myotube maturation (FIG. 9). Ex vivo hematoma comprising RPSO-2 mRNA promotes robust muscle healing of a TA VML after 2 weeks (FIG. 10). These results demonstrate that the ex vivo hematomas comprising mRNA in mineral coated microparticles can be useful as an injectable therapeutic. For example, application of RSPO-2 and Mut-RSPO-2 / BMP-2 mRNA can also be useful in composite musculoskeletal injuries.

[0314] There are conflicting reports on the role of R-Spondins in relation to BMP signaling but consensus is forming around RSPO-2 being inhibitory for BMP receptors (Lee, H., et al. Nat. Commun. 11, 5570 (2020)). The results described herein reaffirmed that WT-RSPO-2 inhibits mineralization in the presence of BMP -2, and that mutation of the BMP receptor region in RSPO-2 - replacing with the TSP-1 region from RSPO-1 - permits BMP-2-mediated mineralization in vitro. Interestingly, the presence of MCMs is sufficient to allow complete mineralization of the tissue culture even w hen combined with WT-RSPO-2.

[0315] Calcium phosphates are known to be osteoconductive and sequester proteins, which may help to override any inhibitory effects of WT-RSPO-2. RSPO-2 has been shown to enhance myogenesis in C2C12 cells. As disclosed herein, a mRNA delivery strategy that promoted myogenesis in C2C12 cells as assessed by MYHC expression and gene expression of theAttorney’s Docket No.: 21105.0097P1

[0316] pro-myogenic gene myf5. MCMs alone improved myotube formation without RSPO-2.

[0317] Interestingly, RSPO-2 or MCM delivery seemed to promote alignment of the myotubes relative to the untreated control. Furthermore, RSPO-2 mRNA with MCMs reduced myostatin, an inhibitory protein for myogenesis, while MCMs alone increased myostatin expression.

[0318] Polytraumatic injury to muscle and bone has few therapeutic options. The compositions and methods disclosed herein can be used to promote healing of muscle and bone defects while inhibiting heterotopic ossification.

Claims

Attorney’s Docket No.: 21105.0097P1CLAIMS WHAT IS CLAIMED IS:

1. A composition comprising:an ex vivo hematoma, wherein the ex vivo hematoma comprises:(a) isolated whole blood;(b) sodium citrate;(c) calcium chloride; thrombin; or thrombin and calcium chloride; and(d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition.

2. The composition of claim 1, wherein the mRNA-based therapeutic composition comprises a mineral coated microparticle; a mRNA complex bound to the mineral coated microparticle, wherein the mRNA complex comprises an mRNA complexed with a lipid nanoparticle.

3. The composition of claims 1, wherein the mRNA-based therapeutic composition comprises mRNA.

4. The composition of claim 3, wherein the mRNA comprises the nucleic acid sequence of SEQ ID NOs: 3, 4, 5, 6, 7, 8, 9, 10, or 11.

5. The composition of claim 3, wherein the mRNA encodes a protein of interest.

6. The composition of claim 3, wherein the mRNA encodes roof plate-specific sondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), transforming growth factors (e.g., TGF-a and TGF-P), and platelet-derived grow th factors (e.g., PDGF-AA and PDGF-BB), insulin-like grow th factor-1 (IGF-1), tumor necrosis factor-a (TNF-a), vascular endothelial growth factor (e.g., VEGF A and B), or basic fibroblast growth factor (bFGF).Attorney’s Docket No.: 21105.0097P17. The composition of claim 3, wherein the mRNA encodes bone morphogenetic protein- 2 (BMP-2), BMP-2 / BMP-4, BMP-2 / BMP-7, BMP-4 / BMP-7, BMP-6, or BMP-9.

8. The composition of claim 3, wherein the mRNA encodes roof plate-specific spondin-2 (RSPO-2).

9. The composition of claim 3, wherein the mRNA encodes a growth factor.

10. The composition of claim 9, wherein the growth factor is roof plate-specific spondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), a transforming grow th factors (TGF-a and TGF-P), and a platelet-derived growth factor (PDGF-AA and PDGF-BB), insulin-like growth factor-1 (IGF-1). tumor necrosis factor-a [TNF-a]), a vascular endothelial growth factor (VEGF A and B), basic fibroblast growth factor (bFGF (FGF-2)) bone morphogenetic protein 2 (BMP-2), BMP-7, BMP-4, BMP-6, BMP-9, BMP-14, or BMP-2 / -7.

11. The composition of claim 10. wherein the growth factor is BMP-2 or BMP-2 / -7.

12. The composition of claim 1, wherein the ex vivo hematoma comprises fibrin fibers having a thickness of 100-400 nm ± 10%.

13. The composition of claim 1, wherein the ex vivo hematoma further comprises a bone substitute.

14. The composition of claim 13, w herein the bone substitute is demineralized bone matrix.

15. The composition of claim 13, wherein the bone substitute is derived from a biological product, a synthetic bone substitute or a combination thereof.Attorney’s Docket No.: 21105.0097P116. The composition of claim 15, wherein the biological product is a demineralized bone matrix, hydroxyapatite, or a coral.

17. The composition of claim 15, wherein the synthetic bone substitute is calcium sulfate, a calcium phosphate cement, P-tri-calcium phosphate ceramics, bioactive glasses, or a polymer.

18. The composition of claim 1, wherein the ex vivo hematoma further comprises an antibiotic.

19. The composition of any of the preceding claims, wherein the ex vivo hematoma further comprises one or more growth factors.

20. The composition of claim 19, wherein the one or more growth factors is bone morphogenetic protein-2 (BMP -2), BMP-7, BMP-4, BMP-6, BMP-9, BMP-14, platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), fibroblast growth factor 2 (FGF-2), or a combination thereof.

21. The composition of claim 1, wherein the whole blood comprises viable cells and one or more biological factors.

22. The composition of claim 21, wherein about 50% to 70% of the viable cells of the whole blood remain viable after formation of the hematoma.

23. The composition of any of the preceding claims, wherein the ex vivo hematoma further comprises a therapeutic agent.

24. The composition of claim 1, wherein the ex vivo hematoma comprises isolated whole blood, thrombin and calcium chloride, and sodium citrate.

25. The composition of claim 1, wherein the ex vivo hematoma comprises isolated whole blood, calcium chloride, and sodium citrate.Attorney’s Docket No.: 21105.0097P126. The composition of claim 1, wherein the ex vivo hematoma comprises isolated whole blood, sodium citrate, and thrombin.

27. The composition of any of the preceding claims, further comprising bone morphogenetic protein 2 (BMP -2).

28. The composition of claim 23, wherein the therapeutic agent is bone morphogenetic protein 2 (BMP-2).

29. The composition of claim 28, wherein the BMP-2 present in the ex vivo hematoma is at a dose of at least 0.01 mg.

30. The composition of claim 28, wherein the BMP-2 is a recombinant BMP -2.

31. The composition of claim 30, wherein the recombinant BMP-2 comprises human BMP-2.

32. The composition of any of the preceding claims, wherein the ex vivo hematoma further comprising growth factors, platelets, and cells.

33. The composition of any of the preceding claims, wherein the composition is formulated as a gel, a liquid, a powder, a paste, granules, or a putty.

34. The composition of any of the preceding claims, wherein the composition is formulated for local administration.

35. The composition of claim 27, wherein the amount of BMP -2 present in the ex vivo hematoma is at least 0.01 mg.

36. The composition of any of the preceding claims, wherein the ratio of the ex vivo hematoma to bone substitute is from 1000:1 to 1:1000.Attorney’s Docket No.: 21105.0097P137. A device comprising the composition of any of the preceding claims.

38. A multi -compartment device comprising a first chamber compnsing isolated whole blood; a second chamber comprising calcium chloride; thrombin; or thrombin and calcium chloride; and a third chamber comprising a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition.

39. The multi-compartment device of claim 38, wherein the first chamber further comprises one or more growth factors, one or more bone substitutes, or a combination thereof.

40. A biomimetic scaffold comprising a scaffold and an ex vivo hematoma, wherein the ex vivo hematoma comprises:(a) isolated whole blood;(b) sodium citrate;(c) calcium chloride; thrombin; or thrombin and calcium chloride; and(d) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition.

41. The biomimetic scaffold of claim 40, wherein the ex vivo hematoma comprises fibrin fibers having a thickness of 100-400 nm ± 10%.

42. The biomimetic scaffold of claim 40, wherein the mRNA-based therapeutic composition comprises mRNA.

43. The biomimetic scaffold of claim 42, wherein the mRNA encodes a protein of interest.

44. The biomimetic scaffold of claim 42, wherein the mRNA encodes roof plate-specific sondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), transforming growth factors (e.g. TGF-a and TGF-P), and platelet-derived growth factors (e.g.Attorney’s Docket No.: 21105.0097P1PDGF-AA and PDGF-BB), insulin-like growth factor-1 (IGF-1), tumor necrosis factor-a (TNF-a), vascular endothelial growth factor (e.g. VEGF A and B), or basic fibroblast growth factor (bFGF; known as FGF-2).

45. The biomimetic scaffold of claim 42, w herein the mRNA encodes bone morphogenetic protein-2 (BMP-2), BMP-2 / BMP-4, BMP-2 / BMP-7, BMP-4 / BMP-7, BMP-6, or BMP-9.

46. The biomimetic scaffold of claim 42, wherein the mRNA encodes roof plate-specific spondin-2 (RSPO-2).

47. The biomimetic scaffold of claim 42, wherein the mRNA encodes a growth factor.

48. The biomimetic scaffold of claim 47, wherein the growth factor is roof plate-specific spondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), a transforming grow th factors (TGF-a and TGF-P), and a platelet-derived growth factor (PDGF-AA and PDGF-BB), insulin-like growth factor-1 (IGF-1), tumor necrosis factor-a [TNF-a]), a vascular endothelial growth factor (VEGF A and B), basic fibroblast growth factor (bFGF; known as FGF-2), bone morphogenetic protein 2 (BMP-2), BMP-7, BMP-4, BMP-6, BMP-9, BMP- 14, or BMP-2 / -7.

49. The biomimetic scaffold of claim 47, wherein the growth factor is BMP-2 or BMP-2 / - 7.

50. The biomimetic scaffold of claim 40, further comprising a bone substitute.

51. The biomimetic scaffold of claim 50, wherein the bone substitute is demineralized bone matrix.

52. The biomimetic scaffold of claim 51, wherein the bone substitute is derived from a biological product or a synthetic bone substitute.Attorney’s Docket No.: 21105.0097P153. The biomimetic scaffold of claim 52, wherein the biological product is a demineralized bone matrix, hydroxyapatite, or a coral.

54. The biomimetic scaffold of claim 52, wherein the synthetic bone substitute is calcium sulfate, a calcium phosphate cement, P-tri-calcium phosphate ceramics, bioactive glasses, or a polymer.

55. The biomimetic scaffold of any of claims 50-54, wherein the ratio of the ex vivo hematoma to bone substitute is from 1000:1 to 1: 1000.

56. The biomimetic scaffold of any of the preceding claims, wherein the ex vivo hematoma further comprises an antibiotic.

57. The biomimetic scaffold of any of the preceding claims, wherein the ex vivo hematoma further comprises one or more grow th factors.

58. The biomimetic scaffold of any of the preceding claims, wherein the one or more growth factors is bone morphogenetic protein 2 (BMP-2), BMP-7, BMP-4, BMP-6, BMP-9, BMP-14, platelet-derived grow th factor (PDGF), vascular endothelial growth factor (VEGF), fibroblast growth factor 2 (FGF-2), or a combination thereof.

59. The biomimetic scaffold of claim 40, wherein the isolated whole blood comprises viable cells and one or more biological factors.

60. The biomimetic scaffold of claim 59, wherein about 50% to 70% of the viable cells of the isolated whole blood remain viable after formation of the hematoma.

61. The biomimetic scaffold of any of the preceding claims, wherein the ex vivo hematoma further comprises a therapeutic agent.

62. The biomimetic scaffold of claim 40, w herein the ex vivo hematoma comprises isolated whole blood and sodium citrate.Attorney’s Docket No.: 21105.0097P163. The biomimetic scaffold of claim 40, wherein the ex vivo hematoma comprises isolated whole blood, calcium chloride and sodium citrate.

64. The biomimetic scaffold of claim 40, wherein the ex vivo hematoma comprises isolated whole blood, sodium citrate, and thrombin.

65. The biomimetic scaffold of claim 40, wherein the ex vivo hematoma comprises isolated whole blood, thrombin and calcium chloride, and sodium citrate.

66. The biomimetic scaffold of any of the preceding claims, wherein the ex vivo hematoma further comprises bone morphogenetic protein 2 (BMP-2).

67. The biomimetic scaffold of claim 61, wherein the therapeutic agent is bone morphogenetic protein 2 (BMP -2).

68. The biomimetic scaffold of claim 66, wherein the BMP-2 present in the ex vivo hematoma is at a dose of at least 0.01 mg.

69. The biomimetic scaffold of claim 66, wherein the BMP-2 is a recombinant BMP -2.

70. The biomimetic scaffold of claim 69, wherein the recombinant BMP-2 comprises human BMP -2.

71. The biomimetic scaffold of any of the preceding claims, wherein the ex vivo hematoma further comprises growth factors, platelets, and cells.

72. The biomimetic scaffold of any of the preceding claims, wherein the ex vivo hematoma is formulated as a gel, a liquid, paste, powder, a putty, or granules.

73. The biomimetic scaffold of any of the preceding claims, wherein the ex vivo hematoma is formulated for local administration.Attorney’s Docket No.: 21105.0097P174. The biomimetic scaffold of any of the preceding claims, wherein the amount of BMP -2 present in the ex vivo hematoma is at least 0.01 mg.

75. The biomimetic scaffold of any of the preceding claims, wherein the scaffold is collagen, chitins, bioabsorbable polymers, nonabsorbable polymers such as PEEK, or titanium or a metallic alloy.

76. A method of promoting muscle regeneration, bone regeneration, or a combination thereof, the method comprising administering to a subject in need thereof a therapeutically effective amount of the composition of any of claims 1 to 36.

77. A method of treating a volumetric muscle loss (VML) injury in a subject, the method comprising administering to the subject in need thereof a therapeutically effective amount of the compositions of any of claims 1 to 36.

78. The method of claims 76 or 77. wherein the isolated whole blood comprises viable cells and one or more biological factors.

79. The method of claim 76 or 77, wherein the ex vivo hematoma comprises isolated whole blood, calcium chloride, and sodium citrate.

80. The method of claim 76 or 77, wherein the subject is a human.

81. The method of claim 76 or 77, wherein the composition is formulated as a clot or scaffold.

82. The method of claim 76 or 77, wherein the composition is formulated for local administration.

83. The method of claim 76 or 77, wherein the composition is administered locally, implanted, or delivered percutaneously.Attorney’s Docket No.: 21105.0097P184. The method of claim 76 or 77, wherein the composition is implanted.

85. The method of claim 76, wherein the subject has a musculoskeletal injury.

86. The method of claim 76, wherein the subject has a volumetric muscle loss injury'.

87. The method of claim 76, wherein the subject has a skeletal defect.

88. The method of claim 87, wherein the skeletal defect is a small skeletal defect or a large segmental bone defect, and nonunion.

89. The method of claim 76, wherein the subject has one or more bone fractures.

90. The method of claim 76, wherein the subject has one or more bone injuries.

91. The method of claim 76 or 77, wherein the subject has one or more muscle injuries.

92. The method of claims 76, wherein the subject has a dental bone defect.

93. The method of claims 76-92, wherein the bone substitute is demineralized bone matrix.

94. A method of constructing an implant, the method comprising:a) dimensioning a depot implant in at least one of a shape and a size that facilitates implantation of the depot implant into a bone defect; and b) structuring the depot implant to have a scaffold by introducing:(i) isolated whole blood and sodium citrate;(ii) calcium chloride; thrombin; or thrombin and calcium chloride; and(iii) a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)- based therapeutic composition to create the scaffold.Attorney’s Docket No.: 21105.0097P195. The method of claim 94, wherein the mRNA- based therapeutic composition comprises a mineral coated microparticle; a mRNA complex bout to the mineral coated microparticle, wherein the mRNA complex comprises an mRNA complexed with a lipid nanoparticle.

96. The method of claim 94, wherein the mRNA-based therapeutic composition comprises mRNA.

97. The method of claim 96, wherein the mRNA encodes a protein of interest.

98. The method of claim 96, wherein the mRNA encodes roof plate-specific sondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), transforming growth factors (e.g., TGF-a and TGF-P), and platelet-derived grow th factors (e.g., PDGF-AA and PDGF-BB), insulin-like grow th factor-1 (IGF-1), tumor necrosis factor-a (TNF-a), vascular endothelial growth factor (e.g., VEGF A and B), or basic fibroblast growth factor (bFGF (FGF-2)).

99. The method of claim 96, wherein the mRNA encodes bone morphogenetic protein-2 (BMP-2), BMP-2 / BMP-4, BMP-2 / BMP-7, BMP-4 / BMP-7, BMP-6, or BMP-9.

100. The method of claim 96, wherein the mRNA encodes roof plate-specific spondin-2 (RSPO-2)101. The method of claim 96. wherein the mRNA encodes a growth factor.

102. The method of claim 101, wherein the grow th factor is roof plate-specific spondin-2 (RSPO-2). nuclear factor erythroid 2-related factor 2 (NRF2), a transforming growth factors (TGF-a and TGF-P), and a platelet-derived growth factor (PDGF-AA and PDGF-BB), insulin-like growth factor-1 (IGF-1), tumor necrosis factor-a [TNF-a]), a vascular endothelial growth factor (VEGF A and B), basic fibroblast growthAttorney’s Docket No.: 21105.0097P1factor (bFGF (FGF-2)), bone morphogenetic protein 2 (BMP-2), BMP-7, BMP-4, BMP-6, BMP-9, BMP-14, or BMP-2 / -7.

103. The method of claim 102, wherein the growth factor is BMP -2 or BMP-2 / -7.

104. The method of claim 94, wherein the scaffold has a porosity of 55 to 75%.

105. The method of claim 94, wherein the scaffold further comprises (iv) a bone substitute.

106. The method of claim 94, wherein the scaffold comprises fibrin fibers having a thickness of 100-400 nm ± 10%.

107. The method of claim 94, wherein the shape of the depot implant is that of a cylinder, a sphere, or any other shape.

108. The method of claim 94, wherein the scaffold is constructed as a clot.

109. The method of claim 94, further comprising one or more growth factors.

110. The method of claim 94, wherein the one or more grow th factors is bone morphogenetic protein 2 (BMP-2), BMP-7. BMP -4, BMP-6. BMP-9, BMP-14, platelet-derived growth factor (PDGF), vascular endothelial growth factor (VEGF), fibroblast growth factor 2 (FGF-2), or a combination thereof.

111. The method of claim 94, wherein the BMP -2 is introduced into the scaffold.

112. The method of claim 94, wherein the scaffold resembles the size and shape of a given bone defect or muscle injury' site.

113. The method of claim 94, wherein the scaffold is chemotactic.Attorney’s Docket No.: 21105.0097P1114. The method of claim 94, wherein the scaffold comprises viable blood cells and appropriate biological factors.

115. The method of claim 105, wherein the bone substitute is demineralized bone matrix.

116. The method of claim 105, wherein the bone substitute is derived from a biological product, a synthetic bone substitute or a combination thereof.

117. The method of claim 116, wherein the biological product is a demineralized bone matrix, hydroxyapatite, or a coral.

118. The method of claim 116, wherein the synthetic bone substitute is calcium sulfate, a calcium phosphate cement, P-tri-calcium phosphate ceramics, bioactive glasses, or a polymer.

119. A method of promoting muscle healing, bone healing, or a combination thereof in a subject, the method comprising implanting the biomimetic scaffold of any of claims 40-75 into a site of interest in the subject.

120. The method of claim 119, wherein the subject has a skeletal defect or a nonunion.

121. The method of claim 120, wherein the skeletal defect is a small skeletal defect or a large segmental bone defect.

122. The method of claim 119, wherein the subject has one or more bone fractures.

123. The method of claim 119, wherein the subject has one or more bone injuries.

124. The method of claim 119, wherein the subject has a dental bone defect.

125. A method of constructing a biomimetic scaffold, the method comprising:Attorney’s Docket No.: 21105.0097P1a) dimensioning a scaffold in at least one of a shape and a size that facilitates implantation of the scaffold into a bone defect;b) combining the scaffold in a) with an ex vivo hematoma comprising:(i) isolated whole blood and sodium citrate;(ii) calcium chloride; thrombin; or thrombin and calcium chloride;to create the biomimetic scaffold; and c) combining the biomimetic scaffold in b) with a messenger ribonucleic acid (mRNA)-based therapeutic composition or a ribonucleic acid (RNA)-based therapeutic composition.

126. The method of claim 125, wherein the ex vivo hematoma has a porosity of 55 to 75%.

127. The method of claim 125, wherein the ex vivo hematoma comprises fibrin fibers having a thickness of 100-400 nm ± 10%.

128. The method of claim 125, wherein the shape of the scaffold is that of a cylinder, a sphere or any other shape.

129. The method of claim 125, wherein the scaffold is collagen, chitins, bioabsorbable polymers, nonabsorbable polymers such as PEEK, or titanium or a metallic alloy.

130. The method of claim 125, wherein the ex vivo hematoma further comprises a bone substitute.

131. The method of claim 130, wherein the bone substitute is demineralized bone matrix.

132. The method of claim 130, wherein the bone substitute is derived from a biological product or a synthetic bone substitute.

133. The method of claim 131, wherein the biological product is a demineralized bone matrix, hydroxyapatite, or a coral.Attorney’s Docket No.: 21105.0097P1134. The method of claim 132, wherein the synthetic bone substitute is calcium sulfate, a calcium phosphate cement, p-tri-calcium phosphate ceramics, bioactive glasses, or a polymer.

135. The method of claim 125, wherein the ex vivo hematoma further comprises one or more growth factors.

136. The method of claim 125, wherein the one or more growth factors is bone morphogenetic protein 2 (BMP-2), BMP-7, BMP -4, BMP-6, BMP-9, BMP- 14, platelet-derived growth factor (PDGF), vascular endothelial growlh factor (VEGF), fibroblast growth factor 2 (FGF-2), or a combination thereof.

137. The method of claim 125, wherein the BMP-2 is introduced into the ex vivo hematoma.

138. The method of claim 125, wherein the amount of BMP -2 present in the scaffold is at least 0.01 mg.

139. The method of claim 125, wherein the scaffold resembles the size and shape of a given bone defect.

140. The method of claim 125, wherein the scaffold is chemotactic.

141. The method of claim 125, wherein the ex vivo hematoma further comprises viable blood cells and appropriate biological factors.

142. The method of claim 125, wherein the mRNA- based therapeutic composition comprises a mineral coated microparticle; a mRNA complex bout to the mineral coated microparticle, wherein the mRNA complex comprises an mRNA complexed with a lipid nanoparticle.Attorney’s Docket No.: 21105.0097P1143. The composition of claims 125, wherein the mRNA-based therapeutic composition comprises mRNA.

144. The composition of claim 143, wherein the mRNA comprises the nucleic acid sequence of SEQ ID NOs: 3, 4, 5, 6, 7, 8, 9, 10, or 11.

145. The composition of claim 144, wherein the mRNA encodes a protein of interest.

146. The composition of claim 144, wherein the mRNA encodes roof plate-specific sondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2), transforming growth factors (e.g., TGF-a and TGF-P), and platelet-derived grow th factors (e.g., PDGF-AA and PDGF-BB), insulin-like growth factor-1 (IGF-1), tumor necrosis factor-a (TNF-a), vascular endothelial growth factor (e.g., VEGF A and B), basic fibroblast growth factor (bFGF (FGF-2)).

147. The composition of claim 144, wherein the mRNA encodes bone morphogenetic protein-2 (BMP-2), BMP-2 / BMP-4, BMP-2 / BMP-7. BMP-4 / BMP-7, BMP-6, or BMP-9148. The composition of claim 144, wherein the mRNA encodes roof plate-specific spondin-2 (RSPO-2).

149. The composition of claim 144, wherein the mRNA encodes a growth factor.

150. The composition of claim 149, wherein the growth factor is roof plate-specific spondin-2 (RSPO-2), nuclear factor erythroid 2-related factor 2 (NRF2). a transforming growth factors (TGF-a and TGF-P), and a platelet-derived growth factor (PDGF-AA and PDGF-BB), insulin-like growth factor-1 (IGF-1), tumor necrosis factor-a [TNF-a]), a vascular endothelial growth factor (VEGF A and B), basic fibroblast growth factor (bFGF (FGF-2)). bone morphogenetic protein 2 (BMP-2). BMP-7, BMP-4, BMP-6, BMP-9, BMP-14, or BMP-2 / -7.Attorney’s Docket No.: 21105.0097P1151. The composition of claim 150, wherein the grow th factor is BMP-2 or BMP-2 / -7.

152. The composition, multi -compartment device, biomimetic scaffold or method of any of the preceding claims, wherein the mRNA-based therapeutic composition comprises a mineral coated substrate; a mRNA complex bound to the mineral coated microparticle, wherein the mRNA complex comprises an mRNA complexed with a lipid nanoparticle.

153. The composition, multi -compartment device, biomimetic scaffold or method of any of the preceding claims, wherein the mRNA-based therapeutic composition comprises a mineral -coated substrate; a mRNA complex(es) bound to the mineral-coated substrate, wherein the mRNA complexes include mRNA complexed with a DOTAP-substituted lipid nanoparticle; and a lyoprotectant, wherein the mRNA-based therapeutic composition is lyophilized to a dry powder.

154. The composition, multi -compartment device, biomimetic scaffold or method of claim 153. wherein the extent of DOTAP substitution is from about 1 to 20%.

155. The composition, multi -compartment device, biomimetic scaffold or method of any of the preceding claims, wherein the RNA-based therapeutic composition comprises a mineral coated substrate; a RNA complex bound to the mineral coated microparticle, wherein the RNA complex comprises an RNA complexed with a lipid nanoparticle.

156. The composition, multi -compartment device, biomimetic scaffold or method of any of the preceding claims, wherein the RNA-based therapeutic composition comprises a mineral -coated substrate; a RNA complex(es) bound to the mineral-coated substrate, wherein the RNA complexes include RNA complexed with a DOTAP-substituted lipid nanoparticle; and a lyoprotectant, wherein the RNA-based therapeutic composition is lyophilized to a dry pow der.Attorney’s Docket No.: 21105.0097P1157. The composition, multi -compartment device, biomimetic scaffold or method of claim 156, wherein the RNA-complexes include RNA selected from the group consisting of mRNA, microRNA. siRNA, shRNA, iRNA, gRNA, and an aptamer.

158. The composition, multi -compartment device, biomimetic scaffold or method of claim 157, wherein the extent of DOTAP substitution is from about 1 to 20%.