Methods of treating estrogen receptor-positive breast cancer
Patent Information
- Application Number
- PCT/US2025/033178
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-06-11
- Filing Date
- 2025-06-11
- Publication Date
- 2026-10-01
AI Technical Summary
Existing treatments for estrogen receptor-positive (ER+) breast cancer, including selective ER modulators and degraders, face challenges with resistance and relapse, necessitating alternative therapeutic strategies to target chromatin complexes involved in ER signaling.
The combined administration of a KAT6A/B inhibitor and a Menin inhibitor, identified through CRISPR-Cas9-based screening, synergistically targets ER+ breast cancer, particularly in metastatic or endocrine-resistant cases, by disrupting KAT6A/B and Menin complexes.
This approach demonstrates significant anti-proliferative effects across various ER+ breast cancer models, including those resistant to endocrine therapy, by altering chromatin accessibility and gene expression, suggesting a promising therapeutic strategy for ER+ breast cancer.
Smart Images

Figure US2025033178_01102026_PF_FP_ABST
Abstract
Description
[0001] METHODS OF TREATING ESTROGEN RECEPTOR-POSITIVE BREAST CANCER
[0002] FIELD
[0003]
[0001] There are provided methods of treating estrogen receptor-positive breast cancer. In particular, the methods comprise the combined administration of therapeutically effective amounts of a KAT6A / B inhibitor and a Menin inhibitor to a patient in need thereof.
[0004] BACKGROUND
[0005]
[0002] In -70% of breast cancers, estrogen receptor (ER) is expressed and functions as a transcription factor, regulating cell growth and tumor progression (Perou, C.M., et al. (2000) Nature 406, 747-752.; Sorlie, T., et al. (2001) Proc National Acad Sci 98, 10869-10874). Inhibiting ER function is the mainstay treatment for ER-positive (ER+) breast cancer and includes selective ER modulators (SERMs, e.g. tamoxifen), aromatase inhibitors, and selective ER degraders (SERDs, e.g. fulvestrant and elacestrant).
[0006]
[0003] Despite the clinical benefit of targeting ER, resistance to endocrine therapies emerges in virtually all patients with metastatic disease and breast cancer remains the second leading cause of cancer-related death in women, with -50% of mortalities arising from ER+ tumors. An increasing number of endocrine resistance mechanisms have been reported, including somatic alterations and epigenetic changes. In a high proportion of these cases, ER signalling remains active in the absence of estrogen and / or presence of antiestrogens, continually driving gene expression and maintaining tumor growth. The continued reliance on ER signalling, even in the therapy-resistant setting, suggests that targeting chromatin complexes that are important for mediating ER-driven transcription may present an important alternative therapeutic strategy.
[0007]
[0004] One such complex implicated in regulating ER and ER signalling is the KAT6 complex. KAT6A (also known as MOZ or MYST3) and its paralog KAT6B (also known as MORE, MYST4, or QKF) belong to the MYST family of histone acetyltransferases (HATs). KAT6A is amplified and / or overexpressed in 15% of breast cancers and overexpression correlates with worse clinical outcome in ER+ tumors. While KAT6A can catalyze H3K9, H3K14, and H3K23 acetylation in different contexts, H3K23ac is the primary target in breast cancer cells. Recently, KAT6A has emerged as a promising further therapeutic target in estrogen receptor positive (ER+) breast cancer. Sharma et al reported (Sharma, S., et al. (2023) Cell Chem. Biol. 30, 1191-1210. e20) a highly potent and selective inhibitor of KAT6A / B histone acetyltransferases, PF-9363 (also known as CTx-648), which was shown to inhibit tumor growth in ER+ breast cancer models both in vitro and in vivo. WO2020 / 254946 reports benzisoxazole sulfonamide derivatives which act as KAT inhibitors. Pertinently, it discloses PF-07248144, which is a closely related KAT6A / B inhibitor to PF-9363, currently under investigation in a Phase 1 clinical study (NCT04606446) for advanced or metastatic breast, prostate, and lung cancer (see also Mukohara et al., Nature Medicine, 2024, https: / / doi.org / 10.1038 / s41591-024-03060-0).
[0008]
[0005] Menin is an evolutionarily conserved nuclear factor that associates with chromatin and interacts with multiple chromatin-associated complexes, most notably the histone lysine methyl transferases KMT2A (MLL1) and KMT2B (MLL2). MEN1 can function as a tumor suppressor in certain contexts and inactivating germline mutations of MEN1 cause the tumor syndrome multiple endocrine neoplasia type 1. However, in other contexts, Menin has been shown to support oncogenic cell proliferation, including in leukemia, prostate, and breast cancer. Over the past 5 years, several Menin inhibitor chemotypes have entered clinical trials in leukemia (e.g. revumenib) and have shown significant clinical activity in Phase 1 / 2 trials.
[0009]
[0006] Hemming et al., (Hemming, M.L., et al. (2022) Cancer Discov. 72, 1804-1823) postulated that the combination of a KAT6A inhibitor and a Menin inhibitor could be useful for treating gastrointestinal stromal tumor (GIST); see also WO2023 / 114867A2. Separately, Pemer et al., (Perner, F., et al., (2023) HemaSphere, 7(S3), 57-58) suggested that the combination of KAT6A (MOZ) inhibitor and a Menin inhibitor could be useful for treating acute myeloid leukaemia; see also WO2024 / 112819.
[0010]
[0007] Although therapeutic targeting of epigenetic proteins and transcriptional networks is a promising treatment modality, the crosstalk and compensatory effects of various chromatin complexes, histone modifications, and transcription factors presents a challenging layer of complexity for treating ER+ breast cancer. Identifying alternative and / or complementary therapeutic strategies for targeting ER+ breast cancer, particularly in cases where the cancer is metastatic, relapsed, or resistant to endocrine therapy, is therefore necessary.
[0011] SUMMARY
[0012]
[0008] Such alternative / complementary methods are provided herein. More specifically, it has now been discovered through epigenetic-focused CRISPR-Cas9-based functional genetic screening in ER+ breast cancer cells that MEN1 (encoding Menin) is a targetable epigenetic co-dependency of KAT6A / B inhibition. Said dependency was hitherto unknown.
[0013]
[0009] Remarkably, it has been found that the combined therapeutic targeting of KAT6A / B and Menin led to synergistic anti-proliferative effects in diverse models of endocrine sensitive and resistant ER+ breast cancer.
[0010] In a first aspect, there is provided a method of treating ER+ breast cancer, comprising the combined administration of therapeutically effective amounts of a KAT6A / B inhibitor and a Menin inhibitor to a patient in need thereof. Also provided is a KAT6A / B inhibitor and a Menin inhibitor for use in a method of treating ER+ breast cancer, comprising the combined administration of said KAT6A / B inhibitor and said Menin inhibitor to a patient in need thereof. Also provided is the use of a KAT6A / B inhibitor and a Menin inhibitor in the manufacture of a medicament, or medicaments, for combined administration in the treatment ER+ breast cancer. In preferred embodiments, the ER+ breast cancer is metastatic or relapsed ER+ breast cancer. In a further preferred embodiment, the ER+ breast cancer is resistant to endocrine therapy.
[0014] BRIEF DESCRIPTION OF THE DRAWINGS
[0015] [Oi l] Aspects and / or embodiments will now be described in detail with reference to the accompanying drawings, in which:
[0016] Figures 1A-1M demonstrate that CRISPR screening uncovered functional interplay between KAT6A / B and Menin complexes.
[0017] Figure 1A shows CRISPR-Cas9-based screening strategy used to identify regulators of response to KAT6A / B inhibition (PF-9363). PD, population doublings; MOI, multiplicity of infection; NGS, next generation sequencing; sgRNA, single-guide RNA.
[0018] Figure IB shows a combined gene score (P-score) of 4 sgRNA targeting each gene was calculated using the MAGeCK pipeline (Li, W., et al. (2014) Genome Biol 75, 554), comparing KAT6A / B inhibition (50nM PF-9363) vs DMSO relative to Day 0. P-scores were rank ordered and plotted (Table 5). Menin (MEN1 is highlighted in red.
[0019] Figure 1C shows cell proliferation of control cells (sgLuc) o MEN 1 knock-out cells (sgMenin-1, sgMenin-2) assessed via CellTiter-Glo after 14 days with increasing doses of KAT6A / B inhibitor (PF-9363), plotted as percent DMSO. Proliferation data are represented as mean of three independent replicates ± SD.
[0020] Figure ID shows cell proliferation of control cells (sgLuc) or KAT6A knock-out cells (sgKAT6A-l, sgKAT6A-2) assessed via CellTiter-Glo after 18 days with increasing doses of Menin inhibitor (SNDX-5613), plotted as percent DMSO. Proliferation data are represented as mean of three independent replicates ± SD.
[0021] Figure IE shows cell proliferation assessed via CellTiter-Glo after 14 days with increasing doses of KAT6A / B inhibitor (PF-9363) and / or Menin inhibitor (SNDX-5613) as indicated, plotted as percent DMSO. The PF-9363 dose response data is a duplicate from Figure SI A. Proliferation data are represented as mean of three independent replicates ± SD.
[0022] Figure IF shows synergy maps of MCF7 cells were generated using SynergyFinder 3.0 (lanevski, A., Giri, A.K., and Aittokallio, T. (2022) Nucleic Acids Res. 50, W739-W743; Zheng, S., et al. (2022) Genom Proteom Bioinform. 20, 587-596). Proliferation was assessed via CellTiter-Glo after 14 days of treatment with indicated dose matrices.
[0023] Figure 1G shows synergy maps of T47D cells were generated using SynergyFinder 3.0. Proliferation was assessed via CellTiter-Glo after 14 days of treatment with indicated dose matrices.
[0024] Figure 1H shows cell counts of MCF7 (top) and T47D (bottom) cells after 14 days of treatment with vehicle (DMSO), KAT6A / B inhibitor (50nM PF-9363), Menin inhibitor (200nM SNDX-5613), or the combination (50nM PF-9363+200nM SNDX-5613).
[0025] Figure II shows quantification of Annexin V+ / DAPI- staining of MCF7 and T47D cells treated with 50nM PF-9363 and / or 200nM SNDX-5613, capivasertib (luM, positive control), or palbociclib (luM, negative control) at the indicated timepoints (n=3 biological replicates).
[0026] Figure 1 J shows Cell-cycle profiling using BrdU incorporation of MCF7 and T47D cells at indicated time-points after 50nM PF9363 and / or 200nM SNDX-5613, or palbociclib (luM, positive control) treatment at the indicated timepoints (top, n=3 biological replicates). Representative FACs plots of MCF7 cells after 4 days of 50nM PF-9363 and / or 200nM SNDX-5613, or palbociclib (luM, positive control) treatment (bottom).
[0027] Figure IK shows viability of MCF7 (top) and T47D (bottom) cells after 8 days of drug treatment, as percent DMSO.
[0028] Figure IL shows cell proliferation of MCF7 (left) and T47D (right) cells assessed via CellTiter-Glo after 7 days with increasing doses of fulvestrant and co-treatment of vehicle (DMSO), KAT6A / B inhibitor (50nM PF-9363), Menin inhibitor (200nM SNDX-5613), or the combination (50nM PF-9363+200nM SNDX-5613), plotted as percent DMSO. Cells were pretreated with DMSO, 50nM PF-9363, and / or 200nM SNDX-5613 for 5 days prior to treatment with fulvestrant. Proliferation data are represented as mean of three independent replicates ± SD.
[0029] Figure IM shows cell proliferation of MCF7 (left) and T47D (right) cells assessed via CellTiter-Glo after 7 days with increasing doses of elacestrant and co-treatment of vehicle (DMSO), KAT6A / B inhibitor (50nM PF-9363), Menin inhibitor (200nM SNDX-5613), or the combination (50nM PF-9363+200nM SNDX-5613), plotted as percent DMSO. Cells were pre- treated with DMSO, 50nM PF-9363, and / or 200nM SNDX-5613 for 5 days prior to treatment with elacestrant. Proliferation data are represented as mean of three independent replicates ± SD.
[0030] Figure 2A shows brightfield images of the ER+ / PR+ PDxO HC1-003 after 14 days in culture with the indicated treatment conditions. Scale bar: 360pm; representative images shown for n=6 replicates (top). Organoid growth assessed via CellTiter-Glo-3D (CTG-3D), relative to DMSO after 14 days of treatment with KAT6A / B inhibitor (PF-9363) and / or Menin inhibitor (SNDX-5613) or fulvestrant as indicated. Data represented as box and whiskers plot (whiskers min to max) of n=6 replicates (bottom).
[0031] Figure 2B shows brightfield images of the ER+ PDxO HC1-018 after 18 days in culture with the indicated treatment conditions. Scale bar: 260pm; representative images shown for n=6 replicates (top). Organoid growth assessed via (CTG-3D), relative to DMSO after 18 days of treatment with KAT6A / B inhibitor (PF-9363) and / or Menin inhibitor (SNDX-5613) or fulvestrant as indicated. Data represented as box and whiskers plot (whiskers min to max) of n=6 replicates (bottom).
[0032] Figure 3A shows cell proliferation of MCF7 control cells (wild-type ESRI) and endogenous knock-in mutant ESRI Y537S cells assessed via CellTiter-Glo after 14 days with increasing doses of KAT6A / B inhibitor (PF-9363) and / or Menin inhibitor (SNDX-5613) as indicated and plotted as percent DMSO. Proliferation data are represented as mean of three independent replicates ± SD.
[0033] Figure 3B shows gene expression normalized to ACTB of MCF7 control (wild-type ESRI) and endogenous knock-in mutant ESRI Y537S cells.
[0034] Figure 3C shows Cell viability of dox-inducible ESRI Y537S T47D (top) and MCF7 (bottom) cells after 7 days with increasing doses of fulvestrant or after 14 days with increasing doses of PF-9363 and / or SNDX-5613 with or without concomitant dox treatment, plotted as percent DMSO
[0035] Figure 3D shows Immunoblot analysis of ERa and b-actin (loading control) in T47D cells following treatment with 50nM PF9363 and / or 200nM SNDX-5613 for 72 hours with or without concomitant dox treatment. Endogenous ERa and dox-inducible HA-tagged Y537S ERa are indicated.
[0036] Figure 3E shows cell proliferation of MCF7 control cells (sgNT) and / F7 knock-out cells using two different sgRNA (sgNFl-1 and sgNFl-2) assessed via CellTiter-Glo after 14 days with increasing doses of KAT6A / B inhibitor (PF-9363) and / or Menin inhibitor (SNDX- 5613) as indicated and plotted as percent DMSO. Proliferation data are represented as mean of three independent replicates ± SD.
[0037] Figure 3F shows and gene expression normalized to ACTB (B) of MCF7 control cells (sgNT) and NF1 knockout cells (sgNFl-1 and sgNFl-2).
[0038] Figure 3G shows cell proliferation of MCF7 control cells (Empty vector) and FOXA1 wild-type and mutant (F266L and SY242CS) overexpression cells assessed via CellTiter-Glo after 14 days with increasing doses of KAT6A / B inhibitor (PF-9363) and / or Menin inhibitor (SNDX-5613) as indicated and plotted as percent DMSO. Proliferation data are represented as mean of three independent replicates ± SD.
[0039] Figure 3H shows gene expression normalized to ACTB (B) of MCF7 control cells (empty vector), FOXA1 wild-type, or mutant (F266L and SY242CS) overexpression cells. Cells were treated with PF-9363 and / or SNDX-5613 in full media for 96 hours.
[0040] Figure 31 shows organoid growth assessed via CTG-3D of the estrogen independent (El) HC1-040 PDxO subline relative to DMSO after 21 days of treatment with KAT6A / B inhibitor (PF-9363) and / or Menin inhibitor (SNDX-5613) or fulvestrant as indicated. Data represented as box and whiskers plot (whiskers min to max) of n=6 replicates (left). Brightfield images of the El HC1-040 PDxO after 21 days in culture with the indicated treatment conditions. Scale bar: 890pm; representative images shown for n=6 replicates (right).
[0041] Figure 4A shows CellTiter-Glo (CTG) luminescence signal of MCF7 control cells (wild-type ESRI) and endogenous knock-in mutant TALEN ESRI Y537S cells after 10 days of estrogen starvation and treated with 50nM PF-9363 and / or 200nM SNDX-5613.
[0042] Figure 4B shows CellTiter-Glo (CTG) luminescence signal of MCF7 control cells (sgNT) and NF1 knockout cells using two different sgRNA (sgNFl-1 and sgNFl-2) after 10 days of estrogen starvation and treated with 50nM PF-9363 and / or 200nM SNDX-5613
[0043] Figure 4C shows CellTiter-Glo (CTG) luminescence signal of MCF7 control cells (empty vector) and FOXA1 wild-type and mutant (F266L and SY242CS) overexpression cells after 10 days of estrogen starvation and treated with 50nM PF-9363 and / or 200nM SNDX- 5613
[0044] Figure 4D shows Cell viability of MCF7 control cells (wild-type ESRI) and endogenous knock-in mutant TALEN ESRI Y537S cells after 7 days with increasing doses of fulvestrant (top) or elacestrant (bottom) and co-treatment of DMSO, PF-9363, SNDX-5613, or the combination, plotted as percent DMSO.
[0045] Figure 4E shows Cell viability of MCF7 control cells (sgNT) and NF 1 knockout cells using two different sgRNA (sgNFl-1 andsgNFl-2) after 7 days with increasing doses of fulvestrant (top) or elacestrant (bottom) and co-treatment of DMSO, PF-9363, SNDX-5613, or the combination, plotted as percent DMSO.
[0046] Figure 4F shows Cell viability of MCF7 control cells (empty vector) and FOXA1 mutant cells (F266L and SY242CS) after 7 days with increasing doses of fulvestrant (top) or elacestrant (bottom) and co-treatment of DMSO, PF-9363, SNDX5613,or the combination, plotted as percent DMSO.
[0047] Figure 5A shows Baseline corrected tumor volume of the ER+ breast cancer HC1-018 PDX model (n=4 mice per arm). Total treatment duration was 40 days, indicated by grey background. Shown are mean ± sem. Statistical comparisons were performed with Kruskal- Wallis with Dunn’s multiple comparisons test. ****p<0.0001, **p<0.01, *p<0.05, ns = not significant.
[0048] Figure 5B shows Log2FC in tumor volume at day 25 and day 50 compared to the start of treatment (day 0) of the HC1-018 PDX. Shown are individual tumors and the median for each treatment cohort.
[0049] Figure 5C shows Body weight of mice treated with vehicle, PF-9363 1 mg / kg dosed via oral gavage (PO) from day 1-20 once per day (QD) and via intraperitoneal injection (IP) from day 20-40 with 5 days on treatment and 2 days off treatment, and / or continuous SNDX- 5613 0.1% chow (n=4 mice per arm). Total treatment duration was 40 days (grey background represents treatment duration).
[0050] Figure 5D shows Body weight of mice treated with vehicle, PF-9363 (1 mg / kg dosed via oral gavage (PO) once per day (QD) with 5 days on treatment and 2 days off treatment), and / or continuous SNDX-5613 0.1% chow (n=3 mice per arm) for 40 days (grey background represents treatment duration).
[0051] Figure 5E shows Baseline corrected tumor volume of the ER+ / PR+ breast cancer HC1- 003 PDX model treated with PF-9363 (1 mg / kg dosed via oral gavage (PO) once per day (QD) with 5 days on treatment and 2 days off treatment), and / or continuous SNDX-5613 0.1% chow (n=3 mice per treatment arm) for 40 days (grey background represents treatment duration). Shown are mean ± sem. Statistical comparisons were performed with Kruskal-Wallis with Dunn’s multiple comparisons test. ****p<0.0001, ***p<0.001, **p<0.01, ns = not significant.
[0052] Figure 5F shows Baseline corrected tumor volume of the ESRI Y537S PDX model (PDX1526)50,52(n=5 mice per arm for vehicle and single agents, n=8 mice for combined PF- 9363+SNDX-5613). Total treatment duration was 40 days, indicated by grey background. Shown are mean ± sem. Figure 5G shows Log2FC in tumor volume at day 46 compared to the start of treatment (Day 0) of the ESRI Y537S DX model (PDX1526). Shown are individual tumors and the median for each treatment cohort.
[0053] Figure 6A & B show dose titration data for MCF7 and T47D cells for Menin inhibitors revumenib (“SNDX” SNDX-5613), ziftomenib (“Kura” KO-539), bleximenib (“Janssen” JNJ-75276617), and emilumenib (“Daichi” DS-1594a) in the presence or absence of PF-9363 at day 12 (A) or day 16 (B).
[0054] DETAILED DESCRIPTION
[0055] Definitions
[0056]
[0012] “Estrogen Receptor-positive breast cancer” or “ER+ breast cancer” is used herein to describe a subtype of cancer (i.e. uncontrolled, abnormal growth of cells) that affects breast cells which express the estrogen receptor (ER).
[0057]
[0013] A “KAT6A / B inhibitor” is a substance which prevents KAT6A and / or its paralog KAT6B from carrying out its function of post-translational modification of histones, preferably by binding to KAT6A and / or KAT6B. A KAT6A / B inhibitor includes one or a combination of any agents such as a small molecule, nucleic acid (e.g., siRNAs or sgRNAs), or antibody, peptide, peptidomimetic or aptamer that acts to disrupt that acts to disrupt, directly or indirectly, and reduce or even eliminate the function or expression of the KAT6A / B protein or A\ KA T6A and / or KAT6B gene. In some embodiments, the KAT6A / B inhibitoris administered subsequent to administration of the Menin inhibitor. In some embodiments, the KAT6A / B inhibitor is administered substantially simultaneously with administration of the Menin inhibitor. Suitable KAT6A / B inhibitors are known in the art or may be identified by their ability to bind to KAT6A / B in a suitable binding assay and / or inhibit KAT6A / B activity in a suitable functional assay. Suitable examples of both these assays are described in WO2020 / 254946.
[0058]
[0014] A “Menin inhibitor” or “Menin complex inhibitor” is a substance that disrupts the complex of Menin with histone lysine methyl transferases on chromatin, preferably by binding to Menin. A Menin inhibitor includes one or a combination of any agents such as a small molecule, nucleic acid (e.g., siRNAs or sgRNAs), or antibody, peptide, peptidomimetic or aptamer that acts to disrupt that acts to disrupt, directly or indirectly, and reduce or even eliminate the function or expression of the Menin protein, the multiple endocrine neoplasia 1 (MEN 1) gene, or the Menin-MLL complex. Suitable Menin inhibitors are known in the art or may be identified by their ability to bind to Menin in a suitable binding assay and / or inhibit Menin activity in a suitable functional assay, for example in the binding or cell proliferation assays described in WO2017 / 24367.
[0059]
[0015] A “selective estrogen receptor degrader” or “SERD” is a type of drug that binds to the estrogen receptor (ER) and, in the process of doing so, causes the ER to be degraded and thus downregulated. Suitable SERDs are known in the art or may be identified by their ability to bind to ER in a suitable binding assay and / or inhibit ER activity in a suitable functional assay. Suitable examples of such assays are described in (Callis R., et al. (2015) J. Biomol. Screening, 20, 8128-8140).
[0060]
[0016] As used herein, “treating” or “treatment” describes the management and care of a subject for the purpose of combating a disease, condition, or disorder. Treating includes preventing the onset of symptoms or complications, alleviating or eliminating symptoms or complications, or eliminating the underlying disease, condition, or disorder. For example, treating breast cancer in a subject includes reducing, repressing, delaying or preventing the growth of cancerous cells from the breast tissue as well as killing cancerous breast cells within the patient.
[0061]
[0017] The phrase “therapeutically effective amounts of a KAT6A / B inhibitor and a Menin inhibitor” encompasses amounts of each when used for combined administration. This means that the amounts may be lower than those required when such substances are used as monotherapy.
[0062]
[0018] The term “combined administration” means administration of the two components of the combination in a manner that results in them exerting their desired pharmacodynamic effects at the same time within the patient’s body. Thus, combined administration is not limited to simultaneous administration of the two components, nor administration via the same route. It encompasses separate, sequential and simultaneous administration via the same or different routes and in the same or different medicaments, provided that it results in them exerting their desired pharmacodynamic effects at the same time within the patient’s body. Methods of administration are well known to those skilled in the art and include, but are not limited to, oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intraaural administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable administration such as intravenous administration, intra-arterial administration, intramuscular administration, intradermal administration, intrathecal administration, and subcutaneous administration. Administration can be continuous or intermittent. While the above means of administration may provide systemic exposure to the active substance(s), local administration / exposure is also contemplated, e.g., to the breast of the patient.
[0063]
[0019] The term “patient” refers to a mammalian, preferably human, subject.
[0064] Treatment of ER+ Breast Cancer
[0065]
[0020] The inventors undertook an unbiased CRISPR-Cas9-based approach to identify epigenetic vulnerabilities that cooperate with KAT6A / B inhibition, and surprisingly discovered MEN1 loss as a top sensitizer to treatment with the highly potent, selective, and orally bioavailable tool compound PF-9363. Menin inhibition was shown to synergize with KAT6A / B inhibition in a panel of ER+ breast cancer cell lines and combination treatment induced more dramatic changes in ER-driven chromatin accessibility and gene expression than either small molecule alone.
[0066]
[0021] Since the inventors were able to demonstrate that KAT6A and Menin-KMT2A complexes cooperatively regulate ER-driven gene expression, the combination of PF- 9363+SNDX-5613 was tested in several models of endocrine resistance. Importantly, the combination was effective across all models tested, including ESRI and FOXA1 mutations as well as NF1 loss. These data suggest that Menin and KAT6A / B inhibition could be a valuable therapeutic approach in patients harboring ESRI, FOXA1, and NF1 alterations who are endocrine therapy refractory.
[0067]
[0022] Thus, in a first aspect, there is provided a method of treating ER+ breast cancer, comprising the combined administration of therapeutically effective amounts of a KAT6A / B inhibitor and a Menin inhibitor to a patient in need thereof. Also provided is a KAT6A / B inhibitor and a Menin inhibitor for use in a method of treating ER+ breast cancer, comprising the combined administration of said KAT6A / B inhibitor and said Menin inhibitor to a patient in need thereof. Also provided is the use of a KAT6A / B inhibitor and a Menin inhibitor in the manufacture of a medicament, or medicaments, for combined administration in the treatment ER+ breast cancer.
[0068]
[0023] In preferred embodiments, the ER+ breast cancer is metastatic or relapsed ER+ breast cancer.
[0069]
[0024] In a further preferred embodiment, the ER+ breast cancer is resistant to endocrine therapy. Even more preferably, the patient with ER+ breast cancer which is resistant to endocrine therapy has been previously identified as having: mutations in estrogen receptor 1 (ESRI); loss of function mutations in neurofibromin 1 (NF1); amplifications of erythroblastic oncogene B-2 (ERBB2); mutations in forkhead box Al (FOXA1); mutations in FOXA1 F266L; mutations in FOXA1 SY242CS; mutations in MYC (MYC proto-oncogene); and / or mutations in CTCF (CCCTC-binding factor).
[0070]
[0025] In further preferred embodiments, the KAT6A / B inhibitor inhibits the activity of KAT6A and / or its paralog KAT6B with an IC50 of 300 nM or less, preferably 100 nM or less, more preferably 50 nM or less.
[0071]
[0026] A representative antibody KAT6A / B inhibitor is antibody 21620002 (commercially available from Novus Biologicals) or 78462S (commercially available from Cell Signaling
[0072] Technology). Representative examples of small molecule KAT6A / B inhibitors that may be useful in the practice of the present disclosure include WM-1119 (2-fluoro-N'-(3-fluoro-5-
[0073] (pyridin-2-yl)benzoyl)benzenesulfonohydrazide), WM-8014 (N'-(4-fluoro-5-methyl-[ 1 , 1' biphenyl]-3-carbonyl)benzenesulfonohydrazide), PF-9363 (N'-(4-fluoro-5-methyl-[l,r biphenyl]-3-carbonyl)benzenesulfonohydrazide), and PF-07248144 (2-Methoxy-N-{4 methoxy-6-[(lH-pyrazol-l-yl)methyl]-l,2-benzoxazol-3-yl}benzene-l- sulfonamide).
[0074]
[0027] The structures of some representative small molecule KAT6A / B inhibitors are as follows:
[0075]
[0028] In further preferred embodiments, the KAT6A / B inhibitor is selected from the group consisting of PF-9363, PF-07248144, WM-1119, WM-8014 (Baell. J. et al. (2018) Nature, 560, 253-257), ISM-5043 as well as compounds disclosed in WO 2023 / 088233 (e.g., 2,6- dimethoxy-N-(5-(thiazol-2-yloxy)-3,4-dihydro-2H-chromeno[8,7-d]isoxazol-9- yl)benzenesulfonamide) and WO 2023 / 114710.
[0076]
[0029] In another preferred embodiment, the KAT6A / B inhibitor is a compound of formula (I): or a pharmaceutically acceptable salt thereof, wherein:
[0077] R1is H, OCH3, OCH2CH3, CF3, or CH2OCH3
[0078] R2is H, fluoro, OH, or OCH3;
[0079] R3is OCH3, OCD3, OCH2CH3, OCH(CH3)2, O-cycloproyl, flouro, chloro, ethyl, or cyclopropyl;
[0080] R4is H, CH3, cyclopropyl, OCH3, OCHF2, bromo, or fluoro; and
[0081] R5is H, fluoro, methyl, hydroxy, or CH2OH. The synthesis of such compounds is described in WO2020 / 254946A1. Preferably, R1is H or OCH3; R2is OCH3; R3is OCH3; R4is H; and R5is H. Most preferably, the KAT6A / B inhibitor is PF-07248144.
[0082]
[0030] In some embodiments, the KAT6A inhibitor is interfering RNA (e.g., a siRNA) or a single guide RNA (sgRNA) used as active agent to decrease the level of KAT6A or the level of another KAT6A / B complex member. Nucleic acid sequences of representative sgRNAs that knock out KAT6A are set forth in Table 1.
[0083] Table 1 : Nucleic Acid sequences of KAT6A / B sgRNA
[0084]
[0031] In further preferred embodiments, the Menin inhibitor inhibits the activity of Menin with an IC50 of 300 nM or less, preferably 100 nM or less, more preferably 50 nM or less.
[0085]
[0032] A representative antibody Menin inhibitor is A300-105A (commercially available from Bethyl Laboratories). Representative small molecule Menin inhibitors include VTP-50469 (5- fluoro-N,N-diisopropyl-2-((4-(7-(((lr,4r)-4-(methylsulfonamido)cyclohexyl)methyl)-2,7- diazaspiro[3.5]nonan-2-yl)pyrimidin-5-yl)oxy)benzamide), KO-539 ((R)-4-methyl-5-((4-((2- (methylamino)-6-(2,2,2-trifluoroethyl)thieno[2,3-d]pyrimidin-4-yl)amino)piperidin-l- yl)methyl)-l-(2-(4-(methylsulfonyl)piperazin-l-yl)propyl)-lH-indole-2-carbonitrile, also used in NCT04067336), JNJ-75276617 ((R)-N-ethyl-5-fluoro-N-isopropyl-2-((5-(2-(6-((2- methoxyethyl)(methyl)amino)-2-methylhexan-3-yl)-2,6-diazaspiro[3.4]octan-6-yl)-l,2,4- triazin-6-yl)oxy)benzamide, also used in NCT04811560), SNDX-5613 (N-ethyl-2-((4-(7- (((lr,4r)-4-(ethylsulfonamido)cyclohexyl)methyl)-2,7-diazaspiro[3.5]nonan-2-yl)pyrimidin- 5-yl)oxy)-5-fluoro-N-isopropylbenzamide, also used in NCT04065399), DS-1594 ((lR,2S,4R)-4-((4-(5,6-dimethoxypyridazin-3-yl)benzyl)amino)-2-(methyl(6-(2,2,2- trifluoroethyl)thieno[2,3-d]pyrimidin-4-yl)amino)cyclopentan-l-ol, also used in NCT04752163), BMF-219 ((R)-N-( 1 -(2-(2-((4-(4-morpholino-7H-pyrrolo[2,3 -d]pyrimidin-6- yl)phenyl)amino)-2-oxoethyl)pyridin-4-yl)piperidin-3-yl)but-2-ynamide), DSP-5336 (N- ethyl-5-fluoro-N-isopropyl-2-((5-(7-((lS,3S,4R)-5-methylene-2-azabicyclo[2.2.2]octane-3- carbonyl)-2,7-diazaspiro[3.5]nonan-2-yl)-l,2,4-triazin-6-yl)oxy)benzamide, also used in NCT04988555), MI-3453 (N-(3-((2-cyano-4-methyl-5-((4-((2-(methylamino)-6-(2,2,2- trifluoroethyl)thieno[2,3-d]pyrimidin-4-yl)amino)piperidin-l-yl)methyl)-lH-indol-l- yl)methyl)bicyclo[l.l.l]pentan-l-yl)formamide, M-808 (methyl ((lS,2R)-2-((S)-2-(azetidin- l-yl)-l -(3 -fluorophenyl)- 1-(1-((1 -(4-((l-((E)-4-(piperi din- l-yl)but-2-enoyl)azeti din-3 - yl)sulfonyl)phenyl)azetidin-3-yl)methyl)piperidin-4-yl)ethyl)cyclopentyl)carbamate), MI- 0202 (4-(4-(5,5-dimethyl-4,5-dihydrothiazol-2-yl)piperazin-l-yl)-6-(2,2,2- trifluoroethyl)thieno[2,3-d]pyrimidine), MI-503 (l-((lH-pyrazol-4-yl)methyl)-4-methyl-5- ((4-((6-(2,2,2-trifluoroethyl)thieno[2,3-d]pyrimidin-4-yl)amino)piperidin-l-yl)methyl)-lH- indole-2-carbonitrile), MI-463 (4-methyl-5-((4-((6-(2,2,2-trifluoroethyl)thieno[2,3- d]pyrimidin-4-yl)amino)piperidin-l-yl)methyl)-lH-indole-2-carbonitrile), MI- 136 (5-((4-((6- (2,2,2-trifluoroethyl)thieno[2,3-d]pyrimidin-4-yl)amino)piperidin-l-yl)methyl)-lH-indole-2- carbonitrile), and ML-227 (4-(3-(4-(cyclopentyl(hydroxy)(phenyl)methyl)piperidin-l- yl)propoxy)benzonitrile). The structures of these small molecule inhibitors are as follows:
[0086]
[0033] In further embodiments, the Menin inhibitor is selected from the group consisting of
[0087] SNDX-5613, VTP-50469, JNJ-75276617, DSP-5336, BMF-219, BN104, MCP-1, ML227, ML399, MIV-6, MI-503, M-525, M-89, M-808, MI-2, MI-3, MI-2-2, MI-136, MI-0202, MI- 227, MI-463, MI-505, MI-538, BAY-155, MI-1481, MI-3454, KO-539, DS-1594a, DS-1594b, DS-1594, and A300-105A.
[0034] In another preferred embodiment, the Menin inhibitor is a compound of formula (II): or a pharmaceutically acceptable salt thereof, wherein:
[0035] The synthesis of such compounds is described in WO2017 / 214367A1. More preferably, . Most preferably, the Menin inhibitor is SNDX-5613.
[0088]
[0036] In some embodiments, the Menin inhibitor is an interfering RNA, for example, a short interfering RNA (siRNA) or a single guide RNA (sgRNA), used as active agent to decrease the level of MEN1 or the level of another Menin-MLL complex member. RNA interference (RNAi) is a phenomenon in which the introduction of double-stranded RNA (dsRNA) into a diverse range of organisms and cell types causes degradation of the complementary mRNA. Soutschek et al., 432: 173-178 (2004) describe a chemical modification to siRNAs that aids in intravenous systemic delivery. Optimizing siRNAs involves consideration of overall G / C content, C / T content at the termini, melting temperature (Tm) and the nucleotide content of the 3' overhang. See, for instance, Schwartz et al., Cell 775: 199-208 (2003) and Khvorova et al., Cell 775:209-216 (2003). Therefore, the present disclosure also includes methods of decreasing levels of MEN1, KAT6A, or other target protein using RNAi technology. Nucleic acid sequences of representative sgRNAs that knock out Menin are set forth in Table 2.
[0089] Table 2: Nucleic Acid sequences of Menin sgRNAs
[0090]
[0037] Even more preferably, the KAT6A / B inhibitor is PF-07248144 and the Menin inhibitor is SNDX-5613.
[0091]
[0038] In a further embodiment of the first aspect, there is provided a method of treating ER+ breast cancer, comprising the combined administration of therapeutically effective amounts of a KAT6A / B inhibitor and a Menin inhibitor to a patient in need thereof, further comprising administration of a therapeutically effective amount of a SERD in addition to the KAT6A / B inhibitor and the Menin inhibitor. In another embodiment, this includes: a KAT6A / B inhibitor, a Menin inhibitor, and a SERD for use in the treatment of ER+ breast cancer; and the use of a KAT6A / B inhibitor, a Menin inhibitor and a SERD in the manufacture of a medicament or medicaments for the treatment of ER+ breast cancer.
[0092]
[0039] Preferably, the SERD (when used) is selected from the group consisting of GDC-9545, AZD9833 (camizestrant), SAR439859, G1T48, LSZ102, LY3484356, ZN-c5, D-0502, SHR9549, ARV-471, ZB716, brilanestrant, etacstil, palazestrant, fulvestrant and elacestrant. More preferably, the SERD is selected from fulvestrant or elacestrant.
[0093]
[0040] Even more preferably, the KAT6A / B inhibitor is PF-07248144, the Menin inhibitor is SNDX-5613 and the SERD is fulvestrant or elacestrant.
[0094]
[0041] The KAT6A / B inhibitor, Menin inhibitor and / or SERD (when used) are preferably in the form of one or more pharmaceutical composition with one or more pharmaceutically acceptable carrier.
[0095]
[0042] The KAT6A / B inhibitor, Menin inhibitor and / or SERD (when used) may be administered separately, sequentially and / or simultaneously via the same or different routes and in the same or different medicaments, provided that it results in them exerting their desired pharmacodynamic effects at the same time within the patient’s body.
[0096]
[0043] In a one embodiment, the KAT6A / B inhibitor, Menin inhibitor and / or SERD (when used) may be administered at least once daily, for example 1-5 times, 1-3 times, 1 or 2 times daily. In a further embodiment, the KAT6A / B inhibitor, Menin inhibitor and / or SERD (when used) may be administered at least once daily for a specific first period of time, followed by a second period of time in which the KAT6A / B inhibitor, Menin inhibitor and / or SERD (when used) are not administered. Alternating periods of administration and non-administration of the KAT6A / B inhibitor, Menin inhibitor and / or SERD (when used) may be repeated.
[0097]
[0044] In a specific embodiment, the KAT6A / B inhibitor may be administered at least once daily in combination with the Menin inhibitor for a first period of time, followed by a second period of time in which the Menin inhibitor and / or SERD (when used) is administered at least once daily without the KAT6A / B inhibitor. In one embodiment, the KAT6A / B inhibitor may be administered at least once daily for a first period of 3-6 days, for example 3, 4, 5, or 6 days, followed by a second period of 1-4 days, for example 1, 2, 3 or 4 days, in which the KAT6A / B inhibitor is not administered. The Menin inhibitor and / or SERD (when used) is administered at least once daily throughout the first and second periods. In a specific example, the KAT6A / B inhibitor is administered daily for 5 days, followed by 2 days without administering the KAT6A / B inhibitor, i.e. 5 days ON, 2 days OFF. The first and second periods may be repeated.
[0045] In a further embodiment, the KAT6A / B inhibitor may be administered at least once daily in combination with the Menin inhibitor and / or SERD (when used) for a first period of time, followed by a second period of time in which the combination is not administered. In one embodiment, the KAT6A / B inhibitor and Menin inhibitor and / or SERD (when used) may be administered at least once daily for a first period of 3-6 days, for example 3, 4, 5, or 6 days, followed by a second period of 1-4 days, for example 1, 2, 3 or 4 days, in which the combination is not administered. In a specific example, the combination is administered daily for 5 days, followed by 2 days without administering the combination, i.e. 5 days ON, 2 days OFF. The first and second periods may be repeated.
[0098] EXAMPLES
[0099] Materials and methods
[0100]
[0046] Cell lines. MDAMB361 cells were obtained from ATCC. CAMA1, MCF7, MDAMB231, SUM149PT, SUM159PT, T47D, and ZR751 cell were obtained from Dr. Karen Cichowski (Brigham and Women’s Hospital, Boston, MA). MCF7 ESRI mutant cell lines were obtained from Dr. Rinath Jeselsohn (Dana-Farber Cancer Institute [DFCI], Boston, MA), MCF7 sgNT and sgNFl cells as well as MCF7 FOXA1 cells were obtained from Dr. Eneda Toska (Johns Hopkins University, Baltimore, MD). T47D and ZR751 cells were cultured in Roswell Park Memorial Institute (RPMI) medium supplemented with IxL-glutamine (Gibco), 10% Fetal Bovine Serum (FBS) and IxPenStrep (Gibco). HEK293T, MCF7, CAMA1, MDAMB231 and MDAMB361 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with IxL-glutamine (Gibco), 10% Fetal Bovine Serum (FBS) and IxPenStrep (Gibco). SUM149PT and SUM159PT cells were cultured in Ham’s F-12 (Gibco) medium, supplemented with IxL-glutamine (Gibco), 10% Fetal Bovine Serum (FBS) and IxPenStrep (Gibco), Ipg / mL Hydrocortisone (Sigma-Aldrich), and 5pg / mL Insulin (Gibco). For estrogen starvation, cells were grown in RPMI or DMEM without phenol red (Gibco), supplemented with 10% charcoal stripped FBS (Gibco), IxPenStrep (Gibco), and IxL- glutamine (Gibco). All cells were grown at 37°C and 5% CO2 and were routinely tested for mycoplasma contamination. The identity of MCF7 and T47D cells was independently confirmed by ATCC’s FTA Sample Collection Kit (ATCC), which utilizes short tandem repeat (STR) profiling.
[0101]
[0047] Patient-derived xenograft organoids (PDxOs). PDxOs were obtained from Dr. Alana Welm (Huntsman Cancer Institute, University of Utah, Salt Lake City, UT) and were thawed and cultured as previously described in Guillen et al., (Guillen, K.P., et al. (2022) Nat Cancer 3, 232-250). PDxOs were maintained in 200 L Matrigel domes (Corning) and were passaged by dissociation using TrypLE (Gibco). ER+ HC1-003 and HC1-018 PDxOs were cultured in Advanced DMEM / F12 (Gibco), supplemented with 5% Fetal Bovine Serum (FBS), 10 mM HEPES (Gibco), IxGlutamax (Gibco), 1 pg / ml hydrocortisone (Sigma-Aldrich), 50 pg / ml gentamicin (Gibco), 10 ng / ml hEGF (Sigma-Aldrich), 100 ng / ml FGF2 (R&D Systems), and 1 mM NAC (Sigma- Aldrich). 10 pM Y-27632 (Selleck Chemicals) was added fresh. The ER+ / HER2+ PDxO HC1-040 estrogen independent (El) was cultured in Advanced DMEM / F12 (Gibco), supplemented with 5% Fetal Bovine Serum (FBS), 10 mM HEPES (Gibco), IxGlutamax (Gibco), 1 pg / ml hydrocortisone (Sigma-Aldrich), 50 pg / ml gentamicin (Gibco), 10 ng / ml hEGF (Sigma- Aldrich), 100 ng / ml FGF2 (R&D Systems), 1 mM NAC (Sigma- Aldrich), and 10 nM heregulin-pi (Pepro Tech). 10 pM Y-27632 (Selleck Chemicals) was added fresh. Medium was changed every 3-5 days. Organoids were grown at 37°C and 5% CO2 and were routinely tested for mycoplasma contamination.
[0102]
[0048] Mouse models HC1-003 and HC1-018 PDX sample collection was previously performed in accordance with the University of Utah IRB (protocols 89989, 91596 and 10924) approved human sample collection following informed consent and PDX models were previously published (HC1-00339 and HC1-01838). Three- to four-week-old NOD rag gamma mice (NRG, Jackson Laboratory) were used to generate tumors as previously described66,67. In brief, tumor chunks (from 2mmx4mm to 4mmx4mm) were implanted orthotopically into cleared inguinal mammary fat pads. For the HC1-018 PDX, Img E2 pellets were administered prior to tumor implantation and mice were switched to E2 water 4 weeks after surgery, as previously published38. The PDXHC1-018 sample is anER+ invasive lobular carcinoma (ILC) and was collected from a brain metastasis. The patient was treated with chemotherapy, tamoxifen, letrozole, and fulvestrant prior to sample collection. The study was carried out at the Huntsman Cancer Institute as per the Institute’s protocols, which were approved by the Institutional Animal Care and Use Committee. For the HC1-003 PDX, 0.25mg E2 pellets with a 90-day release were administered prior to tumor implantation. Mice did not receive any additional E2 in their water. The PDX HC1-003 sample is an ER+ / PR+ invasive ductal carcinoma (IDC) and was collected from a primary breast tumor. The patient had not been exposed to any systemic treatments up to the time of sample collection. The study was carried out at the Dana-Farber Cancer Institute Experimental Therapeutics Core (ETx) and was approved by the relevant Institutional Animal Care and Use Committee.
[0103]
[0049] ESRI Y537S PDX sample collection was previously performed in accordance with the IRB-approved protocol (Dana-Farber / Harvard Cancer Center IRB protocol 93-085) with patient consent and was previously published PDX152650,52. Tumor samples were dipped in 50% matrigel and implanted into the cleared fourth mammary fat pads of ovariectomized NOD-SCID-IL2Rgc- / - mice (NSG, Jackson Laboratories), without E2 supplements. The PDX1526 sample was derived from a chest wall metastasis harboring a Y537S ESRI mutation from a patient who had prior treatments with an aromatase inhibitor, everolimus, fulvestrant, abemaciclib, and capecitabine. The study was carried out at the Dana-Farber Cancer Institute Experimental Therapeutics Core (ETx) and was approved by the relevant Institutional Animal Care and Use Committee.
[0104]
[0050] Virus production and infections. Sequences for selected sgRNA species targeting human KAT6A and Menin or a non-targeting control were cloned into the lentiviral vector improved-scaffold-pU6-sgRNA-EFlalpha_PURO-T2A-RFP (ipUSEPR) from Y. Soto- Feliciano (MIT, Cambridge, MA) using BsmBI. Sequences used are listed in the Table 1 or 2. For the epigenetic-focused CRPSR screen, we used the pUSEPR-humanEpiV2.0 sgRNA library Y. Soto-Feliciano (MIT, Cambridge, MA) with 4 guides per gene, sequences are listed in Table 5. Constitutive Cas9 expression was achieved using pLentiCas9-Blast (Addgene, 52962). To exogenously express ESRI, we stably expressed SFFV-mCherry-IRES-eGFP- ESR1 (N-GFP-ESR1, from J. Tsai (Brigham and Women’s Hospital, Boston, MA). Lentivirus was produced in HEK293T cells following transient cotransfection with ipUSEPR, pLentiCas9, eGFP-ESRl (5 pg), pMD2.G (1 pg, Addgene, 12259) and psPAX2 (5 pg, Addgene, 12260) in 10-cm tissue culture plates using Xtremegene (Roche) and Opti-MEM medium (Gibco). Viral supernatant was collected 48 h after transfection, passed through a 0.45- pm filter, and stored at -80°C. All human breast cancer cell lines were infected by coincubation of cells with viral supernatant supplemented with polybrene (Millipore) at 8 pg / ml at appropriate dilutions (virus:media 1 :3-1 : 10). Cells were recovered for 48 hours and then selected with puromycin (2.5 pg / ml, Sigma-Aldrich) or blasticidin (10 pg / ml, Gibco) for 3-6 days until the non-infected cells were dead.
[0105]
[0051] Epigenetic-focused CRISPR screen. Cloning of the sgRNA library targeting human chromatin regulators was in accordance with the method described in Soto-Feliciano et al. (Soto-Feliciano, et al. (2022) Cancer Discov. 13, 146-169) and chromatin-focused CRSIPR screening in a human cancer cell line was in accordance with the method described in Chen et al. (Chen, X., et al. (2023) Nat. Commun. 14, 4259). Viral supernatant was titrated to produce an MOI of approximately 0.3. For each experimental replicate 30 million Cas9-expressing MCF7 cells were infected with the CRISPR library at 30% RFP transduction efficiency, resulting in >6 million infected cells, providing >1000x coverage of the sgRNA library. After recovery from infection (48 h), cells were placed in puromycin (2.5 pg / ml, Sigma-Aldrich) for 72 h to enrich for sgRNA-infected cells. Subsequently, 6 million puromycin-selected cells were pelleted and stored at -20°C (Day 0) and 6 million puromycin-selected cells per replicate were plated into either DMSO- or PF-9363-containing media (in total, 18 million cells in DMSO and 18 million cells in PF-9363). Cells were split every 3-5 days and at each split 6 million cells per replicate were plated back to maintain >l,000x library coverage. Once the population reached 12 cumulative population doublings, 6 million cells per replicate were pelleted and stored at ~20°C (Day 31). Pelleted cells were thawed and lysed in 1.3 ml lysis buffer per sample (NaCl, 300 mM; SDS, 0.2%; EDTA, 1 mM; Tris-HCl, pH 8.0, 10 mM). Samples were then incubated with RNase A (100 pg / ml, Thermo Fisher Scientific) for 1 h at 65°C and then incubated overnight with proteinase K (100 pg / ml, Invitrogen) at 55°C with constant rotation. Genomic DNA was then purified by phenol-chloroform extraction. Amplicon sequencing libraries were then produced using 35 pg genomic DNA from each experimental replicate as follows: a first-round PCR reaction was carried out in 5 separate lOOpl reactions, using Q5 High-Fidelity DNA Polymerase (NEB) to amplify the region of the sgRNA corresponding to that between U6 and EF-la using primers (forward Fl, and reverse Rl,); the product was pooled from the primary PCR reaction. A second PCR was carried out to incorporate Illumina adaptors and a 6-bp barcode for identification of samples (F2 and R2). A third PCR reaction was carried out to enrich for the full-length amplicon using primers (forward F3, and reverse R3). Final amplicon libraries were purified by AMPure XP bead (Beckman Coulter) purification. Sequencing was done using the Illumina Next Gen Sequencing NextSeq platform (Illumina) with >6 million reads per sample, 75 bp single-end, and results were analyzed using MAGeCK, as described in Li et al., Genome Biol 15, 554. 10.1186 / sl3059-014-0554-4.
[0106] Table 3: primers for Epigenetic-focused CRISPR screen.
[0107]
[0052] In vitro cell growth assays. For dose titration experiments, cells were plated in complete cell culture medium in 96 well plates at optimized cell density for each cell line. The next day (Day 0) triplicate wells of cells were treated with limiting dilutions of drug as indicated or 0.1% DMSO. All wells were DMSO-normalized. Every 3-4 days cells in each well were split 1 :3-l :5, using a constant split-ratio and fresh drug / DMSO was added. At the end of the experiment, cell viability was assayed using the CellTiter-Glo Luminescent Cell Viability Assay (Promega) and luminescence was read using BMG Labtech CLARIOstar77"' plate reader.
[0053] For cell counting based assays, 125,000 cells were seeded in complete culture medium in triplicate per well of a 6 well plate. The next day (Day 0), triplicate wells of cells were treated with drug or 0.1% DMSO were applicable. Every 3-4 days cells in each well were split 1:3- 1 :5, using a constant split-ratio and fresh drug / DMSO was added were applicable.
[0054] For estrogen depletion experiments, 250,000 cells were seeded in complete culture medium in triplicate per well of a 6 well plate. The next day (Day 0), cells were washed with PBS 3 times and phenol red-free DMEM (Gibco), supplemented with 10% charcoal-stripped FBS (Gibco), was added. Estrogen-depleted medium was refreshed every 3-5 days. On day 10 the experiment was stopped for cell counting or CellTiter-Glo Luminescent Cell Viability Assay (Promega).
[0108]
[0055] Drugs were used at the indicated concentrations and included PF-9363 (MedChem Express), SNDX-5613 (MedChem Express), VTP-50469 (MedChem Express), Fulvestrant (Selleck Chemicals), Elacestrant (MedChem Express).
[0109]
[0056] Organoid growth assays. For PDxO drug treatment experiments, organoids were plated in replicates of 6 in a 96 well plate with 700 cells in 5pL Matrigel (Corning) domes per well. Complete cell culture medium was added and the next day (Day 0) organoids were treated with different concentrations of drug or 0.1% DMSO. All wells were DMSO-normalized. Every 3-4 days media was changed and drug / DMSO replenished. At the end of the experiment, cell viability was assayed using the CellTiter-Glo 3D Luminescent Cell Viability Assay (Promega) and luminescence was read using BMG Labtech CLARIOstar77"' plate reader. Representative images were taken using an ECHO Revolve microscope.
[0110]
[0057] Apoptosis and cell cycle assays To assess apoptosis, MCF7 and T47D cells were plated in triplicate in 6 well plates and drugs were added the next day. Every 3-4 days cells were replated at normalized cell densities and fresh drug / DMSO was added. At the time of collection, cells were trypsinized (Corning), washed with cold PBS, resuspended in AnnexinV Binding Buffer, and stained by APC AnnexinV and DAPI for 15 min at room temperature in the dark, using the APC AnnexinV Apoptosis Detection Kit (eBioscience). Cells were analyzed using an LSR Fortessa flow cytometer (BD Bioscience) and data were analyzed with FlowJo software (Tree Star).
[0111]
[0058] For cell cycle assays, MCF7 and T47D cells were plated in triplicate in 6 well plates and drugs were added the next day. Every 3-4 days cells were replated at normalized cell densities and fresh drug / DMSO was added. Cells were treated with 10 pM BrdU (BD Biosciences) for 1 hour. At the time of collection, cells were trypsinized (Corning), washed with cold PBS, and fixed, permealized and stained according to the manufacturer’s instructions (BD Biosciences). Cells were analyzed using an LSR Fortessa flow cytometer (BD Bioscience) and data were analyzed with FlowJo software (Tree Star).
[0112]
[0059] Western blotting. For non-histone proteins, cells were washed twice in cold PBS and lysed in RIPA buffer (150mM NaCl, 0.5% Na Deoxycholate, 0.1% SDS, 1% Triton X-100, 50mM Tris-HCl, pH=8) with protease inhibitor (Roche). Lysates were incubated on ice for 30 minutes and cleared by centrifugation at 14,000g for 10 minutes at 4°C. Protein concentrations were quantified with the Pierce BCA Protein Assay Kit (Thermo Fisher). Samples were normalized and supplemented with NuPage IX LDS Sample Buffer (Invitrogen) and 2.5% 0- mercaptoethanol (Sigma-Aldrich) and denatured at 95°C for 10 minutes. For western blotting, 30-80 ug of protein extract per sample or protein ladder (BioRad) was separated on a 4-12% NuPAGE Bis-Tris or 3-8% Tris-Acetate protein gel (Thermo Fisher) and transferred to nitrocellulose by using iBlot3 Regular Nitrocellulose Transfer Stacks (Thermo Fisher). The membranes were blocked in 5% dry milk for 1 hour and incubated overnight with anti-KAT6A (CST), anti-Menin (Bethyl), anti-ERa (CST), anti-NFl (CST), anti-0-actin (CST). The next day membranes were washed in TBST and developed using anti-mouse or anti-rabbit secondary antibodies (LLCOR Biosciences) and detected using the Odyssey CLx infrared imaging system (LLCOR Biosciences).
[0113]
[0060] For histones, cells were washed twice in cold PBS and pellets were resuspended in TEB (PBS containing 0.5% Triton X-100) with 2mM phenylmethylsulfonylfluoride (PMSF) and protease inhibitor (Roche) at a cell density of 107cells per mL. Cells were lysed on ice for 10 minutes and centrifuged at 2,000 rpm for 10 minutes at 4°C. The pellet was washed in TEB with PMSF and protease inhibitor (Roche) and centrifuged as before. The pellet was resuspended in 0.2N HC1, supplemented with PMSF and protease inhibitor (Roche) at a cell density of 4xl07per ml and histones were acid extracted overnight at 4°C. The next day, samples were centrifuged for 10 minutes at 4°C and the protein concentration in the supernatant was quantified with the Pierce BCA Protein Assay Kit (Thermo Fisher). Samples were normalized and supplemented with NuPage IX LDS Sample Buffer (Invitrogen) and 2.5% 0- mercaptoethanol (Sigma-Aldrich) and denatured at 95°C for 10 minutes. For western blotting, 3-10 ug of protein extract per sample or protein ladder (BioRad) was separated on a 4-12% NuPAGE Bis-Tris protein gel (Thermo Fisher) and transferred to nitrocellulose by using iBlot3 Regular Nitrocellulose Transfer Stacks (Thermo Fisher). The membranes were blocked in 5% dry milk for 1 hour and incubated overnight with anti-H3K23ac (Millipore), anti-H3K27ac (Abeam), anti-H3K9ac (Abeam), and anti-H3 (Abeam). The next day membranes were washed in TBST and developed using anti-rabbit secondary antibodies (LI-COR Biosciences) and detected using the Odyssey CLx infrared imaging system (LI-COR Biosciences).
[0114]
[0061] RNA isolation. For cell lines, 1 million cells were trypsinized (Corning), washed with cold PBS, and lysed in RLT buffer (Qiagen). RNA was isolated using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions and DNase treatment (Qiagen) was performed on the column.
[0115]
[0062] For PDxOs, domes were mechanically disrupted using plain Advanced DMEM / F12 (Gibco). Cells were centrifuged at 4°C, 600 g for 5 minutes and washed once in cold PBS. Pellets were lysed in RLT buffer (Qiagen), supplemented with 1% P-mercaptoethanol (Sigma- Aldrich) and stored at -80°C. Once thawed, samples were transferred to QiaShredder columns (Qiagen) and centrifuged. RNA was isolated from the flow through using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions and DNase treatment (Qiagen) was performed on the column.
[0116]
[0063] qRT-PCR and ChlP-qPCR RNA was reverse transcribed with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). SYBR green gene expression assays (Applied Biosystems) were used for quantitative qRT-PCR. GAPDH was used as the housekeeping gene for normalization. Relative gene expression was calculated by the comparative AA cycle threshold method. Probes used: GAPDH (F: TGCACCACCAACTGCTTAGC, R: GGCATGGACTGTGGTCATGAG), ESRI (endogenous) (F: GAGTATGATCCTACCAGACCCTTC, R:
[0117] CCTGATCATGGAGGGTCAAATC), ESRI (exogenous) (F:
[0118] GAATACGACCCAACACGCCCG R: ACTTGGTCGTGCAGTGTGAGGTC). Samples were loaded in triplicate into 384-well plates and run on the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems).
[0119]
[0064] For ChlP-qPCR, the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) was used with 384-well plates using SYBR green (Applied Biosystems). Percent input was calculated for each ChIP sample based on its corresponding input sample. ChlP-qPCR primers used were: GAPDH (F: CAGTCAGCCGCATCTTCTTT, R: CCTTCAGGCCGTCCCTA), IGF1R (F: GGCTCCCTTTACTAAGTCGTTTA, R: GGATTATTTCTCCCGTGTCTTCT), ESRI (F: GTCCTGGGACTGCACTTG, R: GCACAGCCCGAGGTTAG), PGR (F: TAGTTGAGATAGGGCGGGTAG, R: CTGCACTCGGCCTCAAC), TFF1
[0120] (GGGGAGATGTTGGCATGAAC, R: CTTCAGTCGGGGCTGTTTTC), IRX3 (F: GACGAGAGCACGTTGGAC, R: ATACATCCGCCCGCTTTAC), gene desert (F: AACCTCACTTTCATTGTTACTAGCCATA, R: CGCTCAAGGATGTCAGTAGCAT). Table 3: primers for qRT-PCR and ChlP-qPCR.
[0121]
[0065] RNA sequencing. For full media RNA-seq experiments, cells / organoids were plated in triplicate and drugs were added the next day (Day 0). Cells / organoids were harvested at the indicated timepoints, as described above. For RNA-seq upon acute estradiol stimulation (- / +E2), cells were plated in replicates of 6 in full media and drugs were added the next day (Day
[0122] 0). The following day (Day 1), cells were washed with PBS 3 times and phenol red-free DMEM (Gibco), supplemented with 10% charcoal-stripped FBS (Gibco) and appropriate drug was added. On Day 4 (72 hours upon estrogen starvation, 96 hours upon addition of drugs), 3 of the 6 replicates were stimulated with estradiol (Selleck Chemicals), while the remaining 3 wells were treated with DMSO. 6 hours following DMSO / estradiol treatment, cells were harvested, as described above. RNA quality for RNA sequencing was checked on the Agilent TapeStation (Agilent) and quantified by Qubit (ThermoFisher). RNA (Ipg) was used to make Illumina compatible libraries by doing Poly-A tail selection (New England Biolabs) and library preparation using the NEBNext Ultra II RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was done using the Illumina Next Gen Sequencing NextSeq platform (Illumina) with 20-30 million 37bp paired-end or 75bp single-end reads.
[0123]
[0066] ATAC sequencing. Samples were prepared as previously published in Corces et al., (Corces, M.R., et al. (2017) Nat. Methods 77, 959-962) and Buenrostro et.al. (Buenrostro, J.D., Giresi, P.G., Zaba, L.C., Chang, H.Y., and Greenleaf, W.J. (2013) Nat Methods 10, 1213— 1218). 50,000 cells were harvested and washed in PBS. Cell pellets were resuspended in ImL ATAC-resuspension buffer (10 mM Tris-HCl, pH 7.4; 10 mM NaCl; 3 mM MgC12) and centrifuged at 1,000 g for 10 min at 4°C. Cell pellets were resuspended in 50pL cold lysis buffer (10 mM Tris-HCl, pH 7.4; 10 mM NaCl; 3 mM MgC12; 0.1% NP40; 0.1% Tween-20 (Roche), 0.01% Digitonin (Promega)) and incubated on ice for 3 minutes. ImL wash buffer was added (10 mM Tris-HCl, pH 7.4; 10 mM NaCl; 3 mM MgC12; 0.1% Tween-20) and cells were spun down immediately at 1,000 g for 10 min at 4°C. Following this, the pellet was resuspended in a transposase reaction mixture (2X TD buffer, 20X transposase (lOOnM final, Illumina), 0.01% Digitonin (Promega), 0.1% Tween-20 (Roche)) at 37 °C for 30 minutes in a thermomixer with 1,000 rpm mixing. DNA was purified using a DNA Clean and Concentrator- 5 kit (Zymo) as per the manufacturer’s instructions. The DNA fragments were amplified in a PCR reaction with 2X NEBNext High-Fidelity PCR Master Mix (New England Biolabs) and purified using AMPure XP beads (Beckman Coulter). DNA fragments were quantified by TapeStation 4200 (Agilent) using HSD5000 Tape and Reagent (Agilent) and Qubit (ThermoFisher). This was followed by sequencing using the NextSeq550 (Illumina) to obtain 50 million 37bp, paired-end reads.
[0124]
[0067] ChIP sequencing. Cells were crosslinked in 1% methanol-free formaldehyde (ThermoFisher) for 10 min at room temperature with gentle shaking. Following crosslinking, cells were quenched using 100 mM Tris pH 8.0 and 250 mM Glycine, washed with room temperature PBS and scraped using cell lifters (Coming). 20 million cells were then lysed in ImL of 50 mM Tris-HCl pH 8.0, 100 mM NaCl, 5 mM EDTA, 1% SDS, supplemented with protease inhibitors (Roche). Drosophila melanogaster S2 cells were used for spike-in controls. Chromatin was collected by centrifugation at 15,000g for 10 min and pellets were resuspended in ImL 66mM Tris-HCl pH 8.0, lOOmM NaCl, 5mM EDTA, 1.7% Triton X-100, 0.5% SDS, supplemented with protease inhibitors (Roche). Lysates were transferred to Covaris tubes and chromatin was sheared using an E100S sonicator (Covaris) to 200-400 bp fragments. 5pL of sonicated chromatin was de-crosslinked with 100 mM NaHC03, 100 mM NaCl, 1% SDS in a total volume of 50uL and was incubated at 65°C for 4-6 hours. Following de-crosslinking, DNA was purified with AMPure XP beads (Beckman Coulter). Input DNA fragments were run on a TapeStation 4200 (Agilent), using D5000 Tape and Reagents (Agilent) to ensure proper shearing, and quantified using Qubit (ThermoFisher). Sheared chromatin from 20 million cells was used in each immunoprecipitation using the following antibodies: anti-Menin (Bethyl), anti-KMT2A / MLLl (Bethyl), anti-KAT6A / MOZ (Invitrogen), anti-BRPFl (Invitrogen), anti-RNA Pol II (Abeam). Sheared chromatin from 2-5 million cells was used in each immunoprecipitation using the following antibodies: anti-H3K9ac (Abeam), H3K27ac (Diagenode), H3K4me3 (Abeam). Antibodies were conjugated to protein-A or protein-G magnetic beads (Dynabeads) for 4-6 hours on a rotator at 4°C with 0.5pg / pL BSA (Invitrogen). Subsequently, the sheared chromatin was added to the beads+antibody and was incubated on a rotator at 4°C overnight. Samples were washed serially with Buffer A (150 mmol / L NaCl, 5 mmol / L EDTA, 5% sucrose, 1% Triton X-100, 0.2% SDS, 20 mmol / L Tris), Buffer B (5 mmol / L EDTA, 1% Triton X-100, 0.1% Deoxycholate, 20 mmol / L Tris), Buffer C (250 mmol / L LiCl, 1 mmol / L EDTA, 0.5% NP40, 0.5% Deoxycholate, 10 mmol / L Tris), and TE following resuspension of beads in Elution Buffer (200 mmol / L NaCl, 100 mmol / L NaHCO3, 1% SDS) and incubation at 65°C to reverse cross-links for 12 to 15 hours. Following decrosslinking, DNA was purified with AMPure XP beads (Beckman Coulter). DNA fragments were quantified by TapeStation 4200 (Agilent) using HSD1000 Tape and Reagent (Agilent) and Qubit (ThermoFisher). 1-10 ng of DNA was used in preparation of Illumina compatible libraries using ThruPLEX DNA-Seq Kit (Takara) followed by sequencing using NextSeq550 (Illumina) to obtain 20-30 million 37bp, paired-end reads.
[0125]
[0068] Bioinformatics analysis. For the CRISPR sequencing analysis, the MAGeCK computational pipeline described in Li et al. (Li, W., et al. (2014) Genome Biol 75, 554) was used. FASTQ files were converted to read-count tables using the MAGeCK ‘count’ command. Each genetic screen was carried out in n = 3 replicates. The maximum likelihood estimation (MLE) algorithm of MAGeCK -vispr was used to generate count summaries and beta scores.
[0126]
[0069] For all other sequencing analyses (RNA-, ATAC-, ChlP-seq), raw Illumina sequencer output was converted to FASTQ format using bcl2fastq (v2.20.0.422). Reads (paired-end 37- mers or single 75-mer reads) were aligned to the human genome (Gencode GRCh38 / hg38 v33) using STAR (v2.7.5a; params — alignlntronMax 1 — alignEndsType EndToEnd — alignMatesGapMax 2000 for ChlPseq / ATACseq analysis), sorted and duplicates marked / removed with picard pipeline tools (v2.9.4). Final “deduped” .BAM files were indexed using SAMtools (vl.95). All gene body and TSS locus annotations are from Gencode GRCh38 / hg38 v33.
[0127]
[0070] For RNA-seq, raw per-gene counts were calculated with HTSeq (htseq-count, v0.6. Ipl) and differential RNA-seq expression was calculated using the BioConductor DESeq2 package (vl.24,0), using raw unnormalized per-gene counts from deduplicated BAMs. All heatmaps were generated using the Broad Institute Morpheus tool.
[0128]
[0071] For ATAC-seq, MACS2 (v2.1.4) was used to call peaks. ATAC-seq data visualizations were produced using IGVtools (TDF signal pileups; v2.3.75) and deeptools (tornado plots; v3.1.3; regions around combined peak loci from all AT AC samples plotted using referencePoint option and k=l). Putative enhancer regions were defined as loci corresponding to H3K27ac peak regions called in MCF7 cells that overlapped with called H3K4mel regions in the same cell line but did not overlap with promoter / TSS regions (TSS -lkB / +3kB), nor with annotated blacklisted regions of likely artifact. Proximal gene determination was based on the following criteria: closest TSS (not closest gene) was identified with a 500kB ‘distal’ cut off and 2kB ‘proximal’ cut off, as reported by bedtools “closest” (v2.28.0). Motif enrichment analysis was performed using HOMER (v4.11) motif analysis tools63. Loss of accessibility was defined as rpk drug / DMSO FC <0.5. For ‘All peaks’ with loss of accessibility the top 5 motifs were curated from Homer Known Motif Enrichment Results and Homer de novo Motif Results. For ‘Enhancer-associated peaks’, only the top 5 motifs from Homer Known Motif Enrichment Results were included. Promoter-associated signal was determined using bedtools “coverage” (v2.28.0), using annotated gene body genomic intervals and TSS region intervals (-Ikb to +3kb for each protein-coding transcript TSS, using gene orientation). A single representative promoter region was chosen for each gene, based on the site with the highest average signal in DMSO control samples. Genes with relevant AT AC signal at their promoter (DMSO Repl or Rep2 rpk > 10) were kept for further analysis.
[0129]
[0072] For ChlP-seq, MACS2 (v2.1.4) was used to call peaks with appropriate input samples as controls for peak calling. Peaks were called with q-value cut-off of 0.01 and broad peak mode. Peaks that are overlapped with blacklisted regions were filtered out. Overlaps of called peaks with peaks from other samples, TSS regions, gene bodies and annotated blacklist regions were determined using bedtools “intersect” (v2.28.0), with TSS regions defined as above. Promoter-associated signal was determined using bedtools “coverage” (v2.28.0), using annotated gene body genomic intervals and TSS region intervals (-Ikb to +3kb for each protein-coding transcript TSS, using gene orientation). A single representative promoter region was chosen for each gene, based on the site with the highest average signal in DMSO control samples. Genes with relevant signal at the promoter (2-fold enrichment of DMSO over input and rpk > 10) were kept for further analysis. Copy number-based normalization was performed using gene-associated CN annotations from the Cancer Cell Line Encyclopedia (CCLE), as described in Ghandi et al. (Ghandi, M., et al. (2019) Nature 569, 503-508). ChlP-seq data visualizations were produced using IGVtools (TDF signal pileups; v2.3.75) and deeptools (tornado plots; v3.1.3; regions around TSS / promoter intervals plotted using referencePoint or scaledRegion option and k=l). For RNA Pol II interval counts were normalized using a ratio of TSS signal values among a set of selected housekeeping genes. For KMT2A and KAT6A reads were normalized using ratios of total read counts between treated and control sample pairs. For histone marks, reads were normalized using drosphila-spike in as previously published in Orlando et al. (Orlando, D.A., et al. (2014) Cell Rep. 9, 1163-1170).
[0130]
[0073] Statistical analysis and reproducibility No statistics were applied to determine sample size. Experiments shown are typically representative of at least three independent experimental replicates. Data collection and analysis were not performed blind to the conditions of the experiments. For proliferation assays, dose-response curves were calculated in a variable slope model as a four-parameter dose-response curve (GraphPad Prism Version 10.2.0). Absolute IC50 values were calculated by setting the maximal inhibition baseline parameter to 0% and constraining the minimal inhibition top parameter to 100% (GraphPad Prism Version 10.2.0). ANOVA with Tukey’s multiple comparisons tests were performed with GraphPad Prism Version 10.2.0. ZIP synergy scores were calculated with SynergyFinder 3.0, as described in Zheng et al., Genom Proteom Bioinform, doi: 10.1016 / j.gpb.2022.01.004 and lanevski et al. (lanevski, A., Giri, A.K., and Aittokallio, T. (2022) Nucleic Acids Res. 50, W739-W743).
[0131]
[0074] In vivo xenograft studies For drug treatment studies, engrafted mice were enrolled into treatment groups when tumors reached approximately 100mm3 in size, as measured by calipers and calculated using the [(Length x Width x Width) / 2)] formula.
[0132]
[0075] For the HC1-018 PDX model, mice were randomly assigned to treatment groups (n = 4 mice per arm) and were administered vehicle (5%DMSO / 40% PEG300 / 55%saline, orally (PO), once per day (QD)), Img / kg PF-9363 (PO, QD), SNDX-5613 (0.1% in chow) or the combination. Due to weight loss, the dosing route for vehicle and PF-9363 was changed from PO (day 1-20) to intraperitoneal injection (IP) for day 20-40. The total treatment duration was 40 days. Tumor volumes and body weights were measured twice a week, and all procedures were conducted under protocols approved by the Institutional Animal Care and Use Committee at the University of Utah.
[0133]
[0076] For the HC1-003 PDX model, engrafted mice were randomly assigned to treatment groups (n=3 mice per arm) and were administered vehicle (5%DMSO / 40% PEG300 / 55%PBS, orally (PO), once per day (QD) for five days ON, two days OFF), Img / kg PF-9363 (PO, QD, five days ON, two days OFF), SNDX-5613 (0.1% in chow) or the combination. The total treatment duration was 40 days. Tumor volumes were measured twice a week and body weights were measured daily. Body weight was maintained during the course of treatment, indicating the safety and tolerability of the five-day-ON, two-day-OFF treatment regimen. The study was carried out at the Dana-Farber Cancer Institute Experimental Therapeutics Core (ETx) and was approved by the relevant Institutional Animal Care and Use Committee.
[0134]
[0077] For the ESRI Y537S PDX1526 model, engrafted mice were randomly assigned to treatment groups (n=5 mice per arm for vehicle and single agents; n=8 per arm for the PF- 9363+SNDX-5613 combination treatment) and were administered vehicle (5%DMSO / 40% PEG300 / 55%PBS, orally (PO), once per day (QD) for five days ON, two days OFF), Img / kg PF-9363 (PO, QD, five days ON, two days OFF), SNDX-5613 (0.1% in chow) or the combination. The total treatment duration was 40 days. Tumor volumes were measured twice a week and body weights were measured daily. Body weight was maintained during the course of treatment and follow-up, indicating the safety and tolerability of the five-day-ON, two-day- OFF treatment regimen. The study was carried out at the Dana-Farber Cancer Institute Experimental Therapeutics Core (ETx) and was approved by the relevant Institutional Animal Care and Use Committee.
[0135] Example 1 - KAT6A / B and Menin complexes are targetable co-dependencies in ER+ breast cancer
[0136]
[0078] To enhance the effects of PF-9363 monotherapy and to augment the effects on gene expression, the inventors sought to identify targetable chromatin associated (epigenetic) complexes that cooperate with KAT6A / B by performing a CRISPR-Cas9-based functional genetic screen using a chromatin-focused gRNA library in Cas9-expressing MCF7 cells (Figure 1A).
[0137]
[0079] When comparing the PF-9363 treated group to the vehicle control on day 30 using the MAGeCK pipeline, surprisingly, numerous epigenetic proteins were found whose depletion was greater with KAT6A / B inhibitor treatment as compared to DMSO treatment (Figure IB, Table 5). In particular, MEN1 (encoding Menin) was among the top hits in the screen as a potent sensitizer to PF-9363 treatment.
[0138] Table 5: CRISPR screen results in DMSO vs PF-9363 relative to Day 0 (top hits)
[0139]
[0080] Functionally, the screen results were validated in three ER+ breast cell lines by inactivating MEN1 using two sgRNA and treating with increasing doses of PF-9363. Knockout of MEN 1 significantly sensitized cells to PF-9363 treatment, with 5 to 10-fold shifts in IC50 values (Figure 1C). Conversely, we inactivated KAT6A using two sgRNA and treated cells with the Menin inhibitor SNDX-5613 (revumenib), which is the first Menin inhibitor with published phase 1 trial data (AUGMENT-101, NCT04065399). Analogous to the findings in Figure 1C, inactivation of KAT6A sensitized cells to SNDX-5613 treatment (Figure ID).
[0140]
[0081] To further investigate the interplay between KAT6A and Menin, A panel of ER+ breast cancer cell lines were treated with increasing doses of PF-9363, SNDX-5613 or the combination of lOOnM SNDX-5613 and increasing doses of PF-9363.
[0141]
[0082] While both SNDX-5613 and PF-9363 single agent treatment had significant effects on cell proliferation, co-treatment surprisingly resulted in the strongest overall anti -proliferative effect (Figure IE). ZR751 cells were an exception to this, with no sensitivity to Menin inhibition. This cell line was also most sensitive to PF-9363 treatment, with an IC50<lnM. Interestingly, ZR751 cells completely lack Menin protein, explaining the resistance to Menin inhibitors and suggesting that lack of Menin might mediate ZR751’s exquisite sensitivity to KAT6A / B inhibition.
[0142]
[0083] Next, synergy in MCF7 (Figure IF) and T47D (Figure 1G) cells was assessed with a 6-point dose curve of SNDX-5613 combined with a 4-point dose curve of PF-9363 and calculated ZIP synergy scores using SynergyFinder 3.0. SNDX-5613 showed synergy with PF- 9363 with synergy scores >10 across a broad range of doses in both cell lines. Combined Menin and KAT6A / B inhibition was confirmed to cooperate to reduce cell number by cell counting (Figure 1H).
[0143]
[0084] Phenotypic assessment of MCF7 and T47D cells treated with the inhibitors revealed that combined Menin and KAT6A / B inhibition induced more pronounced apoptosis (Figure II) and G1 arrest (Figure 1J) compared to single agent treatment. Combined Menin and KAT6A / B inhibition had comparable anti-proliferative effects to first- and second- generation SERDs as well as ER targeting Proteolysis Targeting Chimeras (PROTACs) (Figure IK).
[0144]
[0085] Lastly, the effectiveness of the SNDX-5613+PF-9363 combination was assessed in the context of currently approved ER-targeting treatment regiments, specifically the currently approved SERDs fulvestrant (Figure IL) and elacestrant (Figure IM). Surprisingly, it was found that combined Menin and KAT6A / B inhibition significantly enhanced the sensitivity of MCF7 and T47D cells to treatment with either SERD.
[0145]
[0086] Collectively, these findings show that KAT6A / B and Menin-KMT2A complexes are targetable vulnerabilities in ER+ breast cancer cell lines and combined therapeutic inhibition is highly synergistic across multiple models.
[0146] Example 2 - KAT6A and Menin coordinately regulate estrogen receptor-driven gene expression programs in ER+ organoid models
[0147]
[0087] Patient-derived xenograft (PDX) models can be limiting due to their high cost and low throughput. Instead, three-dimensional (3-D) organoid models from human tumors and PDXs (termed PDxOs) are more feasible and accessible, while being more representative of human cancers than two-dimensional (2-D) cultures.
[0148]
[0088] Guillen et al. (Guillen, K.P., et al. (2022) Nat Cancer 3, 232-250) previously established a large collection of paired ER+ PDX and PDxO models with high fidelity to their original tumors and maintenance of functional ER. Accordingly, the effects of KAT6A / B and Menin inhibition were evaluated in two of these ER+ PDxOs, namely the ER+ / progesterone receptor+ (PR+) invasive ductal carcinoma (IDC) model HC1-003, and the ER+ invasive lobular carcinoma (ILC) model HC1-018.
[0149]
[0089] A 5-point dose curve of PF-9363 and SNDX-5613 as well as 3 doses of combined PF- 9363+SNDX-5613 and fulvestrant treatment was tested. HC1-003 organoids were moderately sensitive to low doses of PF-9363 and high doses of SNDX-5613 yet were exquisitely sensitive to all three combination doses (Figure 2A). HC1-018 organoids were highly sensitive to KAT6A / B inhibition at even the lowest dose of PF-9363, nonetheless, cooperative antiproliferative effects were observed at all three doses of combined PF-9363+SNDX-5613 treatment (Figure 2B). In summary, KAT6A / B and Menin inhibition cooperated to reduce organoid growth in both ER+ PDxO models.
[0150] Example 3 - Combined PF-9363+SNDX-5613 treatment overcomes endocrine therapy resistance
[0151]
[0090] Over the last two decades, an ever-increasing number of mechanisms of resistance to endocrine therapies have been identified. Yet, the three most common categories of acquired endocrine resistance are: (i) mutations in ESRI itself, (ii) alterations in signaling pathways, such as loss of function mutations in NF1 or amplifications of ERBB2, and (iii) mutations in genes encoding key transcription factors, such as FOXA1, MFC, and CTCF. While resistant to various ER-targeting agents, most of these models continue to rely on ER-driven gene expression programs. Accordingly, the inventors investigated whether combined PF- 9363+SNDX-5613 treatment would continue to be efficacious in these three types of endocrine resistance.
[0152]
[0091] With respect to (i), mutations in ESRI occur in only ~3% of primary breast cancer but occur in 20-40% of anti -estrogen treated metastatic disease. Most / A 7 mutations occur in the ligand binding domain (LBD), and the common LBD mutation, Y537S, is known to confer endocrine resistance and ligand-independent ER-activity in various contexts. For example, endogenous ESRI Y537S knock-in MCF7 cells are more resistant to fulvestrant and estrogen starvation than parental MCF7 cells. Pleasingly, the ESRI Y537S mutant cells remained sensitive to PF-9363 and SNDX-5613 single agent and combination treatment to the same degree as wild-type parental cells (Figure 3A). Combined KAT6A / B and Menin inhibition was able to prevent E2-induced upregulation of canonical ER target genes, while also significantly downregulating expression of ESRI itself (Figure 3B).
[0153]
[0092] Similar effects were observed in isogenic, doxycycline (dox)-inducible ELA-ESZ? / Y537S models in T47D and MCF7 cells. Dox treatment conferred resistance to fulvestrant, but cells remained sensitive to combined KAT6A / B and Menin inhibition (Figure 3C). While PF- 9363 and / or SNDX-5613 affected endogenous wild-type ERa protein levels, treatment did not reduce levels of Y537S mutant ERa (Figure 3D), supporting the possibility that KAT6A and Menin-KMT2A regulate ER activity beyond ESRI expression itself.
[0154]
[0093] With respect to (ii), the effects of PF-9363 and SNDX-5613 were assessed in the context of loss-of-function mutation of the tumor suppressor gene, NF1. NF1 knock out cells (sgNFl-1 and sgNFl-2) were similarly sensitive to PF-9363 and SNDX-5613 combination treatment compared to our control cells (sgNT), as indicated by comparable IC50 values (Figure 3E). Moreover, combined PF-9363+SNDX-5613 treatment was able to attenuate E2- induced expression of canonical ER target genes in NF1 knockout cells to the same extent as in control cells (Figure 3F).
[0155]
[0094] With respect to (iii) the impact of F0XA1 mutations on PF-9363 and SNDX-5613 sensitivity was investigated. FOXA1 cooperates with ER as a pioneer factor to regulate ER activity and FOXA1 mutations mediate endocrine resistance by enhancing ER-mediated transcription. Specifically, F266I.. a hypermorphic mutation in the Wing2 region of FOXA1, increased FOXA1 chromatin occupancy at ER binding sites. Another mutation, SY242CS, a neomorphic mutation outside of the Wing2 region, activates an alternative transcriptome by binding to non-canonical DNA motifs.
[0156]
[0095] Interestingly, overexpression of wild-type FOXA1 was found to reduce sensitivity to PF-9636, yet the cells remained sensitive to SNDX-5613 single agent and PF-9636+SNDX- 5613 combination treatment (Figure 3G). In contrast, the F266L wing mutation conferred relative resistance to both single agent PF-9636 and SNDX-5613 treatment, nevertheless, the cells remained sensitive to the PF-9636+SNDX-5613 combination, albeit at slightly higher IC50S (Figure 3G). Lastly, the neomorphic SY242CS mutation also reduced sensitivity to both single agent PF-9636 and SNDX-5613 treatment, but the PF-9636+SNDX-5613 combination was nearly as effective in SY242CS cells as it was in empty vector control cells (Figure 3G). The combination PF-9636+SNDX-5613 suppressed canonical ER target genes across all FOXA1 contexts (Figure 3H).
[0157]
[0096] In summary, while overexpression of wild-type FOXA1 or overexpression of two different FOXA 1 mutants affected sensitivity to single agentPF-9363 or SNDX-5613 treatment to various degrees, the cells remained sensitive to the PF-9363+SNDX-5613 combination irrespective of FOXA1 status.
[0158]
[0097] To further confirm the efficacy of combined KAT6A / B and Menin inhibition in endocrine resistant models, we assessed the effects of PF-9636 and / or SNDX-5613 treatment in estrogen-independent ER+ PDxOs. These models were developed previously by transplanting ER+ PDX models into ovariectomized mice without E2 supplementation. Tumor sublines that grew under these conditions were termed estrogen independent (El) and PDxOs from these sublines were established, validated, and published in Guillen et al. (Guillen, K.P., et al. (2022) Nat Cancer 3, 232-250).
[0159]
[0098] Accordingly, a 5-point dose curve of SNDX-5613 and PF-9363 was tested as well as 3 doses of combined PF-9363+SNDX-5613 and fulvestrant treatment in the estrogen- independent PDxO HC1-040-EI (Figure 3D). Fulvestrant treatment had little effect on organoid growth even at high doses, however, at all doses, the PF-9363+SNDX-5613 combination potently suppressed growth (Figure 31).
[0160] Example 4 - Combined KAT6A / B and Menin inhibition re-sensitizes endocrine resistant cells to ER targeting agents
[0161]
[0099] To assess whether combined KAT6A / B and Menin inhibition was able to re-sensitize endocrine resistant cells to ER targeting agents we used three in vitro cellular models of endocrine resistance - ESRI mutation, NF1 loss, and FOXA1 mutation. All three models able to grow well in estrogen depleted media compared to their respective control cells (Figure 4A- C). Treatment with combined PF-9363 and SNDX-5613 resensitized mutant cells to estrogen starvation and reverted cell growth back to the level of wild-type control cells (Figure 4A-C). To assesses KAT6A / B and / or Menin inhibition in combination with currently approved SERDs (fulvestrant and elacestrant), all three models were treated with combined PF-9363 and SNDX- 5613 and either fulvestrant and elacestrant. Combined PF-9363 and SNDX-5613 treatment cooperated with SERD treatment in all three models of endocrine resistance and reduced cell viability to comparable levels as control SERD-treated cells (Figure 4D-F).
[0162] Example 5 - Combined PF-9363+SNDX-5613 treatment demonstrates robust efficacy in ER+ breast cancer patient derived xenograft models in vivo
[0163]
[0100] To evaluated the in vivo activity of PF-9363+SNDX-5613, the combination was tested in the ER+ ILC HC1-018 PDX model, derived from a brain metastasis of a patient previously treated with chemotherapy, tamoxifen, letrozole, and fulvestrant as described in Guillen, K.P., Fujita, M., Butterfield, A. J., Scherer, S.D., Bailey, M.H., Chu, Z., DeRose, Y.S., Zhao, L., Cortes-Sanchez, E., Yang, C.-H., et al. (2022). A human breast cancer-derived xenograft and organoid platform for drug discovery and precision oncology. Nat Cancer 3, 232-250. Both PF-9363 and SNDX-3613 previously demonstrated in vivo efficacy and PK / PD properties for both compounds are well established. Engrafted mice (orthotopic tumor volume of -lOOmm3) were treated with vehicle, PF-9363 (once a day (QD)), SNDX-5613 (0.1% chow), or the combination for 40 days. Monotherapies slowed tumor growth compared to vehicle, but only the combination halted tumor progression (Figure 5A), inducing consistent tumor shrinkage by day 25 day that persisted 10 days post-treatment (Figure 5B). This tumor shrinkage was statistically significant compared to vehicle (p<0.05), though not compared to monotherapies (Figure 5B). SNDX-5613 chow was well tolerated by the mice, however, due to the daily oral dosing of the PF-9363 -treated mice, some toxicity was observed in the PF-9363 monotherapy and PF-9363+SNDX-5613 combination treatment arms (Figure 5C), which was mitigated by changing the dosing route and schedule to 5 days ON, 2 days OFF. Since no toxicity has been reported previously with PF-9363 monotherapy or the PF-9363+SNDX-5613 combination, the inventors postulate that the observed toxicity could be related to the high estrogen supplementation necessary for the HC1-018 tumor model. To investigate and mitigate this, a second PDX cohort was treated with the ER+ / PR+ IDC HC1-003 model at lower levels of estrogen supplementation, using a xenograft derived from a treatment-naive primary tumor described in DeRose, Y.S., Wang, G., Lin, Y.-C., Bernard, P.S., Buys, S.S., Ebbert, M.T.W., Factor, R., Matsen, C., Milash, B.A., Nelson, E., et al. (2011). Tumor grafts derived from women with breast cancer authentically reflect tumor pathology, growth, metastasis and disease outcomes. Nat. Med. 17, 1514-1520. Engrafted mice (orthotopic tumor volume of ~ 100mm3) were treated with vehicle (QD, 5 days ON, 2 days OFF), PF-9363 (QD, 5 days ON, 2 days OFF), SNDX-5613 (0.1% chow), or the PF-9363 (QD, 5 days ON, 2 days OFF)+SNDX- 5613 (0.1% chow) for 40 days. No toxicity or weight loss was observed with this dosing schedule (Figure 5D). All treatment groups reduced tumor growth compared to vehicle, with SNDX-5613 and combined PF-9363+SNDX-5613 treatment inducing significant tumor shrinkage (Figure 5E). The in vivo results confirm that combined KAT6A / B and Menin inhibition has a potent anti-tumor activity in ER+ breast cancer PDX models, closely aligning with the in vitro findings.
[0164]
[0101] To assess the effect of combined KAT6A / B and Menin inhibition in vivo in a ESRI Y537S DX model derived from a chest wall metastasis and harboring K5375ESR1 mutation from a patient who had prior treatments with an aromatase inhibitor, everolimus, fulvestrant, abemaciclib, and capecitabine (PDX1526 as described in Jeselsohn, R., Bergholz, J.S., Pun, M., Cornwell, M., Liu, W., Nardone, A., Xiao, T., Li, W., Qiu, X., Buchwalter, G., et al. (2018). Allele-Specific Chromatin Recruitment and Therapeutic Vulnerabilities of ESRI Activating Mutations. Cancer Cell 33, 173-186. e5), a PDX mose model was established. This PDX was resistant to estrogen deprivation and grew in ovariectomized mice without E2 supplementation. Engrafted mice (orthotopic tumor volume of ~ 100mm3) were treated with single agents or the combination for 40 days. In line with results reported herein, all treatments were well tolerated by the mice with no significant weight loss. PF-9363 alone significantly reduced tumor growth, however, only the combination was able to induce tumor regression (Figure 5F and G).
[0165] Example 6 - KAT6A / B inhibitors induce sensitivity to Menin inhibitors
[0102] To assess the effect of combined KAT6A / B and Menin inhibition with further Menin inhibitors, dose titration was carried out as describe herein with Menin inhibitors revumenib (SNDX), ziftomenib (Kura), bleximenib (Janssen), and emilumenib (Daichi). For dose titration experiments, 10,000-25,000 cells (depending on the cell line) were plated in complete cell culture medium in 96 well plates. The day after seeding (Day 0), triplicate wells of cells were treated with limiting dilutions of drug as indicated or 0.1% DMSO. All wells were DMSO-normalized. Every 3-4 days cells in each well were split 1 :3-l :5, using a constant splitratio and fresh drug / DMSO was added. Cell viability was assayed using the CellTiter-Glo Luminescent Cell Viability Assay (Promega) and luminescence was read using the BMG Labtech CLARIOstar^"' plate reader. Viability of cells was assessed by CellTiterGlo after 12 and 16 days of treatment as indicated and is plotted as percent DMSO. Data represent mean of 3 biological replicates ± SD.
[0166]
[0103] As shown in Figure 6A and B, treatment with PF-9363 increased sensitivity of MCF7 and T47D cells to Menin inhibitors revumenib (SNDX-5613), ziftomenib (KO-539), bleximenib (JNJ-75276617), and emilumenib (DS-1594a) in a dose titration test at Day 12 and Day 16, showing that combined KAT6A / B and Menin inhibition is broadly effective with all Menin inhibitors. The same effect was observed at all time points.
[0167]
[0104] In summary, these findings demonstrate that combined KAT6A / B and Menin inhibition continues to be broadly effective in diverse contexts of therapeutic resistance to anti-estrogen therapies, underscoring their therapeutic use for endocrine-resistant patients harboring these frequent alterations.
Claims
CLAIMS1. A method of treating estrogen receptor-positive (ER+) breast cancer, comprising the combined administration of therapeutically effective amounts of a KAT6A / B inhibitor and a Menin inhibitor to a patient in need thereof.
2. A KAT6A / B inhibitor and a Menin inhibitor for use in a method of treating ER+ breast cancer, comprising the combined administration of said KAT6A / B inhibitor and said Menin inhibitor to a patient in need thereof.
3. Use of a KAT6A / B inhibitor and a Menin inhibitor in the manufacture of a medicament, or medicaments, for combined administration in the treatment ER+ breast cancer.
4. A method according to claim 1; a KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2; or the use of a KAT6A / B inhibitor and a Menin inhibitor according to claim 3; wherein the ER+ breast cancer is metastatic or relapsed ER+ breast cancer.
5. A method according to claim 1 or 4; a KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2 or 4; or the use of a AT6A / B inhibitor and a Menin inhibitor according to claim 3 or 4; wherein the ER+ breast cancer is resistant to endocrine therapy.
6. A method according to claim 5; a KAT6A / B inhibitor and a Menin inhibitor for use according to claim 5; or the use of a KAT6A / B inhibitor and a Menin inhibitor according to claim 5; wherein the patient with ER+ breast cancer which is resistant to endocrine therapy has been previously identified as having: mutations in estrogen receptor 1 (ESRI); loss of function mutations in neurofibromin 1 (NF1); amplifications of erythroblastic oncogene B-2 (ERBB2); mutations in forkhead box Al (FOXA1); mutations in FOXA1 F266L; mutations in FOXA1 SY242CS; mutations in MYC; and / or mutations in CTCF .
7. A method according to claim 1, 4, 5, or 6; a KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2, 4, 5, or 6; or the use of a KAT6A / B inhibitor and a Menininhibitor according to claim 3, 4, 5, or 6; wherein the KAT6A / B inhibitor is selected from the group consisting of PF-9363, PF-07248144, WM-1119 and WM-8014.
8. A method according to claim 1, 4, 5, or 6; a KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2, 4, 5, or 6; or the use of a KAT6A / B inhibitor and a Menin inhibitor according to claim 3, 4, 5, or 6; wherein the KAT6A / B inhibitor is a compound of formula (I):or a pharmaceutically acceptable salt thereof, wherein:R1is H, OCH3, OCH2CH3, CF3, or CH2OCH3R2is H, fluoro, OH, or OCH3;R3is OCH3, OCD3, OCH2CH3, OCH(CH3)2, O-cycloproyl, flouro, chloro, ethyl, or cyclopropyl;R4is H, CH3, cyclopropyl, OCH3, OCHF2, bromo, or fluoro; andR5is H, fluoro, methyl, hydroxy, or CH2OH.
9. A method according to claim 1, 4, 5, 6, 7 or 8; KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2, 4, 5, 6, 7 or 8; or the use of a KAT6A / B inhibitor and a Menin inhibitor according to claim 3, 4, 5, 6, 7 or 8; wherein the Menin inhibitor is selected from the group consisting of SNDX-5613 (revumenib), VTP-50469, JNJ- 75276617 (bleximenib), DSP-5336, BMF-219, BN104, MCP-1, ML227, ML399, MIV- 6, MI-503, M-525, M-89, M-808, MI-2, MI-3, MI-2-2, MI-136, MI-0202, MI-227, MI- 463, MI-505, MI-538, BAY-155, MI-1481, MI-3454, KO-539 (ziftomenib), DS-1594a (emilumenib), DS-1594b, DS-1594, and A300-105A.
10. A method according to claim 1, 4, 5, 6, 7 or 8; KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2, 4, 5, 6, 7 or 8; or the use of a KAT6A / B inhibitor and a Menin inhibitor according to claim 3, 4, 5, 6, 7 or 8; wherein the Menin inhibitor is a compound of formula (II):or a pharmaceutically acceptable salt thereof, wherein:
11. A method according to claim 1, 4, 5, 6, 7, 8, 9 or 10; KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2, 4, 5, 6, 7, 8, 9 or 10; or the use of a KAT6A / Binhibitor and a Menin inhibitor according to claim 3, 4, 5, 6, 7,8, 9 or 10; wherein the KAT6A / B inhibitor is PF-07248144 and the Menin inhibitor is SNDX-5613.
12. A method according to claim 1, 4, 5, 6, 7, 8, 9, 10 or 11; a KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2, 4, 5, 6, 7, 8, 9, 10 or 11; or the use of a KAT6A / B inhibitor and a Menin inhibitor according to claim 3, 4, 5, 6, 7, 8, 9, 10 or 11; further comprising administration of a therapeutically effective amount of a selective estrogen receptor degrader (SERD) in addition to the KAT6A / B inhibitor and the Menin inhibitor.
13. A method according to claim 1, 4, 5, 6, 7, 8, 9, 10, 11 or 12; a KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2, 4, 5, 6, 7, 8, 9, 10, 11 or 12; or the use of a KAT6A / B inhibitor and a Menin inhibitor according to claim 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12; wherein the SERD is selected from the group consisting of GDC-9545, AZD9833 (camizestrant), SAR439859, G1T48, LSZ102, LY3484356, ZN-c5, D-0502, SHR9549, ARV-471, ZB716, brilanestrant, etacstil, palazestrant, fulvestrant and elacestrant.
14. A method according to claim 1, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13; a KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13; or the use of a KAT6A / B inhibitor and a Menin inhibitor according to claim 3, 4, 5, 6, 7, 8,9, 10, 11, 12 or 13; wherein the SERD is fulvestrant or elacestrant.
15. A method according to claim 1, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13; a KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2, 4, 5, 6, 7, 8, 9, 10,11, 12 or 13; or the use of a KAT6A / B inhibitor and a Menin inhibitor according to claim 3, 4, 5, 6, 7, 8, 9,10, 11, 12 or 13; wherein the KAT6A / B inhibitor is PF-07248144, the Menin inhibitor is SNDX-5613 and the SERD is fulvestrant or elacestrant.
16. A method according to claim 1, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13; a KAT6A / B inhibitor and a Menin inhibitor for use according to claim 2, 4, 5, 6, 7, 8, 9, 10,11, 12 or 13; or the use of a KAT6A / B inhibitor and a Menin inhibitor according to claim 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or 13; wherein the a KAT6A / B inhibitor and / or Menin inhibitor are administered for a first period of time, followed by a second period of time wherein the a KAT6A / B inhibitor and / or Menin inhibitor are not administered.