Keloid spheroid model preparation using patient-derived keloid fibroblasts and endothelial cells, and use thereof
By cultivating patient-derived keloid fibroblasts with endothelial cells in a specific ratio and using 3D culture techniques, the keloid spheroid model addresses the limitations of existing keloid models, offering improved drug screening and personalized treatment options.
Patent Information
- Application Number
- PCT/KR2024/021476
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-02-07
- Filing Date
- 2024-12-30
- Publication Date
- 2025-08-14
AI Technical Summary
Current keloid models, such as 2D fibroblast cell cultures and co-culture models, fail to accurately represent the complex interactions and tissue structure of keloids, limiting their effectiveness in predicting drug reactions and treating keloid skin or scars, while existing 3D models like organoids have lower productivity and longer generation times.
A method for producing a keloid spheroid model by cultivating patient-derived keloid fibroblasts with endothelial cells in a specific ratio, using various 3D culture techniques, to enhance cell interaction and genetic expression profiles, facilitating drug screening and personalized treatment options.
The keloid spheroid model provides a more representative in vitro model for keloid studies, allowing for optimized drug screening and personalized treatment methods based on individual patient responses.
Smart Images

Figure KR2024021476_14082025_PF_FP_ABST
Abstract
Description
Production of a keloid spheroid model using patient-derived keloid fibroblasts and endothelial cells and its use
[0001] The present invention relates to the production of a keloid spheroid model using patient-derived keloids and its use, and more specifically, to an optimized manufacturing method for producing a keloid spheroid model and a drug evaluation method for preventing or treating keloid skin or keloid scars using the same, for use as a patient-tailored disease model.
[0002] Keloids are benign fibroproliferative conditions that develop beyond the initial wound margin. They manifest as excessively thickened collagen deposits in the highly vascular dermis. Various treatments have been attempted for keloids, including intralesional injections of triamcinolone, fluorouracil, and bleomycin. However, treatment responses vary depending on the patient and lesion, and there is currently no method for predicting drug response before treatment.
[0003] In addition, because keloids are a unique human disease, it is difficult to create an animal model, and various in vitro keloid models have been created and reported (Ud-Din and Bayat, 2017; Lebeko et al., 2019; Limandjaja et al., 2020). Among them, the most commonly used in vitro keloid model is a two-dimensional (2D) monolayer fibroblast culture system, but it has fundamental limitations in that it has almost no cell interaction and collagen deposition, which are the main characteristics of keloids (Lebeko et al., 2019; Tan et al., 2020).
[0004] In addition, co-culture models have the problem of not being able to reflect tissue architecture although they show a certain degree of increased cell interaction (Lebeko et al. 2019), and among 3D culture models using 3D culture technology, which is widely used to study the pathogenesis of various neoplastic diseases, especially cancer (Franchi-Mendes et al., 2021a), organoids can better reflect the in vivo environment than spheroids, but have the problem of low productivity and longer generation time (Lebeko et al., 2019).
[0005] In contrast, spheroids have been demonstrated to be a 3D cell culture model capable of rapid mass production and enhanced cell interactions resembling the genetic expression profiles of in vivo tissues (Khaitan and Dwarakanath, 2006; Fennema et al., 2013; Franchi-Mendes et al., 2021a), (Kunz-Schughart et al., 1998; Lin and Chang, 2008).
[0006] Accordingly, although spheroid models for drug screening and optimization have been evaluated in several studies (Khaitan and Dwarakanath, 2006; Song et al., 2018), they have not been widely used in keloid research, and the keloid spheroids reported so far have simply used keloid tissue itself harvested from the central dermis of patients with active keloids without epidermis, and primary keloid spheroids have been cultured under aquatic conditions (Lee et al., 2013).
[0007] Furthermore, 2D monolayer cell cultures of keloid fibroblasts exhibit a restricted genetic expression profile associated with fibrosis (Sato et al., 1998). Therefore, spheroids were considered useful for modeling keloids in keloid research.
[0008] In addition, heterotypic cell interactions are an important factor in keloid development, and previous studies have mainly focused on the cellular interactions between keratinocytes and fibroblasts in keloids (Ong et al., 2007; Hahn et al., 2013). However, recently, endothelial dysfunction has been known to play an important role in keloid development (Ogawa and Akaishi, 2016), and the development of single-cell RNA sequencing technology has also revealed that endothelial cells play an important role in keloid development (Liu et al., 2022; Shim et al., 2022).
[0009] Accordingly, the inventors of the present invention have created a more representative in vitro model of keloids containing keloid fibroblasts and endothelial cells using spheroid technology, and have used this to evaluate the activity, gene expression profile, and drug response of keloid spheroids, thereby enhancing their usefulness as an in vitro model, thereby completing the present invention.
[0010] The present invention aims to provide a method for producing a keloid spheroid model using a patient-derived keloid, a keloid spheroid model produced by the method, a method for screening a preventive or therapeutic agent for keloid skin or keloid scars using the keloid spheroid model, and a method for providing information for selecting a patient-tailored preventive or therapeutic agent for keloid skin or keloid scars.
[0011] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned can be clearly understood by those skilled in the art from the description below.
[0012] According to one embodiment of the present invention, a method for producing a keloid spheroid model is provided, comprising: 1) culturing patient-derived keloid fibroblasts; 2) mixing and culturing the cultured keloid fibroblasts of 1) with endothelial cells; and 3) culturing the cells mixed and cultured according to 2) in three dimensions.
[0013] In the present invention, the keloid of step 1) may be characterized as an idiopathic or cicatricial keloid.
[0014] In the present invention, the mixed culture step of step 2) may be characterized by culturing keloid fibroblasts and endothelial cells by mixing them at a ratio of 8:1 to 2:1.
[0015] In the present invention, it may be characterized in that the keloid fibroblasts and endothelial cells are cultured by mixing them at a ratio of 4:1.
[0016] In the present invention, the endothelial cells may be characterized by being at least one selected from the group consisting of skin, veins, cardiac lumen, arteries, capillaries, cornea, and lymphatic vessels.
[0017] In the present invention, the venous cells may be characterized as being umbilical vein endothelial cells.
[0018] In the present invention, the three-dimensional culturing step of step 3) may be characterized by being selected from the group consisting of pellet culture, static suspension culture, spinner / rotational chamber culture, nano / micro pattern culture, magnetic levitation culture, soild scaffold in well culture, hydrogel in well culture, hydrogels on micropillar culture, hydrogels in microchannel culture, U shape well culture, V shape well culture, and hang in drop culture.
[0019] According to another embodiment of the present invention, a keloid spheroid model manufactured by the method for manufacturing a keloid spheroid model of the present invention is provided.
[0020] In the present invention, the keloid spheroid model may be characterized in that the area, diameter, or cell viability of the spheroid is maintained for 3 to 6 days from the date of spheroid formation.
[0021] In the present invention, the keloid spheroid model may be characterized by expressing at least one gene selected from the group consisting of COL1A1, COL3A1, TGFB1, TGFB3, HIF1A, MMP14, HTRA1, ADAM12, and CTHRC1.
[0022] According to another embodiment of the present invention, a method for screening for an agent for preventing or treating keloid skin or keloid scars is provided, comprising: a step of treating a candidate substance in a keloid spheroid model produced by a method for producing a keloid spheroid model of the present invention; and a step of evaluating the volume or cell viability level of a keloid caused by the candidate substance in the keloid spheroid model treated with the candidate substance.
[0023] In the present invention, if the volume reduction or cell viability level of the keloid by the candidate substance increases compared to the negative control model, it can be characterized in that the candidate substance is judged to be an agent for preventing or treating keloid skin or keloid scars in the keloid spheroid model.
[0024] In the present invention, the candidate substance may be characterized by being at least one selected from the group consisting of a compound, a microbial culture or extract, a natural product extract, a nucleic acid, a protein, a peptide, a laser, and an energy-based device (EBD).
[0025] According to another embodiment of the present invention, a method for providing information for selecting a method for preventing or treating keloid skin or keloid scars tailored to a patient is provided, characterized in that it comprises the steps of: treating a candidate substance to a keloid spheroid model produced by the method for producing a keloid spheroid model of the present invention; and selecting the candidate substance as a preventive or therapeutic agent for keloid skin or keloid scars, when the candidate substance increases the volume reduction or cell viability level of the keloid in the keloid spheroid model treated with the candidate substance compared to a negative control model.
[0026] A keloid spheroid model using patient-derived keloids according to one embodiment of the present invention and a method for providing information for drug screening and selection of treatment methods using the same can provide an optimized treatment method for each patient in a patient group with various clinical information in which each patient has different responses to drugs.
[0027] Figure 1 illustrates an overall experimental outline of the present invention, and is a schematic diagram of keloid spheroid formation, viability analysis, composition analysis, propagation analysis, and drug analysis.
[0028] Figure 2 is a diagram showing the formation of a keloid spheroid model according to the mixing ratio of keloid fibroblasts and endothelial cells according to Example 2.
[0029] Figure 3 is a diagram showing the contents of Example 3, confirming the survival rate of a keloid spheroid model.
[0030] Figure 4 is a diagram showing the contents of Experimental Example 4, the composition of a keloid spheroid model and the results of propagation analysis.
[0031] Figure 5 is a diagram showing the content of Experimental Example 5, confirming the formation of a keloid spheroid model according to the optimal mixing ratio of keloid fibroblasts and endothelial cells.
[0032] Figure 6 is a diagram showing the expression of keloid gene markers in a keloid spheroid model, which is the content of Experimental Example 6.
[0033] Figure 7 is a diagram showing the contents of Experimental Example 7, showing changes according to candidate substances treated in a keloid spheroid model.
[0034] Figure 8 is a schematic diagram of a model production of a patient-derived keloid spheroid intended for the present invention and a screening method or information provision method according to drug reactivity using the same.
[0035] Figure 9 is a schematic diagram of the use of patient-derived spheroids for customized treatment of keloid patients as intended by the present invention.
[0036] Hereinafter, examples will be given to provide a more specific explanation. However, the following examples are illustrative only and the scope of the present invention is not limited thereto.
[0037] According to one embodiment of the present invention, a method for producing a keloid spheroid model is provided, comprising: 1) culturing patient-derived keloid fibroblasts; 2) mixing and culturing the cultured keloid fibroblasts of 1) with endothelial cells; and 3) culturing the cells mixed and cultured according to 2) in three dimensions.
[0038] In the present invention, the keloid of step 1) refers to a disease in which excessive proliferation of connective tissue of the skin occurs during the wound recovery process after skin damage, and may be an idiopathic or scar keloid.
[0039] The above patient-derived keloid fibroblasts are patient tissues obtained from various body parts such as the patient's ear, chest, back, and shoulder, and the site of keloid occurrence and the degree of lesion may all be different.
[0040] In the present invention, the term 'compact' means compact, and 'compact spheroid' may mean a dense spheroid composed of aggregated cells, and may mean a density of spheroids that matches the intended experiment.
[0041] In the mixed culture step of step 2) of the present invention, keloid fibroblasts and endothelial cells can be cultured by mixing them in a ratio of 8:1 to 2:1 or 6:1 to 2:1, and in terms of maintaining them as compact spheroids with excellent cell viability and angiogenic ability and achieving a significant area and diameter, they can be cultured by mixing them in a ratio of 4:1 most suitably.
[0042] For example, if the ratio of keloid fibroblasts and endothelial cells deviates from 8:1 to 2:1, problems such as decreased cell viability may occur, and problems such as gene expression levels not increasing as desired may occur.
[0043] In the present invention, the endothelial cells may be characterized as being at least one selected from the group consisting of skin, vein, cardiac lumen, artery, capillary, cornea, and lymphatic vessel, and may be characterized as being most suitable as umbilical vein endothelial cells in terms of producing compact spheroids with excellent cell viability and angiogenic ability.
[0044] In the present invention, the 3D culturing step of step 3) may be characterized by being selected from the group consisting of pellet culture, static suspension, spinner / rotational chamber, nano / micro pattern, magnetic levitation, soild scaffold in well, hydrogel in well, hydrogels on micropillar, hydrogels in microchannel, U shape well, V shape well and hang in drop, and in terms of producing a compact 3D spheroid with excellent cell viability and angiogenic ability, the hang in drop is most suitable. It can be achieved.
[0045] According to another embodiment of the present invention, a keloid spheroid model manufactured by the method for manufacturing a keloid spheroid model of the present invention is provided.
[0046] In the present invention, the keloid spheroid model may be characterized in that the area, diameter, or cell viability of the spheroid is maintained for 3 to 6 days from the date of spheroid formation.
[0047] For example, if a keloid spheroid model less than 3 days old from the date of spheroid formation is used, the desired degree of compactness may not be achieved, and if a keloid spheroid model more than 6 days old is used, a problem of partial regression may occur.
[0048] That is, in terms of using compact spheroids with the desired excellent cell viability and angiogenic ability, it is appropriate to use a keloid spheroid model 3 to 6 days from the date of spheroid formation.
[0049] In the present invention, the keloid spheroid model may be characterized by expressing at least one gene selected from the group consisting of COL1A1 (collagen type I alpha 1 chain), COL3A1 (collagen type 3 alpha 1 chain), TGFB1 (transforming growth factor beta 1), TGFB3 (transforming growth factor beta 3), HIF1A (Hypoxia-inducible factor 1-alpha), MMP14 (Matrix metalloproteinase-14), HTRA1 (Serine protease HTRA1), ADAM12 (Disintegrin and metalloproteinase domain-containing protein 12), and CTHRC1 (collagen triple helix repeat containing 1).
[0050] For example, the expression level of the above gene may vary from patient to patient.
[0051] According to another embodiment of the present invention, a method for screening an agent for preventing or treating keloid skin or keloid scars is provided, comprising: a step of treating a candidate substance in a keloid spheroid model produced by a method for producing a keloid spheroid model of the present invention; and a step of evaluating the volume or cell viability level of a keloid caused by the candidate substance in the keloid spheroid model treated with the candidate substance.
[0052] In the present invention, if the volume reduction or cell viability level of the keloid by the candidate substance increases compared to the negative control model, it can be characterized in that the candidate substance is judged to be an agent for preventing or treating keloid skin or keloid scars in the keloid spheroid model.
[0053] The negative control model may mean, for example, a case in which the same keloid spheroid model is not treated with a candidate substance.
[0054] In the present invention, the candidate material may be characterized by being at least one selected from the group consisting of compounds, microbial cultures or extracts, natural product extracts, nucleic acids (DNA and RNA), proteins, peptides, lasers, and energy-based devices (EBD).
[0055] For example, the compound may include one or more selected from the group consisting of common keloid drug compounds, such as corticosteroids, verapamil, interferon, colchicine, retinoids, interleukin-6, triamcinolone, fluorouracil, and bleomycin.
[0056] According to another embodiment of the present invention, a method for providing information for selecting a method for preventing or treating keloid skin or keloid scars tailored to a patient is provided, characterized in that it comprises the steps of: treating a candidate substance to a keloid spheroid model produced by the method for producing a keloid spheroid model of the present invention; and selecting the candidate substance as a preventive or therapeutic agent for keloid skin or keloid scars when the candidate substance increases the volume reduction or cell viability level of the keloid in the keloid spheroid model treated with the candidate substance compared to a negative control model.
[0057] Accordingly, a keloid spheroid model manufactured by including keloid fibroblasts derived from patients with various keloid skin or keloid scars can be produced as an in vitro model, and by evaluating various drug effects using the keloid spheroid model, an analysis system or screening method optimized for each patient can be established, and information can be provided for selecting a patient-tailored drug or treatment method using the keloid spheroid model.
[0058]
[0059] Hereinafter, the present invention will be described in detail through the following examples and experimental examples.
[0060] However, the following examples and experimental examples are only illustrative of the present invention, and the content of the present invention is not limited by the following examples and experimental examples.
[0061]
[0062] Example
[0063] Example 1. Preparation of fibroblasts and endothelial cells
[0064] Keloid fibroblasts were collected from commercial cell lines and from patients with keloids confirmed by clinical appearance and histopathological examination.
[0065] (This study was approved by the Institutional Review Board (IRB) of Samsung Medical Center (IRB number: SMC 2020-03-032). Informed consent was obtained from all patients.)
[0066] For group A, a commercial keloid fibroblast cell line (CRL1762, ATCC, Manassas, VA, USA) was used.
[0067] For groups K1, K2, and K3, keloid fibroblasts were extracted from patients with different clinical responses to treatment according to Table 1 below, all obtained from the same anatomical site via excisional biopsy.
[0068] Sample IDSexRaceAgeSite of SamplingK1MaleAsian50ChestK2FemaleAsian55ChestK3FemaleAsian55Chest
[0069] Specifically, keloid fibroblasts according to each group above were cultured and then fibroblasts were isolated from keloid tissue. Next, fibroblasts were cultured in DMEM (Thermo Fisher Scientific, Waltham, MA, USA) containing 10% heat-inactivated fetal bovine serum (Thermo Fisher Scientific, Waltham, MA, USA) and 1% penicillin-streptomycin (Gibco, Carlsbad, CA).
[0070] Additionally, endothelial cells were cultured in EGM-2 BulletKit medium (Lonza, Basel, Switzerland) using a commercial human umbilical vein endothelial cell (HUVECs) cell line (C2519A, Lonza, Basel, Switzerland).
[0071] At this time, fibroblasts and endothelial cells (HUVEC) used in all experiments were passaged 3 to 5 times.
[0072]
[0073] Example 2. Spheroid formation
[0074] The number of fibroblasts per spheroid was fixed at 2000, and the number of endothelial cells was set to 0, 250, 500, 1000, and 2000. Next, fibroblasts and endothelial cells were mixed according to the defined cell ratio (1:0, 8:1, 4:1, 2:1, 1:1) and cultured in 100 mm culture dishes. Both types of cells were cultured in 40 μL DMEM containing 10% heat-inactivated FBS (fetal bovine serum, Thermo Fisher Scientific, Waltham, MA, USA) and 1% penicillin-streptomycin (Gibco, Carlsbad, CA, USA).
[0075] Next, spheroids were generated through 3D cell culture using the hang-in-drop method. Specifically, the dish was carefully inverted, 3 mL of PBS was added to the chamber at the bottom of the dish to prevent the spheroids from drying, and they were cultured in a 5% CO2 incubator. The changes in the spheroids were observed using an inverted microscope (CKX53, Olympus, Shinjuku, Japan), and the results are shown in Fig. 2.
[0076] Figure 2A shows the state changes of aggregated cells according to density (scale bar = 100 μm), categorized into various states: aggregation, lag period, compact spheroid, lag period, and regression. This confirms that aggregated cells change density.
[0077] Figures 2B and 2C show different state changes of keloid spheroids according to cell ratio.
[0078] Specifically, in A(F1E0), compact spheroids were formed on the second day, the earliest day, but were unable to maintain compactness and regressed after four days.
[0079] On the other hand, in A(F8E1), A(F4E1), and A(F2E1), compact spheroids were observed to form on the third day and were maintained from the fourth to sixth day. In addition, A(F1E1) was unable to form condensed spheroids until the sixth day, so the 1:1 ratio was considered inappropriate for further analysis.
[0080] Therefore, it was found that endothelial cells are necessary to maintain keloid spheroids, but too many endothelial cells hindered the formation of keloid spheroids, and at least 4 days were required to form and maintain compact keloid spheroids.
[0081] Figure 2D measures the area and diameter of the spheroids and sets the area and diameter of A(F1E0) as the control. The area of the spheroids on the 6th day was 10,804 to 25,118 μm. 2 , the diameter of the spheroids was 127~215μm. At this time, the diameter of A(F1E0) was the largest at 194μm on the first day, but gradually decreased to a minimum diameter of 127μm on the 6th day. In the case of A(F1E1), the area and diameter were the largest, and in the case of A(F4E1), it was the second largest, showing a significant increase compared to the area and diameter of A(F1E0). However, as mentioned above, A(F1E1) could not form compact spheroids, and it was confirmed that A(F4E1) could form and maintain compact spheroids with a large diameter.
[0082]
[0083] Example 3. Cell viability analysis
[0084] The spheroids according to Example 2 were evaluated for cell viability on days 2, 4, and 6 of culture, and the results are shown in Figure 3.
[0085] Specifically, a Live / Dead Cell Double Staining Kit (Sigma-Aldrich, Burlington, MA, USA) was used, and spheroids were stained according to the manufacturer's protocol. Next, live cells were observed at a wavelength of 490 nm with the green fluorescent dye calcein AM, and dead cells were observed at a wavelength of 545 nm with propidium iodide fluorescent dye using a confocal laser scanning microscope (LSM800; Carl Zeiss, Oberkochen, Germany). Each experiment was repeated three times.
[0086] Referring to Figure 3, the cell viability analysis results showed that A(F1E0) showed low cell viability in the center from day 4. In contrast, spheroids with endothelial cells showed higher cell viability in the center. In other words, it was found that the higher the proportion of endothelial cells, the higher the likelihood of increased cell viability.
[0087] Additionally, when comparing the survival rate of keloid spheroids on day 6 with that on day 4, it was confirmed that the proportion of non-viable cells in the center increased in all groups, while the size of the spheroids decreased.
[0088]
[0089] Example 4. Composition and propagation analysis
[0090] To determine cell composition with angiogenic capacity, confocal fluorescence microscopy and propagation analysis were performed, and the results are shown in Fig. 4.
[0091] 1) Composition analysis
[0092] Fibroblasts and endothelial cells were cultured in 100 mm culture dishes with 100 μL of 1X Track It Blue solution (AAT Bioquest, Pleasanton, CA, USA) for 30 minutes each using the Cell Explorer Live Cell Tracking Kit (AAT Bioquest, Pleasanton, CA, USA).
[0093] Next, the fluorescent dye was washed away, and spheroids were formed by mixing fibroblasts and endothelial cells at a predefined cell ratio. After culture, blue fluorescence was observed using a 575 / 26 nm filter of a confocal laser scanning microscope (LSM800, Carl Zeiss, Oberkochen, Germany), and orange fluorescence was observed using a 450 / 40 nm filter. The experiment was repeated three times.
[0094] As a result, compact spheroids were maintained from day 4 and non-viable cells increased after day 4, so confocal fluorescence microscopy was performed using day 4 spheroids, and the results are shown in Figure 4A.
[0095] Referring to Figure 4A, it was confirmed that fibroblasts and endothelial cells were well mixed in all groups.
[0096] 2) Radio analysis
[0097] The propagation assay was performed using spheroids mixed in the same manner as the composition analysis described above, cultured for 3 days. Specifically, EGM-2 BulletKit spheroid medium (Lonza, Basel, Switzerland) and Matrigel® Basement Membrane Matrix (Corning, Corning, NY, USA) were mixed in a 1:1 ratio, and 100 μL of the mixture was injected per well into a 96-well culture plate, followed by culture including spheroids. After culture for 1, 3, and 5 days, images were taken using an inverted microscope (CKX53, Olympus, Shinjuku, Tokyo, Japan) and quantified using ImageJ (National Institutes of Health, Bethesda, MD, USA). The experiment was repeated three times.
[0098] Next, the proliferation area of the keloid spheroid was examined and quantified by performing a propagation analysis, which is shown in Figures 4B and 4C. Specifically, since the proliferation area may contain both the germination area of endothelial cells and the proliferation area of fibroblasts, the proliferation area of A (F1E0) was set as the control.
[0099] Referring to Figures 4B and 4C, it was confirmed that A(F4E1) and A(F2E1) had a significantly increased proliferation area compared to A(F1E0) on day 5. Therefore, it was found that A(F4E1) and A(F2E1) had a higher angiogenic capacity than other spheroids.
[0100]
[0101] Example 5. Optimal ratio of keloid fibroblasts and endothelial cells
[0102] Through the above Examples 1 to 4, it was found that both A(F4E1) and A(F2E1) could be maintained as compact spheroids with excellent cell viability and angiogenic ability. In addition, in the case of A(F4E1), both the area and diameter showed a significant increase, and therefore the 4:1 ratio was evaluated as the best ratio for modeling and evaluating keloids, followed by the 2:1 ratio.
[0103] Next, keloid spheroids (K1, K2, K3) were generated using patient-derived keloid fibroblasts obtained through biopsy from the same anatomical location of three patients. In previous experiments using commercially available ATCC keloid fibroblasts (Examples 1 to 4 above), 4:1 and 2:1 ratios were considered to be the optimal ratios for keloid spheroids, and thus patient-derived keloid fibroblasts were used to generate keloid spheroids. Specifically, 4:1 ratios of K1 (F4E1), K2 (F4E1), K3 (F4E1) and 2:1 ratios of K1 (F2E1), K2 (F2E1), K3 (F2E1) were generated, and the results are shown in FIGS. 5A and 5B .
[0104] Referring to Figures 5A and 5B, microscopic examination revealed that K1 showed compact spheroids from day 3, but partial regression was observed on day 6. K2 and K3 formed compact spheroids from day 2 and maintained them until day 6. On day 6, the area of the spheroids increased from 13,489 to 23,427 μm. 2 Up to this point, the diameter of the spheroids was confirmed to range from 146 to 192 μm, and among these, the area and diameter were confirmed to be the largest in K3 (F4E1) and the smallest in K2 (F4E1).
[0105]
[0106] Example 6. Quantification using real-time PCR (RT-PCR)
[0107] Spheroids were cultured for 3 days and gene expression analysis was performed using quantitative RT-PCR. A total of 70 spheroids were used for each group, and each spheroid, containing the same amount of fibroblasts and endothelial cells, was cultured using 2D monolayer culture to compare gene expression profiles. Next, with reference to previous keloid studies (Seifert et al., 2008; Yamawaki et al., 2018; Zhao et al., 2018; Kang et al., 2020; Shim et al., 2022), representative genetic markers associated with keloid pathogenesis, COL1A1, COL3A1, TGFB1, TGFB3, HIF1A, MMP14, HTRA1, ADAM12, and CTHRC1, were analyzed, and total RNA was extracted using the RNeasy mini kit (Qiagen, Hilden, Germany). Template cDNA was obtained by reverse transcription of total RNA using oligo(dT) primers and PrimeScript RT reagent Kit (Takara, Tokyo, Japan), and PCR amplification was performed using SYBR® Green Realtime PCR Master Mix (Toyobo, Osaka, Japan) and the results are shown in Figure 6. In addition, the primers used for real-time RT-PCR are listed in Table 2 below.
[0108] Gene Primer Sequence (Forward) Primer Sequence (Reverse) COL1A1CTGAGCCAGCAGATCGAGAA (SEQ ID NO: 1)CATCTTGAGGTCACGGCAGG (SEQ ID NO: 2) COL3A1TATCGAACACGCAAGGCTGT (SEQ ID NO: 3)AAAAGCAAACAGGGCCAACG (SEQ ID NO: 4) TGFB1CGGCCTTTCCTGCTTCTCAT (SEQ ID NO: 5)GAGGTCCTTGCGGAAGTCAA (SEQ ID NO: 6) TGFB3CCCAGCTCTAAGCGGAATGA (SEQ ID NO: 7)TAGCGCTGTTTGGCAATGTG (SEQ ID NO: 8) HIF1AGCAGAATGCTCAGAGAAAGCG (SEQ ID NO: 9)TAGCTGCATGATCGTCTGGC (SEQ ID NO: 10) MMP14CCCAACATCTGTGACGGGAA (SEQ ID NO: 11)TTGGTTATTCCTCACCCGCC (SEQ ID NO: 12)HTRA1AAGTTCCTCACGGAGTCCCA (SEQ ID NO: 13)GCTCTTTGGCTTTGCTGGAC (SEQ ID NO: 14)ADAM12TCCGGCAAGCAGATAACCAA (SEQ ID NO: 15)TAAACCACAAATCCGGCAGC (SEQ ID NO: 16)CTHRC1GTGGCTCACTTCGGCTAAAAT (SEQ ID NO: 17)CAATGGGAAGAGGTCCTGAACA (SEQ ID NO: 18)
[0109] Referring to Fig. 6, which compares the RNA expression of each keloid spheroid with that of the control group (Monolayer) cultured in a 2D monolayer with the same number of cells (fibroblasts and HUVECs), it was confirmed that the keloid spheroid according to the present invention significantly increases the expression levels of all keloid gene markers. Specifically, when the gene markers were divided according to the average expression level, COL1A1, ADAM12, and HIF1A showed an increase of less than 10-fold, but COL3A1, HTRA1, TGFB1, TGFB3, CTHRC1, and MMP14 showed an increase of more than 10-fold, and it was confirmed that COL1A1 and TGFB3 showed higher expression levels than COL3A1 and TGFB1, respectively. Furthermore, when comparing the effects of various cell ratios on gene expression levels within each group, the 2:1 ratio showed the smallest increase among the various ratios in all groups, which confirmed that increasing the fibroblast cell ratio likely increases gene expression levels, and thus the 4:1 ratio could be judged to be the optimal ratio for keloid spheroids as an in vitro model. Interestingly, keloid spheroids generated from commercially available ATCC keloid fibroblasts showed higher gene expression levels than patient-derived keloid spheroids, except for ADAM12, which suggests that various clinical symptoms and activities of keloids may be reflected in patient-derived keloid spheroids.
[0110]
[0111] Example 7. Drug Analysis
[0112] Pharmacological analyses were performed using the three most commonly used drugs for keloids in clinical settings: triamcinolone, fluorouracil, and bleomycin. The drug compounds were purchased from Selleckchem (Houston, TX, USA).
[0113] Specifically, spheroids cultured for 2 days were treated with each drug compound dissolved in DMSO at concentrations of 10 μM and 100 μM, and then cultured for 48 hours. The spheroids were visually evaluated using a Live / Dead Cell Double Staining Kit (Sigma-Aldrich, Burlington, MA, USA) on a confocal laser scanning microscope (LSM800, Carl Zeiss, Oberkochen, Germany) to observe the relative fluorescence levels associated with each concentration. The diameter of each spheroid was measured using ImageJ (National Institutes of Health, Bethesda, MD, USA), and the volume was calculated assuming a spherical shape. The relative volume of the spheroids was determined with reference to the negative control group (vehicles) that was not treated with the drug, and the experiment was repeated three times and the results are shown in Fig. 7.
[0114] To evaluate the potential of keloid spheroids as a tool platform for in vitro drug screening, drug assays were performed in spheroids prepared from ATCC keloid fibroblasts and HUVECs in a 4:1 ratio (A(F4E1)) and spheroids prepared from patient-derived keloid fibroblasts and HUVECs (K1(F4E1), K2(F4E1), K3(F4E1)).
[0115] Referring to Figure 7, which depicts both live / dead cell staining images and the relative volume of keloid spheroids, the efficacy of the administered drug was inferred from the significant change in diameter and decrease in density as observed by confocal microscopy.
[0116] Specifically, this was further confirmed by the decrease in the relative volume of spheroids compared to the negative control (vehicle), and it was confirmed that the drug responsiveness exhibited by keloid spheroids was dependent on the source of fibroblasts.
[0117] Referring to Figure 7B, A(F4E1) showed reactivity to all drugs tested at concentrations of 10 μM and 100 μM. K1(F4E1) and K3(F4E1) showed reactivity only to fluorouracil at 100 μM concentration, while showing insignificant reactivity to both triamcinolone and bleomycin, while K2(F4E1) demonstrated sensitivity to fluorouracil at both 10 μM and 100 μM concentrations, and substantial reactivity to triamcinolone and bleomycin at 100 μM concentration.
[0118]
[0119] Example 8. Statistical Analysis
[0120] All statistical analyses were performed using Prism 9.3.1 (GraphPad, San Diego, CA, USA). Additionally, one-way analysis of variance (ANOVA) was performed to compare the means of different groups to determine whether they differed significantly. The criterion for statistical significance was set at p < 0.05.
[0121]
[0122] In summary, patient-derived keloid fibroblasts can be cultured by mixing them with umbilical vein endothelial cells at a ratio of 8:1 to 2:1, and then induced to form keloid spheroids through three-dimensional culture. Keloid spheroids cultured for 3 to 6 days from the time of keloid spheroid formation are formed into compact spheroids with excellent cell viability and angiogenic ability, and can achieve significant area and diameter, so they can be utilized as an excellent keloid spheroid model.
[0123] That is, the results according to the above examples and experimental examples show that a keloid spheroid model of an actual patient can be successfully modeled using a keloid spheroid model including patient-derived keloid fibroblasts.
[0124] In addition, by referring to the response of candidate substances or therapeutic drugs in the patient's keloid spheroid model, it is possible to find an optimized treatment method for each individual patient and select a method for preventing or treating keloid skin or keloid scars, as well as provide information for selecting a patient-tailored treatment method.
[0125]
[0126] As the specific parts of the present invention have been described in detail above, it will be understood by those skilled in the art that the present invention can be easily modified into other specific forms without changing the technical idea or essential features of the present invention, and it is clear that the scope of the present invention is not limited thereto.
[0127] Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.
[0128] A keloid spheroid model using patient-derived keloids according to one embodiment of the present invention and a method for providing information for drug screening and selection of treatment methods using the same can provide an optimized treatment method for each patient in a patient group with various clinical information in which each patient has different drug responses, and thus has industrial applicability.
Claims
1. 1) Step of culturing patient-derived keloid fibroblasts; 2) a step of mixing and culturing the cultured keloid fibroblasts of 1) above with endothelial cells; and 3) A method for producing a keloid spheroid model, comprising: a step of culturing cells mixed and cultured according to the above 2) in three dimensions.
2. In paragraph 1, A method for producing a keloid spheroid model, characterized in that the keloid of the above step 1) is an idiopathic or cicatricial keloid.
3. In paragraph 1, A method for producing a keloid spheroid model, characterized in that the mixed culture step of step 2) above is culturing keloid fibroblasts and endothelial cells by mixing them at a ratio of 8:1 to 2:
1.
4. In paragraph 3, A method for producing a keloid spheroid model, characterized in that the above keloid fibroblasts and endothelial cells are cultured by mixing them at a ratio of 4:
1.
5. In paragraph 3, A method for producing a keloid spheroid model, characterized in that the above endothelial cells are at least one selected from the group consisting of skin, veins, cardiac lumen, arteries, capillaries, corneas, and lymphatic vessels.
6. In paragraph 5, A method for producing a keloid spheroid model, characterized in that the above venous cells are umbilical vein endothelial cells.
7. In paragraph 1, A method for producing a keloid spheroid model, characterized in that the three-dimensional culturing step of the above step 3) is selected from the group consisting of pellet culture, static suspension, spinner / rotational chamber, nano / micro pattern, magnetic levitation, soild scaffold in well, hydrogel in well, hydrogels on micropillar, hydrogels in microchannel, U shape well, V shape well, and hang in drop.
8. A keloid spheroid model manufactured by the manufacturing method of any one of claims 1 to 7.
9. In paragraph 8, The above keloid spheroid model is a keloid spheroid model characterized in that the area, diameter, or cell viability of the spheroid is maintained for 3 to 6 days from the date of spheroid formation.
10. In paragraph 8, The above keloid spheroid model is characterized in that it expresses at least one gene selected from the group consisting of COL1A1, COL3A1, TGFB1, TGFB3, HIF1A, MMP14, HTRA1, ADAM12, and CTHRC1.
11. A step of treating a candidate substance in the keloid spheroid model of Article 8; and A step of evaluating the volume or cell viability level of a keloid by a candidate substance in a keloid spheroid model treated with the candidate substance; including; A method for screening for the prevention or treatment of keloid skin or keloid scars.
12. In paragraph 11, If the volume of keloids or the level of cell viability by the above candidate substance increases compared to the negative control model, The above candidate substance is characterized in that it is determined to be an agent for preventing or treating keloid skin or keloid scars in the above keloid spheroid model. A method for screening for the prevention or treatment of keloid skin or keloid scars.
13. In paragraph 11, The above candidate substance is characterized in that the candidate substance is at least one selected from the group consisting of a compound, a microbial culture or extract, a natural product extract, a nucleic acid, a protein, a peptide, a laser, and an energy-based device (EBD). A method for screening for the prevention or treatment of keloid skin or keloid scars.
14. Step of processing candidate substances into the keloid spheroid model of Article 8 and If the candidate substance increases the volume reduction or cell viability level of the keloid spheroid model treated with the candidate substance compared to the negative control model, A method characterized by comprising a step of selecting the candidate substance as a preventive or therapeutic agent for keloid skin or keloid scars. A method for providing information for selecting a patient-specific method for preventing or treating keloid skin or keloid scars.
Citation Information
Patent Citations
Method for constructing keloid model in vitro
CN114381423A
Skin spheroids and process of preparation and use thereof
WO2022108772A1