Plastid transit peptide and use thereof

Abstract

Provided are a novel plastid transit peptide and a use thereof. The provided plastid transit peptide can direct an operably linked polypeptide or protein to a plant plastid in a targeted manner. The present invention further relates to a composition and method for directing an operably linked polypeptide or protein to a plastid in a targeted manner, and in particular to a method for producing a transgenic plant material comprising the plastid transit peptide, a plant material produced by this method, and a plant commodity, product or processed agricultural product produced from the plant material. Compared with natural plastid transit peptides, the provided novel plastid transit peptide has the advantages of stronger universality, better adaptability, and higher targeted localization efficiency, and has broad application prospects in the field of plants.

Description

Plastid transport peptides and their uses Technical Field

[0001] This invention relates to the fields of plant molecular biology, plastid biology, and protein transport technology. More specifically, this invention relates to the field of protein targeting. The invention provides plastid transport peptides that guide operatively linked polypeptides or proteins to the localization of plant plastids, comprising the amino acid sequence of the plastid transport peptide and / or the nucleotide sequence encoding the amino acid sequence. Particularly, it relates to polypeptide compositions and methods for genetically encoding and expressing peptides targeted to plant plastids, including but not limited to the production of transgenic plant materials and plant commodities, products, or processed agricultural products derived from said plant materials. Background Technology

[0002] Plastids are important organelles in plant and algal cells, participating in photosynthesis, respiration, and various metabolic processes. They store products such as starch and are responsible for the synthesis of many molecules, including fatty acids and terpenes, as well as other molecules required for cell building blocks. Depending on their role within the cell, plastids have the ability to differentiate or redifferentiate into several forms. Undifferentiated proplastids can potentially develop into any of the following types of plastids: chloroplasts, chromoplasts, leucoplasts, starch morphosomes, otoliths, oleoplasts, and proteinoids.

[0003] As described in existing literature, many important biological processes occur within plastids, making the localization of exogenous proteins to plastids crucial for studying these processes. Plastid transit peptides (PTPs) effectively mediate the targeting, localization, or transport of linking peptides to plastids. These plastids can be primary, secondary, or tertiary. The transit peptide is located at the N-terminus of the protein entering the plastid. Plastid transit peptides, or chloroplast transit peptides (CTPs), guide peptides containing chloroplast transit peptides to plastids (e.g., chloroplasts) via co-translation or post-translational methods. Endogenous or exogenous chloroplast proteins can be directed to chloroplasts by expressing them as larger precursor peptides containing chloroplast transit peptides. Most chloroplast proteins are encoded in the nucleus of plant cells, synthesized in the cytoplasm as larger precursor proteins, and then transported to chloroplasts post-translationally. The precursor proteins transported to chloroplasts for expression contain an N-terminal extension called the chloroplast transit peptide. Transport peptides play a role in specific recognition on the chloroplast surface and are involved in mediating the post-translational transport of precursor proteins across the chloroplast envelope and from the chloroplast envelope to various subcompartments of the chloroplast (such as the stroma, thylakoids, and thylakoid membranes). These N-terminal transport peptide sequences contain all the information needed to transport chloroplast proteins into plastids.

[0004] Studies have shown that the structural composition of plasmid transport peptides generally includes the following characteristics: plasmid transport peptides typically contain 40 to 100 amino acids; they contain almost no negatively charged amino acids, such as aspartic acid, glutamic acid, asparagine, or glutamine; their N-terminal regions are uncharged amino acids, and also lack amino acids such as glycine or proline; their central regions contain a very high proportion of basic or hydroxy amino acids, such as serine or threonine; and their C-terminal regions are rich in arginine and have the ability to form facultative β-sheet secondary structures. After the peptide is introduced into the plasmid, the transport peptide can be effectively cleaved from the linker peptide by specific proteases within the plasmid (Christian, Ryan W et al., PeerJ 8.2(2020):e9772). The structural composition of chloroplast transport peptides in higher plants typically exhibits the following characteristics: they share similar features with mitochondrial transport peptides on their surface, namely, they are rich in hydroxylated residues and lack acidic residues; they are 30-120 residues in length; the N-terminal 10-15 amino acids lack glycine, proline, and charged residues; the variable central region is rich in serine, threonine, lysine, and arginine; the C-terminal region contains loosely conserved sequences for proteolytic processing; there are no conserved extension sequences or conserved secondary structure motifs; and theoretically, they primarily adopt a random coil conformation (Cline and Henry, Annals of Cell and Developmental Biology 12: 1-26 (1996)).

[0005] Although some natural plasmid transport peptides exist, data on the structure of transport peptides in higher plants are limited, and the isolation of more novel plasmid transport peptides remains urgent. Compared with existing technologies, this invention provides a novel plasmid transport peptide and its uses. The main technical solutions of this invention address the following issues: (1) Natural plasmid transport peptides have poor versatility and adaptability, and can only target specific peptides or proteins; (2) Due to the limited number of target receptors on the plasmid membrane, the targeting efficiency of natural plasmid transport peptides in guiding peptides or proteins is low.

[0006] Summary of the Invention

[0007] The purpose of this invention is to provide a novel plasmid transport peptide and its uses. The plasmid transport peptide can guide operatively linked polypeptides or proteins to be localized to plant plasmids. Compared with natural plasmid transport peptides, it has the advantages of greater versatility, adaptability and higher targeting efficiency.

[0008] To achieve the above objectives, the present invention provides a novel plasmid transport peptide, wherein the amino acid sequence of the plasmid transport peptide includes SEQ ID NO:1 to SEQ ID NO:36.

[0009] To achieve the above objectives, the present invention also provides a nucleotide sequence encoding a plasmid transport peptide comprising SEQ ID NO:37 to SEQ ID NO:72.

[0010] To achieve the above objectives, the present invention also provides a composition for operatively linking polypeptides or proteins to plant plastids.

[0011] Furthermore, the plant plastid is a chloroplast.

[0012] Further, the composition comprises a nucleic acid molecule, characterized in that the nucleic acid molecule comprises a nucleotide sequence capable of encoding a plasmid transport peptide and a nucleotide sequence of interest operably linked together.

[0013] Furthermore, the nucleic acid molecule can be used to express and target the polypeptide encoded by the nucleotide sequence of interest to plant plastids.

[0014] Furthermore, the composition is a frame-in-frame nucleotide sequence, chimeric nucleotide sequence, or fusion nucleotide sequence containing the nucleic acid molecule.

[0015] Furthermore, the composition is an expression cassette containing nucleic acid molecules, characterized in that the expression cassette contains a linked regulatory sequence that regulates the nucleic acid molecules.

[0016] Furthermore, the composition is a recombinant vector containing the expression cassette.

[0017] Preferably, the plant is a monocotyledonous or dicotyledonous plant.

[0018] More preferably, the plant is corn, soybean, Arabidopsis thaliana, cotton, rapeseed, rice, sorghum, wheat, barley, millet, tobacco, sunflower, sugarcane, or oats.

[0019] To achieve the above objectives, the present invention also provides a method for operably linked polypeptides or proteins to target plant plastids, comprising:

[0020] To obtain cells of a transgenic host organism containing a plasmid transport peptide and an expression cassette operatively linked to a nucleotide sequence of interest;

[0021] Culture the cells of the transgenic host organism;

[0022] The protein of the plasmid transport peptide was recovered.

[0023] Furthermore, the transgenic host organism includes plants, animals, bacteria, yeast, baculoviruses, nematodes, or algae.

[0024] To achieve the above objectives, the present invention also provides a method for producing plant material containing the plasmid transport peptide, comprising:

[0025] Cultivate at least one plant propagule, wherein the genome of the plant propagule includes the plastosome transport peptide or the expression cassette;

[0026] The plant propagule grows into a plant;

[0027] Furthermore, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0028] Furthermore, the plant materials produced by the method can be used to obtain plant commodities, products, or processed agricultural products derived from the plant materials.

[0029] Preferably, the plant is corn, soybean, Arabidopsis thaliana, cotton, rapeseed, rice, sorghum, wheat, barley, millet, tobacco, sunflower, sugarcane, or oats.

[0030] To achieve the above objectives, the present invention also provides a method for enhancing plant tolerance to herbicides.

[0031] Furthermore, the method for enhancing plant tolerance to herbicides involves introducing a nucleic acid molecule, expression cassette, or recombinant vector into a plant by operatively linking a plasmid transport peptide to a herbicide tolerance gene sequence.

[0032] Furthermore, the gene enhancing plant tolerance to herbicides is cPTG (protoporphyrinogen oxidase gene) and / or cEPSPS (5-enolpyruvate-shikimate-3-phosphate synthase gene), characterized in that the gene is operatively linked to a plasmid transport peptide.

[0033] Furthermore, the herbicides that increase herbicide tolerance are protoporphyrinogen oxidase (PPO) inhibitor herbicides and 5-enolpyruvylmangiferyl-3-phosphate synthase (EPSPS) herbicides.

[0034] Preferably, the herbicide that increases herbicide tolerance is ethoxyflufenican, pyrimisulfuron, propyzoxystrobin, or glyphosate.

[0035] Preferably, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0036] More preferably, the plant is corn, soybean, Arabidopsis thaliana, cotton, rapeseed, rice, sorghum, wheat, barley, millet, tobacco, sunflower, sugarcane, or oats.

[0037] As a specific embodiment of the present invention, the plasmid transport peptide (also known as a secretory signal sequence or guide sequence) is a polypeptide or protein that promotes cytoplasmic synthesis through a post-translational mechanism, targeting and guiding it to specific plasmids, organelles, or cellular compartments. The plasmid transport peptide can be exogenous, and the polypeptide or protein guided to the plasmid can be, but is not limited to, polypeptides or proteins with the following properties: herbicide tolerance, resistance to insect pests and pathogens (viral resistance, bacterial pathogen resistance, insect resistance, nematode resistance, fungal resistance, and Bt toxin protein synthesis). Plant yield or environmental tolerance (tolerance to extreme temperatures, soil conditions, light levels, water levels, nitrogen levels, and chemical environments), plant physiological processes (photosynthesis, hormone synthesis), nutrient enhancement, medicinal or industrial products (synthesis of fatty acids, amino acids, oils, carotenoids, terpenes, starch, zeaxanthin cyclooxygenase, choline monooxygenase, ferrous chelate, ω-3 fatty acid desaturase, glutamine synthase, starch modifying enzyme, essential amino acids, provitamin A), extended shelf life, restoration of cytoplasmic male sterility, etc. For example, targeting chloroplasts using sequences encoding chloroplast transport peptides, targeting the endoplasmic reticulum using the 'KDEL' preserved sequence, or targeting vacuoles using the C-terminal propeptide (CTPP) of the barley lectin gene. Plastosome transport peptides consist of three main domains (Karlin-Neumann & Tobin, 1986; Quigley, Martin & Cerff, 1988; Bruce, 2000, 2001; Li & Teng, 2013), including an uncharged N-terminal proximal region, a central domain rich in hydroxylated residues and lacking acidic residues, and an arginine-rich C-terminal distal region (Bruce, 2001).

[0038] As a specific embodiment of the present invention, isolated sequences having plasmid transport peptide activity and hybridizing with the plasmid transport peptide sequence or fragment thereof of the present invention under stringent conditions are included in the present invention. These sequences are at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more homologous to the sequences of the present invention. That is, the range of sequence identity is distributed at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity.

[0039] As a specific embodiment of the present invention, the terms "transport," "targeting," and "transfer" refer to the property of the plasmid transport peptide amino acid sequence of the present invention to facilitate the movement of a polypeptide containing the amino acid sequence from the nucleus of a host cell to the plasmid of the host cell. In a particular embodiment, such amino acid sequence may be capable of transporting about 100%, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 70%, at least about 60%, or at least about 50% of the polypeptide containing the amino acid sequence into the plasmid of the host cell.

[0040] In a specific embodiment of the present invention, the porphyrin biosynthesis pathway is used to synthesize chlorophyll and heme, which play important roles in plant metabolism, and this pathway occurs in chloroplasts. In this pathway, protoporphyrinogen oxidase (PPO) catalyzes the oxidation of protoporphyrinogen IX to protoporphyrin IX. After the production of protoporphyrin IX, protoporphyrin IX combines with magnesium via magnesium chelate enzyme to synthesize chlorophyll, or combines with iron via iron chelate enzyme to synthesize heme. Herbicides that exert their effects by inhibiting PPO include diphenyl ether PPO inhibitors, oxadiazonon PPO inhibitors, N-phenylphthalamide imine PPO inhibitors, oxazolinone PPO inhibitors, phenylpyrazole PPO inhibitors, uracil PPO inhibitors, thiadiazole PPO inhibitors, triazolinone PPO inhibitors, triazinone PPO inhibitors, and other types of PPO inhibitors. In plants, PPO inhibitors suppress the enzymatic activity of PPO, leading to the inhibition of chlorophyll and heme synthesis and the accumulation of the substrate protoporphyrinogen IX. The accumulated protoporphyrinogen IX is rapidly exported from the chloroplast to the cytoplasm. In the cytoplasm, protoporphyrinogen IX is converted to protoporphyrin IX under non-enzymatic reactions and further generates highly reactive singlet oxygen (1O2) in the presence of light and oxygen molecules. These singlet oxygen molecules damage the cell membrane and rapidly lead to the death of plant cells."PPO inhibitor herbicides," also known as "PPO inhibitor class herbicides," can be selected from one or more of the following groups, but are not limited to: diphenyl ethers (glufosinate, chlomethoxyfen, bifenox, oxyfluorfen, trifluoromethyl sulfadiazine and its salts and esters, fomesafen, lactofen, fluoroglycofen-ethyl, chlorfluazine, aclonifen, bifenox, ethoxyfen, chlorintrofen, halosafen)); oxadiazones (oxadiazon, oxadiargyl); N-phenylphthalamide imines (oxadiazon, oxadiargyl) Amines (flumioxazin, flumiclorac-pentyl, cinidon-ethyl); oxazolinones (pentoxazone); phenylpyrazoles (fluazolate, pyrazosulfuron); ureapyridines (saflufenacil, flufenazate, saflufenacil); thiadiazoles (thidiazimin, fluthiacet); triazolinones (azafenidin, sulfentrazone, carfentrazone); trifludimoxazin; other types (flufenpyr-ethyl, pyraclonil).

[0041] The oxyfluorfen described in this invention refers to 2-chloro-1-(3-ethoxy-4-nitrophenoxy)-4-trifluoromethylbenzene, a colorless crystalline solid. It belongs to the diphenyl ether class of ultra-low dosage selective, pre- and post-emergence contact PPO inhibitor herbicides and can be formulated into emulsifiable concentrates for use. Weeds are primarily killed by absorption of the herbicide through the coleoptile and mesocotyl. Oxyfluorfen can effectively control weeds in fields of rice, soybeans, corn, cotton, vegetables, grapes, and fruit trees. The weeds it can control include, but are not limited to, barnyard grass, sesbania, wild oats, foxtail grass, datura, creeping bentgrass, ragweed, spiny yellow clover, velvetleaf, field mustard, and both sessile and broadleaf weeds. The effective dosage of ethoxyflufenican mentioned in this invention refers to 180-720 g ai / ha, including 190-700 g ai / ha, 250-650 g ai / ha, 300-600 g ai / ha, or 400-500 g ai / ha.

[0042] Saflufenacil, as described in this invention, refers to N'-[2-chloro-4-fluoro-5-(3-methyl-2,6-dioxo-4-(trifluoromethyl)-3,6-dihydro-1(2H)-pyrimidinyl)benzoyl]-N-isopropyl-N-methylthioamide, a light brown extruded granular solid. It belongs to the ureazine class of non-selective PPO inhibitor herbicides and can be formulated into 70% water-dispersible granules. Saflufenacil is effective in controlling various broadleaf weeds, including those resistant to glyphosate, ALS, and triazine. It has a rapid inactivation effect and its soil residue degrades quickly. The effective dosage of saflufenacil described in this invention refers to application at 25-100 g ai / ha, including 30-95 g ai / ha, 40-90 g ai / ha, 50-85 g ai / ha, or 60-80 g ai / ha.

[0043] Flumioxazin, as described in this invention, refers to 2-[7-fluoro-3,4-dihydro-3-oxo-4-(2-propynyl)-2H-1,4-benzoxazin-6-yl]-4,5,6,7-tetrahydro-1H-isoindole-1,3(2H)-dione. It belongs to the N-phenylphthalamide imine class of PPO inhibitor herbicides absorbed by seedlings and leaves, and is commonly formulated as a 50% wettable powder and a 48% suspension concentrate. Flumioxazin is effective in controlling annual broadleaf weeds and some grassy weeds. It is readily degradable in the environment and safe for subsequent crops. The effective dose of propyzamide described in this invention refers to a dosage of 60-240 g ai / ha, including 70-220 g ai / ha, 85-200 g ai / ha, 90-185 g ai / ha, or 100-150 g ai / ha.

[0044] As a specific embodiment of the present invention, N-phosphonomethylglycine, also known as glyphosate, is a systemic, chronic, broad-spectrum, non-selective herbicide. Glyphosate is a competitive inhibitor of phosphoenolpyruvate (PEP), the substrate for the synthesis of 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). It inhibits the conversion of both PEP and 3-phosphate shikimate to 5-enolpyruvylshikimate-3-phosphate shikimate under EPSPS catalysis, thereby blocking the synthesis pathway of shikimate, a precursor for aromatic amino acid synthesis, thus interfering with protein synthesis and leading to plant and bacterial death. Glyphosate tolerance can be achieved by expressing modified EPSPS. Modified EPSPS has a lower affinity for glyphosate, thus maintaining its catalytic activity in the presence of glyphosate, thereby achieving glyphosate tolerance.

[0045] In this invention, "glyphosate" refers to N-phosphonomethylglycine and its salts, and "treatment with glyphosate herbicide" means treatment with any herbicide formulation containing glyphosate. Commercial formulations of glyphosate include, but are not limited to, (Glyphosate as isopropylamine salt) WEATHERMAX (glyphosate as a potassium salt) DRY and (Glyphosate as an amine salt) GEOFORCE (as a sodium salt of glyphosate) and (Glyphosate as a trimethyl sulfide). The effective dose of glyphosate described in this invention refers to a dosage of 200-1600 g ae / ha, including 250-1600 g ae / ha, 300-1600 g ae / ha, 500-1600 g ae / ha, 800-1500 g ae / ha, 1000-1500 g ae / ha, or 1200-1500 g ae / ha.

[0046] As is well known to those skilled in the art, DNA typically exists in a double-stranded form. In this arrangement, one strand is complementary to the other, and vice versa. Because DNA replicates in plants, other complementary strands of DNA are produced. Thus, this invention includes the use of the polynucleotides and their complementary strands as exemplified in the sequence listing. The term "coding strand" as commonly used in the art refers to the strand that binds to the antisense strand. To express proteins in vivo, typically one strand of DNA is transcribed into a complementary strand of mRNA, which serves as a template for protein translation. The mRNA is actually transcribed from the "antisense" strand of DNA. The "sense" or "coding" strand has a series of codons (codons are three nucleotides, and reading three at a time produces a specific amino acid), which can be read as an open reading frame (ORF) to form the target protein or peptide. This invention also includes RNA that functions substantially similarly to the DNA of the examples.

[0047] The plasmid transport peptides described in this invention include not only specific example sequences, but also portions and / or fragments (including deletions at the inner and / or ends compared to the full-length amino acid sequence), variants, mutants, substitutes (proteins with substituted amino acids), chimeras, and fusion proteins that preserve the amino acid sequence characteristics of the specific examples. The term "variant" or "mutation" refers to a nucleotide sequence encoding the same protein or an equivalent protein encoding plasmid transport peptide activity. The term "equivalent protein" refers to a protein having the same or substantially the same biological activity of the plasmid transport peptide as the protein of the claims.

[0048] The “fragment” or “truncated” DNA molecule or protein sequence referred to in this invention refers to a portion of the original DNA or protein sequence (nucleotide or amino acid) involved or its artificially modified form (e.g., a sequence suitable for plant expression). The length of the aforementioned sequence may vary, but the length is sufficient to ensure that the protein (encoding) is a plasmid transport peptide.

[0049] Due to the abundance of genetic codons, many different DNA sequences can encode the same amino acid sequence. Alternative DNA sequences that generate these proteins encoding the same or substantially the same proteins are within the skill level of those skilled in the art. These different DNA sequences are included within the scope of this invention. The term "substantially the same" means a sequence with amino acid substitutions, deletions, additions, or insertions that do not substantially affect the activity of plasmid transport peptides, and also includes fragments that retain plasmid transport peptide activity.

[0050] The substitution, deletion, or addition of amino acid sequences in this invention is a conventional technique in the art. Preferably, such amino acid changes are: small property changes, i.e., conserved amino acid substitutions that do not significantly affect protein folding and / or activity; small deletions, typically about 1-5 amino acid deletions; and small amino or carboxyl terminal extensions, such as an extension of one methionine residue to the amino terminus.

[0051] The regulatory sequences described in this invention include, but are not limited to, promoters, terminators, enhancers, leader sequences, introns, and other regulatory sequences operatively linked to the plasmid transport peptides described in this invention.

[0052] The promoters mentioned are plant-expressible promoters, meaning promoters that ensure the expression of the coding sequence linked to them within plant cells. Plant-expressible promoters can be constitutive promoters. Examples of promoters that guide constitutive expression in plants include, but are not limited to, the 35S promoter derived from cauliflower mosaic virus, the maize Ubi promoter, and the promoter of the rice GOS2 gene. Alternatively, plant-expressible promoters can be tissue-specific promoters, meaning that the promoter guides the expression level of the coding sequence in some plant tissues, such as green tissues, to be higher than in other plant tissues (which can be determined by conventional RNA assays), such as the PEP carboxylase promoter. Alternatively, plant-expressible promoters can be wound-inducible promoters. Wound-inducible promoters, or promoters that guide wound-induced expression patterns, refer to promoters that significantly increase the expression of the coding sequence under their regulation when plants experience mechanical or insect-induced trauma compared to normal growth conditions. Examples of trauma-inducible promoters include, but are not limited to, promoters of the protease repressor genes (pin I and pin II) in potatoes and tomatoes and the protease repressor gene (MPI) in maize.

[0053] The leader sequence includes, but is not limited to, small RNA virus leader sequences; potato virus Y group leader sequences; untranslated leader sequences of alfalfa mosaic virus capsid protein mRNA (AMV RNA4); and tobacco mosaic virus (TMV) leader sequences.

[0054] The enhancers include, but are not limited to, enhancers for cauliflower mosaic virus (CaMV), enhancers for scrophularia mosaic virus (FMV), enhancers for carnation weathering ring virus (CERV), enhancers for cassava vein mosaic virus (CsVMV), enhancers for four o'clock mosaic virus (MMV), enhancers for night-blooming jasmine yellow leaf curl virus (CmYLCV), enhancers for cotton leaf curl virus (CLCuMV), enhancers for dayflower yellow mottle virus (CoYMV), and enhancers for peanut chlorotic streak mosaic virus (PCLSV).

[0055] For monocotyledonous plant applications, the introns include, but are not limited to, the maize hsp70 intron, the maize ubiquitin intron, the Adh intron 1, the sucrose synthase intron, or the rice Act1 intron. For dicotyledonous plant applications, the introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "super ubiquitin" intron.

[0056] The terminator can be a suitable polyadenylation signal sequence that functions in plants, including but not limited to polyadenylation signal sequences derived from the Agrobacterium tumefaciens carmine synthase (NOS) gene, polyadenylation signal sequences derived from the protease inhibitor II (pin II) gene, polyadenylation signal sequences derived from the pea ssRUBISCO E9 gene, and polyadenylation signal sequences derived from the α-tubulin gene.

[0057] The transformation schemes and nucleotide sequence introduction schemes described in this invention vary depending on the type of plant or plant cell being transformed, i.e., monocotyledonous or dicotyledonous plants. Suitable methods for introducing nucleotide sequences into plant cells and subsequently inserting them into the plant genome include, but are not limited to, Agrobacterium-mediated transformation, microemission bombardment, direct DNA uptake into protoplasts, electroporation, or whisker-based DNA introduction. Transformed cells can be grown into plants in a conventional manner. These plants are cultured and pollinated with the same or different transformants to produce hybrids that express the desired identified phenotypic trait. Two or more generations can be cultured to ensure stable maintenance and genetic inheritance of the desired phenotypic trait, and then seeds that guarantee the expression of the desired phenotypic trait are harvested.

[0058] The articles “a” and “an” used in this invention refer to one or more (i.e., at least one). For example, “an element” means one or more elements (components). Furthermore, the term “comprising” or variations thereof, such as “including” or “containing”, should be understood to mean including one of the said elements, integers or steps, or a group of elements, integers or steps, but does not exclude any other elements, integers or steps, or groups of elements, integers or steps.

[0059] The terms "comprising" and "including" as used in this invention mean "including but not limited to".

[0060] The term "genetic material" as used in this invention includes all genes and nucleic acid molecules, such as DNA and RNA.

[0061] As used in this invention, the term "endogenous" refers to substances (e.g., nucleic acid molecules and polypeptides) derived from a particular organism, tissue, or cell. For example, "endogenous" polypeptides expressed in plant cells can refer to polypeptides that are typically expressed in the same type of cells from non-genetically engineered plants of the same species.

[0062] The term "exogenous" as used in this invention refers to DNA from another source. In the context of DNA, "exogenous" means any foreign "non-self" DNA, including DNA from another plant of the same species.

[0063] As used in this invention, the term "nucleic acid molecule" refers to a polymeric form of nucleotides, which may include both sense and antisense strands of RNA, cDNA, and genomic DNA, as well as synthetic forms and mixed polymers of the foregoing. Nucleotides may refer to ribonucleotides, deoxyribonucleotides, or modified forms of either of these types of nucleotides. As used herein, "nucleic acid molecule" is synonymous with "nucleic acid" and "polynucleotide." Unless otherwise specified, nucleic acid molecules are generally at least 10 bases in length. The term includes both single-stranded and double-stranded forms of DNA. Nucleic acid molecules include dimer (so-called tandem) forms and transcripts of nucleic acid molecules. Nucleic acid molecules may include naturally occurring nucleotides and modified nucleotides linked together by naturally occurring nucleotide linkages and / or non-naturally occurring nucleotide linkages. As will be readily understood by those skilled in the art, nucleic acid molecules may be chemically or biochemically modified, or may contain non-natural or derivatized nucleotide bases. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with analogues, and internucleotide modifications (e.g., non-electrolyte linkages: such as methylphosphonates, triphosphates, aminophosphates, carbamates, etc.; electrolyte linkages: such as thiophosphates, dithiophosphates, etc.; overhangs: such as peptides; intercalating agents: such as acridine, psoralen, etc.; chelating agents; alkylating agents; and modified linkages: such as α-anomeric nucleic acids, etc.). The term "nucleic acid molecule" also includes any topological conformation, including single-stranded, double-stranded, partially double-stranded, triple-stranded, hairpin-shaped, circular, and padlock-shaped conformations.

[0064] When used in the context of a specific nucleic acid, the term "encoding" or "coded" as used in this invention means that the nucleic acid contains the necessary information to guide the translation of a polynucleotide sequence or gene into a specific protein. The information used to encode the protein is detailed using codons. The nucleic acid encoding the protein may contain untranslated sequences (e.g., introns) within the translated region of the nucleic acid, or may lack such inserted untranslated sequences (e.g., in cDNA).

[0065] The terms “polypeptide,” “peptide,” and “protein” used in this invention are used interchangeably to refer to polymers of amino acid residues. These terms apply to polymers of amino acid residues, wherein one or more amino acid residues in the polymer are an artificial chemical analog of a corresponding naturally occurring amino acid, and to naturally occurring amino acid polymers.

[0066] The term “functional activity” or “activity” as used in this invention refers to the ability of the plasmid transport peptide (alone or in combination with other proteins) for the purposes of this invention to guide the operatively linked polypeptide or protein to be localized to plant plasmids.

[0067] As used in this invention, the term "expression" refers to a process by which the coding information of nucleic acid transcription units (including, for example, genomic DNA or cDNA) is translated into operational, non-operational, or structural parts of a cell, typically involving protein synthesis. Gene expression can be influenced by external signals, such as exposure of cells, tissues, or organisms to agents that increase or decrease gene expression. Gene expression can also be regulated at any point in the pathway from DNA to RNA to protein. Regulation of gene expression occurs, for example, by controlling the action on transcription, translation, RNA transport and processing, degradation of intermediate molecules (such as mRNA), or by activation, inactivation, compartmentalization, or degradation of specific protein molecules after their production, or a combination thereof. Gene expression can be measured at the RNA or protein level by any method known in the art, including but not limited to Northern blotting, RT-PCR, Western blotting, or in vitro, in situ, or in vivo protein activity assays.

[0068] As used in this invention, the term "sequence identity" or "identity" refers to the same residues in two nucleic acid or polypeptide sequences when compared with maximum correspondence on a specified comparison window. To achieve optimal sequence alignment, the sequence portion in the comparison window may contain additions or deletions (i.e., vacancies) compared to a reference sequence (which contains no additions or deletions). The percentage of sequence identity is calculated by determining the number of positions where the same nucleotide or amino acid residues appear in the sequence, dividing this number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100.

[0069] As used in this invention, the term "operably linked" means that the first nucleotide sequence and the second nucleotide sequence are "operably linked" when they are in a functional relationship. For example, if a promoter affects the transcription or expression of a coding sequence, then the promoter and coding sequence are operably linked. When generated in a recombinant manner, the operably linked nucleotide sequences are usually contiguous, and two protein-coding regions can be linked within the same reading frame if necessary. However, the operably linked nucleotide sequences are not necessarily contiguous. When the term "operably linked" is used in relation to a regulatory sequence and a coding sequence, it means that the regulatory sequence affects the expression of the linked coding sequence. A "regulatory sequence" or "control element" refers to a nucleotide sequence that affects the timing and level / amount of transcription, RNA processing or stability, or the translation of a related coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, enhancers, stem-loop structures, repressor-binding sequences, termination sequences, polyadenylation recognition sequences, etc. A particular regulatory sequence may be located upstream and / or downstream of the coding sequence to which it is operably linked. Moreover, specific regulatory sequences that can be operatively linked to the coding sequence can be located on the relevant complementary strand of the double-stranded nucleic acid molecule.

[0070] In this invention, "linkage" refers to the connection of nucleic acid sequences, whereby one sequence provides the function required for the linked sequences. In this invention, "linkage" can refer to linking a plasmid transport peptide to a sequence of interest, such that the transport of the polypeptide encoded by the sequence of interest is controlled and regulated by the plasmid transport peptide. Methods of nucleic acid sequence "linkage" include, but are not limited to: in-frame linking and fusion linking. In-frame linking refers to arranging two or more different DNA fragments or biological elements in a specific order and linking them to the same expression cassette or recombinant vector using recombinant DNA technology. In-frame linking allows multiple genes to be expressed simultaneously in the same cell to construct biological systems capable of expressing multiple genes or having complex functions. Fusion linking refers to linking two or more different biological elements or protein sequences together using molecular biology techniques (e.g., linker sequences) to form a new fusion protein or fusion gene. Nucleic acid sequences that can be "linked" include, but are not limited to: sequences that provide gene expression function (i.e., gene expression elements, such as promoters, 5' untranslated regions, introns, protein-coding regions, 3' untranslated regions, polyadenylation sites, and / or transcription terminators); sequences that provide DNA transfer and / or integration function (i.e., T-DNA boundary sequences, site-specific recombinase recognition sites, and integrase recognition sites); sequences that provide selective function (i.e., antibiotic resistance markers and biosynthetic genes); sequences that provide scoreable marker function; sequences that assist in sequence manipulation in vitro or in vivo (i.e., multiple adapter sequences and site-specific recombination sequences); and sequences that provide replication function (i.e., bacterial origin of replication, autonomous replication sequences, and centromere sequences).

[0071] The term "expression cassette" as used in this invention refers to a DNA sequence containing all the necessary components that work together to ensure the expression of one or more genes of interest in a host cell; it is a genetic construct with a specific function. The construction of an expression cassette includes, but is not limited to: a promoter, a gene of interest, a terminator, an enhancer, and a marker gene. The promoter controls the initiation point of gene expression and can bind to RNA polymerase to initiate the transcription process. The gene of interest refers to the gene that needs to be expressed in the cell. The terminator is a signal sequence used to indicate the end of the transcription process. Methods for constructing expression cassettes include PCR amplification, gene cloning, enzyme digestion, and ligation, which are conventional molecular biology techniques well known to those skilled in the art.

[0072] As used in this invention, the term "vector" refers to a nucleic acid molecule introduced into a cell, for example, to produce a transformed cell. A vector may contain a nucleic acid sequence, such as an origin of replication, that allows it to replicate within a host cell. Examples of vectors include, but are not limited to, plasmids, phages, or viruses carrying exogenous DNA into the cell. A vector may also include one or more genes, antisense molecules, and / or selectable marker genes, as well as other genetic elements known in the art. A vector can transduce, transform, or infect cells, thereby causing the cells to express the nucleic acid molecule and / or the protein encoded by the vector. Optionally, a vector may include substances that facilitate the entry of the nucleic acid molecule into the cell (e.g., liposomes, protein coatings, etc.).

[0073] As used in this invention, the terms "transformation" or "transduction" refer to the transfer of one or more nucleic acid molecules into a cell. A cell is "transformed" when nucleic acid molecules are stably replicated by the cell through incorporation into the cell's genome or through appendage replication. The term "transformation" encompasses all techniques that can introduce nucleic acid molecules into such cells. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation (Fromm et al., (1986), Nature 319:791-3); liposome transfection (Felgner et al., (1987), Proc. Natl. Acad. Sci. USA 84:7413-7); microinjection (Mueller et al., (1978), Cell 15:579-85); Agrobacterium-mediated transfer (Fraley et al., (1983), Proc. Natl. Acad. Sci. USA 80:4803-7); direct DNA uptake; and particle bombardment (Klein et al., (1987), Nature 327:70).

[0074] As used in this invention, the term "plant" refers to the whole plant, including all plants and plant populations, such as desired and unwanted wild plants or crop plants (including naturally occurring crop plants). Crop plants can be plants obtained through conventional breeding and optimization methods or through biotechnology and recombination methods, or a combination of these methods, including transgenic plants.

[0075] The term "plant part" as used in this invention includes plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can regenerate, plant callus, plant clumps, and complete plant cells in a plant or plant part. Examples of plant parts include embryos, endosperm, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It should be understood that parts of transgenic plants within the scope of this invention include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, endosperm, and flowers, stems, fruits, leaves, and roots derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of this invention and are therefore at least partially composed of transgenic cells. In one aspect, a plant part is a plant cell. In another aspect, a plant part is a non-regenerative or regenerative cell. In yet another aspect, a plant cell is a somatic cell. A non-regenerative cell is a cell that cannot be regenerated into a whole plant through in vitro culture. Non-regenerative cells can be in the plants or plant parts (e.g., leaves) of this invention. Non-regenerative cells can be cells in seeds or the seed coat of said seeds. Mature plant organs (including mature leaves, mature stems, or mature roots) contain at least one non-regenerating cell. On the other hand, plant cells are reproductive cells, such as ovules or cells that are part of pollen. In another aspect, pollen cells are vegetative (non-reproductive) cells, or sperm cells.

[0076] The terms "herbicide tolerance of plants, seeds, plant tissues, or cells" or "herbicide-resistant plants, seeds, plant tissues, or cells" as used in this invention refer to the ability of plants, seeds, plant tissues, or cells to resist the action of herbicides when applied. For example, herbicide-resistant plants can survive or continue to grow in the presence of herbicides. Herbicide tolerance of plants, seeds, plant tissues, or cells can be measured by comparing plants, seeds, plant tissues, or cells with suitable controls. For example, herbicide tolerance can be measured or assessed by applying a herbicide to a plant containing DNA molecules encoding proteins that confer herbicide tolerance (test plants) and a plant not containing DNA molecules encoding proteins that confer herbicide tolerance (control plants), and then comparing the plant damage of the two types of plants, wherein the herbicide tolerance of the test plants is indicated by a reduction in the damage rate compared to the damage rate of the control plants. Herbicide-resistant plants, seeds, plant tissues, or cells exhibit a reduced response to the toxic effects of herbicides compared to control plants, seeds, plant tissues, or cells. The term "herbicide tolerance trait" refers to a transgenic trait that confers improved herbicide tolerance to plants compared to wild-type plants.

[0077] This invention can be applied to a variety of plants, including but not limited to alfalfa, beans, cauliflower, cabbage, carrots, celery, cotton, cucumbers, eggplants, lettuce, melons, peas, peppers, zucchini, radishes, rapeseed, spinach, soybeans, pumpkins, tomatoes, Arabidopsis thaliana, or watermelons; preferably, the dicotyledonous plants refer to soybeans, Arabidopsis thaliana, tobacco, cotton, or rapeseed. The monocotyledonous plants include but are not limited to corn, rice, sorghum, wheat, barley, rye, millet, sugarcane, oats, or turfgrass; preferably, the monocotyledonous plants refer to corn, rice, sorghum, wheat, barley, millet, sugarcane, or oats.

[0078] The term "weed" as used in this invention refers to plants that compete with cultivated target plants in the plant growth environment.

[0079] This invention provides commodities, products, or processed agricultural products obtained by processing harvested plants or parts containing the plasmid transport peptides described in this invention. The terms "commodity," "product," and "processed agricultural product" refer to any composition or product derived from materials derived from plants, seeds, plant cells, or plant parts containing the plasmid transport peptides described in this invention. Specifically, the terms "commodity," "product," and "processed agricultural product" include, but are not limited to, food or feed products, coarse flour, starch, wheat flour, oil, crushed or whole grains or seeds, protein concentrates, protein isolates, or biomass.

[0080] Unless otherwise specifically explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Definitions of common terms in molecular biology can be found in publications such as: Lewin B., Genes V, Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Meyers RA (ed.), Molecular Biology and Biotechnology: A Comprehensive Desk Reference, VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). Unless otherwise specified, all percentages are by weight, and all solvent mixture proportions are by volume. All temperatures are in degrees Celsius.

[0081] All references cited herein are incorporated herein by reference, and the extent of incorporation does not conflict with the explicit details disclosed herein. The references provided herein are solely for reference to their disclosures prior to the filing date of this application. Nothing herein should be construed as an admission that the inventor has no claim to prior disclosures due to prior invention.

[0082] This invention provides a novel plasmid transport peptide and its uses. This plasmid transport peptide can guide operatively linked polypeptides or proteins to localize on plant plasmids, and has the following advantages compared to natural plasmid transport peptides:

[0083] 1. This invention discloses for the first time a novel plasmid transport peptide, the amino acid sequence of which includes SEQ ID NO:1 to SEQ ID NO:36.

[0084] 2. The plasmid transport peptide-guided operably linked polypeptides or proteins disclosed in this invention have strong versatility and adaptability.

[0085] 3. The plasmid transport peptide disclosed in this invention has high recognition and localization efficiency for operably linked polypeptides or proteins targeting plasmids.

[0086] 4. The plasmid transport peptide disclosed in this invention has broad application prospects in the plant field.

[0087] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0088] Figure 1 is a schematic diagram of the structure of the plant expression vector DBNBC-01 of the present invention.

[0089] Figure 2 is a schematic diagram of the structure of the dicotyledonous scaffold carrier DBNBC-PTG-D of the present invention;

[0090] Figure 3 is a schematic diagram of the recombinant expression vector DBN101-P containing the plasmid transport peptide spAtCLP4 and the cPTG gene of the present invention.

[0091] Figure 4 is a schematic diagram of the structure of the positive control recombinant expression vector DBN170-P containing the positive control plasmid transport peptide spAtCLP2 and the cPTG gene of the present invention.

[0092] Figure 5 is a schematic diagram of the structure of the plasmid-free negative control vector DBN172-P of the present invention.

[0093] Figure 6 is a schematic diagram of the structure of the negative control vector DBN173-P without the cPTG gene of the present invention.

[0094] Figure 7 is a schematic diagram of the structure of the dicotyledonous scaffold vectors DBNBC-EPSPS and DBN164-P containing the cEPSPS gene of the present invention.

[0095] Figure 8 is a schematic diagram of the recombinant expression vector DBN165-P containing the plasmid transport peptide spAtLTP3 and the cEPSPS gene of the present invention.

[0096] Figure 9 is a schematic diagram of the structure of the positive control vector DBN169-P containing the Arabidopsis thaliana chloroplast transport peptide spAtCTP2 and the cEPSPS gene of the present invention.

[0097] Figure 10 shows the resistance results of the T0 generation Arabidopsis thaliana containing plastosome transport peptide and cEPSPS gene of the present invention after 7 days of glyphosate herbicide spraying.

[0098] Figure 11 shows the resistance results of the T1 generation Arabidopsis thaliana containing plastosome transport peptide and cEPSPS gene of the present invention after 7 days of glyphosate herbicide spraying.

[0099] Figure 12 is a schematic diagram of the structure of the negative control vector DBN174-P that does not contain the cPTG gene in this invention.

[0100] Figure 13 is a schematic diagram of the structure of the monocotyledonous scaffold vector DBNBC-PTG-M containing the cPTG-SZ gene of the present invention.

[0101] Figure 14 is a schematic diagram of the recombinant expression vector DBN137-P containing the plasmid transport peptide spAtCLP4 and the cPTG-SZ gene of the present invention.

[0102] Figure 15 is a schematic diagram of the structure of the positive control vector DBN171-P containing the positive control plasmid transport peptide spAtCLP2 and the cPTG-SZ gene of the present invention. Detailed Implementation

[0103] The technical solution of the plasmid transport peptide of the present invention and its application is further illustrated below through specific embodiments.

[0104] First embodiment: Design and generation of plasmid transport peptide sequences

[0105] By analyzing the biological characteristics of the structure and composition of plasmid transport peptides, and based on scientific understanding of their structure and function, the inventors rationally designed and assembled the three domains of plasmid transport peptides—the molecular chaperone recognition domain, the channel protein recognition domain, and the signal peptide recognition domain—to generate novel plasmid transport peptides. Through extensive experimental testing and screening, the inventors obtained a series of novel plasmid transport peptides with good physiological activity, including spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, spAtCLP11, spAtCLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, and spAtLTP1. The amino acid sequences of the novel plasmid transport peptides are shown in SEQ ID NO:1 to SEQ ID NO:36 in the sequence listing. Nucleotide sequences encoding the corresponding amino acid sequences were obtained based on plant-preferred codons, as shown in SEQ ID NO:37 to SEQ ID NO:72 in the sequence listing.

[0106] Second embodiment: Expression of the protoporphyrinogen oxidase cPTG gene linked to plasmid transport peptide in transgenic Arabidopsis thaliana.

[0107] 1. Constructing a recombinant expression vector for Arabidopsis containing a plasmid transport peptide linked to the cPTG gene.

[0108] 1.1 Construction of the dicotyledonous scaffold vector DBNBC-PTG-D containing the cPTG gene

[0109] The plant expression vector DBNBC-01 was linearized by double digestion with restriction endonucleases HindIII and SbfI. The digestion products were purified to obtain the linearized DBNBC-01 expression vector backbone, which was a pCAMBIA2301 vector modified with an antibiotic resistance tag (available from CAMBIA). A schematic diagram of the DBNBC-01 expression vector structure is shown in Figure 1 (cSpec: spectinomycin gene; RB: right border; LB: left border). Using primers SEQ ID NO: 80 and SEQ ID NO: 81, the first fragment pr35S was amplified using the pCAMBIA2301 vector as a template. Using primers SEQ ID NO: 82 and SEQ ID NO: 83, the second fragment cPTG was amplified using the synthesized gene as a template. Using primers SEQ ID NO: 84 and SEQ ID NO: 85, the third fragment t35S was amplified using the synthesized gene as a template. Using primers SEQ ID NO: 86 and SEQ ID NO: 87, the fourth fragment prAtUbi10 was amplified using the Arabidopsis thaliana genome as a template. Using primers SEQ ID NO: 88 and SEQ ID NO: 89, the fifth fragment cPAT was amplified using the synthesized gene as a template. Using primers SEQ ID NO: 90 and SEQ ID NO: 91, the sixth fragment tNos was amplified using the pCAMBIA2301 vector as a template. All synthesized genes were manufactured by GenScript Biotech Ltd.

[0110] The six PCR amplification fragments were mixed with the linearized DBNBC-01 expression vector backbone for recombination. The procedure was performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct the backbone vector DBNBC-PTG-D containing the cPTG gene. Its structural diagram is shown in Figure 2 (cSpec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prAtUbi10: Arabidopsis ubiquitin 10 gene promoter (SEQ ID NO: 76); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: carmine synthase gene terminator (SEQ ID NO: 77). NO: 78); LB: Left boundary).

[0111] The recombinant backbone vector DBNBC-PTG-D was transformed into *E. coli* DH5α competent cells using a heat shock method. The heat shock conditions were as follows: 100 μL of *E. coli* DH5α competent cells and 20 μL of recombinant plasmid DNA (backbone vector DBNBC-PTG-D) were gently mixed, and the mixture was heat-shocked in a 42°C water bath for 30 seconds, followed immediately by placing it on ice for 2 min. Then, 250 μL of antibiotic-free LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH adjusted to 7.5 with NaOH, and cultured at 37°C with shaking (200 rpm / min) for 1 hour) was added. The cells were then incubated upside down on LB agar plates containing 50 mg / L spectinomycin at 37°C for 12 hours. Positive colonies were picked and cultured overnight in LB broth containing 50 mg / L spectinomycin at 37°C with shaking (200 rpm / min). Plasmids were extracted using the alkaline lysis method: The bacterial culture was centrifuged at 12000 rpm for 1 min, the supernatant was discarded, and the precipitated bacterial cells were resuspended in 100 μL of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); 200 μL of freshly prepared solution II (0.2 M... Add NaOH and 1% SDS (sodium dodecyl sulfate), invert the tube four times to mix, and place on ice for 3-5 min; add 150 μL of ice-cold Solution III (3M potassium acetate, 5M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at 4℃ and 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of anhydrous ethanol, mix well, and place at room temperature for 5 min; centrifuge at 4℃ and 12000 rpm for 5 min, discard the supernatant, wash the precipitate with 70% ethanol (V / V) and air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at 37℃ for 30 min; store at -20℃ for later use. The extracted plasmids were sequenced and identified, and the results showed that the backbone vector DBNBC-PTG-D containing the cPTG gene was successfully constructed.

[0112] 1.2 Synthetic plasmid transport peptide nucleotide sequence

[0113] The nucleotide sequences of the plassome transport peptides are shown in SEQ ID NO: 37 to SEQ ID NO: 72, all synthesized at GenScript Biotech Ltd. Universal adapter primer 1 was used to ligate the 5' and 3' ends of the nucleotide sequences of the plassome transport peptides.

[0114] 5' universal adapter primer 1: 5'-ttcatttggagaggacaggcgcc-3', as shown in SEQ ID NO: 92 in the sequence listing;

[0115] The 3' universal adapter primer 1: 5'-cttcccattaggagaagacat-3', as shown in SEQ ID NO: 93 in the sequence listing.

[0116] 1.3 Construction of a dicotyledonous expression vector containing a plasmid transport peptide linked to the cPTG gene

[0117] The backbone vector DBNBC-PTG-D was linearized using the restriction endonuclease KasI. The spAtCLP4 element (SEQ ID NO: 37) with universal adapter primer 1 was mixed with the linearized backbone vector DBNBC-PTG-D fragment for recombination. The procedure was performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct the vector DBN101-P containing the plasmid transport peptide spAtCLP4 linked to the cPTG gene. A schematic diagram of the structure of vector DBN101-P is shown in Figure 3 (cSpec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); spAtCLP4: artificial plasmid transport peptide nucleotide sequence (SEQ ID NO: 37); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 73). NO: 75); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); LB: left border).

[0118] Following the same method used to construct the recombinant expression vector DBN101-P as described above, the plasmid transport peptides spAtCLP5 (SEQ ID NO: 38) to spAtLTP23 (SEQ ID NO: 72) replaced spAtCLP4 (SEQ ID NO: 37).The following 35 recombinant expression vectors were constructed: DBN101-P (containing plasmid transport peptide spAtCLP4), DBN102-P (containing plasmid transport peptide spAtCLP5), DBN103-P (containing plasmid transport peptide spAtCLP6), DBN104-P (containing plasmid transport peptide spAtCLP7), DBN105-P (containing plasmid transport peptide spAtCLP8), DBN106-P (containing plasmid transport peptide spAtCLP9), DBN107-P (containing plasmid transport peptide spAtCLP10), DBN108-P (containing plasmid transport peptide spAtCLP11), and DBN109-P (containing plasmid transport peptide spA). DBN110-P (containing plasmid transport peptide spAtCLP13), DBN111-P (containing plasmid transport peptide spAtCLP14), DBN112-P (containing plasmid transport peptide spAtCLP15), DBN113-P (containing plasmid transport peptide spAtCLP16), DBN114-P (containing plasmid transport peptide spPhCTP2), DBN115-P (containing plasmid transport peptide spAtCTP4), DBN116-P (containing plasmid transport peptide spAtLTP1), DBN117-P (containing plasmid transport peptide spAtLTP2), DBN118-P (containing plasmid transport peptide spAtLTP1) P3), DBN119-P (containing plasmid transport peptide spAtLTP4), DBN120-P (containing plasmid transport peptide spAtLTP5), DBN121-P (containing plasmid transport peptide spAtLTP6), DBN122-P (containing plasmid transport peptide spAtLTP7), DBN123-P (containing plasmid transport peptide spAtLTP8), DBN124-P (containing plasmid transport peptide spAtLTP9), DBN125-P (containing plasmid transport peptide spAtLTP10), DBN126-P (containing plasmid transport peptide spAtLTP11), DBN127-P (containing plasmid transport peptide spAtLTP12), D DBN128-P (containing plasmid transport peptide spAtLTP13), DBN129-P (containing plasmid transport peptide spAtLTP15), DBN130-P (containing plasmid transport peptide spAtLTP17), DBN131-P (containing plasmid transport peptide spAtLTP18), DBN132-P (containing plasmid transport peptide spAtLTP19), DBN133-P (containing plasmid transport peptide spAtLTP20), DBN134-P (containing plasmid transport peptide spAtLTP21), DBN135-P (containing plasmid transport peptide spAtLTP22), and DBN136-P (containing plasmid transport peptide spAtLTP23).

[0119] 1.4 Construction of an Arabidopsis control vector containing a known control transport peptide linked to the cPTG gene

[0120] (1) Construct a positive control vector DBN170-P containing a known positive control plasmid transport peptide linked to the cPTG gene.

[0121] The backbone vector DBNBC-PTG-D was linearized using the restriction endonuclease KasI. The nucleotide sequence (SEQ ID NO: 79) of the known positive control plasmid transport peptide spAtCLP2 (from the applicant's prior patent application CN202110514749.8) with universal adapter primer 1 was mixed with the linearized backbone vector DBNBC-PTG-D fragment for recombination. The operation was performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct the positive control vector DBN170-P containing the positive control plasmid transport peptide linked to the cPTG gene. The structural schematic diagram of the vector DBN170-P is shown in Figure 4 (cSpec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); spAtCLP2: positive control plasmid transport peptide (SEQ ID NO: 79); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 73). NO: 74); t35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: Promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO: 76); cPAT: Phosphinctin N-acetyltransferase gene (SEQ ID NO: 77); tNos: Terminator of carmine synthase gene (SEQ ID NO: 78); LB: Left border).

[0122] (2) Constructing a negative control vector DBN172-P without plasmid transport peptides

[0123] Using the same vector recombination construction method disclosed in section 1.1 of the second embodiment above, the operation steps were performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct a dicotyledonous negative control vector DBN172-P containing only the cPTG gene and lacking plasmid transport peptides. Its structural schematic diagram is shown in Figure 5 (Spec: spectinomycin gene; RB: right border; prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO: 76); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 78). NO: 77); t35S: Cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); LB: Left boundary).

[0124] (3) Constructing the negative control vector DBN173-P without the cPTG gene.

[0125] Using the same vector recombination construction method disclosed in section 1.1 of the second embodiment above, the operation steps were performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to obtain the negative control vector DBN173-P without the cPTG gene in dicotyledonous plants. Its structural schematic diagram is shown in Figure 6 (Spec: spectinomycin gene; RB: right border; eFMV: 34S enhancer of Scrophularia mosaic virus (SEQ ID NO: 122); prBrCBP1: promoter of rapeseed eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO: 123); spAtCTP2: Arabidopsis thaliana chloroplast transport peptide (SEQ ID NO: 127); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO: 124); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 124). NO: 125); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO: 76); cEGFP: green fluorescent protein gene (SEQ ID NO: 126); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: promoter of cauliflower mosaic virus 35S (SEQ ID NO: 73); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); t35S: terminator of cauliflower mosaic virus 35S (SEQ ID NO: 75); LB: left border).

[0126] 2. Arabidopsis recombinant expression vector transformed into Agrobacterium

[0127] The correctly constructed recombinant expression vectors DBN101-P to DBN136-P and control vectors DBN170-P, DBN172-P, and DBN173-P were transformed into Agrobacterium GV3101 using the liquid nitrogen method. The transformation conditions were as follows: 100 μL Agrobacterium GV3101, 3 μL plasmid DNA (recombinant expression vectors DBN101-P to DBN136-P and control vectors DBN170-P, DBN172-P, and DBN173-P); incubated in liquid nitrogen for 10 min, followed by a 37°C water bath for 10 min; the transformed... Agrobacterium GV3101 after processing was inoculated into LB tubes and cultured at 28℃ and 200 rpm for 2 h. The cultured cells were then plated onto LB agar plates containing 50 mg / L rifampicin and 50 mg / L spectinomycin until positive single colonies grew. Single colonies were picked, cultured, and their plasmids were extracted. The extracted plasmids were sequenced and identified. The results showed that the recombinant expression vectors DBN101-P to DBN136-P and the control vectors DBN170-P, DBN172-P, and DBN173-P had completely correct structures.

[0128] 3. Obtaining transgenic Arabidopsis plants

[0129] Wild-type Arabidopsis seeds were suspended in a 0.1% (w / v) agarose solution. The suspended seeds were stored at 4°C for 2 days to complete the necessary dormancy to ensure synchronous germination. A mixture of vermiculite and horse manure was irrigated with groundwater until moist, and the soil mixture was drained for 24 hours. The pretreated seeds were planted on the soil mixture and covered with a moisture-retaining cover for 7 days. The seeds were then germinated and cultivated in a greenhouse under long-day conditions (16 hours light / 8 hours dark) with constant temperature (22°C), constant humidity (40-50%), and light intensity of 120-150 μmol / m²s⁻¹. The plants were initially irrigated with Hoagland solution, followed by deionized water, keeping the soil moist but not saturated.

[0130] Arabidopsis thaliana was transformed using the flower immersion method. One or more 15-30 mL aliquots of LB medium containing spectinomycin (50 mg / L) and rifampin (10 mg / L) were inoculated with selected Agrobacterium colonies. The pre-cultures were incubated overnight at 28°C with constant shaking at 220 rpm. Each pre-culture was used to inoculate two 500 mL aliquots of YEP medium containing spectinomycin (50 mg / L) and rifampin (10 mg / L), and the cultures were incubated overnight at 28°C with constant shaking. The cells were centrifuged at approximately 4000 rpm for 20 min at room temperature to pellet the cells, and the supernatant was discarded. The cell pellet was gently resuspended in 500 mL of osmotic medium containing 1 / 2 × MS salt / vitamin B5, 10% (w / v) sucrose, 0.044 μM benzylaminopurine (10 μL / L (stock solution in 1 mg / mL DMSO)), and 300 μL / L Silwet L-77. Approximately one-month-old Arabidopsis plants were immersed in the resuspended cell medium for 5 min, ensuring the newest inflorescences were submerged. The plants were then laid sideways and covered, kept moist in the dark for 24 h, and then cultured normally at 22°C with a 16 h light / 8 h dark photoperiod. Seeds were harvested after approximately 4 weeks.

[0131] The newly harvested T1 seeds were dried at room temperature for 7 days. The seeds were planted in 26.5cm×51cm germination trays, with each tray receiving 200mg of T1 seeds (approximately 10,000 seeds). The seeds had been pre-suspended in distilled water and stored at 4°C for 2 days to complete the necessary dormancy and ensure synchronous germination.

[0132] Mix vermiculite with horse manure and irrigate the bottom of the soil with water until moist, then drain by gravity. Use a pipette to evenly sow the pretreated seeds onto the soil mixture and cover with a moisture-retaining cover for 4-5 days. Remove the cover one day before initial transformant selection using a post-emergence spray of glufosinate (selecting the co-transformed cPAT gene). At 7 and 11 days post-planting, spray T1 plants (cotyledon stage and 2-4 leaf stage, respectively) with a 0.2% solution of Liberty herbicide (200 gai / L glufosinate) using a DeVilbiss compressed air nozzle at a spray volume of 10 mL / tray (703 L / ha) to provide an effective dose of glufosinate at each application. 4-7 days after the final spray, identify surviving plants (actively growing plants) and transplant them into 7cm × 7cm square pots prepared with horse manure and vermiculite (3-5 plants per pot). Cover the transplanted plants with a moisture-retaining cover for 3-4 days, and place them in a 22°C incubator as before, or move them directly into a greenhouse.

[0133] The cover was then removed, and the plants were planted in a greenhouse (temperature 22±5℃, 50±30%RH, 14h light: 10h dark, minimum 500μE / m2s-1 natural + supplemental light) for at least one day before further testing the ability of spAtCLP4 to spAtLTP23 to provide tolerance to PPO inhibitor herbicides linked to cPTG genes.

[0134] 4. Herbicide tolerance test of transgenic Arabidopsis plants

[0135] First, select transformed Arabidopsis thaliana T1 generation plants using glufosinate-ammonia herbicide. Furthermore, 24 Arabidopsis thaliana T1 plants, 24 plants each of the following generations (transformed with nucleotide sequences of spAtCLP4 to spAtLTP23 linked to the cPTG gene, 24 plants of the positive control vector, 24 plants of the negative control vector, and 24 wild-type Arabidopsis thaliana plants (CK)) were sprayed with three PPO inhibitor herbicides on the 18th day after sowing to test the herbicide tolerance of Arabidopsis thaliana. The three PPO inhibitor herbicides and their corresponding spraying concentrations were as follows: two concentrations of ethoxyflufenican at 180 g ai / ha (1× field concentration) and 720 g ai / ha (4× field concentration); two concentrations of benzoylsulfuron at 25 g ai / ha (1× field concentration) and 100 g ai / ha (4× field concentration); and two concentrations of propyzoxystrobin at 60 g ai / ha (1× field concentration) and 240 g ai / ha (2× field concentration). ai / ha (4× field concentration).

[0136] Those skilled in the art should know that, 7 days after spraying (7DAT, where DAT is an abbreviation for Day after treatment, indicating the number of days after the treatment, excluding the day of treatment, the same applies below), the degree of damage to each plant by the herbicide can be evaluated based on the percentage of average plant damage (average plant damage percentage = leaf damage area / total leaf area × 100%), i.e., the herbicide damage level: Level 0 indicates that the growth status is basically the same as that of the blank solvent (water), Level 1 indicates that the average plant damage percentage is less than 10%, Level 2 indicates that the average plant damage percentage is greater than 10%, and Level 3 indicates that the average plant damage percentage is 100%. The resistance performance of each recombinant expression vector in the transformation event is scored according to the formula X = [Σ(N×S) / (T×M)]×100. (X - herbicide damage score, N - number of plants with the same damage level, S - number of herbicide damage grades, T - total number of plants, M - highest herbicide damage grade), resistance was evaluated based on the scores: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), lowly resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Tables 1 to 3.

[0137] Table 2. Results of the experiment on the tolerance of transgenic Arabidopsis thaliana T1 generation plants to ethoxyflufenican.

[0138] Table 1 shows that Arabidopsis T1 generation plants with negative control vectors DBN172-P and DBN173-P were not resistant to ethoxyflufenican, while Arabidopsis T1 generation plants with positive control vector DBN170-P were highly resistant to 1 to 4 times the field concentration of ethoxyflufenican. Arabidopsis T1 generation plants with vectors DBN101-P to DBN136-P, respectively, containing plasmid transport peptides spAtCLP4 to spAtLTP23 linked to the cPTG gene, exhibited excellent tolerance to ethoxyflufenican. Among them, 32 vectors showed high or moderate resistance to 1 to 4 times the field concentration of ethoxyflufenican. The technical effect of the plasmid transport peptides was superior to or equivalent to the herbicide tolerance of transgenic Arabidopsis T1 generation plants containing the positive control plasmid transport peptide spAtCLP2.

[0139] Table 2. Results of the tolerance experiment of transgenic Arabidopsis thaliana T1 generation plants to pyrimisulfuron.

[0140] Table 2 shows that Arabidopsis T1 generation plants with negative control vectors DBN172-P and DBN173-P were not resistant to benzosulfuron, while Arabidopsis T1 generation plants with positive control vector DBN170-P were highly resistant to 1-fold and moderately resistant to 4-fold field concentrations of benzosulfuron. Among Arabidopsis T1 generation plants transformed with vectors DBN101-P to DBN136-P, which were respectively infused with plasmid transport peptides spAtCLP4 to spAtLTP23 and linked to the cPTG gene, 22 vectors showed excellent tolerance to benzosulfuron, exhibiting high or moderate resistance to 1-fold to 4-fold field concentrations of benzosulfuron. The technical effect of these plasmid transport peptides was superior to or equivalent to the herbicide tolerance of transgenic Arabidopsis T1 generation plants transformed with the positive control plasmid transport peptide spAtCLP2.

[0141] Table 3. Results of the tolerance experiment of transgenic Arabidopsis thaliana T1 generation plants to propyzoxystrobin.

[0142] Table 3 shows that the Arabidopsis T1 generation plants with negative control vectors DBN172-P and DBN173-P were not resistant to propyzamide, while the Arabidopsis T1 generation plants with the positive control vector DBN170-P were highly resistant to 1 to 4 times the field concentration of propyzamide. Among the Arabidopsis T1 generation plants from DBN101-P to DBN136-P, which were transformed with plasmid transport peptides spAtCLP4 to spAtLTP23 respectively linked to the cPTG gene, 29 plants showed excellent tolerance to propyzamide, exhibiting high / moderate resistance to 1 to 4 times the field concentration of propyzamide. The technical effect of the plasmid transport peptides was superior to or equivalent to the herbicide tolerance of the transgenic Arabidopsis T1 generation plants transformed with the positive control plasmid transport peptide spAtCTP2.

[0143] Third embodiment: Expression of the cEPSPS gene linked to plasmid transport peptide in transgenic Arabidopsis thaliana.

[0144] 1. Constructing a recombinant expression vector for Arabidopsis containing plasmid transport peptides and the cEPSPS gene.

[0145] 1.1 Construction of the dicotyledonous backbone vector DBNBC-EPSPS containing the cEPSPS gene and the negative control vector DBN164-P without plassome transport peptide.

[0146] Using the same vector recombination construction method disclosed in section 1.1 of the second embodiment above, the operation steps were performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949). This yielded a dicotyledonous backbone vector DBNBC-EPSPS containing the cEPSPS gene and a negative control vector DBN164-P without plasmid transport peptides. A schematic diagram of the structure of the backbone vector DBNBC-EPSPS is shown in Figure 7-A, and a schematic diagram of the structure of the negative control vector DBN164-P is shown in Figure 7-B (Spec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPAT: phosphinicotinic N-acetyltransferase gene (SEQ ID NO: 77); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); eFMV: Scrophularia mosaic virus 34S enhancer (SEQ ID NO: 75). NO: 122); prBrCBP1: promoter of rapeseed eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO: 123); cEPSPS: 5-enolpyruvate-shikimate-3-phosphate synthase gene (SEQ ID NO: 124); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 125); LB: left border). The distinguishing feature of the dicotyledonous backbone vector DBNBC-EPSPS and the negative control vector DBN164-P without plasmid transport peptide is that an AscI restriction site is added between the prBrCBP1 promoter element of the backbone vector DBNBC-EPSPS and the cEPSPS gene, and the plasmid transport peptide used in this invention is inserted into the backbone vector DBNBC-EPSPS at the AscI restriction site.

[0147] 1.2 Synthetic plasmid transport peptide nucleotide sequence

[0148] The plassome transport peptide nucleotide sequences spAtLTP3 (SEQ ID NO: 54), spAtCLP11 (SEQ ID NO: 44), spAtCLP13 (SEQ ID NO: 46), and spPhCTP2 (SEQ ID NO: 50) were all synthesized at Genscript Biotech Co., Ltd. The 5' and 3' ends of the aforementioned plassome transport peptide nucleotide sequences (SEQ ID NO: 54, SEQ ID NO: 44, SEQ ID NO: 46, and SEQ ID NO: 50) were respectively ligated to universal adapter primer 3.

[0149] 5' universal adapter primer 3: 5'-ttgcattgacaagtagcc-3', as shown in SEQ ID NO: 120 in the sequence listing;

[0150] The 3' universal connector primer 3: 5'-atgcttcacggtgcaagc-3', as shown in SEQ ID NO: 121 in the sequence listing.

[0151] 1.3 Construction of an expression vector containing plasmid transport peptide linked to the cEPSPS gene

[0152] The backbone vector DBNBC-EPSPS was linearized using the restriction endonuclease AscI. The spAtLTP3 (SEQ ID NO: 54) with universal adapter 3 was mixed with the linearized backbone vector DBNBC-EPSPS fragment for recombination. The procedure was performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct the vector DBN165-P containing the cEPSPS gene. The structural diagram of the vector DBN165-P is shown in Figure 8 (Spec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPAT: phosphinicotinic N-acetyltransferase gene (SEQ ID NO: 77); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); eFMV: Scrophularia mosaic virus 34S enhancer (SEQ ID NO: 122); prBrCBP1: promoter of rapeseed eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO: 54). NO: 123); plasmid transport peptide spAtLTP3 (SEQ ID NO: 54); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO: 124); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 125); LB: left border).

[0153] Following the same method used to construct the recombinant expression vector DBN165-P, the plasmid transport peptides spAtCLP11 (SEQ ID NO: 44), spAtCLP13 (SEQ ID NO: 46), and spPhCTP2 (SEQ ID NO: 50) were replaced with spAtLTP3 (SEQ ID NO: 54) to construct three other recombinant expression vectors: DBN166-P (containing plasmid transport peptide spAtCLP11), DBN167-P (containing plasmid transport peptide spAtCLP13), and DBN168-P (containing plasmid transport peptide spPhCTP2).

[0154] 1.4 Construction of an Arabidopsis positive control vector containing a known plasmid transport peptide linked to the cEPSPS gene.

[0155] (1) Construct a positive control vector DBN169-P, which links the known plasmid transport peptide spAtCTP2 to the cEPSPS gene.

[0156] The backbone vector DBNBC-EPSPS was linearized using the restriction endonuclease AscI. The nucleotide sequence (SEQ ID NO: 127) of the known positive control Arabidopsis chloroplast transport peptide spAtCTP2 with universal adapter primer 3 was mixed and recombinated with the linearized backbone vector DBNBC-EPSPS fragment. The operation was performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct the positive control vector DBN169-P containing the positive control plasmid transport peptide and cEPSPS gene. This vector served as the first positive control vector in this embodiment. The structural diagram of the vector DBN169-P is shown in Figure 9 (Spec: spectinomycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); eFMV: Scrophularia mosaic virus 34S enhancer (SEQ ID NO: 75). NO: 122); prBrCBP1: Promoter of rapeseed eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO: 123); spAtCTP2: Arabidopsis thaliana chloroplast transport peptide (SEQ ID NO: 127); cEPSPS: 5-enolpyruvate-shikimic acid-3-phosphate synthase gene (SEQ ID NO: 124); tPsE9: Terminator of pea RbcS gene (SEQ ID NO: 125); LB: Left boundary).

[0157] (2) Positive control vector DBN173-P containing the known plasmid transport peptide spAtCTP2 linked to the cEPSPS gene.

[0158] The vector DBN173-P disclosed in section (3) of paragraph 1.4 of the second embodiment above is used as the second positive control vector in this embodiment. The vector DBN173-P contains the known plasmid transport peptide spAtCTP2 and the cEPSPS gene linked together.

[0159] 2. Obtaining transgenic Arabidopsis plants

[0160] Using the methods for transforming Agrobacterium and obtaining transgenic Arabidopsis plants disclosed in paragraphs 2 and 3 of the second embodiment above, the above recombinant vectors DBN164-P (negative control), DBN165-P, DBN166-P, DBN167-P, DBN168-P, and DBN169-P (positive control) were transformed with Agrobacterium and the corresponding transgenic Arabidopsis plants were obtained.

[0161] 3. Testing the glyphosate herbicide tolerance of transgenic Arabidopsis plants

[0162] The herbicide tolerance of transgenic Arabidopsis thaliana T0 generation plants was tested by spraying with glyphosate herbicide. T0 generation plants were generated by linking the cEPSPS gene with plasmid transport peptides spAtLTP3 (vector DBN165-P), spAtCLP11 (vector DBN166-P), spAtCLP13 (vector DBN167-P), and spPhCTP2 (vector DBN168-P), respectively. T0 generation plants were also generated using positive control vectors DBN169-P and DBN173-P containing the known control transport peptide spAtCTP2. Additionally, 24 plants each were generated using the negative control vector DBN164-P (without plasmid transport peptide) and wild-type Arabidopsis thaliana (CK). On day 18 post-sowing, two different concentrations were applied: 1680 g ae / ha (2 times the field concentration, 2×) and 3360 g ae / ha. The glyphosate herbicide at ae / ha (4 times the field concentration, 4×) was sprayed to test the herbicide tolerance of transgenic Arabidopsis thaliana T0 generation plants. The experimental results are shown in Table 4 and Figure 10.

[0163] The herbicide tolerance of transgenic Arabidopsis T1 plants was tested by spraying with glyphosate herbicide. Twelve Arabidopsis thaliana T1 generation plants were generated by linking the cEPSPS gene with plasmid transport peptides spAtLTP3 (vector DBN165-P), spAtCLP11 (vector DBN166-P), spAtCLP13 (vector DBN167-P), and spPhCTP2 (vector DBN168-P), respectively. Twelve positive control vectors DBN169-P and DBN173-P (containing the known positive control transport peptide spAtCTP2) and twelve negative control vectors DBN164-P (without plasmid transport peptides) and twelve wild-type Arabidopsis thaliana plants (CK) were also generated. On the 18th day after sowing, these plants were sprayed with glyphosate herbicide at a concentration of 3360 g ae / ha (4 times the field concentration, 4×) to test herbicide tolerance. The experimental results are shown in Table 5 and Figure 11.

[0164] Those skilled in the art should know that the key points for judging the level of glyphosate phytotoxicity are the degree of yellowing of old and new leaves, and the recovery progress. The grading standards are as follows: Grade 0: New leaves show almost no chlorosis; Grade 1: New leaves show slight chlorosis, which can recover to normal leaf color within 7 days; Grade 2: New leaves show obvious chlorosis, which can recover to normal leaf color in 7-10 days, and has a certain impact on plant growth and fruiting; Grade 3: New leaves show obvious chlorosis and are accompanied by deformity, which significantly inhibits plant growth and fruiting. Severely affected plants have withered leaves and are close to death. Seven days after spraying (7DAT), the resistance performance of each recombinant expression vector was scored according to the formula X=[Σ(N×S) / (T×M)]×100. (X - herbicide damage score, N - number of plants with the same damage level, S - number of herbicide damage levels, T - total number of plants, M - highest herbicide damage level), resistance is evaluated based on the score: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), low resistant plants (34-67 points), non-resistant plants (68-100 points).

[0165] Table 4. Results of glyphosate tolerance experiments on transgenic Arabidopsis T0 plants with plasmid transport peptide linked to the cEPSPS gene.

[0166] Table 4 shows that the T0 generation Arabidopsis plants of the negative control vector DBN164-P without plasmid transport peptides and wild-type (CK) plants were intolerant to glyphosate. The T0 generation Arabidopsis plants of the positive control vectors DBN169-P and DBN173-P containing the spAtCTP2 plasmid transport peptide were highly resistant to 2 to 4 times the field concentration of glyphosate. Plants transfected with the plasmid transport peptides spAtLTP3, spAtCLP11, spAtCLP13, and spPh... Arabidopsis thaliana T0 generation plants with CTP2 linked to the cEPSPS gene in vectors DBN165-P, DBN166-P, DBN167-P, and DBN168-P respectively exhibited excellent tolerance to glyphosate herbicide, showing high resistance / moderate resistance to 2 to 4 times the field concentration of glyphosate. The technical effect of the plasmid transport peptide is superior to or equivalent to the herbicide tolerance of transgenic Arabidopsis thaliana T0 generation plants transformed with the positive control plasmid transport peptide spAtCTP2.

[0167] Table 5. Results of glyphosate tolerance experiments on transgenic Arabidopsis T1 plants with plasmid transport peptide linked to the cEPSPS gene.

[0168] The results in Table 5 show that the T1 generation plants of the negative control vector DBN164-P without plasmid transport peptides and wild-type (CK) Arabidopsis plants were intolerant to glyphosate. The T1 generation plants of Arabidopsis with the positive control vectors DBN169-P and DBN173-P containing the spAtCTP2 plasmid transport peptide were highly resistant to 4 times the field concentration of glyphosate. The T1 generation plants of Arabidopsis with the vectors DBN165-P, DBN166-P, DBN167-P, and DBN168-P, which were transformed with the plasmid transport peptides spAtLTP3, spAtCLP11, spAtCLP13, and spPhCTP2 respectively linked to the cEPSPS gene, showed excellent tolerance to glyphosate herbicide and were highly resistant to 4 times the field concentration of glyphosate. The technical effect of the plasmid transport peptides was better than or equivalent to the herbicide tolerance of the transgenic Arabidopsis T1 generation plants transformed with the positive control plasmid transport peptide spAtCTP2.

[0169] Based on the experimental results of the second and third embodiments, the plasmid transport peptide disclosed in this invention can connect the cPTG gene and the transport protoporphyrinogen oxidase protein to achieve high resistance to PPO inhibitor herbicides at 1 to 4 times the field concentration. Furthermore, the plasmid transport peptide can also connect the cEPSPS gene and the transport EPSPS protein to achieve high resistance to glyphosate herbicides at 2 to 4 times the field concentration. Experimental results show that the novel plasmid transport peptide disclosed in this invention can enhance plant tolerance to herbicides and has the following advantages compared to natural plasmid transport peptides: (1) strong versatility and adaptability of the operatively linked peptides or proteins; (2) high efficiency in targeting plasmids for recognition and localization; and (3) broad application prospects in the plant field.

[0170] Fourth Example: Expression of the plasmid transport peptide-linked protoporphyrinogen oxidase cPTG gene in transgenic soybean.

[0171] 1. Construct a soybean recombinant expression vector containing a plasmid transport peptide linked to the cPTG gene.

[0172] 1.1 Construction of soybean negative control vector DBN174-P

[0173] The same vector recombination construction method as in Example 2, Section 1.1 above was used, and the operation steps were performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949). A dicotyledonous negative control vector DBN174-P without plasmid transport peptides and the cPTG gene was obtained, and its structural schematic diagram is shown in Figure 12 (Spec: spectinomycin gene; RB: right border; prGm17gTsf1: soybean tsf1 gene promoter (SEQ ID NO: 136); spAtCTP2: Arabidopsis thaliana chloroplast transport peptide (SEQ ID NO: 127); cEPSPS: 5-enolpyruvate shikimate-3-phosphate synthase gene (SEQ ID NO: 124); tPsE9: pea RbcS gene terminator (SEQ ID NO: 125); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 125). NO: 73); cPAT: Phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); t35S: cauliflower mosaic 35S terminator (SEQ ID NO: 75); LB: left border).

[0174] 1.2 Construction of soybean recombinant expression vector

[0175] The seven recombinant expression vectors DBN101-P (containing plasmid transport peptide spAtCLP4), DBN104-P (containing plasmid transport peptide spAtCLP7), DBN105-P (containing plasmid transport peptide spAtCLP8), DBN108-P (containing plasmid transport peptide spAtCLP11), DBN109-P (containing plasmid transport peptide spAtCLP12), DBN110-P (containing plasmid transport peptide spAtCLP13), and DBN118-P (containing plasmid transport peptide spAtLTP3), along with the positive control vector DBN170-P and the negative control vector DBN174-P, were used for soybean genetic transformation.

[0176] 2. Obtaining transgenic soybean plants

[0177] 1.1 Transformation of Agrobacterium tumefaciens with recombinant expression vector

[0178] Using the recombinant expression vectors DBN101-P, DBN104-P, DBN105-P, DBN108-P, DBN109-P, DBN110-P, DBN118-P, positive control vector DBN170-P, and negative control vector DBN174-P constructed as described in paragraph 1.1 of the second embodiment above, cotyledonary node tissues of the aseptically cultured soybean variety Jack were co-cultured with the above-mentioned Agrobacterium using the conventional Agrobacterium infection method.

[0179] The constructed soybean recombinant expression vectors included: DBN101-P T-DNA (containing pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP4 (SEQ ID NO: 37); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: Arabidopsis ubiquitin 10 gene promoter (SEQ ID NO: 76); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: carmine synthase gene terminator (SEQ ID NO: 78)) and DBN104-P T-DNA (containing pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP7 (SEQ ID NO: 78)). NO: 40); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78)); T-DNA of DBN105-P (containing pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP8 (SEQ ID NO: 41); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 40); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78)); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 73); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); cPAT: promoter of cauliflower mosaic virus (SEQ ID NO: 74); cPAT: promoter of cauliflower mosaic virus (SEQ ID NO: 75); cPAT: promoter of cauliflower mosaic virus (SEQ ID NO: 76); cPAT: promoter of phosphinicotin N- NO: 75); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO: 76); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78)); T-DNA of DBN108-P (containing pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP11 (SEQ ID NO: 44); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO: 76);cPAT: Phosphirin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78)); DBN109-P T-DNA (containing pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP12 (SEQ ID NO: 45); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: promoter of Arabidopsis ubiquitin 10 gene (SEQ ID NO: 76); cPAT: Phosphirin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78)); T-DNA of DBN110-P (containing pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP13 (SEQ ID NO: 46); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: Arabidopsis ubiquitin 10 gene promoter (SEQ ID NO: 76); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: carmine synthase gene terminator (SEQ ID NO: 78)) and T-DNA of DBN118-P (containing pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtLTP3 (SEQ ID NO: 78)). (SEQ ID NO: 54); cPTG: protoporphyrinogen oxidase gene (SEQ ID NO: 74); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 75); prAtUbi10: Arabidopsis ubiquitin 10 gene promoter (SEQ ID NO: 76); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); T-DNA from positive control vector DBN170-P and negative control vector DBN174-P were transferred into soybean chromosomes, resulting in soybean plants with plasmid transport peptides linking the cPTG and cPAT genes respectively, as well as soybean plants with positive control vector DBN170-P and negative control vector DBN174-P.

[0180] 1.2 Soybean genetic transformation

[0181] Agrobacterium-mediated genetic transformation of soybean was briefly described as follows: Mature soybean seeds were germinated in soybean germination medium (3.1 g / L B5 salt, B5 vitamin, 20 g / L sucrose, 8 g / L agar, pH 5.6). Seeds were inoculated onto the germination medium and cultured under the following conditions: temperature 25 ± 1℃; photoperiod (light / dark) 16:8 hours. After 4-6 days of germination, fresh green, swollen, sterile soybean seedlings were harvested. The hypocotyl was removed 3-4 mm below the cotyledon node, the cotyledons were longitudinally cut open, and the terminal bud, lateral buds, and seed roots were removed. Inoculate the cotyledonary node with the back of a scalpel. Contact the injured cotyledonary node tissue with an Agrobacterium suspension, in which Agrobacterium can deliver the T-DNA sequence to the injured cotyledonary node tissue (Step 1: Infection Step). In this step, the cotyledonary node tissue is preferably immersed in an Agrobacterium suspension (OD660 = 0.5-0.8) and an infection medium (MS salt 2.15 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, acetylsuccinone (AS) 40 mg / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3) to initiate inoculation. The cotyledonary node tissue is co-cultured with Agrobacterium for a period of time (3 days) (Step 2: Co-culture Step). Preferably, after the infection step, the cotyledonary node tissue is cultured on a solid medium (MS salt 4.3 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L, pH 5.6). Following this co-culture phase, a selective "recovery" step may be performed. In the "recovery" step, the recovery medium (B5 salt 3.1 g / L, vitamin B5, MES 1 g / L, sucrose 30 g / L, ZT 2 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, pH 5.6) contains at least one known antibiotic that inhibits Agrobacterium growth (cephalosporin 150-250 mg / L), without the addition of a plant transformant selector (step 3: recovery step). Preferably, the cotyledonary regenerated tissue blocks are cultured on a solid medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the cotyledonary regenerated tissue blocks are cultured on a medium containing a selector (glufosinate) and the growing transformed callus is selected (step 4: selection step). Preferably, the cotyledonary regenerated tissue blocks are cultured on a screening solid medium containing a selector (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, glufosinate 6 mg / L, pH 5.6), resulting in selective growth of transformed cells.Then, the transformed cells regenerate into plants (step 5: regeneration step). Preferably, the tissue blocks regenerated from the cotyledonary nodes grown on a medium containing a selector are cultured on solid media (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0182] The selected resistant tissue blocks were transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, glufosinate 6 mg / L, pH 5.6) and cultured for differentiation at 25°C. The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) and cultured at 25°C until approximately 10 cm tall, then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the plants are cultured at 26°C for 16 hours each day, followed by 20°C for 8 hours each day.

[0183] 3. TaqMan probe-based quantitative PCR method for verifying transgenic plants

[0184] Approximately 100 mg of leaf samples were taken from soybean plants transformed with the cPTG and cPAT genes, respectively. Genomic DNA was extracted using Qiagen's DNeasy Plant Maxi Kit, and the copy number of the cPAT gene was determined by Taqman probe-based quantitative PCR. Wild-type soybean plants were used as controls, and the same analysis was performed. The experiment was conducted in triplicate, and the average value was used.

[0185] The specific method for detecting the cPAT gene copy number is as follows:

[0186] Step 6. Take 100 mg of leaves from soybean plants with cPTG and cPAT genes and wild-type soybean plants respectively, grind them into homogenates in a mortar with liquid nitrogen, and take 3 replicates for each sample.

[0187] Step 7. Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. Refer to the product instructions for specific methods.

[0188] Step 8. Determine the genomic DNA concentration of the above samples using a NanoDrop 2000 (Thermo Scientific);

[0189] Step 9. Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μL;

[0190] Step 10. The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type soybean plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:

[0191] The following primers and probes are used to detect the cPAT gene sequence:

[0192] Primer 1: gagggtgttgtggctggtattg, as shown in SEQ ID NO: 137 in the sequence listing;

[0193] Primer 2: tctcaactgtccaatcgtaagcg, as shown in SEQ ID NO: 138 in the sequence listing;

[0194] Probe 1: cttacgctgggccctggaaggctag, as shown in SEQ ID NO: 139 in the sequence listing.

[0195] The PCR reaction system is as follows:

[0196] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in amber tubes at 4°C.

[0197] The PCR reaction conditions are as follows:

[0198] Data were analyzed using the Applied Biosystems 7900HT Fast Real-Time PCR System SDS v2.3 software. The results showed that the cPTG and cPAT gene sequences had been integrated into the chromosomes of the tested soybean plants. The transgenic soybean plants with single copies of the cPTG and cPAT gene sequences were used to detect herbicide tolerance.

[0199] 4. Testing the herbicide tolerance of genetically modified soybean plants

[0200] Transgenic soybean T1 generation plants, transgenic soybean plants with plastid transport peptides spAtCLP4, spAtCLP7, spAtCLP8, spAtCLP11, spAtCLP12, and spAtLTP3 respectively linked to the cPTG gene in recombinant expression vectors DBN101-P, DBN104-P, DBN105-P, DBN108-P, DBN109-P, DBN110-P, and DBN118-P, positive control vector DBN170-P, and negative control vector DBN174-P were respectively transformed into the soybean chromosome. Three PPO inhibitor herbicides were sprayed. The three PPO inhibitor herbicides and their corresponding spraying concentrations were 4 times the field concentration of ethoxyflufen (720 g ai / ha), 4 times the field concentration of phenylsulfuron (100 g ai / ha), and 4 times the field concentration of propyzoxystrobin (240 g ai / ha). Phenotypic behavior was observed on days 3 and 7 after spraying to assess herbicide tolerance in genetically modified soybeans.

[0201] Those skilled in the art should know that the phytotoxicity characteristics of PPO inhibitor herbicides include yellow, relatively scattered mottled spots on the leaves and browning at the growing point. PPO inhibitor herbicide phytotoxicity generally occurs at the growing point, on the first, second, and third leaves from the top (trifoliate compound leaves), while true leaf phytotoxicity is generally not obvious. Grade 0 is defined as no phytotoxicity at all; Grade 1 is defined as slight phytotoxicity affecting less than 50% of the leaf area and slight browning at the growing point, either of which is rated as Grade 1; Grade 2 is defined as severe phytotoxicity affecting more than 50% of the leaf area and severe inhibition at the growing point; Grade 3 is defined as severe phytotoxicity affecting the entire plant, with growth affected by the phytotoxicity and unable to recover.

[0202] The resistance performance of each recombinant expression vector in the transformation event was scored according to the formula X=[Σ(N×S) / (T×M)]×100. (X-drug damage score, N-number of plants with the same level of damage, S-number of drug damage levels, T-total number of plants, M-highest drug damage level). Resistance was evaluated according to the score: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), low resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Table 6.

[0203] Table 6. Results of the tolerance experiment of transgenic soybean T1 generation plants to PPO inhibitor herbicides.

[0204] Table 6 shows that the transgenic soybean plants of the negative control vector DBN174-P were intolerant to ethoxyflufenican, pyrimisulfuron, or propyzoxyl herbicides. The transgenic soybean plants of the positive control vector DBN170-P, containing the positive control plasmid transport peptide spAtCLP2, were highly resistant to 4 times the field concentration of ethoxyflufenican, pyrimisulfuron, and propyzoxyl. The transgenic soybean plants incorporating plasmid transport peptides spAtCLP4, spAtCLP7, spAtCLP8, spAtCLP11, spAtCLP12, and spAtLTP3 were respectively linked to… Transgenic soybean T1 generation plants inoculated with the recombinant expression vectors DBN101-P, DBN104-P, DBN105-P, DBN108-P, DBN109-P, and DBN118-P of the cPTG gene exhibited excellent tolerance to PPO inhibitor herbicides. They showed high or moderate resistance to 4 times the field concentration of ethoxyflufenican, pyrimisulfuron, or propyzoxystrobin. The technical effect of the plasmid transport peptide was superior to or equivalent to the herbicide tolerance of transgenic soybean T1 generation plants inoculated with the positive control plasmid transport peptide spAtCLP2.

[0205] Fifth Example: Expression of the plasmid transport peptide-linked protoporphyrinogen oxidase cPTG-SZ gene in transgenic maize.

[0206] 1. Construct a maize recombinant expression vector containing a plasmid transport peptide linked to the cPTG-SZ gene.

[0207] 1.1 Construction of the monocotyledonous scaffold vector DBNBC-PTG-M containing the cPTG-SZ gene

[0208] The plant expression vector DBNBC-01 (structural schematic shown in Figure 1) was linearized by double digestion with restriction endonucleases KpnI and SbfI. The digestion products were purified to obtain the linearized DBNBC-01 expression vector backbone, which was a pCAMBIA2301 vector with a modified resistance tag (available from CAMBIA). Using primers SEQ ID NO: 94 and SEQ ID NO: 95, the first fragment prHvLTP2 was amplified using the synthesized gene as a template. Using primers SEQ ID NO: 96 and SEQ ID NO: 97, the second fragment cDsRed was amplified using the synthesized gene as a template. Using primers SEQ ID NO: 98 and SEQ ID NO: 99, the third fragment tPinII was amplified using the synthesized gene as a template. Using primers SEQ ID NO: 100 and SEQ ID NO: 101, the fourth fragment prOsAct1 was amplified using the synthesized gene as a template. Using primers SEQ ID NO: 102 and SEQ ID NO: 103, the fifth fragment cPAT was amplified using the synthesized gene as a template. Using primers SEQ ID NO: 104 and SEQ ID NO: 105, the sixth fragment tNos was amplified using the pCAMBIA2301 vector as a template. Using primers SEQ ID NO: 106 and SEQ ID NO: 107, the seventh fragment pr35S was amplified using the pCAMBIA2301 vector as a template. Using primers SEQ ID NO: 108 and SEQ ID NO: 109, the eighth fragment cPTG-SZ, which is the nucleotide sequence of protoporphyrinogen oxidase designed based on maize preferred codons, was amplified using primers SEQ ID NO: 110 and SEQ ID NO: 111, the ninth fragment t35S was amplified using the synthesized gene as a template. Using primers SEQ ID NO: 112 and SEQ ID NO: 113, the tenth fragment prZmUbi1 was amplified using the synthesized gene as a template. Using primers SEQ ID NO: 114 and SEQ ID NO: 115, the eleventh fragment cPMI was amplified using the synthesized gene as a template. Using primers SEQ ID NO: 116 and SEQ ID NO: 117, the twelfth fragment tNos was amplified using the pCAMBIA2301 vector as a template.

[0209] The twelve PCR amplification fragments were mixed with the linearized DBNBC-01 expression vector backbone for recombination. The procedure was performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct the backbone vector DBNBC-PTG-M containing the cPTG-SZ gene. Its structural diagram is shown in Figure 13 (cSpec: spectinomycin gene; RB: right border; prHvLTP2: barley lipid transfer protein promoter (SEQ ID NO: 128); cDsRed: coral red fluorescent protein gene (SEQ ID NO: 129); tPinII: protease inhibitor II gene terminator (SEQ ID NO: 130); prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: carmine synthase gene terminator (SEQ ID NO: 77). NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); cPTG-SZ: Protoporphyrinogen oxidase gene designed based on maize preferred codons (SEQ ID NO: 132); t35s: Cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: Maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: Carmine synthase gene terminator (SEQ ID NO: 78); LB: Left boundary).

[0210] The recombinant backbone vector DBNBC-PTG-M was transformed into *E. coli* DH5α competent cells using a heat shock method. The heat shock conditions were as follows: 100 μL of *E. coli* DH5α competent cells and 20 μL of recombinant plasmid DNA (backbone vector DBNBC-PTG-M) were gently mixed and then heat-shocked in a 42°C water bath for 30 seconds, followed immediately by placing on ice for 2 min. Then, 250 μL of antibiotic-free LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH adjusted to 7.5 with NaOH, and cultured at 37°C with shaking (200 rpm / min) for 1 hour) was added. The cells were then incubated upside down on LB agar plates containing 50 mg / L spectinomycin at 37°C for 12 hours. Positive colonies were picked and cultured overnight in LB broth containing 50 mg / L spectinomycin at 37°C with shaking (200 rpm / min). Plasmids were extracted using the alkaline lysis method: The bacterial culture was centrifuged at 12000 rpm for 1 min, the supernatant was discarded, and the precipitated bacterial cells were resuspended in 100 μL of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH = 8.0); 200 μL of freshly prepared solution II (0.2 M... Add NaOH and 1% SDS (sodium dodecyl sulfate), invert the tube four times to mix, and place on ice for 3-5 min; add 150 μL of ice-cold Solution III (3M potassium acetate, 5M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at 4℃ and 12000 rpm for 5 min, transfer the supernatant to a new 2 mL centrifuge tube, add 2 volumes of anhydrous ethanol, mix well, and place at room temperature for 5 min; centrifuge at 4℃ and 12000 rpm for 5 min, discard the supernatant, wash the precipitate with 70% ethanol (V / V) and air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH = 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest RNA in a water bath at 37℃ for 30 min; store at -20℃ for later use. The extracted plasmids were sequenced and identified, and the results showed that the backbone vector DBNBC-PTG-M containing the cPTG-SZ gene was successfully constructed.

[0211] 1.2 Synthetic plasmid transport peptide nucleotide sequence

[0212] Plastid transit peptides spAtCLP4 (SEQ ID NO: 37), spAtCLP5 (SEQ ID NO: 38), spAtCLP6 (SEQ ID NO: 39), spAtCLP7 (SEQ ID NO: 40), spAtCLP8 (SEQ ID NO: 41), spAtCLP9 (SEQ ID NO: 42), spAtCLP10 (SEQ ID NO: 43), spAtCLP11 (SEQ ID NO: 44), spAtCLP12 (SEQ ID NO: 45), spAtCLP13 (SEQ ID NO: 46), spAtCLP14 (SEQ ID NO: 47), spAtCLP15 (SEQ ID NO: 48), spAtCLP16 (SEQ ID NO: 49), spPhCTP2 (SEQ ID NO: 50), spAtCTP4 (SEQ ID NO: 51), spAtLTP1 (SEQ ID NO: 52), spAtLTP2 (SEQ ID NO: 53), spAtLTP3 (SEQ ID The nucleotide sequences of spAtLTP4 (SEQ ID NO: 54), spAtLTP5 (SEQ ID NO: 56), spAtLTP6 (SEQ ID NO: 57), spAtLTP7 (SEQ ID NO: 58), spAtLTP12 (SEQ ID NO: 63), spAtLTP13 (SEQ ID NO: 64), spAtLTP15 (SEQ ID NO: 65), spAtLTP17 (SEQ ID NO: 66), spAtLTP18 (SEQ ID NO: 67), and the positive control plasmid transport peptide spAtCLP2 (SEQ ID NO: 79) were all synthesized at GenScript Biotech Ltd. The 5' and 3' ends of the nucleotide sequences of the plasmid transport peptides SEQ ID NO: 37 to SEQ ID NO: 58, SEQ ID NO: 63 to SEQ ID NO: 67, and SEQ ID NO: 79 were respectively ligated to universal adapter primer 2.

[0213] 5' universal adapter primer 2: 5'-ttcatttggagaggacaaagctt-3', as shown in SEQ ID NO: 118 in the sequence listing;

[0214] 3' universal adapter primer 2: 5'-ccgttgggacttgacat-3', as shown in SEQ ID NO: 119 in the sequence listing.

[0215] 1.3 Construct a monocotyledonous expression vector containing a plasmid transport peptide linked to the cPTG-SZ gene.

[0216] The backbone vector DBNBC-PTG-M was linearized using the restriction endonuclease HindIII. The plasmid transport peptide spAtCLP4 (SEQ ID NO: 37) with universal adapter 2 and the positive control plasmid transport peptide spAtCLP2 (SEQ ID NO: 79) were mixed and recombinated with the linearized backbone vector DBNBC-PTG-M fragment, respectively. The operation was performed according to the instructions of the Takara In-Fusion Snap Assembly Master Mix kit (Clontech, CA, JPN, CAT: 638949) to construct the vector DBN137-P containing the plasmid transport peptide spAtCLP4 linked to the cPTG-SZ gene. The structural diagram of the vector DBN137-P is shown in Figure 14 (cSpec: spectinomycin gene; RB: right border; prHvLTP2: barley lipid transfer protein promoter (SEQ ID NO: 128); cDsRed: coral red fluorescent protein gene (SEQ ID NO: 129); tPinII: protease repressor II gene terminator (SEQ ID NO: 130); prOsAct1: rice Act1 gene promoter (SEQ ID NO: 79). NO: 131); cPAT: Phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: Terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: 35S promoter of cauliflower mosaic virus (SEQ ID NO: 73); spAtCLP4 (SEQ ID NO: 37); cPTG-SZ: Protoporphyrinogen oxidase gene optimized by maize codons (SEQ ID NO: 132); t35s: 35S terminator of cauliflower virus (SEQ ID NO: 75); prZmUbi1: Promoter of maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: Terminator of carmine synthase gene (SEQ ID NO: 131); cPAT: Phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: Terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: 35S promoter of cauliflower mosaic virus (SEQ ID NO: 73); spAtCLP4 (SEQ ID NO: 37); cPTG-SZ: Protoporphyrinogen oxidase gene optimized by maize codons (SEQ ID NO: 132); t35s: 35S terminator of cauliflower mosaic virus (SEQ ID NO: 75); prZmUbi1: Promoter of maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: Terminator of carmine synthase gene (SEQ ID NO: 135); NO: 78); LB: left boundary); Construct a positive control vector DBN171-P containing the positive control plasmid transport peptide spAtCLP2 linked to the cPTG-SZ gene. The structural schematic diagram of the positive control vector DBN171-P is shown in Figure 15 (cSpec: spectinomycin gene; RB: right boundary; prHvLTP2: barley lipid transfer protein promoter (SEQ ID NO: 128); cDsRed: coral red fluorescent protein gene (SEQ ID NO: 129); tPinII: protease repressor II gene terminator (SEQ ID NO: 130);prOsAct1: Rice Act1 gene promoter (SEQ ID NO: 131); cPAT: Phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: Terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: Cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); Positive control transport peptide spAtCLP2 (SEQ ID NO: 79); cPTG-SZ: Maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: Cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: Maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: Terminator of carmine synthase gene (SEQ ID NO: 135). NO: 78); LB: Left boundary).

[0217] Following the same method used to construct the recombinant expression vector DBN137-P as described above, the plasmid transport peptides spAtCLP5 (SEQ ID NO: 38), spAtCLP6 (SEQ ID NO: 39), spAtCLP7 (SEQ ID NO: 40), spAtCLP8 (SEQ ID NO: 41), spAtCLP9 (SEQ ID NO: 42), spAtCLP10 (SEQ ID NO: 43), spAtCLP11 (SEQ ID NO: 44), spAtCLP12 (SEQ ID NO: 45), spAtCLP13 (SEQ ID NO: 46), spAtCLP14 (SEQ ID NO: 47), spAtCLP15 (SEQ ID NO: 48), spAtCLP16 (SEQ ID NO: 49), spPhCTP2 (SEQ ID NO: 50), spAtCTP4 (SEQ ID NO: 51), spAtLTP1 (SEQ ID NO: 52), spAtLTP2 (SEQ ID NO: 53), and spAtLTP3 (SEQ ID NO: 54) were transported to the recombinant expression vector DBN137-P. The nucleotide sequence of spAtLTP4 (SEQ ID NO: 54), spAtLTP5 (SEQ ID NO: 55), spAtLTP6 (SEQ ID NO: 57), spAtLTP7 (SEQ ID NO: 58), spAtLTP12 (SEQ ID NO: 63), spAtLTP13 (SEQ ID NO: 64), spAtLTP15 (SEQ ID NO: 65), spAtLTP17 (SEQ ID NO: 66), or spAtLTP18 (SEQ ID NO: 67) is replaced by the plasmid transport peptide spAtCLP4 (SEQ ID NO: 57).The nucleotide sequence of NO: 37 was used to construct 26 other recombinant expression vectors: DBN138-P (containing plasmid transport peptide spAtCLP5), DBN139-P (containing plasmid transport peptide spAtCLP6), DBN140-P (containing plasmid transport peptide spAtCLP7), DBN141-P (containing plasmid transport peptide spAtCLP8), DBN142-P (containing plasmid transport peptide spAtCLP9), and DBN143-P (containing plasmid transport peptide spAtCLP9). 10) DBN144-P (containing plasmid transport peptide spAtCLP11), DBN145-P (containing plasmid transport peptide spAtCLP12), DBN146-P (containing plasmid transport peptide spAtCLP13), DBN147-P (containing plasmid transport peptide spAtCLP14), DBN148-P (containing plasmid transport peptide spAtCLP15), DBN149-P (containing plasmid transport peptide spAtCLP16), DBN150-P (containing plasmid transport peptide spAtCLP16), DBN144-P (containing plasmid transport peptide spAtCLP14), DBN148-P (containing plasmid transport peptide spAtCLP15), DBN149-P (containing plasmid transport peptide spAtCLP16), DBN150-P (containing plasmid transport peptide spAtCLP15), DBN149-P (containing plasmid transport peptide spAtCLP16), DBN150-P (containing plasmid transport peptide spAtCLP15), DBN145-P (containing plasmid transport peptide spAtCLP16), DBN145-P (containing plasmid transport peptide spAtCLP15), DBN146 ...47-P (containing plasmid transport peptide spAtCLP14), DBN148-P (containing plasmid transport peptide spAtCLP15), DBN149-P (containing plasmid transport peptide spAtCLP16), DBN150-P (containing plasmid transport peptide spAtCLP15), DBN1 plasmid transport peptides spPhCTP2), DBN151-P (containing plasmid transport peptide spAtCTP4), DBN152-P (containing plasmid transport peptide spAtLTP1), DBN153-P (containing plasmid transport peptide spAtLTP2), DBN154-P (containing plasmid transport peptide spAtLTP3), DBN155-P (containing plasmid transport peptide spAtLTP4), DBN156-P (containing plasmid transport peptide spAtLTP5), DBN157-P The recombinant expression vectors DBN158-P (containing spAtLTP6), DBN159-P (containing spAtLTP12), DBN160-P (containing spAtLTP13), DBN161-P (containing spAtLTP15), DBN162-P (containing spAtLTP17), and DBN163-P (containing spAtLTP18) were used. Sequencing verified that the nucleotide sequences of the plasmid transport peptides contained in the above recombinant expression vectors were correctly inserted.

[0218] 2. Transformation of Agrobacterium tumefaciens using maize recombinant expression vector

[0219] The recombinant expression vectors DBN137-P, DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, and DBN15 were correctly constructed. Genes 7-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, DBN163-P, and the positive control vector DBN171-P were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) using liquid nitrogen. The transformation conditions were: 100 μL Agrobacterium LBA4404, 3 μL plasmid DNA (recombinant expression vector); incubation in liquid nitrogen for 10 min, followed by a 37°C water bath for 10 min; the transformed Agrobacterium... LBA4404 was inoculated into LB tubes and cultured at 28℃ and 200 rpm for 2 hours. The culture was then plated onto LB agar plates containing 50 mg / L rifampicin and 50 mg / L spectinomycin until positive single colonies appeared. Single colonies were picked, cultured, and their plasmids were extracted. Sequencing identification of the extracted plasmids revealed that the recombinant expression vectors DBN137-P, DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, and DBN4404 were the correct vectors. The structures of N144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, DBN163-P, and the positive control vector DBN171-P are completely correct.

[0220] 3. Obtaining transgenic maize plants

[0221] Following the conventional Agrobacterium infection method, aseptically cultured immature embryos of maize variety DBN567 were co-cultured with the aforementioned Agrobacterium. The recombinant expression vector constructed as described in section 1.3 of this example, DBN137-P, contained the following T-DNA: prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: alkaloid synthase gene terminator (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP4 (SEQ ID NO: 37); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 (Ubiquitin 1). 1) Gene promoters (SEQ ID NO: 133); cPMI: phosphoglucono-mannitol isomerase gene (SEQ ID NO: 134); tNos: terminator of carmine synthase gene (SEQ ID NO: 78)); DBN138-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP5 (SEQ ID NO: 38); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 134); NO: 75); prZmUbi1: promoter of the maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78); DBN139-P T-DNA (containing prOsAct1: promoter of the rice Act1 gene (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78); pr35S: promoter of cauliflower mosaic virus 35S (SEQ ID NO: 73); plasmid transport peptide spAtCLP6 (SEQ ID NO: 39);cPTG-SZ: Maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: Maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: Autocarbamate synthase gene terminator (SEQ ID NO: 78)); DBN140-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: Phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: Autocarbamate synthase gene terminator (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 132); t35s: cauliflower mosaic virus 35S promoter (SEQ ID NO: 75 ... NO: 73); plasmid transport peptide spAtCLP7 (SEQ ID NO: 40); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); DBN141-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP8 (SEQ ID NO: 41); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); T-DNA of DBN142-P (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131));cPAT: Phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: Terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: 35S promoter of cauliflower mosaic virus (SEQ ID NO: 73); plasmid transport peptide spAtCLP9 (SEQ ID NO: 42); cPTG-SZ: Protoporphyrinogen oxidase gene optimized with maize codons (SEQ ID NO: 132); t35s: 35S terminator of cauliflower virus (SEQ ID NO: 75); prZmUbi1: Promoter of maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: Terminator of carmine synthase gene (SEQ ID NO: 78); The T-DNA of DBN143-P contains prOsAct1: the promoter of the rice Act1 gene (SEQ ID NO: 131); cPAT: the N-acetyltransferase gene of phosphinic acid (SEQ ID NO: 77); tNos: the terminator of the carmine synthase gene (SEQ ID NO: 78); pr35S: the promoter of cauliflower mosaic virus 35S (SEQ ID NO: 73); plasmid transport peptide spAtCLP10 (SEQ ID NO: 43); cPTG-SZ: the protoporphyrinogen oxidase gene optimized by maize codons (SEQ ID NO: 132); t35s: the terminator of cauliflower virus 35S (SEQ ID NO: 75); prZmUbi1: the promoter of the maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: the mannose phosphate isomerase gene (SEQ ID NO: 78). NO: 134); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78)); T-DNA of DBN144-P (containing prOsAct1: promoter of the rice Act1 gene (SEQ ID NO: 131); cPAT: N-acetyltransferase gene of phosphinic acid (SEQ ID NO: 77); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78); pr35S: promoter of cauliflower mosaic virus 35S (SEQ ID NO: 73); plasmid transport peptide spAtCLP11 (SEQ ID NO: 44); cPTG-SZ: protoporphyrinogen oxidase gene optimized by maize codons (SEQ ID NO: 132); t35s: terminator of cauliflower virus 35S (SEQ ID NO: 75); prZmUbi1: promoter of maize ubiquitin 1 gene (SEQ ID NO: 133);cPMI: mannose phosphate isomerase gene (SEQ ID NO: 134); tNos: terminator of carmine synthase gene (SEQ ID NO: 78)); T-DNA of DBN145-P (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP12 (SEQ ID NO: 45); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 (Ubiquitin 1) 1) Gene promoters (SEQ ID NO: 133); cPMI: phosphoglucono-mannose isomerase gene (SEQ ID NO: 134); tNos: terminator of carmine synthase gene (SEQ ID NO: 78)); DBN146-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP13 (SEQ ID NO: 46); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 134); NO: 75); prZmUbi1: promoter of the maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78)); T-DNA of DBN147-P (containing prOsAct1: promoter of the rice Act1 gene (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78); pr35S: promoter of cauliflower mosaic virus 35S (SEQ ID NO: 73); plasmid transport peptide spAtCLP14 (SEQ ID NO: 47);cPTG-SZ: Maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: Maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: Autocarbamate synthase gene terminator (SEQ ID NO: 78)); DBN148-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: Phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: Autocarbamate synthase gene terminator (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 132); t35s: cauliflower mosaic virus 35S promoter (SEQ ID NO: 75 ... NO: 73); plasmid transport peptide spAtCLP15 (SEQ ID NO: 48); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: phosphoglucono-mannose isomerase gene (SEQ ID NO: 134); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); DBN149-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtCLP16 (SEQ ID NO: 49); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); T-DNA of DBN150-P (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131));cPAT: Phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: Terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: 35S promoter of cauliflower mosaic virus (SEQ ID NO: 73); plasmid transport peptide spPhCTP2 (SEQ ID NO: 50); cPTG-SZ: Protoporphyrinogen oxidase gene optimized with maize codons (SEQ ID NO: 132); t35s: 35S terminator of cauliflower virus (SEQ ID NO: 75); prZmUbi1: Promoter of maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: Terminator of carmine synthase gene (SEQ ID NO: 78); The T-DNA of DBN151-P contains prOsAct1: the promoter of the rice Act1 gene (SEQ ID NO: 131); cPAT: the N-acetyltransferase gene of phosphinic acid (SEQ ID NO: 77); tNos: the terminator of the carmine synthase gene (SEQ ID NO: 78); pr35S: the promoter of cauliflower mosaic virus 35S (SEQ ID NO: 73); plasmid transport peptide spAtCTP4 (SEQ ID NO: 51); cPTG-SZ: the protoporphyrinogen oxidase gene optimized by maize codons (SEQ ID NO: 132); t35s: the terminator of cauliflower virus 35S (SEQ ID NO: 75); prZmUbi1: the promoter of the maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: the mannose phosphate isomerase gene (SEQ ID NO: 78). NO: 134); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78)); T-DNA of DBN152-P (containing prOsAct1: promoter of the rice Act1 gene (SEQ ID NO: 131); cPAT: N-acetyltransferase gene of phosphinic acid (SEQ ID NO: 77); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78); pr35S: promoter of cauliflower mosaic virus 35S (SEQ ID NO: 73); plasmid transport peptide spAtLTP1 (SEQ ID NO: 52); cPTG-SZ: protoporphyrinogen oxidase gene optimized by maize codons (SEQ ID NO: 132); t35s: terminator of cauliflower virus 35S (SEQ ID NO: 75); prZmUbi1: promoter of maize ubiquitin 1 gene (SEQ ID NO: 133);cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); DBN153-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtLTP2 (SEQ ID NO: 53); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 (Ubiquitin 1) 1) Gene promoters (SEQ ID NO: 133); cPMI: phosphoglucono-mannitol isomerase gene (SEQ ID NO: 134); tNos: terminator of carmine synthase gene (SEQ ID NO: 78)); DBN154-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtLTP3 (SEQ ID NO: 54); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 73). NO: 75); prZmUbi1: promoter of the maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78)); T-DNA of DBN155-P (containing prOsAct1: promoter of the rice Act1 gene (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78); pr35S: promoter of cauliflower mosaic virus 35S (SEQ ID NO: 73); plasmid transport peptide spAtLTP4 (SEQ ID NO: 55);cPTG-SZ: Maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: Maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: Autocarbamate synthase gene terminator (SEQ ID NO: 78)); DBN156-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: Phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: Autocarbamate synthase gene terminator (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 132); t35s: cauliflower mosaic virus 35S promoter (SEQ ID NO: 75 ... NO: 73); plasmid transport peptide spAtLTP5 (SEQ ID NO: 56); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); DBN157-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtLTP6 (SEQ ID NO: 57); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 gene promoter (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: carmine synthase gene terminator (SEQ ID NO: 78)); T-DNA of DBN158-P (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131));cPAT: Phosphirin N-acetyltransferase gene (SEQ ID NO: 77); tNos: Terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: 35S promoter of cauliflower mosaic virus (SEQ ID NO: 73); plasmid transport peptide spAtLTP7 (SEQ ID NO: 58); cPTG-SZ: Protoporphyrinogen oxidase gene optimized with maize codons (SEQ ID NO: 132); t35s: 35S terminator of cauliflower virus (SEQ ID NO: 75); prZmUbi1: Promoter of maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: Terminator of carmine synthase gene (SEQ ID NO: 78); The T-DNA of DBN159-P contains prOsAct1: the promoter of the rice Act1 gene (SEQ ID NO: 131); cPAT: the phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: the terminator of the carmine synthase gene (SEQ ID NO: 78); pr35S: the promoter of cauliflower mosaic virus 35S (SEQ ID NO: 73); plasmid transport peptide spAtLTP12 (SEQ ID NO: 63); cPTG-SZ: the protoporphyrinogen oxidase gene optimized by maize codons (SEQ ID NO: 132); t35s: the cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: the promoter of the maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: the phosphoglucono-mannitol isomerase gene (SEQ ID NO: 78). NO: 134); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78)); T-DNA of DBN160-P (containing prOsAct1: promoter of the rice Act1 gene (SEQ ID NO: 131); cPAT: N-acetyltransferase gene of phosphinic acid (SEQ ID NO: 77); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78); pr35S: promoter of cauliflower mosaic virus 35S (SEQ ID NO: 73); plasmid transport peptide spAtLTP13 (SEQ ID NO: 64); cPTG-SZ: protoporphyrinogen oxidase gene optimized by maize codons (SEQ ID NO: 132); t35s: terminator of cauliflower virus 35S (SEQ ID NO: 75); prZmUbi1: promoter of maize ubiquitin 1 gene (SEQ ID NO: 133);cPMI: Phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of carmine synthase gene (SEQ ID NO: 78)); T-DNA of DBN161-P (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtLTP15 (SEQ ID NO: 65); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: maize ubiquitin 1 (Ubiquitin 1) 1) Gene promoters (SEQ ID NO: 133); cPMI: phosphoglucono-mannose isomerase gene (SEQ ID NO: 134); tNos: terminator of carmine synthase gene (SEQ ID NO: 78)); DBN162-P T-DNA (containing prOsAct1: rice Act1 gene promoter (SEQ ID NO: 131); cPAT: phosphinicotin N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of carmine synthase gene (SEQ ID NO: 78); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 73); plasmid transport peptide spAtLTP17 (SEQ ID NO: 66); cPTG-SZ: maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 73). NO: 75); prZmUbi1: promoter of the maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78)); T-DNA of DBN163-P (containing prOsAct1: promoter of the rice Act1 gene (SEQ ID NO: 131); cPAT: phosphinic acid N-acetyltransferase gene (SEQ ID NO: 77); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78); pr35S: promoter of cauliflower mosaic virus 35S (SEQ ID NO: 73); plasmid transport peptide spAtLTP18 (SEQ ID NO: 67);cPTG-SZ: a maize codon-optimized protoporphyrinogen oxidase gene (SEQ ID NO: 132); t35s: cauliflower virus 35S terminator (SEQ ID NO: 75); prZmUbi1: promoter of the maize ubiquitin 1 gene (SEQ ID NO: 133); cPMI: phosphomannose isomerase gene (SEQ ID NO: 134); tNos: terminator of the carmine synthase gene (SEQ ID NO: 78) were respectively transferred into the maize chromosome set, and transgenic maize plants were obtained.

[0222] Agrobacterium-mediated maize transformation, briefly, involves isolating immature embryos from maize and contacting them with an Agrobacterium suspension, wherein Agrobacterium is capable of delivering the T-DNA nucleotide sequence of each vector to at least one cell of one of the embryos (Step 1: Infection Step). In this step, the embryos are preferably immersed in an Agrobacterium suspension (OD660 = 0.4-0.6, infection medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, acetylsuccinone (AS) 40 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH 5.3) to initiate inoculation. The embryos are co-cultured with Agrobacterium for a period of time (3 days) (Step 2: Co-culture Step). Preferably, after the infection step, the immature embryos are cultured on a solid medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetylsuccinone (AS) 100 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8). Following this co-culture phase, a selective "recovery" step may be performed. In the "recovery" step, the recovery medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, plant gel 3 g / L, pH 5.8) contains at least one known antibiotic (cephalosporin) that inhibits the growth of Agrobacterium, without the addition of a selector for plant transformants (step 3: recovery step). Preferably, the immature embryos are cultured on a solid medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the inoculated immature embryos are cultured on a medium containing a selector (mannose) and the growing transformed callus is selected (step 4: selection step). Preferably, the immature embryos are cultured on a screening solid medium containing a selector (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, mannose 12.5 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, plant gel 3 g / L, pH 5.8), resulting in selective growth of transformed cells. Then, the callus regenerates into a plant (step 5: regeneration step), preferably, the callus grown on the medium containing the selector is cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate the plant.

[0223] The selected resistant callus tissues were transferred to the MS differentiation medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, mannose 5 g / L, plant gel 3 g / L, pH 5.8) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the MS rooting medium (MS salt 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, plant gel 3 g / L, pH 5.8) and cultured at 25°C until approximately 10 cm tall. They were then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the seedlings were cultured at 28°C for 16 hours daily, followed by 8 hours at 20°C.

[0224] 4. TaqMan probe-based quantitative PCR method for verifying transgenic plants

[0225] Transgenic maize plants were verified using TaqMan probe-based quantitative real-time PCR. Recombinant expression vectors DBN137-P and DBN1, which were respectively transformed with plasmid transport peptides spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, spAtCLP11, spAtCLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, spAtLTP1, spAtLTP2, spAtLTP3, spAtLTP4, spAtLTP5, spAtLTP6, spAtLTP7, spAtLTP12, spAtLTP13, spAtLTP15, spAtLTP17, and spAtLTP18 and linked to the cPTG-SZ gene, were used. 38-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146 -P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, Transgenic maize plants of the gene types DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, and DBN163-P, as well as transgenic maize plants transformed into the positive control vector DBN171-P containing the positive control plasmid transport peptide spAtCLP2 linked to the cPTG-SZ gene, were analyzed. The copy number of the cPTG-SZ gene was determined by TaqMan probe-based quantitative PCR. Simultaneously, wild-type maize plants of the DBN567 variety were used as negative controls, and analysis was performed using the same method. The experiment was conducted in triplicate, and the average value was used.

[0226] The following primers and probes are used to detect the cPMI gene sequence:

[0227] Primer 3: gctgtaagagcttactgaaaaaattaaca, as shown in SEQ ID NO: 140 in the sequence listing;

[0228] Primer 4: cgatctgcaggtcgacgg, as shown in SEQ ID NO: 141 in the sequence listing;

[0229] Probe 2: tctcttgctaagctgggagctcgatcc, as shown in SEQ ID NO: 142 in the sequence listing.

[0230] By analyzing the experimental results of cPMI gene copy number, it was confirmed that the corresponding sequence had been integrated into the chromosome set of the maize plant being tested, and transgenic maize plants with a single copy of the cPTG-SZ gene were obtained for herbicide tolerance testing.

[0231] 5. Testing the herbicide tolerance of transgenic maize plants

[0232] (1) Detection of herbicide tolerance in transgenic maize T0 generation plants

[0233] The plasmid transport peptides spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, spAtCLP11, spAtCLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, spAtLTP1, spAtLTP2, spAtLTP3, spAtLTP4, spAtLTP5, spAtLTP6, spAtLTP7, and spAtCLP16 were respectively... LTP12, spAtLTP13, spAtLTP15, spAtLTP17, and spAtLTP18 were respectively linked to the recombinant expression vectors DBN137-P, DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, DBN152-P, and DBN153-P of the cPTG-SZ gene. Sixteen transgenic maize plants (T0 generation) from DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, and DBN163-P transgenic maize plants with the positive control vector DBN171-P, and sixteen plants from the negative control wild-type maize variety DBN567 were selected. On the 18th day after sowing, the maize plants were sprayed with three PPO inhibitor herbicides to test their herbicide tolerance. The three PPO inhibitor herbicides and their corresponding spraying concentrations were 2 times the field concentration of ethoxyflufen (360 g ai / ha), 2 times the field concentration of phenylsulfuron (50 g ai / ha), and 2 times the field concentration of propyzoxystrobin (110 g ai / ha).

[0234] Phenotypic behavior was observed after 3DAT herbicide application to assess herbicide tolerance in transgenic maize. Those skilled in the art should know that the degree of herbicide damage to each plant can be evaluated using the average percentage of plant damage (average percentage of plant damage = leaf damage area / total leaf area × 100%), i.e., the herbicide damage level: Level 0 indicates growth status is basically the same as after spraying a blank solvent (water); Level 1 indicates an average percentage of plant damage less than 10%; Level 2 indicates an average percentage of plant damage greater than 10%; and Level 3 indicates an average percentage of plant damage of 100%. The resistance performance of each recombinant expression vector in transformation events was scored using the formula X = [Σ(N×S) / (T×M)] × 100. (X - herbicide damage score, N - number of plants with the same damage level, S - number of herbicide damage grades, T - total number of plants, M - highest herbicide damage grade), resistance was evaluated based on the scores: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), lowly resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Table 7.

[0235] Table 7. Results of the experiment on the tolerance of transgenic maize T0 plants to PPO inhibitor herbicides.

[0236] Table 7 shows that the negative control wild-type maize variety DBN567 was intolerant to ethoxyflufenican, pyrimisulfuron, or propyzoxyl herbicides; the transgenic maize T0 generation plants containing the positive control vector DBN171-P (containing the positive control plasmid transport peptide spAtCLP2) were resistant to 2 times the field concentration of ethoxyflufenican, pyrimisulfuron, and propyzoxyl; and the transgenic maize plants incorporating the plasmid transport peptides spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, spAtCLP11, and spAtCLP2 were resistant to these herbicides. CLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, spAtLTP1, spAtLTP2, spAtLTP3, spAtLTP4, spAtLTP5, spAtLTP6, spAtLTP7, spAtLTP12, spAtLTP13, spAtLTP15, spAtLTP17, and spAtLTP18 are respectively linked to the recombinant expression vectors DBN137-P and DBN2 of the cPTG-SZ gene. N138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149 -P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DB The transgenic maize T0 generation plants of N161-P, DBN162-P, and DBN163-P showed excellent tolerance to 2 times the field concentration of PPO inhibitor herbicides. Among the recombinant expression vectors, 22 vectors showed high or moderate resistance to 2 times the field concentration of ethoxyflufenican, 16 vectors showed high or moderate resistance to 2 times the field concentration of pyrimethanil, and 26 vectors showed high or moderate resistance to 2 times the field concentration of propyzamide. The technical effect of the plasmid transport peptide was better than that of the transgenic maize T0 generation plants transformed with the positive control plasmid transport peptide spAtCLP2.

[0237] (2) Herbicide tolerance test of transgenic maize T1 generation plants

[0238] The plasmid transport peptides spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, spAtCLP11, spAtCLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, and spAtLTP1 were respectively... spAtLTP2, spAtLTP3, spAtLTP4, spAtLTP5, spAtLTP6, spAtLTP7, spAtLTP12, spAtLTP13, spAtLTP15, spAtLTP17, and spAtLTP18 are respectively linked to the recombinant expression vectors DBN137-P, DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN149-P, DBN150-P, DBN151-P, and DBN... Sixteen transgenic maize T1 generation plants (DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, DBN161-P, DBN162-P, and DBN163-P) with their chromosomes inserted into maize, along with sixteen transgenic maize T1 generation plants of the positive control vector DBN171-P and sixteen plants of the negative control wild-type maize variety DBN567, were selected. On the 18th day after sowing, three PPO inhibitor herbicides were sprayed to test the herbicide tolerance of the maize plants. The three PPO inhibitor herbicides and their corresponding spraying concentrations were: 4 times the field concentration of ethoxyflufen (720g). (ai / ha), 4 times the field concentration of benzopyrimethanil (100g ai / ha) and 4 times the field concentration of propyzoxystrobin (220g ai / ha).

[0239] Phenotypic behavior was observed after spraying with 3DAT and 7DAT herbicides to assess herbicide tolerance in transgenic maize. Those skilled in the art should know that the degree of damage to each plant by the herbicide can be evaluated based on the average percentage of plant damage (average percentage of plant damage = leaf damage area / total leaf area × 100%), i.e., the herbicide damage level: Level 0 indicates that the growth status is basically the same as that of the blank solvent (water); Level 1 indicates that the average percentage of plant damage is less than 10%; Level 2 indicates that the average percentage of plant damage is greater than 10%; and Level 3 indicates that the average percentage of plant damage is 100%. The resistance performance of each recombinant expression vector in the transformation event was scored according to the formula X = [Σ(N×S) / (T×M)]×100. (X - herbicide damage score, N - number of plants with the same damage level, S - number of herbicide damage grades, T - total number of plants, M - highest herbicide damage grade), resistance was evaluated based on the scores: highly resistant plants (0-15 points), moderately resistant plants (16-33 points), lowly resistant plants (34-67 points), and non-resistant plants (68-100 points). The experimental results are shown in Table 8.

[0240] Table 8. Results of the experiment on the tolerance of transgenic maize T1 plants to PPO inhibitor herbicides.

[0241] Table 8 shows that the negative control wild-type maize variety DBN567 showed low resistance to 4 times the field concentration of ethoxyflufenican, pyrimisulfuron, or propyzoxystrobin; the transgenic maize T1 generation plants of the positive control vector DBN171-P, containing the positive control plasmid transport peptide spAtCLP2, showed resistance to 4 times the field concentration of ethoxyflufenican, pyrimisulfuron, and propyzoxystrobin; and the transgenic maize plants incorporating plasmid transport peptides spAtCLP4, spAtCLP5, spAtCLP6, spAtCLP7, spAtCLP8, spAtCLP9, spAtCLP10, and spAtCLP11 showed resistance to these herbicides. spAtCLP12, spAtCLP13, spAtCLP14, spAtCLP15, spAtCLP16, spPhCTP2, spAtCTP4, spAtLTP1, spAtLTP2, spAtLTP3, spAtLTP4, spAtLTP5, spAtLTP6, spAtLTP7, spAtLTP12, spAtLTP13, spAtLTP15, spAtLTP17, and spAtLTP18 were respectively linked to the recombinant expression vector DBN137-P of the cPTG-SZ gene. , DBN138-P, DBN139-P, DBN140-P, DBN141-P, DBN142-P, DBN143-P, DBN144-P, DBN145-P, DBN146-P, DBN147-P, DBN148-P, DBN1 49-P, DBN150-P, DBN151-P, DBN152-P, DBN153-P, DBN154-P, DBN155-P, DBN156-P, DBN157-P, DBN158-P, DBN159-P, DBN160-P, The transgenic maize T1 generation plants of DBN161-P, DBN162-P, and DBN163-P showed excellent tolerance to 4 times the field concentration of PPO inhibitor herbicides. Among the recombinant expression vectors, 23 vectors showed high or moderate resistance to 4 times the field concentration of ethoxyflufenican, 24 vectors showed high or moderate resistance to 4 times the field concentration of pyrimethanil, and 26 vectors showed high or moderate resistance to 2 times the field concentration of propyzamide. The technical effect of the plasmid transport peptide is better than that of the transgenic maize T1 generation plants transformed with the positive control plasmid transport peptide spAtCLP2.

[0242] In summary, this invention provides a novel universal plasmid transport peptide that can effectively localize exogenous proteins into plant plasmids, improving localization efficiency, reducing operational complexity, and avoiding adverse effects on plant cells. Specifically, the plasmid transport peptide disclosed in this invention has good versatility and can localize proteins encoded by the protoporphyrinogen oxidase (PPO) gene and proteins encoded by the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, showing broad application prospects in the fields of protein transport and protein localization. Considering the advanced nature of the technical solution of this invention, it has wide applications in plant molecular biology, plasmid biology, and protein transport technology. Therefore, the technical solution of this invention has significant application value in these technical fields. With the increasing global demand for efficient and safe agricultural production, the plasmid transport peptide disclosed in this invention can be widely used in bio-breeding and plant production, for example, to improve the disease resistance and stress resistance of crops and increase agricultural production efficiency.

[0243] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

Claims

1. A plasmid transport peptide, characterized in that... The amino acid sequence of the plasmid transport peptide has at least 90% sequence identity with any of the sequences in SEQ ID NO:1 to SEQ ID NO:

36.

2. The plasmid transport peptide according to claim 1, characterized in that... The amino acid sequence of the plasmid transport peptide includes at least one of SEQ ID NO:1 to SEQ ID NO:

36.

3. A nucleotide sequence, characterized in that... Encoding the plasmid transport peptide as described in claim 1 or 2.

4. The nucleotide sequence according to claim 3, characterized in that... The sequence includes at least one of SEQ ID NO:37 to SEQ ID NO:

72.

5. A composition, characterized in that... The invention comprises the plasmid transport peptide of claim 1 or 2 and at least one polypeptide or protein, wherein the plasmid transport peptide is capable of operatively linking the polypeptide or protein to plant plasmids.

6. The composition according to claim 5, characterized in that... The polypeptide or protein may be exogenous or endogenous.

7. An expression box, characterized in that... The expression cassette comprises the composition of claim 5 or 6 and an expressible promoter operatively connected.

8. The expression box according to claim 7, characterized in that... The promoter is a constitutive promoter, a tissue-specific promoter, or an inducible promoter.

9. The expression box according to claim 7 or 8, characterized in that... The promoters are the cauliflower mosaic virus 35S promoter, the rapeseed eukaryotic elongation factor gene 1α promoter, the Arabidopsis ubiquitin 10 gene promoter, the soybean tsf1 gene promoter, the rice Act1 gene promoter, or the maize ubiquitin 1 gene promoter.

10. An expression vector, characterized in that... The expression box comprising any one of claims 7-9.

11. A plant material, characterized in that... The expression cassette comprises any one of claims 7-9, and the plant material is selected from plant cells, plant tissues, plant tissue cultures, callus cultures, or plant parts.

12. The plant material according to claim 11, characterized in that... The plant materials are selected from corn, soybean, Arabidopsis thaliana, cotton, rapeseed, rice, sorghum, wheat, barley, millet, tobacco, sunflower, sugarcane or oats.

13. A method for targeting and guiding polypeptides or proteins to plant plastids, characterized in that, This includes operatively linking the plasmid transport peptide of claim 1 or 2 to the polypeptide or protein, and introducing the operatively linked composition, expression cassette, or expression vector into plant material.

14. The method for targeting and guiding polypeptides or proteins to plant plastids according to claim 13, characterized in that... The plant plastids are chloroplasts, chromoplasts, leucoplasts, starch morphogens, otoliths, oleoplasts, or proteinoids.

15. A method for producing transgenic plant material, characterized in that, This includes operatively linking the plasmid transport peptide of claim 1 or 2 to the polypeptide or protein, and transforming the linked composition, expression cassette or expression vector into plant cells, thereby regenerating the transformed cells into whole plants.

16. Use of the plasmid transport peptide of claim 1 or 2 for targeting operatively linked polypeptides or proteins to plant plasmids.

17. The use of the plasmid transport peptide according to claim 16 for targeting operably linked polypeptides or proteins to plant plasmids, characterized in that, The plants are selected from corn, soybean, Arabidopsis thaliana, cotton, rapeseed, rice, sorghum, wheat, barley, millet, tobacco, sunflower, sugarcane or oats.

18. The use of the plasmid transport peptide according to claim 16 or 17 for targeting and directing operably linked polypeptides or proteins to plant plasmids, characterized in that, The uses include enhancing plant tolerance to herbicides.

19. The use of the plasmid transport peptide according to claim 18 for targeting operably linked polypeptides or proteins to plant plasmids, characterized in that, The enhancement of plant tolerance to herbicides includes operatively linking the plasmid transport peptide of claim 1 or 2 to the nucleotide sequence of a herbicide tolerance gene and then introducing it into plant material or plants.

20. The use of the plastid transport peptide according to claim 19 for targeting operatively linked polypeptides or proteins to plant plastids, wherein the herbicide tolerance gene is a protoporphyrinogen oxidase gene or a 5-enolpyruvate-shikimate-3-phosphate synthase gene.

21. The use of the plasmid transport peptide according to claim 19 for targeting operatively linked polypeptides or proteins to plant plasmids, wherein the herbicide is a protoporphyrinogen oxidase inhibitor herbicide or a 5-enolpyruvylshikimate-3-phosphate synthase herbicide. Preferably, the protoporphyrinogen oxidase inhibitor herbicide is ethoxyflufenican, phenylsulfuron-methyl, or propyzoxystrobin. Preferably, the 5-enolpyruvylshikimate-3-phosphate synthase herbicide is glyphosate.

22. The use of the plasmid transport peptide according to claim 16 or 17 for targeting and directing operably linked polypeptides or proteins to plant plasmids, characterized in that, The applications include identifying the activity of plastid transport peptides in plants.

23. The use of the plasmid transport peptide according to claim 22 for targeting operably linked polypeptides or proteins to plant plasmids, characterized in that, The identification of the activity of plastosome transport peptides in plants includes operatively linking the plastosome transport peptides of claim 1 or 2 to the nucleotide sequence of a herbicide tolerance gene, introducing the operatively linked sequence into plant material or plants, and detecting the plant's tolerance to herbicides.

24. A method for obtaining plant commodities, plant products, or processed agricultural products, characterized in that, This includes processing the harvest of the plant described in claim 15 to obtain plant commodities, plant products, or processed agricultural products.

Images