Methods related to expansion genomics

The described method expands nucleic acid samples to create a less dense environment for sequencing, addressing the limitations of next-generation genomic analysis by enhancing yield and resolution through fixation, encapsulation, and epitope replacement techniques.

WO2026064457A1PCT designated stage Publication Date: 2026-03-26PRESIDENT & FELLOWS OF HARVARD COLLEGE
View PDF 7 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2025-09-18
Publication Date
2026-03-26

AI Technical Summary

Technical Problem

Next-generation genomic DNA analysis technologies are limited by the sparsity of genomic data and the dense packing of DNA in the cell nucleus, which hinders sequencing and profiling methods.

Method used

A method involving fixation, encapsulation, and expansion of nucleic acid samples using fixative reagents, detergents, and encapsulation solutions, followed by droplet formation and protein digestion to create a less dense environment for sequencing, combined with epitope replacement techniques for antibody-guided approaches.

Benefits of technology

This method provides a 100-fold increase in yield and improves the resolution of genomic analysis by expanding cellular components, allowing for high-resolution single-cell genomics and sequencing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025046889_26032026_PF_FP_ABST
    Figure US2025046889_26032026_PF_FP_ABST
Patent Text Reader

Abstract

Described herein are methods for sequencing a nucleic acid in a sample and / or detecting the location of one or more nucleic acid sequences in a sample, imaging a sample.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No: 002806-000113WOPT METHODS RELATED TO EXPANSION GENOMICS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 119 of U.S. Provisional Application No. 63 / 697,057 filed September 20, 2024 and 63 / 741,577 filed January 3, 2025, the contents of which are incorporated herein by reference in their entireties. GOVERNMENT SUPPORT

[0002] The invention was made with government support under HL151353 awarded by National Institutes of Health (NIH) and under 1764269 awarded by the National Science Foundation (NSF). The government has certain rights in the invention. SEQUENCE LISTING

[0003] The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on September 9, 2025, is named 002806-000113WOPT_SL.xml and is 62,017 bytes in size. TECHNICAL FIELD

[0004] The technology described herein relates to methods for preparing and providing nucleic acid samples for analysis, e.g., by sequencing or detection of target features / sequences. BACKGROUND

[0005] Next-generation analysis of genomic DNA has often lagged behind RNA analysis technologies because of the inherent sparsity of genomic data (with a theoretical maximum of two copies of any DNA locus in diploid cells) and the extreme density of packaged DNA in the cell’s nucleus. For example, approximately 70% of the human genome is present as densely packed heterochromatin which is resistant to next generation technologies such as sequencing adapters or antibody-guided approaches. The enzymatic reactions necessary for next generation sequencing as well as profiling of various genomic modalities are limited in their resolution by spatial occlusion of the large complexes required for their function. SUMMARY

[0006] As described herein, the inventors have developed methods for physically expanding cells while retaining the relative cellular organization and / or performing single-cell genomics on expanded single cells. This expansion creates space around and between cellular components, creating a less dense environment amenable to a variety of sequencing technologies and enzymatically-reliant technologies. In addition, the inventors have developed an “epitope replacement” technique that retains the power of antibody-mediated targeting or guiding approaches, while still permitting protease digestion to reduce 4888-3636-9385.3 1 002806-000113WOPTAttorney Docket No: 002806-000113WOPT cellular and genomic density. As demonstrated in the examples herein, these approaches provide a 100- fold increase in yield over existing technologies.

[0007] In one aspect of any of the embodiments, described herein is a method comprising: a) contacting a sample comprising at least one nucleic acid molecule with: i) a fixative reagent; ii) a detergent; and iii) optionally a reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids; to provide a fixed sample; b) contacting the fixed sample with an encapsulation solution comprising: i) acrylamide; ii) bis-acrylamide; iii) sodium acrylate; iv) sodium chloride; v) TEMED; vi) ammonium persulfate; and vii) optionally 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl (4-Hydroxy-TEMPO); to provide a solution comprising the fixed sample; c) contacting the solution comprising the fixed sample with a carrier oil to provide a droplet comprising the fixed sample; d) contacting the droplet comprising the fixed sample with: i) an emulsion breaking solution comprising at least one deemulsifier; ii) a digestion solution comprising at least one protease; and / or iii) a low positive ion expansion solution; thereby by removing the carrier oil, digesting proteins in the droplet comprising the fixed sample, and expanding the droplet comprising the fixed sample to provide an expanded sample; and e) sequencing one or more nucleic acid sequences in the expanded sample and / or detecting the location of one or more nucleic acid sequences in the expanded sample.

[0008] In one aspect of any of the embodiments, described herein is a method comprising sequencing one or more nucleic acid sequences in an expanded sample and / or detecting the location of one or more nucleic acid sequences in an expanded sample. 4888-3636-9385.3 2 002806-000113WOPTAttorney Docket No: 002806-000113WOPT

[0009] In some embodiments of any of the aspects, the nucleic acid sequence is present in genomic DNA. In some embodiments of any of the aspects, at least one nucleic acid molecule is at least one chromosome.

[0010] In some embodiments of any of the aspects, the fixative reagent is selected from the group consisting of: formaldehyde; paraformaldehyde (PFA); glutaraldehyde (GA); ethylene glycol bis(succinimidyl succinate) (EGS); dimethyl adipimidate (DMA); and discuccinimidyl glutarate (DSG). In some embodiments of any of the aspects, the fixative reagent is formaldehyde.

[0011] In some embodiments of any of the aspects, the detergent is selected from the group consisting of: nonyl phenoxypolyethoxylethanol (NP-40); 2-[4-(2,4,4-trimethylpentan-2-yl)phenoxy]ethanol (Triton X-100); polysorbate 20 (Tween 20), and digitonin. In some embodiments of any of the aspects, the detergent is NP-40.

[0012] In some embodiments of any of the aspects, the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids is selected from the group consisting of: Methacrylic acid N- hydroxysuccinimide ester (MA-NHS); and LabelX. In some embodiments of any of the aspects, the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids is MA-NHS.

[0013] In some embodiments of any of the aspects, contacting the sample comprising the fixed sample comprises contacting at least one cell comprising the at least one nucleic acid molecule. In some embodiments of any of the aspects, at least one droplet formed in step c comprises one cell. In some embodiments of any of the aspects, at least one droplet formed in step c comprises only one cell.

[0014] In some embodiments of any of the aspects, the step of contacting the solution comprising the fixed sample with a carrier oil is performed on a microfluidic device. In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is no greater than 400 µL / minute, no greater than 300 µL / minute, is 150-300 µL / minute, or is 270 µL / minute. In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 100 µL / minute, no greater than 50 µL / minute, is 10-100 µL / minute, or is 25 µL / minute. In some embodiments of any of the aspects, the carrier oil is a fluorinated oil.

[0015] In some embodiments of any of the aspects, the at least one deemulsifier is selected from the group consisting of: chloroform; perfluorooctanol (PFO); and a detergent-free hydrofluoroether (HFE) oil. In some embodiments of any of the aspects, the at least one deemulsifier is PFO.

[0016] In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising less than 2 M of a positive ion. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, and Mg2+. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising less 4888-3636-9385.3 3 002806-000113WOPTAttorney Docket No: 002806-000113WOPT than 2 M of positively-charged detergent molecules. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, Mg2+, and positively-charged detergent molecules. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising phosphate buffered saline (PBS), Tris, and / or water.

[0017] In some embodiments of any of the aspects, the method further comprises contacting the sample comprising at least one nucleic acid molecule, the solution comprising the fixed sample, or the droplet comprising the fixed sample with at least one antibody reagent or aptamer reagent before contacting the droplet comprising the fixed sample with a digestion solution and / or an expansion solution. In some embodiments of any of the aspects, further comprises contacting the sample comprising at least one nucleic acid molecule with at least one antibody reagent or aptamer reagent before contacting the sample comprising at least one nucleic acid molecule with formaldehyde, NP-40, and / or MA-NHS. In some embodiments of any of the aspects, the reagent is an at least one antibody reagent. In some embodiments of any of the aspects, the reagent is an at least one aptamer reagent. In some embodiments of any of the aspects, the at least one antibody reagent or aptamer reagent is specific for a nucleic acid or nucleic acid- associated molecule.

[0018] In some embodiments of any of the aspects, the at least one antibody reagent or aptamer reagent comprises a non-proteinaceous label. In some embodiments of any of the aspects, the non-proteinaceous label is selected from the group consisting of: biotin; fluorescein isothiocyanate (FITC); digoxigenin; and rhodamine. In some embodiments of any of the aspects, the non-proteinaceous label is biotin.

[0019] In some embodiments of any of the aspects, the at least one antibody reagent comprises a primary antibody with a non-proteinaceous label. In some embodiments of any of the aspects, the at least one antibody reagent comprises a) a primary antibody and b) a secondary antibody with a non-proteinaceous label.

[0020] In some embodiments of any of the aspects, the method further comprises contacting the expanded sample with at least one antibody reagent or aptamer reagent specific for the non-proteinaceous label. In some embodiments of any of the aspects, the method further comprises contacting the expanded sample with at least one antibody reagent specific for the non-proteinaceous label. In some embodiments of any of the aspects, the method further comprises contacting the expanded sample with at least one aptamer reagent specific for the non-proteinaceous label. In some embodiments of any of the aspects, the method further comprises contacting the expanded sample with a) at least one primary antibody reagent specific for the non-proteinaceous label and b) at least one secondary antibody specific for the primary antibody reagent specific for the non-proteinaceous label. 4888-3636-9385.3 4 002806-000113WOPTAttorney Docket No: 002806-000113WOPT

[0021] In some embodiments of any of the aspects, the sequencing comprises next-generation sequencing. In some embodiments of any of the aspects, the sequence comprises single-cell sequencing. In some embodiments of any of the aspects, the sequencing comprises the use of a transposase-mediated adapter. In some embodiments of any of the aspects, the sequencing comprises contacting the expanded sample with at least one transposase. In some embodiments of any of the aspects, the sequencing comprises contacting the expanded sample with at least one reagent comprising a transposase conjugated, bound to, or fused with an antibody-binding protein. In some embodiments of any of the aspects, the antibody-binding protein binds to the antibody reagent, the primary antibody, and / or the secondary antibody. In some embodiments of any of the aspects, the antibody-binding protein binds to the secondary antibody. In some embodiments of any of the aspects, the at least one transposase is Tn5. In some embodiments of any of the aspects, the sequencing comprises contacting the expanded sample with pA- Tn5, pG-Tn5, or pAG-Tn5. In some embodiments of any of the aspects, the sequencing comprises contacting the expanded sample with pAG-Tn5. In some embodiments of any of the aspects, the transposase, pA-Tn5, pG-Tn5, or pAG-Tn5 is loaded with next-generation sequencing adapters.

[0022] In some embodiments of any of the aspects, the method further comprises a step of contacting the expanded sample with a visualization agent. In some embodiments of any of the aspects, the visualization agent is selected from the group consisting of: 4′,6-diamidino-2-phenylindole (DAPI); an anthraquinone dye; and a cyanine dye. In some embodiments of any of the aspects, the visualization agent is DAPI.

[0023] In some embodiments of any of the aspects, the sample is enlarged or expanded. In some embodiments of any of the aspects, the sample is enlarged or expanded for high-resolution single-cell genomics. In some embodiments of any of the aspects, multiple samples are enlarged or expanded. In some embodiments of any of the aspects, multiple samples are enlarged or expanded, thereby providing a library of samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Fig.1A depicts a view of gels after polymerization partially expanded in PBS and fully expanded in water. Fig.1B depicts a violin plot showing the diametric expansion of gels in different solutions.

[0025] Fig.2A depicts a schematic showing one embodiment of the Expansion Whole-Genome Sequencing workflow. Fig.2B depicts genomic sequencing tracks showing that coverage across several K562 cells is similar to ENCODE WG-seq data. Fig.2C demonstrates that copy numbers called from Ex- WG-seq in 8 cells closely resemble ENCODE data.

[0026] Fig.3A depicts a schematic illustrating one embodiment of the Expansion CUT&Tag workflow. Fig.3B depicts images of encapsulated K562s with fluorescent streptavidin show specific biotin localization after protein digestion. Fig.3C depicts representative aggregate and single-cell tracks show 4888-3636-9385.3 5 002806-000113WOPTAttorney Docket No: 002806-000113WOPT Expansion CUT&Tag’s specificity compares positively to ENCODE H3K27me3 K562 data. Fig.3D depicts a correlation heatmap showing Ex-WG-seq and Ex-CUT&Tag data can clearly be separated by the epitope used.

[0027] Fig.4 depicts staining of DNA with DAPI and RNA with SYTO RNASelect shows proper localization of RNA throughout the nucleus after encapsulation.

[0028] Figs.5A-5I depicts Expansion In situ Genome Sequencing (ExIGS) workflow. Fig.5A: Workflow for expansion library construction and immunofluorescence. (i) Cell fixation and Tn5 transposition. (ii) Immunostaining and hairpin ligation. (iii) Acrylamide linking and gelation. (iv) Expansion and immunofluorescence. (v) Rolling circle amplification (RCA) and in situ sequencing. UMI, Unique Molecular Identifier; RCA, Rolling Circle Amplification; dNTPs, Deoxyribonucleotide triphosphate. Fig.5B: In situ sequencing-by-synthesis. Up to 21 rounds of sequencing are performed to obtain spatial positions and UMI sequences. Fig.5C: PCR of genomic fragments, followed by ex situ paired-end sequencing to obtain genomic DNA and UMI sequences. Fig.5D: Table of spatially-resolved genomic reads formed through integration of (Fig.5B) and (Fig.5C) (Methods). Fig.5E: Spatially- resolved reads, colored by chromosome, overlaid on maximum intensity projection of in situ sequencing of UMI position 1. Fig.5F: Expansion immunofluorescence of nuclear lamina (LMNA), H3K9me3, and nuclear speckles (SC35). Fig.5G: DNA density stain (Sytox green) of the same nucleus before (top left) and after (bottom right) expansion. Fig.5H: Left, IGS of a PGP1 fibroblast nucleus(20) with ~600 spatially-resolved genomic reads. Right, ExIGS of a skin fibroblast nucleus with ~6,000 spatially- resolved genomic reads. Reads colored by chromosome number. Fig.5I: Top, magnified views of the boxes shown in (Fig.5F) for lamin A / C, H3K9me3, and SC35 (nuclear speckles). ExIGS points are colored by expansion factor–adjusted distance to immunostain. Bottom, plots showing correspondence between immunostain contact frequencies and IMR-90 ATAC-seq for single chromosomes at 500-kb resolution. All images are 3D stacks but are shown as maximum-intensity z projections for visualization purposes. Scale bars denoted as “Ex” in (Fig.5B), (Fig.5E), (Fig.5F), and (Fig.5G) represent observed distances in the expanded sample, and scale bars in (Fig.5H) and (Fig.5I) represent true expansion factor–adjusted distances. Scale bars in Fig.5B, 5E, 5F, and 5G represent the observed distances in the expanded sample, while scale bars in 5H and 5I represent true spatial distances corrected by expansion factor.

[0029] Fig.6 depicts optimization of re-embedding gel composition. Images of secondary re-embedding gels made using different Acry:Bis ratios, visualized with an acrydite-modified fluorescent moiety. Higher acrylamide percentages form more dense gels with smaller pores. It was found that low acrylamide gels (2-2.5%) fail to completely polymerase, and higher acrylamide gels (3-3.5%) have small 4888-3636-9385.3 6 002806-000113WOPTAttorney Docket No: 002806-000113WOPT pore size which disrupt diffusion of enzymes into the gel. It was found that 2.7% acrylamide gels polymerize and retain large enough pores to facilitate enzyme diffusion into the gel.

[0030] Figs.7A-7B demonstrate split barcode design for sequencing-by-synthesis. (Fig.7A) Schematic of the split barcode design used for in situ sequencing-by-synthesis. Including multiple primers and performing a blocking step before each primer “resets” the gradual decay of fluorescent signals caused by signal phasing. (Fig.7B) Workflow for in situ sequencing-by-synthesis using the split barcode design shown in (Fig.7A). Primer hybridization is followed by repeated dNTP incorporation, imaging, and cleavage. Once all of the bases of a primer is read out, free -OH groups are blocked and the process is repeated for each primer.

[0031] Figs.8A-8B depict the correction of sequencing-by-synthesis fluorescence signal. (Fig.8A) Computational correction of spectral bleed-through. For each base and channel, a set of high-confidence DNA amplicons is defined, and fluorescent signal is measured at these locations for all other bases (e.g. we define a set of high-confidence T amplicons and measure the signal at these locations in A, C, and G). These signals are used to calculate a fit that represents the degree of bleed-through between each pair of channels, and are applied to correct the original images. (Fig.8B) Same as (Fig.8A), but for signal phasing. For each base and channel, a set of high-confidence DNA amplicons is defined, and fluorescent signal is measured at these locations in the next base (e.g. a set of high-confidence A amplicons were defined in base 1 and the A signal measured at these locations in base 2). These signals are used to calculate a fit that represents the degree of bleed-through between subsequent bases, and are applied to correct the original images.

[0032] Figs.9A-9D depict registration and identification of 3D amplicon positions. (Fig.9A) Images from each channel of in situ sequencing for base 1 of a skin fibroblast. Each image shows maximum intensity projections in x, y, and z. (Fig.9B) The same images as (Fig.9A), but following Gaussian high- pass filtering. (Fig.9C) The nucleus first shown in (Fig.9A) after registration of base 2 images to base 1 images. (Fig.9D) The same images as (Fig.9B), but with overlaid amplicon locations identified via 3D peak calling.

[0033] Fig.10 depicts expansion immunofluorescence imaging and segmentation. Image stacks showing either expansion immunofluorescence imaging of targeted nuclear proteins (Lamin A / C, H3K9me3, and nuclear speckles) and their segmentation at various 3D slices of an IMR-90 fibroblast. Scale bar in bottom right applies to all images, 5 microns.

[0034] Figs.11A-11B quantification of expansion factor. (Fig.11A) Left, DNA density (SYTOX Green) image montage of IMR-90 cells on a coverslip taken at 20x resolution, prior to expansion. Top right, DNA density image montage of a subset of the same IMR-90 cells in a gel following expansion, with 4888-3636-9385.3 7 002806-000113WOPTAttorney Docket No: 002806-000113WOPT individual fields of view taken at 40x resolution and combined using field xy coordinates. Bottom right, registration of pre- and post- expansion image segmentations. Observed image sizes as marked. (Fig. 11B) Nuclei registration of pre- (bottom left half) and post-expansion (top right half) DNA density images. Scale bars represent observed distances. Sample shown had an expansion factor of approximately 5.

[0035] Fig.12 depicts visualization of chromosome territories in a skin fibroblast. ExIGS genomic reads for each chromosome in a skin fibroblast. Reads from each chromosome were assigned to one of two homologs for all autosomes and chrX (the donor of this cell line was female) based on spatial and genomic position. Colored dots indicate the position of the ExIGS reads on the given chromosome, gray dots represent ExIGS reads from other chromosomes. Black lines trace the 3D path each homolog takes through the nucleus. Shown as a maximum intensity projection in z for visualization. Scale bar in bottom right applies to all images, 5 microns.

[0036] Figs.13A-13B depict a comparison to Hi-C data. (Fig.13A) Left, Contact frequency matrix for chr1 from Hi-C of IMR-90 fibroblasts from GSE63525(92) at 1 Mb resolution with Knight-Ruiz matrix balancing normalization. Middle, Inverse mean spatial distance matrix for chr1 from ExIGS of skin fibroblasts at 1 Mb resolution. Right, comparison of ExIGS mean spatial distance and normalized Hi-C contact frequency. Each point represents a pair of 1 Mb genomic bins from the chromosome shown. (Fig. 13B) Same as (Fig.13A), but for chr5.

[0037] Figs.14A-14C depicts DNA fragment resolution and genomic coverage. (Fig.14A) A histogram showing the genomic fragment sizes of all uniquely aligned ExIGS reads from skin fibroblasts. The peak of the distribution (~100 bp) represents the average per-read genomic resolution of the method. (Fig.14B) Transcription start site (TSS) enrichment for the same reads from (Fig.14A). The absence of a large peak centered on 0 suggests that HCl treatment is effective at minimizing Tn5’s inherent bias towards accessible chromatin. (Fig.14C) Normalized genomic coverage of non-overlapping 500 kb genomic bins of ExIGS reads from skin fibroblasts. Copy number was calculated by dividing by the median coverage and multiplying by 2.96.4% of autosomal bins with more than 10 reads displayed a copy number between 1 and 3. Moderate peaks and valleys likely represent GC bias, points around zero likely fall in low mappability regions. Colors represent bin chromosome.

[0038] Fig.15 depicts quantification of expanded resolution. Top, Quantification of 3D amplicon and nuclear lamina feature width (lamin B) from in situ genome sequencing (IGS) of early mouse embryos. Bottom, Same as top, but for ExIGS of human skin fibroblasts (Lamin A / C). Feature widths were calculated using full width at half maximum measurements. The improvement in resolution is likely greater for lamin than DNA amplicons because the latter is not a diffraction-limited measurement 4888-3636-9385.3 8 002806-000113WOPTAttorney Docket No: 002806-000113WOPT (because amplicons are randomly imaged in 1 of 4 sequencing channels), but may also be due to species (mouse vs. human) or lamin type (Lamin B vs. Lamin A / C) differences.

[0039] Figs.16A-16D depict benchmarking of DNA-protein association, genomic resolution, and coverage. (Fig.16A) Left, Histogram of distance to nuclear boundary for IGS genomic reads. Peaks every ~300 nm likely represent spatial resolution limits in the z dimension. Right, Plots showing correspondence between distance to nuclear exterior and IMR-90 ATAC-seq for chromosome 1 at 500 kb resolution. Correlation value shown is calculated across all genomic bins. (Fig.16B) Same as (Fig.16A), but for distance to lamin A / C for ExIGS genomic reads. (Fig.16C) Plot showing Pearson correlations over all IMR-90 ExIGS reads between distance to nuclear proteins (Lamin A / C and nuclear speckles) and binned ATAC-seq values at 7 different genomic resolutions. (Fig.16D) Plot showing the percentage of bins at 7 different genomic resolutions measured by ExIGS in this study vs. in a comparable study that applied whole-genome DNA FISH to human fibroblasts. DETAILED DESCRIPTION

[0040] The methods described herein can enlarge or expand a sample, e.g., chromosomal sample or a cell comprising at least one chromosome. In some embodiments of any of the aspects, the sample is enlarged or expanded for high-resolution single-cell genomics. In some embodiments of any of the aspects, the sample is enlarged or expanded for high-resolution sequencing, e.g., genomic sequencing. In some embodiments of any of the aspects, multiple samples are enlarged or expanded. In some embodiments of any of the aspects, multiple samples are enlarged or expanded, thereby providing a library of samples, e.g., for sequencing.

[0041] Accordingly, in one aspect of any of the embodiments, described herein is a method comprising sequencing one or more nucleic acid sequences in an expanded sample and / or detecting the location of one or more nucleic acid sequences in an expanded sample. In one aspect of any of the embodiments, described herein is a method comprising sequencing one or more nucleic acid sequences in an expanded sample. In one aspect of any of the embodiments, described herein is a method comprising detecting the location of one or more nucleic acid sequences in an expanded sample.

[0042] As used herein, “expanded” refers to having been made larger or more spread out. An expanded sample’s components can retain their relative positions, while space is created between at least some of the components by moving the components away from at least one expansion reference point, e.g., away from the center of a cell. The sample is therefore not merely enlarged by the addition of material or a discrete void that extends the outer boundary of the sample, but by moving multiple components away 4888-3636-9385.3 9 002806-000113WOPTAttorney Docket No: 002806-000113WOPT from the expansion reference point(s). The degree or rate of expansion can be consistent or inconsistent throughout the sample.

[0043] As used herein, “sample” refers to a material containing at least one nucleic acid molecule. A sample can be a cell, a population of cells, a tissue, a cell culture or portion thereof, an in vitro system comprising at least one nucleic acid molecule, and / or a sample obtained from a subject or a patient. In some embodiments of any of the aspects, the sample is a sample in which individual cells present in the sample are in solution, e.g., any tissue or extracellular matrix has been digested or disrupted such that at least some of the cells are not present in an aggregation of cells. The sample can be pre-treated to provide individual cells in the sample which are in solution. Methods of treating materials to provide cells in solution are well known in the art, e.g., enzymatic digestion and mechanical disruption.

[0044] In some embodiments, the nucleic acid sequence in a sample is a nucleic acid sequence in genomic DNA. In some embodiments, the nucleic acid sequence in a sample is a nucleic acid sequence in or on a chromosome. In some embodiments, the at least one nucleic acid molecule is at least one chromosome.

[0045] Described herein are methods of expanding samples and / or providing expanded samples. To provide or prepare an expanded sample, the sample is fixed, encapsulated, formed into droplets, and expanded. In some embodiments of any of the aspects, to provide or prepare an expanded sample, the sample is fixed, then encapsulated, then formed into droplets, and then expanded.

[0046] In one aspect of any of the embodiments, described herein is a method comprising: a) contacting a sample comprising at least one nucleic acid molecule with: i) a fixative reagent; ii) a detergent; and iii) optionally a reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids; to provide a fixed sample; b) contacting the fixed sample with an encapsulation solution to provide a solution comprising the fixed sample; c) contacting the solution comprising the fixed sample with a carrier oil to provide a droplet comprising the fixed sample; d) contacting the droplet comprising the fixed sample with: i) an emulsion breaking solution comprising at least one deemulsifier ii) a digestion solution comprising at least one protease; and / or iii) a low positive ion expansion solution; 4888-3636-9385.3 10 002806-000113WOPTAttorney Docket No: 002806-000113WOPT thereby by removing the carrier oil, digesting proteins in the droplet comprising the fixed sample, and expanding the droplet comprising the fixed sample to provide an expanded sample.

[0047] In one aspect of any of the embodiments, described herein is a method comprising: a) contacting a sample comprising at least one nucleic acid molecule with: i) a fixative reagent; ii) a detergent; and iii) optionally a reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids; to provide a fixed sample; b) contacting the fixed sample with an encapsulation solution to provide a solution comprising the fixed sample; c) contacting the solution comprising the fixed sample with a carrier oil to provide a droplet comprising the fixed sample; d) contacting the droplet comprising the fixed sample with: i) an emulsion breaking solution comprising at least one deemulsifier ii) a digestion solution comprising at least one protease; and / or iii) a low positive ion expansion solution; thereby by removing the carrier oil, digesting proteins in the droplet comprising the fixed sample, and expanding the droplet comprising the fixed sample to provide an expanded sample; and e) sequencing one or more nucleic acid sequences in the expanded sample and / or detecting the location of one or more nucleic acid sequences in the expanded sample.

[0048] In one aspect of any of the embodiments, described herein is a method comprising: a) contacting a sample comprising at least one nucleic acid molecule with: i) a fixative reagent; ii) a detergent; and iii) optionally a reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids; to provide a fixed sample; b) contacting the fixed sample with an encapsulation solution to provide a solution comprising the fixed sample; 4888-3636-9385.3 11 002806-000113WOPTAttorney Docket No: 002806-000113WOPT c) contacting the solution comprising the fixed sample with a carrier oil to provide a droplet comprising the fixed sample; d) contacting the droplet comprising the fixed sample with: i) an emulsion breaking solution comprising at least one deemulsifier ii) a digestion solution comprising at least one protease; and / or iii) a low positive ion expansion solution; thereby by removing the carrier oil, digesting proteins in the droplet comprising the fixed sample, and expanding the droplet comprising the fixed sample to provide an expanded sample; and e) sequencing one or more nucleic acid sequences in the expanded sample.

[0049] In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the fixative reagent and the detergent simultaneously.

[0050] In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the fixative reagent and the detergent sequentially. In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the fixative reagent and then the detergent. In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the detergent and then the fixative reagent.

[0051] In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with a reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids. In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is not contacted with a reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids.

[0052] In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the fixative reagent, the detergent, and the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids simultaneously.

[0053] In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the fixative reagent, the detergent, and the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids sequentially.

[0054] In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the fixative reagent, then the detergent, and then the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids. In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the 4888-3636-9385.3 12 002806-000113WOPTAttorney Docket No: 002806-000113WOPT fixative reagent, then the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids, and then the detergent.

[0055] In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the detergent, then the fixative reagent, and then the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids. In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the detergent, then the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids, and then the fixative reagent.

[0056] In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids, then the detergent, and then the fixative reagent. In some embodiments of any of the aspects, in step a), the sample comprising at least one nucleic acid molecule is contacted with the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids, then the fixative reagent, and then the detergent.

[0057] As used herein, “fixative reagent” refers to a reagent that causes biomolecules to be fixed or made stationary relative to each other. In some embodiments of any of the aspects, a fixative reagent can be a cross-linking fixative reagent, e.g., that forms cross-links with and / or between the biomolecules. Fixative reagents are known in the art and commercially available. Exemplary, non-limiting examples of cross- linking agents include formaldehyde; paraformaldehyde (PFA); glutaraldehyde (GA); ethylene glycol bis(succinimidyl succinate) (EGS); dimethyl adipimidate (DMA); and discuccinimidyl glutarate (DSG). In some embodiments of any of the aspects, the fixative reagent is formaldehyde. In some embodiments of any of the aspects, the fixative reagent is formaldehyde; paraformaldehyde (PFA); ethylene glycol bis(succinimidyl succinate) (EGS); or discuccinimidyl glutarate (DSG).

[0058] As used herein, a “detergent” is an amphiphilic surfactant. Detergents are well known in the art and are commercially available. Non-limiting examples of detergents include nonyl phenoxypolyethoxylethanol (NP-40); 2-[4-(2,4,4-trimethylpentan-2-yl)phenoxy]ethanol (Triton X-100); polysorbate 20 (Tween 20), and digitonin. In some embodiments of any of the aspects, the detergent is NP-40.

[0059] Reagents that introduce an acrylic or methacrylic moiety to peptides and / or nucleic acids are known in the art and are commercially available. Non-limiting examples of such reagents include methacrylic acid N-hydroxysuccinimide ester (MA-NHS) and LabelX (see, e.g., Chen et al. Nat Methods 13(8):679-684 (2016) which is incorporated by reference herein in its entirety. In some embodiments of 4888-3636-9385.3 13 002806-000113WOPTAttorney Docket No: 002806-000113WOPT any of the aspects, the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids is MA-NHS.

[0060] Once the sample is fixed, it is contacted with an encapsulation solution. The encapsulation solution is a solution that can form an expandable gel, e.g., after polymerization and / or hydration. Such expandable gel compositions are known in the art and include expandable hydrogels. For example, acrylamide and N,N-dimethylacrylamide (DMAA) solutions are suitable encapsulation solutions. Encapsulation solutions can also comprise polymer salts (e.g., sodium acrylate) and / or salts (e.g., NaCl).

[0061] In some embodiments of any of the aspects, encapsulation solution comprises acrylamide; bis- acrylamide; sodium acrylate; sodium chloride; tetramethylethylenediamine (TEMED); ammonium persulfate; and / or 4-Hydroxy-TEMPO (4-Hydroxy-2,2,6,6-tetramethylpiperidine 1-oxyl) (4HT). In some embodiments of any of the aspects, encapsulation solution comprises acrylamide; bis-acrylamide; sodium acrylate; sodium chloride; tetramethylethylenediamine (TEMED); ammonium persulfate; and 4-Hydroxy- TEMPO (4-Hydroxy-2,2,6,6-tetramethylpiperidine 1-oxyl) (4HT). In some embodiments of any of the aspects, encapsulation solution comprises acrylamide; bis-acrylamide; sodium acrylate; sodium chloride; tetramethylethylenediamine (TEMED); and / or ammonium persulfate. In some embodiments of any of the aspects, encapsulation solution comprises acrylamide; bis-acrylamide; sodium acrylate; sodium chloride; tetramethylethylenediamine (TEMED); and ammonium persulfate. In some embodiments of any of the aspects, encapsulation solution consists of acrylamide; bis-acrylamide; sodium acrylate; sodium chloride; tetramethylethylenediamine (TEMED); and ammonium persulfate. In some embodiments of any of the aspects, encapsulation solution consists of acrylamide; bis-acrylamide; sodium acrylate; sodium chloride; tetramethylethylenediamine (TEMED); ammonium persulfate; and 4HT.

[0062] Once the sample is fixed and in solution in an encapsulation solution, it is contacted with a carrier oil to form at least one droplet comprising the fixed sample. In some embodiments of any of the aspects, the at least one nucleic acid molecule is present in a cell, and contacting the sample comprising the fixed sample comprises contacting at least one cell comprising the at least one nucleic acid molecule.

[0063] In embodiments relating to cells comprising the at least one nucleic acid molecule, the droplet formation can result in each droplet formed comprising no more than one cell. In embodiments relating to cells comprising the at least one nucleic acid molecule, the droplet formation can result in at least 90% of the droplets formed comprising no more than one cell. In embodiments relating to cells comprising the at least one nucleic acid molecule, the droplet formation can result in at least 95% of the droplets formed comprising no more than one cell. In embodiments relating to cells comprising the at least one nucleic acid molecule, the droplet formation can result in at least 98% of the droplets formed comprising no more 4888-3636-9385.3 14 002806-000113WOPTAttorney Docket No: 002806-000113WOPT than one cell. In embodiments relating to cells comprising the at least one nucleic acid molecule, the droplet formation can result in at least 99% of the droplets formed comprising no more than one cell.

[0064] Providing droplets with no more than one cell in each droplet can include the generation of droplets with no cells, e.g., many of the droplets formed will not comprise a cell. In embodiments relating to cells comprising the at least one nucleic acid molecule, the droplet formation can result in at least one droplet formed comprising only one cell. In some embodiments, the droplets not comprising cells can be removed, e.g., by gating mechanisms in a sorting device.

[0065] As used herein, “carrier oil” refers to an oil that can form an emulsion with droplets of an aqueous solution, e.g., the encapsulation solution. Carrier oils are known in the art and commercially available, e.g., Bio-Rad’s (Hercules, CA) QX-200™ droplet generation oil #1864005. Many carrier oils are optimized for use with specific droplet generators, e.g., Bio-Rad’s (Hercules, CA) QX-200™ droplet generation oil #1864005. In some embodiments of any of the aspects, the carrier oil is a fluorinated oil. In some embodiments of any of the aspects, the carrier oil is a droplet generation oil.

[0066] Contacting the solution comprising the fixed sample with a carrier oil can be performed with either the solution comprising the fixed sample and / or the carrier oil under flow during the contacting. Droplet generators are commercially available, e.g., Bio-Rad’s (Hercules, CA) QX-200™ droplet generator.

[0067] In some embodiments of any of the aspects, the step of contacting the solution comprising the fixed sample with a carrier oil is performed on a microfluidic device.

[0068] In some embodiments of any of the aspects, the step of contacting the solution comprising the fixed sample with a carrier oil is performed on a microfluidic device, with the carrier oil under flow. In some embodiments of any of the aspects, the step of contacting the solution comprising the fixed sample with a carrier oil is performed on a microfluidic device, with the solution comprising the fixed sample under flow. In some embodiments of any of the aspects, the step of contacting the solution comprising the fixed sample with a carrier oil is performed on a microfluidic device, with the solution comprising the fixed sample and the carrier oil both under flow.

[0069] In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is no greater than 1,000 µL / minute. In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is no greater than 500 µL / minute. In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is no greater than 400 µL / minute. In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is no greater than 300 µL / minute. In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is no greater than 200 µL / minute. 4888-3636-9385.3 15 002806-000113WOPTAttorney Docket No: 002806-000113WOPT

[0070] In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is 50-500 µL / minute. In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is 100-400 µL / minute. In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is 150-300 µL / minute. In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is about 270 µL / minute. In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is 270 µL / minute + 10%. In some embodiments of any of the aspects, the carrier oil flow rate on the microfluidic device is 270 µL / minute.

[0071] In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 400 µL / minute. In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 300 µL / minute. In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 200 µL / minute. In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 100 µL / minute. In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 50 µL / minute.

[0072] In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is 1-500 µL / minute. In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is 5-200 µL / minute. In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is 10-100 µL / minute. In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is about 25 µL / minute. In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is 25 µL / minute + 10%. In some embodiments of any of the aspects, the solution comprising the fixed sample’s flow rate on the microfluidic device is 25 µL / minute.

[0073] Once the droplets comprising the fixed sample are formed, the carrier oil can be removed, proteins in the droplet comprising the fixed sample and / or in the fixed sample can be digested, and / or the droplet comprising the fixed sample and / or the fixed sample can be expanded to provide an expanded sample. These processes can be performed simultaneously or sequentially.

[0074] In some embodiments of the any of the aspects, the droplet comprising the fixed sample is contacted with: i) an emulsion breaking solution comprising at least one deemulsifier; ii) a digestion solution comprising at least one protease; and / or iii) a low positive ion expansion solution. 4888-3636-9385.3 16 002806-000113WOPTAttorney Docket No: 002806-000113WOPT In some embodiments of the any of the aspects the droplet comprising the fixed sample is contacted with: i) an emulsion breaking solution comprising at least one deemulsifier; ii) a digestion solution comprising at least one protease; and iii) a low positive ion expansion solution. In some embodiments of the any of the aspects the droplet comprising the fixed sample is contacted simultaneously with: i) an emulsion breaking solution comprising at least one deemulsifier; ii) a digestion solution comprising at least one protease; and iii) a low positive ion expansion solution.

[0075] In some embodiments of the any of the aspects, the droplet comprising the fixed sample is contacted with an emulsion breaking solution comprising at least one deemulsifier; then with a digestion solution comprising at least one protease; and then with a low positive ion expansion solution. In some embodiments of the any of the aspects, the droplet comprising the fixed sample is contacted with an emulsion breaking solution comprising at least one deemulsifier; then with a low positive ion expansion solution; and then with a digestion solution comprising at least one protease. In some embodiments of the any of the aspects, the droplet comprising the fixed sample is contacted with a digestion solution comprising at least one protease; then with an emulsion breaking solution comprising at least one deemulsifier; and then with a low positive ion expansion solution. In some embodiments of the any of the aspects, the droplet comprising the fixed sample is contacted with a digestion solution comprising at least one protease; then with a low positive ion expansion solution; and then with an emulsion breaking solution comprising at least one deemulsifier. In some embodiments of the any of the aspects, the droplet comprising the fixed sample is contacted with a low positive ion expansion solution; then with an emulsion breaking solution comprising at least one deemulsifier; and then with a digestion solution comprising at least one protease. In some embodiments of the any of the aspects, the droplet comprising the fixed sample is contacted with a low positive ion expansion solution; then with a digestion solution comprising at least one protease; and then with an emulsion breaking solution comprising at least one deemulsifier.

[0076] Contacting with an emulsion breaking solution comprising at least one deemulsifier destabilizes the emulsion formed by the carrier oil and the droplets comprising the fixed solution, thereby removing the carrier oil. As used herein, “deemulsifier” refers to a reagent that destabilizes an emulsion, i.e., separates the oil and water phases of an emulsion. In some embodiments of any of the aspects, the deemulsifier is an organic solvent. Deemulsifiers are known in the art and are commercially available. 4888-3636-9385.3 17 002806-000113WOPTAttorney Docket No: 002806-000113WOPT Exemplary non-limiting deemulsifiers include chloroform; perfluorooctanol (PFO); and detergent-free hydrofluoroether (HFE) oils. In some embodiments of any of the aspects, the deemulsifier is PFO.

[0077] Contacting with a digestion solution comprising at least one protease digests and / or degrades the proteins present in the fixed sample. This digestion can improve access to the nucleic acid molecules present in the sample, permitting later sequencing and / or detection steps. Proteases are well known in the art and commercially available. The protease can be a serine protease, cysteine protease, threonine protease, aspartic protease, glutamic protease, or metalloprotease. Exemplary non-limiting proteases include pepsin, trypsin, pancreatin, endoproteasinase, alpha-chymotrypsin, carboxypeptidase, papin, elastase, thermolysin, cathepsin, caspase, and cystatin.

[0078] Contacting with a low positive ion expansion solution expands the droplet comprising the fixed sample to provide an expanded sample, e.g., by expanding the encapsulation solution. A low positive ion expansion solution comprises less than 2M of any positive ion, e.g., any alkaline earth metal ion and / or positively-charged detergent molecules.

[0079] In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising less than 2 M of a positive ion. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, and Mg2+, collectively. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising less than 2 M of positively-charged detergent molecules. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising less than 2 M each of Na+, Li+, Ca2+, Mg2+, and positively-charged detergent molecules. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, Mg2+, and positively- charged detergent molecules (e.g., collectively).

[0080] In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising phosphate buffered saline (PBS), Tris, and / or water. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising phosphate buffered saline (PBS). In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising buffer-free water.

[0081] In some embodiments of any of the aspects, the method comprises sequencing one or more nucleic acid sequences in the expanded sample. In some embodiments of any of the aspects, the method comprises detecting the location of one or more nucleic acid sequences in the expanded sample. In some embodiments of any of the aspects, the method comprises sequencing one or more nucleic acid sequences in the expanded sample and detecting the location of one or more nucleic acid sequences in the expanded sample. 4888-3636-9385.3 18 002806-000113WOPTAttorney Docket No: 002806-000113WOPT

[0082] Sequencing methods and reagents are well known in the art. Briefly, a sample obtained from a subject can be contacted with one or more primers which specifically hybridize to a single-strand nucleic acid sequence flanking the target gene sequence and a complementary strand is synthesized. In some next-generation technologies, an adaptor (double or single-stranded) is ligated to nucleic acid molecules in the sample and synthesis proceeds from the adaptor or adaptor compatible primers. In some third- generation technologies, the sequence can be determined, e.g. by determining the location and pattern of the hybridization of probes, or measuring one or more characteristics of a single molecule as it passes through a sensor (e.g. the modulation of an electrical field as a nucleic acid molecule passes through a nanopore). Exemplary methods of sequencing include, but are not limited to, Sanger sequencing, dideoxy chain termination, high-throughput sequencing, next generation sequencing, 454 sequencing, SOLiD sequencing, polony sequencing, Illumina sequencing, Ion Torrent sequencing, sequencing by hybridization, nanopore sequencing, Helioscope sequencing, single molecule real time sequencing, RNAP sequencing, long read sequencing, and the like. Methods and protocols for performing these sequencing methods are known in the art, see, e.g. “Next Generation Genome Sequencing” Ed. Michal Janitz, Wiley- VCH; “High-Throughput Next Generation Sequencing” Eds. Kwon and Ricke, Humanna Press, 2011; and Sambrook et al., Molecular Cloning: A Laboratory Manual (4 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012); which are incorporated by reference herein in their entireties.

[0083] Nucleic acid sequences of genomic targets are generally known for many species, e.g., those with completed genomes such as human and mouse. Accordingly, a skilled artisan can design an appropriate primer based on the known sequence of a nucleic acid sequence of interest. Alternatively, adaptor-based sequencing can be used, which does not require primers specific to a genomic sequence.

[0084] In some embodiments of any of the aspects, the sequencing comprises next-generation sequencing. In some embodiments of any of the aspects, the sequencing comprises single-cell sequencing.

[0085] In some embodiments of any of the aspects, the sequencing and / or detecting can comprise targeting an adaptor (and therefore the sequencing) to specific locations by tagging or marking specific locations or sequences with an antibody reagent or aptamer reagent, which permits directing adaptors or other sequencing reagents to those specific locations or sequences.

[0086] Accordingly, in some embodiments of any of the aspects, the method can further comprise contacting the sample comprising at least one nucleic acid molecule, the solution comprising the fixed sample, or the droplet comprising the fixed sample with at least one antibody reagent or aptamer reagent before contacting the droplet comprising the fixed sample with a digestion solution and / or an expansion solution. In some embodiments of any of the aspects, the method can further comprise contacting the 4888-3636-9385.3 19 002806-000113WOPTAttorney Docket No: 002806-000113WOPT sample comprising at least one nucleic acid molecule, the solution comprising the fixed sample, or the droplet comprising the fixed sample with at least one antibody reagent or aptamer reagent before contacting the droplet comprising the fixed sample with a digestion solution. In some embodiments of any of the aspects, the method can further comprise contacting the sample comprising at least one nucleic acid molecule with at least one antibody reagent or aptamer reagent before contacting the sample comprising at least one nucleic acid molecule with a fixative reagent. In some embodiments of any of the aspects, the method can further comprise contacting the sample comprising at least one nucleic acid molecule with at least one antibody reagent or aptamer reagent before contacting the sample comprising at least one nucleic acid molecule with a detergent. In some embodiments of any of the aspects, the method can further comprise contacting the sample comprising at least one nucleic acid molecule with at least one antibody reagent or aptamer reagent before contacting the sample comprising at least one nucleic acid molecule with a reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids. In some embodiments of any of the aspects, the method can further comprise contacting the sample comprising at least one nucleic acid molecule with at least one antibody reagent or aptamer reagent before contacting the sample comprising at least one nucleic acid molecule with a fixative reagent, a detergent, or a reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids. In some embodiments of any of the aspects, the method can further comprise contacting the sample comprising at least one nucleic acid molecule with at least one antibody reagent or aptamer reagent before contacting the sample comprising at least one nucleic acid molecule with formaldehyde, NP-40, and / or MA-NHS. In any of the foregoing, in some embodiments the reagent is an at least one antibody reagent. In any of the foregoing, in some embodiments the reagent is an at least one aptamer reagent.

[0087] In some embodiments of any of the aspects, the at least one antibody reagent or aptamer reagent is specific for a nucleic acid (e.g., a particular nucleic acid sequence) or a nucleic acid-associated molecule. This permits antibody-guided analysis, e.g., antibody-guided adaptor ligation for next generation sequencing approaches, permitting sequencing of a particular nucleic acid sequence of interest, or to nucleic acid sequences in proximity to a particular nucleic acid-associated molecule of interest. Nucleic acid-associated molecules can include transcription factors, ribosomes, chaperones, histones, DNA repair proteins, and the like. Antibody reagents specific for such targets are known in the art and commercially available. For example, as of November 32023, the AbCam antibody catalog offers 8,574 antibody reagents in their “Epigenetics and Nuclear Signaling” section, including, e.g., 178 antibody reagents specific for Histone H3 and 67 antibody reagents specific for Histone H4. In some embodiments of any of the aspects, the at least one antibody reagent is specific for a nucleic acid (e.g., a particular 4888-3636-9385.3 20 002806-000113WOPTAttorney Docket No: 002806-000113WOPT nucleic acid sequence). In some embodiments of any of the aspects, the at least one antibody reagent or aptamer reagent is specific for a nucleic acid-associated molecule.

[0088] In some embodiments of any of the aspects, the at least one nucleic acid molecule is contacted with the at least one antibody reagent prior to the proteinase treatment. This ensures that the antibody reagent is removed before sequencing / detecting, allowing optimal access to the nucleic acid molecule itself during sequencing / detecting. To permit the antibody-guiding to function after the antibody is digested, the antibody reagent can comprise a non-proteinaceous label. This permits the antibody reagent to bind specifically to its target (e.g., the nucleic acid sequence or nucleic acid-associated molecule) and then the non-proteinaceous label will remain in close physical proximity to the target after the proteinase treatment. This approach is referred to as “epitope replacement” herein. Non-proteinaceous labels are known in the art and commercially available as free label molecules, or as part of labelled antibody reagents. Exemplary non-limiting non-proteinaceous labels include biotin; fluorescent dyes (e.g., ALEXA FLUOR dyes); oligonucleotides; nanoparticles (e.g., latex nanoparticles, gold nanoparticles, or fluorescent nanoparticles); metal ions; fluorescein isothiocyanate (FITC); digoxigenin; and rhodamine and derivatives (e.g., Texas red and tetrarhodimine isothiocynate (TRITC)). In some embodiments of any of the aspects, the non-proteinaceous label is biotin. In some embodiments of any of the aspects, the non- proteinaceous label is FITC.

[0089] The at least one antibody reagent can comprise a single antibody reagent that is directly labelled, or a pair of primary antibody reagent and secondary antibody reagent where the secondary antibody reagent is labeled. The use of paired primary and secondary antibody reagents is well known in the art and permits the ready use of a number of non-customized / labelled primary antibody reagents. In some embodiments of any of the aspects, the at least one antibody reagent comprises a primary antibody with a non-proteinaceous label. In some embodiments of any of the aspects, the at least one antibody reagent comprises a) a primary antibody and b) a secondary antibody with a non-proteinaceous label. The primary antibody reagent is specific for specific for a nucleic acid (e.g., a particular nucleic acid sequence) or a nucleic acid-associated molecule and the secondary antibody reagent is specific for the primary antibody reagent. Secondary antibodies are well known in the art and commercially available, and include, for example antibodies specific for a particular species’ Ig molecules (e.g., anti-mouse Ig antibodies or anti-rabbit Ig antibodies).

[0090] After the proteinase treatment and expansion of the sample, epitope replacement can then comprise contacting the expanded sample with at least one antibody reagent specific for the non- proteinaceous label. Antibody reagents specific for non-proteinaceous labels are known in the art and 4888-3636-9385.3 21 002806-000113WOPTAttorney Docket No: 002806-000113WOPT commercially available. By way of non-limiting example, the following antibody reagents are available from AbCam (Cambridge, UK): Anti-biotin antibodies BTN / 2032R Cat. No.ab234284 Hyb-8 Cat. No. ab201341 39-15D9 Cat. No. ab3780 3E6 Cat. No. ab36406 Anti-FITC F4 / 1 Cat. No. ab112511 9 Cat. No. ab116639 2A3 Cat. No. ab10257 7F4 Cat. No. ab116449 In some embodiments of any of the aspects, the expanded sample can be contacted with a) at least one primary antibody reagent specific for the non-proteinaceous label and b) at least one secondary antibody specific for the primary antibody reagent specific for the non-proteinaceous label.

[0091] Transposes have been applied to a variety of nucleic acid analysis techniques, e.g., next- generation sequencing. The ability of a transpose to insert DNA into a target nucleic acid molecule permits the use of transposase-mediated insertion of adaptor or barcode sequences into, e.g., genomic DNA. Transposases can insert nucleic acid sequences (e.g., adapters) on a random basis, permitting introduction of adapters with any sequence bias and allowing next generation sequencing with universal primer sets and without prior knowledge of the nucleic acid sequence that is to be sequenced. An example of this technology is NEXTERA™ sequencing (Illumina San Diego, CA). In some embodiments of any of the aspects, the sequencing comprises the use of a transposase-mediated adapter, e.g., a known nucleic acid molecule inserted by a transpose. Such transposase-mediated adapters can comprise outer end sequences recognized by the transpose to be used. Such transpose-mediated technologies are known in the art. See, e.g., Li et al. Int. J. Mol Sci 21(21):8329 (2020), which is incorporated by reference in its entirety herein, for further discussion.

[0092] In some embodiments of any of the aspects, the sequencing comprises contacting the expanded sample with at least one transposase.

[0093] Transpose-mediated insertion, e.g., of an adapter, can be targeted instead of random by conjugating the transposase to a protein or aptamer that specifically binds a desired target. Such proteins and aptamers can be antibody reagents, or proteins that bind specifically to a target of interest (e.g., Protein A which binds specifically to specific histone modifications). 4888-3636-9385.3 22 002806-000113WOPTAttorney Docket No: 002806-000113WOPT

[0094] In some embodiments of any of the aspects, the sequencing comprises contacting the expanded sample with at least one reagent comprising a transposase conjugated, bound to, or fused with an antibody-binding protein. Antibody-binding proteins, e.g., secondary or tertiary antibodies are well known in the art and commercially available. In some embodiments of any of the aspects, the antibody- binding protein binds specifically to an antibody reagent, primary antibody, and / or secondary antibody described herein. In some embodiments of any of the aspects, the antibody-binding protein is specific for the at least one antibody reagent specific for the non-proteinaceous label. In some embodiments of any of the aspects, the antibody-binding protein is specific for the secondary antibody specific for the primary antibody reagent specific for the non-proteinaceous label.

[0095] In some embodiments of any of the aspects, the at least one transposase is Tn5.

[0096] In some embodiments of any of the aspects, the sequencing comprises contacting the expanded sample with pA-Tn5, pG-Tn5, or pAG-Tn5. In some embodiments of any of the aspects, the sequencing comprises contacting the expanded sample with pAG-Tn5.

[0097] In some embodiments of any of the aspects, the transposase, pA-Tn5, pG-Tn5, or pAG-Tn5 is loaded (i.e., bound to and / or complexed with) with one or more next-generation sequencing adapters. Such adapters are well known in the art and are readily selected by one of skill in the art depending on the next-generation sequencing approach desired. Suitable adapters are commercially available from suppliers of next-generation sequencing technologies.

[0098] In some embodiments of any of the aspects, the transposase, pA-Tn5, pG-Tn5, or pAG-Tn5 is in a buffer comprising 10 mM Tris, 1% DMF, and 5 mM MgCl2. In some embodiments of any of the aspects, the transposase, pA-Tn5, pG-Tn5, or pAG-Tn5 is in a buffer consisting of water, 10 mM Tris, 1% DMF, and 5 mM MgCl2.

[0099] In some embodiments of any of the aspects, the method further comprises a step of contacting the expanded sample with a visualization agent. A visualization agent is any reagent that can be optically detected, permitting visualization (directly or by machine) of some aspect of the sample. Such agents are known in the art and include fluorescent and luminescent molecules. In some embodiments of any of the aspects, the visualization agent binds to DNA. In some embodiments of any of the aspects, the visualization agent is a fluorescent dye that binds DNA. Visualization agents are known in the art and include, by way of non-limiting example, 4′,6-diamidino-2-phenylindole (DAPI); anthraquinone dyes (e.g., DRAQ5); and cyanine dyes (e.g., SYTOX™ dyes such as SYTOX™ Green, SYTOX™ Blue, and SYTOX™ Red). In some embodiments of any of the aspects, the visualization agent is DAPI.

[0100] Visualization agents can comprise a detectable label and / or comprise the ability to generate a detectable signal (e.g. by catalyzing reaction converting a compound to a detectable product). 4888-3636-9385.3 23 002806-000113WOPTAttorney Docket No: 002806-000113WOPT Visualization agents can comprise, for example, a light-absorbing dye, or a fluorescent dye. Visualization agent, methods of detecting them, and methods of incorporating them into other reagents (e.g. antibodies and nucleic acid probes) are well known in the art. In some embodiments of any of the aspects, visualization agents can include those that can be detected by spectroscopic, photochemical, biochemical, immunochemical, electromagnetic, radiochemical, or chemical means, such as fluorescence, chemifluoresence, or chemiluminescence, or any other appropriate means.

[0101] In one aspect of any of the embodiments, described herein is a method comprising: a) contacting a sample comprising at least one nucleic acid molecule with: i) a fixative reagent; and ii) an acid; to provide a fixed sample; b) contacting the fixed sample with sequencing adaptors, and optionally transposase, to provide a fixed sample comprising linear nucleic acid fragments; c) contacting the fixed sample comprising nucleic linear acid fragments with at least one hairpin adaptor to provide a fixed sample comprising circularized nucleic acid fragments; d) optionally immunostaining the fixed sample comprising circularized nucleic acid fragments; e) contacting the fixed sample comprising circularized nucleic acid fragments with at least one amino-oligo hook complementary to the at least one hairpin adapter to provide a fixed sample comprising circularized nucleic acid-adapter fragments; f) contacting the fixed sample comprising circularized nucleic acid-adapter fragments with MA-NHS to provide fixed sample comprising fixed sample comprising circularized nucleic acid-methyl acrylate adapter fragments; g) contacting the expanded sample with an encapsulation solution comprising: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate; v) sodium chloride; vi) TEMED; vii) ammonium persulfate; and viii) optionally 4HT; to provide a gel comprising the fixed sample; 4888-3636-9385.3 24 002806-000113WOPTAttorney Docket No: 002806-000113WOPT h) contacting the gel comprising the fixed sample with: i) a digestion solution comprising at least one protease; and / or ii) a low positive ion expansion solution; thereby digesting proteins in the gel comprising the fixed sample, and / or expanding the gel comprising the fixed sample to provide an expanded sample; i) optionally contacting the expanded sample with a re-embedding solution comprising at least one of: acrylamide; APS; and TEMED; to provide a re-embedded expanded sample; j) optionally contacting the re-embedded expanded sample with at least one of EDC and NHS to provide a passivated expanded sample; and and k) at least one of: i) sequencing one or more nucleic acid sequences in the expanded sample (or re- embedded expanded sample or passivated expanded sample) and / or detecting the location of one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) and ii) imaging or detecting the expanded sample (or re-embedded expanded sample or passivated expanded sample).

[0102] In some embodiments of any of the aspects, the nucleic acid sequence is present in genomic DNA. In some embodiments of any of the aspects, the nucleic acid sequence is present in genomic DNA in a cell. In some embodiments of any of the aspects, the at least one nucleic acid molecule is at least one chromosome. In some embodiments of any of the aspects, the sample comprises a chromosome. In some embodiments of any of the aspects, the sample comprises a cell. In some embodiments of any of the aspects, the sample comprises a nucleus.

[0103] In some embodiments of any of the aspects, the fixative reagent is selected from the group consisting of: formaldehyde; paraformaldehyde (PFA); glutaraldehyde (GA); ethylene glycol bis(succinimidyl succinate) (EGS); dimethyl adipimidate (DMA); and discuccinimidyl glutarate (DSG). In some embodiments of any of the aspects, the fixative reagent is paraformaldehyde (PFA).

[0104] The acid can be HCl. In some embodiments of any of the aspects, the acid is HCl at a concentration of 0.01 to 1.0 N. In some embodiments of any of the aspects, the acid is HCl at a 4888-3636-9385.3 25 002806-000113WOPTAttorney Docket No: 002806-000113WOPT concentration of 0.05 to 0.5 N. In some embodiments of any of the aspects, the acid is HCl at a concentration of 0.08 to 1.2 N. In some embodiments of any of the aspects, the acid is HCl at a concentration of 0.1 N + 10%. In some embodiments of any of the aspects, the acid is HCl at a concentration of 0.1 N + 1%. In some embodiments of any of the aspects, the acid is HCl at a concentration of 0.1 N.

[0105] As used herein, a “fixed sample” is a sample in which biomolecules are fixed or stationary relative to each other.

[0106] As used herein “sequencing adaptor” refers to a sequence in a target (transcribed as part of the target or ligated to the target) which can specifically hybridize with a sequencing primer, e.g., a next- generation sequencing primer, to permit amplification of a target. Sequencing adapter sequences for a variety of next-generation sequencing platforms are well known in the art. In some embodiments of any of the aspects, the sequencing adaptors are compatible with Illumina sequencing technology. In some embodiments of any of the aspects, the sequencing adaptors are compatible with loading of a transposase, e.g., Tn5 transposase. A sequencing adaptor is “compatible” with loading of a transposase when it comprises a transposase recognition sequence. Such recognition sequences are known in the art. For example, for Tn5, the recognition sequence is a 19 base pair sequence called a “mosaic end.”

[0107] A transposase functions by first “loading” a nucleic acid molecule of interest, often an oligo comprising a transposase recognition sequence that the transposase binds specifically to. The transposase then binds randomly to the genome and cuts it into fragments. After cutting, the transpoase ligates the loaded oligo to the genome fragments.

[0108] In some embodiments of any of the aspects the step of contacting the fixed sample comprises contacting the fixed sample sequencing adaptors. In some embodiments of any of the aspects the step of contacting the fixed sample comprises contacting the fixed sample sequencing adaptors and a transposase. In some embodiments of any of the aspects, the transposase is Tn5 transposase.

[0109] Contacting a fixed sample with a) sequencing adaptors and / or b) sequencing adaptors and transposase will fragment the nucleic acids in the fixed sample and ligate the ends of the fragments to the sequencing adaptors, providing a fixed sample comprising linear nucleic acid fragments.

[0110] Contacting the fixed sample comprising nucleic linear acid fragments with at least one hairpin adaptor will cause the linear fragments to circularize, as the hairpin adaptor binds to sequencing adaptors on each end of the linear nucleic acid fragments. This provides a fixed sample comprising circularized nucleic acid fragments.

[0111] As used herein, “hairpin adaptor” refers to a molecule that forms a stem-loop structure and can hybridize with the sequencing adaptor. In some embodiments, a hairpin adaptor comprises a double 4888-3636-9385.3 26 002806-000113WOPTAttorney Docket No: 002806-000113WOPT stranded stem, a primer binding site, and a single-stranded region complementary to the sequencing adaptor. In some embodiments of any of the aspects, the hairpin adaptor comprises, from 5’ to 3’, a first stem region, a primer binding site, a second stem region, and a single-stranded region complementary to the sequencing adaptor. In some embodiments of any of the aspects, the hairpin adaptor comprises, from 5’ to 3’, a first stem region, a primer binding site, a barcode region, a second stem region, and a single- stranded region complementary to the sequencing adaptor. In some embodiments of any of the aspects, the hairpin adaptor comprises, from 5’ to 3’, a first stem region, a barcode region, a primer binding site, a second stem region, and a single-stranded region complementary to the sequencing adaptor.

[0112] In some embodiments of any of the aspects, the hairpin adaptor comprises, from 5’ to 3’, a single-stranded region complementary to the transposase adaptor, a first stem region, a primer binding site, and a second stem region. In some embodiments of any of the aspects, the hairpin adaptor comprises, from 5’ to 3’, a single-stranded region complementary to the sequencing adaptor, a first stem region, a primer binding site, a barcode region, and a second stem region. In some embodiments of any of the aspects, the hairpin adaptor comprises, from 5’ to 3’, a single-stranded region complementary to the sequencing adaptor, a first stem region, a barcode region, a primer binding site, and a second stem region.

[0113] In some embodiments of any of the aspects, the first stem region and second stem region form a double-stranded stem structure.

[0114] In some embodiments of any of the aspects, the double-stranded stem is 10-20 bp in length. In some embodiments of any of the aspects, the first stem region is 10-20 nucleotides in length. In some embodiments of any of the aspects, the second region is 10-20 nucleotides in length.

[0115] In some embodiments of any of the aspects, the single-stranded region complementary to the sequencing adaptor is 20-50 nucleotides in length. In some embodiments of any of the aspects, the single- stranded region complementary to the sequencing adaptor is 30-40 nucleotides in length.

[0116] In some embodiments of any of the aspects, the hairpin adaptor comprises a 14bp double- stranded stem, a 33bp single-stranded region complementary to a sequencing adaptor (e.g., Tn5 adapter), and a 22bp split barcode (comprising three 6bp segments and one 4bp segment) where each barcode includes an upstream primer binding site for in situ sequencing.

[0117] In some embodiments of any of the aspects, the hairpin adaptor comprises a 14bp double- stranded stem, a 20bp sequencing primer binding site flanked by 16bp sequences on each side, and a 33bp single-stranded region complementary to a sequencing (e.g., Tn5) adapter.

[0118] In some embodiments of any of the aspects, the hairpin adaptor comprises no more than 100 nucleotides. In some embodiments of any of the aspects, the hairpin adaptor comprises no more than 120 nucleotides. In some embodiments of any of the aspects, the hairpin adaptor comprises no more than 140 4888-3636-9385.3 27 002806-000113WOPTAttorney Docket No: 002806-000113WOPT nucleotides. In some embodiments of any of the aspects, the hairpin adaptor comprises no more than 150 nucleotides. In some embodiments of any of the aspects, the hairpin adaptor comprises no more than 160 nucleotides. In some embodiments of any of the aspects, the hairpin adaptor comprises no more than 180 nucleotides.

[0119] In some embodiments of any of the aspects, the hairpin adaptor comprises no more than 200 nucleotides.

[0120] In some embodiments of any of the aspects, the hairpin adaptor comprises a barcode. As used herein, a “barcode” refers to a short sequence of nucleotides (e.g., fewer than 40, 30, 25, 20, 15, 13, 12, or fewer nucleotides) which is unique to a particular nucleic acid described herein. In some embodiments of any of the aspects, the barcode sequence is unique or distinguishable from at least one other barcode sequence comprised by other nucleic acids in a sample described herein. In some embodiments of any of the aspects, the barcode is part of the upstream primer binding site for in situ sequencing, e.g., it can be part of a sequence complementary to a primer in step k). In some embodiments of any of the aspects, the barcode is a unique molecular identifier barcode.

[0121] In some embodiments of any of the aspects, the barcode can be a split barcode. A standard barcode would be a contiguous sequence. For example a standard 21 base barcode would be a contiguous 21 nucleotides. However, sequencing a 21 base barcode may not exhibit 100% efficiency as the individual molecules may not proceed in complete synchronicity. This can be addressed with a split barcode, where the barcode comprises multiple non-contiguous sequences, e.g. a 4-6 bp sequence after each primer. This permits background to be reset after each primer incorporation and provide more accuracy. In some embodiments of any of the aspects, the barcode can be a split barcode comprising three 6 bp segments and one 4 bp segment.

[0122] In some embodiments of any of the aspects, fixed sample comprising circularized nucleic acid fragments is immunostained. In some embodiments of any of the aspects, fixed sample comprising circularized nucleic acid fragments is not immunostained. Immunostaining refers to the use of an antibody to detect a specific protein in a sample.

[0123] In some embodiments of any of the aspects, immunostaining comprises contacting with one or more antibody reagents comprising a detectable label. In some embodiments of any of the aspects, immunostaining comprises contacting with one or more primary antibody reagents. In some embodiments of any of the aspects, immunostaining comprises contacting with one or more primary antibody reagents comprising a detectable label. In some embodiments of any of the aspects, immunostaining comprises contacting with one or more secondary antibody reagents. In some embodiments of any of the aspects, immunostaining comprises contacting with one or more secondary antibody reagents comprising a 4888-3636-9385.3 28 002806-000113WOPTAttorney Docket No: 002806-000113WOPT detectable label. In some embodiments of any of the aspects, immunostaining comprises contacting with a) one or more primary antibody reagents and b) one or more secondary antibody reagents comprising a detectable label. In some embodiments of any of the aspects, the detectable label is a non-proteinaceous label.

[0124] Contacting the fixed sample comprising circularized nucleic acid fragments with at least one amino-oligo hook complementary to the at least one hairpin adapter will hybridize at least part of a amino-oligo hook and at least a part of a circularized nucleic acid fragment, thereby providing a fixed sample comprising circularized nucleic acid-adapter fragments. As used herein “amino-oligo hook” refers to a nucleic acid comprising at least a) a sequence complementary to at least a portion of a hairpin adapter and an acrydite group. In some embodiments of any of the aspects, the at least one amino-oligo hook comprises an oligonucleotide having a 5’ end and a 3’ end; an amino group at the 3’ end; an acrydite group at the 5’ end; and a region complementary to the hairpin adaptor. In some embodiments of any of the aspects, the at least one amino-oligo hook comprises an oligonucleotide having a 5’ end and a 3’ end; an amino group at the 3’ end; an acrydite group at the 5’ end; and a region complementary the binding site of the first sequencing primer, located immediately preceding the initial 6 bp barcode in the hairpin adaptor.

[0125] In some embodiments of any of the aspects, the at least one amino-oligo hook comprises an oligonucleotide having a 5’ end and a 3’ end; an amino group at the 3’ end; an acrydite group at the 5’ end; and a region complementary to the primer binding site of the hairpin adaptor. In some embodiments of any of the aspects, the at least one amino-oligo hook comprises an oligonucleotide having a 5’ end and a 3’ end; an amino group at the 3’ end; an acrydite group at the 5’ end; and a region complementary to the barcode portion of the hairpin adaptor. In some embodiments of any of the aspects, the amino-oligo hook comprises a 15bp region complementary to a hairpin adaptor, flanked 5’ and 3’ by a 12bp poly-dT linker sequence (SEQ ID NO: 1), with an acrydite moiety at the 5' end and an amino group at the 3' end.

[0126] In some embodiments of any of the aspects, the amino-oligo-hook comprises no more than 40 nucleotides. In some embodiments of any of the aspects, the amino-oligo-hook comprises no more than 50 nucleotides. In some embodiments of any of the aspects, the amino-oligo-hook comprises no more than 60 nucleotides. In some embodiments of any of the aspects, the amino-oligo-hook comprises no more than 100 nucleotides.

[0127] Contacting the fixed sample comprising circularized nucleic acid-adapter fragments with MA- NHS will convert the acrydite group on the amino-oligo-hook to a methyl acrylate and “locks” the nucleic acid to the acrylamide gel polymer during the expansion and / or re-embedding steps, thereby providing a 4888-3636-9385.3 29 002806-000113WOPTAttorney Docket No: 002806-000113WOPT fixed sample comprising fixed sample comprising circularized nucleic acid-methyl acrylate adapter fragments.

[0128] In some embodiments of any of the aspects, the MA-NHS in step f) is present at 1-100 mM. In some embodiments of any of the aspects, the MA-NHS in step f) is present at 2-20 mM. In some embodiments of any of the aspects, the MA-NHS in step f) is present at 5-10 mM. In some embodiments of any of the aspects, the MA-NHS in step f) is present at 1-100 mM in 1xPBS. In some embodiments of any of the aspects, the MA-NHS in step f) is present at 2-20 mM in 1xPBS. In some embodiments of any of the aspects, the MA-NHS in step f) is present at 5-10 mM in 1xPBS.

[0129] Contacting the fixed sample comprising circularized nucleic acid-methyl acrylate adapter fragments with an encapsulation provides a gel comprising the fixed sample.

[0130] In some embodiments of any of the aspects, the encapsulation solution comprises i) N,N- dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate, v) sodium chloride; vii) TEMED; viii) ammonium persulfate; and optionally 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl (4- Hydroxy-TEMPO). In some embodiments of any of the aspects, the encapsulation solution comprises i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate, v) sodium chloride; vii) TEMED; viii) ammonium persulfate; and ix) 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl (4-Hydroxy- TEMPO). In some embodiments of any of the aspects, the encapsulation solution comprises three or more of: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate, v) sodium chloride; vii) TEMED; viii) ammonium persulfate; and ix) 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl (4-Hydroxy-TEMPO). In some embodiments of any of the aspects, the encapsulation solution comprises four or more of: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate, v) sodium chloride; vii) TEMED; viii) ammonium persulfate; and ix) 4-hydroxy-2,2,6,6- tetramethylpiperidin-1-oxyl (4-Hydroxy-TEMPO). In some embodiments of any of the aspects, the encapsulation solution comprises five or more of: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis- acrylamide; iv) sodium acrylate, v) sodium chloride; vii) TEMED; viii) ammonium persulfate; and ix) 4- hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl (4-Hydroxy-TEMPO). In some embodiments of any of the aspects, the encapsulation solution comprises six or more of: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate, v) sodium chloride; vii) TEMED; viii) ammonium persulfate; and ix) 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl (4-Hydroxy-TEMPO). In some embodiments of any of the aspects, the encapsulation solution comprises seven or more of: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate, v) sodium chloride; vii) TEMED; viii) ammonium persulfate; and ix) 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl (4-Hydroxy-TEMPO). In some embodiments of any of the aspects, the encapsulation solution comprises eight or more of: i) N,N- 4888-3636-9385.3 30 002806-000113WOPTAttorney Docket No: 002806-000113WOPT dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate, v) sodium chloride; vii) TEMED; viii) ammonium persulfate; and ix) 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl (4-Hydroxy- TEMPO). In some embodiments of any of the aspects, the encapsulation solution comprises nine or more of: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate, v) sodium chloride; vii) TEMED; viii) ammonium persulfate; and ix) 4-hydroxy-2,2,6,6-tetramethylpiperidin-1-oxyl (4-Hydroxy-TEMPO). In some embodiments of any of the aspects, the encapsulation solution comprises nine or more of: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate, v) sodium chloride; vii) TEMED; and viii) ammonium persulfate.

[0131] Contacting the gel comprising the fixed sample with a digestion solution enzymatically digests proteins present in the sample. As used herein, “digestion solution” refers to a solution comprising at least one protease.

[0132] In some embodiments of any of the aspects, the digestion solution comprises at least one protease. Proteases are known in the art and commercially available. Non-limiting examples of proteases include proteinase K, trypsin, ArgC, LysC, or pepsin. In some embodiments of any of the aspects, the digestion solution comprises proteinase K. In some embodiments of any of the aspects, the digestion solution comprises trypsin. In some embodiments of any of the aspects, the digestion solution comprises pepsin. In some embodiments of any of the aspects, the digestion solution comprises ArgC. In some embodiments of any of the aspects, the digestion solution comprises proteinase LysC.

[0133] In some embodiments of any of the aspects, the digestion solution comprises a) the at least one protease and b) Tris-HCl, b) EDTA, c) guanidine HCl and / or NaCl, and d) Triton X-100. In some embodiments of any of the aspects, the digestion solution comprises a) the at least one protease and b) Tris-HCl, b) EDTA, c) guanidine HCl, and d) Triton X-100. In some embodiments of any of the aspects, the digestion solution comprises a) the at least one protease and b) Tris-HCl, b) EDTA, c) NaCl, and d) Triton X-100. In some embodiments of any of the aspects, the digestion solution comprises a) the at least one protease and b) Tris-HCl, b) EDTA, c) guanidine HCl and NaCl, and d) Triton X-100.

[0134] In some embodiments of any of the aspects, the gel comprising the fixed sample is contacted with a digestion solution and a low positive ion expansion solution. In some embodiments of any of the aspects, the gel comprising the fixed sample is contacted with a digestion solution and a low positive ion expansion solution consecutively. In some embodiments of any of the aspects, the gel comprising the fixed sample is contacted with a digestion solution and a low positive ion expansion solution serially. In some embodiments of any of the aspects, the gel comprising the fixed sample is contacted with a digestion solution. In some embodiments of any of the aspects, the gel comprising the fixed sample is contacted with a low positive ion expansion solution. In some embodiments of any of the aspects, the gel 4888-3636-9385.3 31 002806-000113WOPTAttorney Docket No: 002806-000113WOPT comprising the fixed sample is contacted with a digestion solution and not contacted with a low positive ion expansion solution. In some embodiments of any of the aspects, the gel comprising the fixed sample is contacted with a low positive ion expansion solution and not contacted with a digestion solution.

[0135] Contacting the gel comprising the fixed sample with a low positive ion expansion solution caused the sample to expand.

[0136] In some embodiments of any of the aspects, the low positive ion expansion solution comprises less than 2 M of a positive ion. In some embodiments of any of the aspects, the low positive ion expansion solution comprises less than 2 M of any positive ion. In some embodiments of any of the aspects, the low positive ion expansion solution comprises less than 2 M of each of Na+, Li+, Ca2+, and Mg2+. In some embodiments of any of the aspects, the low positive ion expansion solution comprises less than 2 M of each of Na+, Li+, Ca2+, and Mg2+ collectively.

[0137] In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising phosphate buffered saline (PBS), Tris, and / or water. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising phosphate buffered saline (PBS), Tris, and water. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising phosphate buffered saline (PBS) and water. In some embodiments of any of the aspects, the low positive ion expansion solution is a solution comprising Tris and water.

[0138] Contacting an expanded sample with a re-embedding solution embeds the expanded sample in an acrylamide gel. In some embodiments of any of the aspects, the method comprises contacting the expanded solution with a re-embedding solution. As used herein, “re-embedding solution” refers to a solution which will form an acrylamide gel on at least one side of an expanded sample. In some embodiments of any of the aspects, a re-embedding solution comprises at least one of acrylamide; ammonium persulfate (APS); and tetramethylethylenediamine (TEMED). In some embodiments of any of the aspects, a re-embedding solution comprises acrylamide; ammonium persulfate (APS); and tetramethylethylenediamine (TEMED). In some embodiments of any of the aspects, a re-embedding solution comprises acrylamide. In some embodiments of any of the aspects, a re-embedding solution comprises at least one of ammonium persulfate (APS). In some embodiments of any of the aspects, a re- embedding solution comprises tetramethylethylenediamine (TEMED).

[0139] Contacting the re-embedded expanded sample with EDC and / or NHS will neutralize the charge on the gel polymers due to sodium acrylate, thereby providing a passivated expanded sample. In some embodiments of any of the aspects, the re-embedded expanded sample is contacted with EDC and / or NHS. In some embodiments of any of the aspects, the re-embedded expanded sample is contacted with EDC. In some embodiments of any of the aspects, the re-embedded expanded sample is contacted with 4888-3636-9385.3 32 002806-000113WOPTAttorney Docket No: 002806-000113WOPT NHS. In some embodiments of any of the aspects, the re-embedded expanded sample is contacted with EDC and NHS.

[0140] In some embodiments of any of the aspects the 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) is present at 10-10,000 mM. In some embodiments of any of the aspects the EDC is present at 50- 200 mM. In some embodiments of any of the aspects the EDC is present at 75-125 mM. In some embodiments of any of the aspects the EDC is present at 100 mM + 10% In some embodiments of any of the aspects the EDC is present at 100 mM.

[0141] In some embodiments of any of the aspects the N-Hydroxysuccinimide (NHS) is present at 10- 10,000 mM. In some embodiments of any of the aspects the NHS is present at 50-200 mM. In some embodiments of any of the aspects the NHS is present at 75-125 mM. In some embodiments of any of the aspects the NHS is present at 100 mM + 10%. In some embodiments of any of the aspects the NHS is present at 100 mM.

[0142] In some embodiments of any of the aspects the EDC is present at 100 mM.

[0143] EDC and NHS (100mM each) in slightly acidic MES buffer (pH 6.2) followed by 2M ethanolamine in slightly basic buffer (pH 8.5)

[0144] In some embodiments of any of the aspects, the re-embedded expanded sample is contacted with EDC and NHS and then contacted with ethanolamine. In some embodiments of any of the aspects, the ethanolamine is present at 0.2 M to 20 M. In some embodiments of any of the aspects, the ethanolamine is present at 1 M to 4 M. In some embodiments of any of the aspects, the ethanolamine is present at 2 M + 10%. In some embodiments of any of the aspects, the ethanolamine is present at 2 M.

[0145] In some embodiments of any of the aspects, one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) are sequenced. In some embodiments of any of the aspects, the location of one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) is detected. In some embodiments of any of the aspects, the expanded sample (or re-embedded expanded sample or passivated expanded sample) is imaged or detected.

[0146] In some embodiments of any of the aspects, one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) are sequenced and the location of one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) is detected. In some embodiments of any of the aspects, one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) are sequenced and the expanded sample (or re-embedded expanded sample or passivated expanded sample) is imaged or detected. In some embodiments of any of the aspects, the location of one 4888-3636-9385.3 33 002806-000113WOPTAttorney Docket No: 002806-000113WOPT or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) is detected and the expanded sample (or re-embedded expanded sample or passivated expanded sample) is imaged or detected. In some embodiments of any of the aspects, one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) are sequenced and the location of one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) is detected and the expanded sample (or re-embedded expanded sample or passivated expanded sample) is imaged or detected.

[0147] As used herein, "sequencing" refers to the determination of the exact order of nucleotide bases in a strand of DNA (deoxyribonucleic acid) or RNA (ribonucleic acid) or the exact order of amino acids residues or peptides in a protein. Nucleic acid sequencing can be done using Sanger sequencing, dideoxy chain termination, or next-generation high-throughput sequencing.

[0148] Methods of sequencing a nucleic acid sequence are well known in the art. Briefly, a sample obtained from a subject can be contacted with one or more primers which specifically hybridize to a single-strand nucleic acid sequence flanking the target gene sequence and a complementary strand is synthesized.

[0149] In some embodiments of any of the aspects, the sequencing comprises high-throughput sequencing. In some embodiments of any of the aspects, the sequencing comprises next generation sequencing. In some next-generation technologies, an adaptor (double or single-stranded) is ligated to nucleic acid molecules in the sample and synthesis proceeds from the adaptor or adaptor compatible primers. In some third-generation technologies, the sequence can be determined, e.g. by determining the location and pattern of the hybridization of probes, or measuring one or more characteristics of a single molecule as it passes through a sensor (e.g. the modulation of an electrical field as a nucleic acid molecule passes through a nanopore.

[0150] As used herein “next-generation sequencing” refers to oligonucleotide sequencing technologies that have the capacity to sequence oligonucleotides at speeds and throughputs above those possible with conventional sequencing methods (e.g. Sanger sequencing), due to performing and reading out thousands to millions of sequencing reactions in parallel. Next-generation sequencing includes third and fourth generation sequencing technologies. Non-limiting examples of next-generation sequencing methods / platforms include bridge amplication (Illumina’s MiniSeq, MiSeq, NextSeq, NovaSeq, and HiSeq); Massively Parallel Signature Sequencing (Lynx Therapeutics / Illumina); 454 pyro- sequencing (454 Life Sciences / Roche Diagnostics); solid-phase, reversible dye-terminator sequencing (Solexa / Illumina): SOLiD technology (Applied Biosystems); Ion semiconductor sequencing (ION Torrent); DNA nanoball sequencing (Complete Genomics); small molecule realtime (SMRT (Pacific 4888-3636-9385.3 34 002806-000113WOPTAttorney Docket No: 002806-000113WOPT Biosciences), nanopore-based DNA sequencing (Oxford Nanopore Technologies’ MinION, GridION, and PremethION), and technologies available from Intelligen Bio-systems, and Helicos Biosciences. Next- generation sequencing technologies and the constraints and design parameters of associated sequencing primers are well known in the art (see, e.g. Shendure, et al., “Next-generation DNA sequencing,” Nature, 2008, vol.26, No.10, 1135-1145; Mardis, “The impact of next-generation sequencing technology on genetics,” Trends in Genetics, 2007, vol.24, No.3, pp.133-141; Su, et al., “Next-generation sequencing and its applications in molecular diagnostics” Expert Rev Mol Diagn, 2011, 11(3):333-43; Zhang et al., “The impact of next-generation sequencing on genomics”, J Genet Genomics, 2011, 38(3):95-109; (Nyren, P. et al. Anal Biochem 208: 17175 (1993); Bentley, D. R. Curr Opin Genet Dev 16:545-52 (2006); Strausberg, R. L., et al. Drug Disc Today 13:569-77 (2008); U.S. Pat. No.7,282,337; U.S. Pat. No.7,279,563; U.S. Pat. No.7,226,720; U.S. Pat. No.7,220,549; U.S. Pat. No.7,169,560; U.S. Pat. No. 6,818,395; U.S. Pat. No.6,911,345; US Pub. Nos.2006 / 0252077; 2007 / 0070349; and 20070070349;which are incorporated by reference herein in their entireties).Methods and protocols for performingthese sequencing methods are known in the art, see, e.g. “Next Generation Genome Sequencing” Ed. Michal Janitz, Wiley-VCH; “High-Throughput Next Generation Sequencing” Eds. Kwon and Ricke, Humanna Press, 2011; and Sambrook et al., Molecular Cloning: A Laboratory Manual (4 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012); which are incorporated by reference herein in their entireties.

[0151] In some embodiments of any of the aspects, the method further comprises performing rolling circle amplification before the sequencing step,

[0152] In some embodiments of any of the aspects, the location is the relative spatial position, e.g., relative to at least one other nucleic acid or nucleic acid fragment in the sample. In some embodiments, the location is the location in three-dimensions.

[0153] The term “imaging” as used herein refers to the representation or reproduction of a biomolecule or group of biomolecules e.g., a nucleic acids, by way of a visual representation (i.e., the formation of an image). In some embodiments of any of the aspects, the term imaging as used herein refers to a basic visual representation of part of a cell, for example, in some embodiments, imaging refers molecular imaging of the cell, where relative locations of nucleic acid sequences are provided in a visual representation.

[0154] In some embodiments of any of the aspects, imaging comprises contacting a sample with a visualization agent. A visualization agent is any reagent that can be optically detected, permitting visualization (directly or by machine) of some aspect of the sample. 4888-3636-9385.3 35 002806-000113WOPTAttorney Docket No: 002806-000113WOPT

[0155] In some embodiments of any of the aspects, the imaging comprises super-resolution immunofluorescence imaging. In some embodiments of any of the aspects, the imaging the use of a diffraction-limited microscope.

[0156] In some embodiments of any of the aspects, multiple samples can be subjected to the methods described herein, thereby providing a library of samples. In some embodiments of any of the aspects, the multiple samples are samples from multiple individuals. In some embodiments of any of the aspects, the multiple samples are samples from multiple tissues. In some embodiments of any of the aspects, the multiple samples are samples from multiple conditions, e.g., with and without the presence of a drug. In some embodiments of any of the aspects, the multiple samples are samples from multiple developmental stages. In some embodiments of any of the aspects, the multiple samples are samples from multiple species.

[0157] In one respect, the present invention relates to the herein described compositions, methods, and respective component(s) thereof, as essential to the technology, yet open to the inclusion of unspecified elements, essential or not ("comprising). In some embodiments of any of the aspects, other elements to be included in the description of the composition, method or respective component thereof are limited to those that do not materially affect the basic and novel characteristic(s) of the technology (e.g., the composition, method, or respective component thereof “consists essentially of” the elements described herein). This applies equally to steps within a described method as well as compositions and components therein. In other embodiments of any of the aspects, the compositions, methods, and respective components thereof, described herein are intended to be exclusive of any element not deemed an essential element to the component, composition or method (e.g., the composition, method, or respective component thereof “consists of” the elements described herein). This applies equally to steps within a described method as well as compositions and components therein.

[0158] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail.

[0159] For convenience, certain terms employed herein, in the specification, examples and appended claims are collected here. 4888-3636-9385.3 36 002806-000113WOPTAttorney Docket No: 002806-000113WOPT

[0160] The terms “decrease”, “reduced”, “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount. In some embodiments, “reduce,” “reduction" or “decrease" or “inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more. As used herein, “reduction” or “inhibition” does not encompass a complete inhibition or reduction as compared to a reference level. “Complete inhibition” is a 100% inhibition as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal for an individual without a given disorder.

[0161] The terms “increased”, “increase”, “enhance”, or “activate” are all used herein to mean an increase by a statically significant amount. In some embodiments, the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, a “increase” is a statistically significant increase in such level.

[0162] The term “sample” or “test sample” as used herein denotes a sample taken or isolated from a biological organism or other source of nucleic acids (e.g., cell culture). In some embodiments of any of the aspects, a sample can comprise cells. In some embodiments of any of the aspects, a sample can comprise cells from a subject.

[0163] In some embodiments of any of the aspects, the sample is cells, or tissue, or peripheral blood, or bodily fluid. Exemplary biological samples include, but are not limited to, a biopsy, a tumor sample, biofluid sample; blood; serum; plasma; urine; sperm; mucus; tissue biopsy; organ biopsy; synovial fluid; bile fluid; cerebrospinal fluid; mucosal secretion; effusion; sweat; saliva; and / or tissue sample etc. The term also includes a mixture of the above-mentioned samples. The term “sample” also includes untreated or pretreated (or pre-processed) biological samples. 4888-3636-9385.3 37 002806-000113WOPTAttorney Docket No: 002806-000113WOPT

[0164] The test sample can be obtained by removing a sample from a subject, but can also be accomplished by using a previously isolated sample (e.g. isolated at a prior timepoint and isolated by the same or another person).

[0165] In some embodiments of any of the aspects, the sample can be an untreated test sample. As used herein, the phrase “untreated sample” refers to a sample that has not had any prior sample pre-treatment except for dilution and / or suspension in a solution. Exemplary methods for treating a sample include, but are not limited to, centrifugation, filtration, sonication, homogenization, heating, freezing and thawing, and combinations thereof. In some embodiments of any of the aspects, the sample can be a frozen sample, e.g., a frozen tissue. The frozen sample can be thawed before employing methods, assays and systems described herein. After thawing, a frozen sample can be centrifuged before being subjected to methods, assays and systems described herein. In some embodiments of any of the aspects, the sample is a clarified sample, for example, by centrifugation and collection of a supernatant comprising the clarified sample. In some embodiments of any of the aspects, a sample can be a pre-processed sample, for example, supernatant or filtrate resulting from a treatment selected from the group consisting of centrifugation, filtration, thawing, purification, and any combinations thereof. In some embodiments of any of the aspects, the test sample can be treated with a chemical and / or biological reagent. Chemical and / or biological reagents can be employed to protect and / or maintain the stability of the sample, including biomolecules (e.g., nucleic acid and protein) therein, during processing. One exemplary reagent is a protease inhibitor, which is generally used to protect or maintain the stability of protein during processing. The skilled artisan is well aware of methods and processes appropriate for pre-processing of biological samples required for determination of the level of an expression product as described herein.

[0166] In some embodiments of any of the aspects, the methods, assays, and systems described herein can further comprise a step of obtaining or having obtained a sample from a subject. In some embodiments of any of the aspects, the subject can be a human subject.

[0167] As used herein, the terms “protein" and “polypeptide" are used interchangeably herein to designate a series of amino acid residues, connected to each other by peptide bonds between the alpha- amino and carboxy groups of adjacent residues. The terms "protein", and "polypeptide" refer to a polymer of amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function. "Protein" and “polypeptide” are often used in reference to relatively large polypeptides, whereas the term "peptide" is often used in reference to small polypeptides, but usage of these terms in the art overlaps. The terms "protein" and "polypeptide" are used interchangeably herein when referring to a gene product and fragments thereof. Thus, exemplary 4888-3636-9385.3 38 002806-000113WOPTAttorney Docket No: 002806-000113WOPT polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing.

[0168] As used herein, the term “antibody” refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds an antigen. The term also refers to antibodies comprised of two immunoglobulin heavy chains and two immunoglobulin light chains as well as a variety of forms including full length antibodies and antigen-binding portions thereof; including, for example, an immunoglobulin molecule, a monoclonal antibody, a chimeric antibody, a CDR-grafted antibody, a humanized antibody, a Fab, a Fab’, a F(ab’)2, a Fv, a disulfide linked Fv, a scFv, a single domain antibody (dAb), a diabody, a multispecific antibody, a dual specific antibody, an anti-idiotypic antibody, a bispecific antibody, a functionally active epitope-binding portion thereof, and / or bifunctional hybrid antibodies.

[0169] Each heavy chain is composed of a variable region of said heavy chain (abbreviated here as HCVR or VH) and a constant region of said heavy chain. The heavy chain constant region consists of three domains CH1, CH2 and CH3. Each light chain is composed of a variable region of said light chain (abbreviated here as LCVR or VL) and a constant region of said light chain. The light chain constant region consists of a CL domain. The VH and VL regions may be further divided into hypervariable regions referred to as complementarity-determining regions (CDRs) and interspersed with conserved regions referred to as framework regions (FR). Each VH and VL region thus consists of three CDRs and four FRs which are arranged from the N terminus to the C terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. This structure is well known to those skilled in the art.

[0170] As used herein, the term “CDR” refers to the complementarity determining regions within antibody variable sequences. The exact boundaries of these CDRs have been defined differently according to different systems. CDRs may be defined according to the Kabat system (see Kabat, E. A.et al., 1991, “Sequences of Proteins of Immunological Interest”, 5th edit., NIH Publication no.91-3242, U.S. Department of Health and Human Services). Other systems may be used to define CDRs, which as the system devised by Chothia et al (see Chothia, C. & Lesk, A. M., 1987, “Canonical structures for the hypervariable regions of immunoglobulins”, J. Mol. Biol., 196, 901-917) and the IMGT system (see Lefranc, M. P., 1997, “Unique database numbering system for immunogenetic analysis”, Immunol. Today, 18, 50). An antibody typically contains 3 heavy chain CDRs and 3 light chain CDRs. The term CDR or CDRs is used here to indicate one or several of these regions. A person skilled in the art is able to readily compare the different systems of nomenclature and determine whether a particular sequence may 4888-3636-9385.3 39 002806-000113WOPTAttorney Docket No: 002806-000113WOPT be defined as a CDR. The methods and compositions used herein may utilize CDRs defined according to any of these systems.

[0171] The term “antigen-binding portion” of an antibody refers to one or more portions of an antibody as described herein, said one or more portions still having the binding affinities as defined above herein. Portions of a complete antibody have been shown to be able to carry out the antigen-binding function of an antibody. In accordance with the term “antigen-binding portion” of an antibody, examples of binding portions include (i) an Fab portion, i.e., a monovalent portion composed of the VL, VH, CL and CH1 domains; (ii) an F(ab’)2 portion, i.e., a bivalent portion comprising two Fab portions linked to one another in the hinge region via a disulfide bridge; (iii) an Fd portion composed of the VH and CH1 domains; (iv) an Fv portion composed of the FL and VH domains of a single arm of an antibody; and (v) a dAb portion consisting of a VH domain or of VH, CH1, CH2, DH3, or VH, CH2, CH3 (dAbs, or single domain antibodies, comprising only VL domains have also been shown to specifically bind to target epitopes).

[0172] Although the two domains of the Fv portion, namely VL and VH, are encoded by separate genes, they may further be linked to one another using a synthetic linker and recombinant methods, making it possible to prepare them as a single protein chain in which the VL and VH regions combine in order to form monovalent molecules (known as single chain Fv (ScFv)).

[0173] The term “antigen-binding portion” of an antibody is also intended to comprise such single chain antibodies. Other forms of single chain antibodies such as “diabodies” can also be included. Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker which is too short for the two domains being able to combine on the same chain, thereby forcing said domains to pair with complementary domains of a different chain and to form two antigen-binding sites. An immunoglobulin constant domain refers to a heavy or light chain constant domain. Human IgG heavy chain and light chain constant domain amino acid sequences are known in the art.

[0174] As used herein, the term “antibody reagent” refers to a polypeptide that includes at least one immunoglobulin variable domain or immunoglobulin variable domain sequence and which specifically binds a given antigen. An antibody reagent can comprise an antibody or a polypeptide comprising an antigen-binding domain of an antibody. In some embodiments of any of the aspects, an antibody reagent can comprise a monoclonal antibody or a polypeptide comprising an antigen-binding domain of a monoclonal antibody. For example, an antibody can include a heavy (H) chain variable region (abbreviated herein as VH), and a light (L) chain variable region (abbreviated herein as VL). In another example, an antibody includes two heavy (H) chain variable regions and two light (L) chain variable regions. The term “antibody reagent” encompasses antigen-binding fragments of antibodies (e.g., single 4888-3636-9385.3 40 002806-000113WOPTAttorney Docket No: 002806-000113WOPT chain antibodies, Fab and sFab fragments, F(ab’)2, Fd fragments, Fv fragments, scFv, and domain antibodies (dAb) fragments as well as complete antibodies.

[0175] An antibody can have the structural features of IgA, IgG, IgE, IgD, IgM (as well as subtypes and combinations thereof). Antibodies can be from any source, including mouse, rabbit, pig, rat, and primate (human and non-human primate) and primatized antibodies. Antibodies also include midibodies, humanized antibodies, chimeric antibodies, and the like.

[0176] Furthermore, an antibody reagent as described herein may be part of a larger immunoadhesion molecule formed by covalent or noncovalent association of said antibody or antibody portion with one or more further proteins or peptides. Relevant to such immunoadhesion molecules are the use of the streptavidin core region in order to prepare a tetrameric scFv molecule and the use of a cysteine residue, a marker peptide and a C-terminal polyhistidinyl in order to produce bivalent and biotinylated scFv molecules.

[0177] In some embodiments of any of the aspects, the antibody reagent described herein can be an immunoglobulin molecule, a monoclonal antibody, a chimeric antibody, a CDR-grafted antibody, a humanized antibody, a Fab, a Fab’, a F(ab’)2, a Fv, a disulfide linked Fv, a scFv, a single domain antibody, a diabody, a multispecific antibody, a dual specific antibody, an anti-idiotypic antibody, a bispecific antibody, and a functionally active epitope-binding portion thereof.

[0178] In some embodiments of any of the aspects, one or more of the reagents described herein can comprise a detectable label and / or comprise the ability to generate a detectable signal (e.g. by catalyzing reaction converting a compound to a detectable product). Detectable labels can comprise, for example, a light-absorbing dye, a fluorescent dye, or a radioactive label. Detectable labels, methods of detecting them, and methods of incorporating them into reagents (e.g. antibodies and nucleic acid probes) are well known in the art.

[0179] In some embodiments of any of the aspects, detectable labels can include labels that can be detected by spectroscopic, photochemical, biochemical, immunochemical, electromagnetic, radiochemical, or chemical means, such as fluorescence, chemifluoresence, or chemiluminescence, or any other appropriate means. The detectable labels used in the methods described herein can be primary labels (where the label comprises a moiety that is directly detectable or that produces a directly detectable moiety) or secondary labels (where the detectable label binds to another moiety to produce a detectable signal, e.g., as is common in immunological labeling using secondary and tertiary antibodies). The detectable label can be linked by covalent or non-covalent means to the reagent. Alternatively, a detectable label can be linked such as by directly labeling a molecule that achieves binding to the reagent via a ligand-receptor binding pair arrangement or other such specific recognition 4888-3636-9385.3 41 002806-000113WOPTAttorney Docket No: 002806-000113WOPT molecules. Detectable labels can include, but are not limited to radioisotopes, bioluminescent compounds, chromophores, antibodies, chemiluminescent compounds, fluorescent compounds, metal chelates, and enzymes.

[0180] In other embodiments, the detection reagent is labeled with a fluorescent compound. When the fluorescently labeled reagent is exposed to light of the proper wavelength, its presence can then be detected due to fluorescence. In some embodiments of any of the aspects, a detectable label can be a fluorescent dye molecule, or fluorophore including, but not limited to fluorescein, phycoerythrin, phycocyanin, o-phthaldehyde, fluorescamine, Cy3TM, Cy5TM, allophycocyanine, Texas Red, peridenin chlorophyll, cyanine, tandem conjugates such as phycoerythrin-Cy5TM, green fluorescent protein, rhodamine, fluorescein isothiocyanate (FITC) and Oregon GreenTM, rhodamine and derivatives (e.g., Texas red and tetrarhodimine isothiocynate (TRITC)), biotin, phycoerythrin, AMCA, CyDyesTM, 6- carboxyfhiorescein (commonly known by the abbreviations FAM and F), 6-carboxy-2',4',7',4,7- hexachlorofiuorescein (HEX), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfiuorescein (JOE or J), N,N,N',N'- tetramethyl-6carboxyrhodamine (TAMRA or T), 6-carboxy-X-rhodamine (ROX or R), 5- carboxyrhodamine-6G (R6G5 or G5), 6-carboxyrhodamine-6G (R6G6 or G6), and rhodamine 110; cyanine dyes, e.g. Cy3, Cy5 and Cy7 dyes; coumarins, e.g umbelliferone; benzimide dyes, e.g. Hoechst 33258; phenanthridine dyes, e.g. Texas Red; ethidium dyes; acridine dyes; carbazole dyes; phenoxazine dyes; porphyrin dyes; polymethine dyes, e.g. cyanine dyes such as Cy3, Cy5, etc; BODIPY dyes and quinoline dyes. In some embodiments of any of the aspects, a detectable label can be a radiolabel including, but not limited to3H,125I,35S,14C,32P, and33P. In some embodiments of any of the aspects, a detectable label can be an enzyme including, but not limited to horseradish peroxidase and alkaline phosphatase. An enzymatic label can produce, for example, a chemiluminescent signal, a color signal, or a fluorescent signal. Enzymes contemplated for use to detectably label an antibody reagent include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. In some embodiments of any of the aspects, a detectable label is a chemiluminescent label, including, but not limited to lucigenin, luminol, luciferin, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester. In some embodiments of any of the aspects, a detectable label can be a spectral colorimetric label including, but not limited to colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, and latex) beads. 4888-3636-9385.3 42 002806-000113WOPTAttorney Docket No: 002806-000113WOPT

[0181] In some embodiments of any of the aspects, detection reagents can also be labeled with a detectable tag, such as c-Myc, HA, VSV-G, HSV, FLAG, V5, HIS, or biotin. Other detection systems can also be used, for example, a biotin-streptavidin system. In this system, the antibodies immunoreactive (i. e. specific for) with the biomarker of interest is biotinylated. Quantity of biotinylated antibody bound to the biomarker is determined using a streptavidin-peroxidase conjugate and a chromagenic substrate. Such streptavidin peroxidase detection kits are commercially available, e.g. from DAKO; Carpinteria, CA. A reagent can also be detectably labeled using fluorescence emitting metals such as152Eu, or others of the lanthanide series. These metals can be attached to the reagent using such metal chelating groups as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).

[0182] As used herein, the term “nucleic acid” or “nucleic acid sequence” refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid or an analog thereof. The nucleic acid can be either single-stranded or double-stranded. A single-stranded nucleic acid can be one nucleic acid strand of a denatured double- stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double-stranded DNA. In one aspect, the nucleic acid can be DNA. In another aspect, the nucleic acid can be RNA. Suitable DNA can include, e.g., genomic DNA or cDNA. Suitable RNA can include, e.g., mRNA.

[0183] As used herein, a “portion” or ‘region” of a nucleic acid molecule refers to contiguous set of nucleotides comprised by that molecule. A portion can comprise all or only a subset of the nucleotides comprised by the molecule. A portion can be double-stranded or single-stranded.

[0184] As used herein, the term “complementary” refers to the ability of nucleotides to form hydrogen-bonded base pairs. In some embodiments of any of the aspects, complementary refers to hydrogen-bonded base pair formation preferences between the nucleotide bases G, A, T, C and U, such that when two given polynucleotides or polynucleotide sequences anneal to each other, A pairs with T and G pairs with C in DNA, and G pairs with C and A pairs with U in RNA.

[0185] As used herein, the term “hybridization” refers to the formation of one or more complementary base pairs between two nucleic acids, e.g., two complementary nucleic acids strands or two complementary regions annealing by base pair interactions. In some embodiments, conditions for hybridization may vary based on the length and sequence of the complementary sequences. In some embodiments, conditions for hybridization are based upon a Tm(e.g., a calculated Tm) of the complementary sequences. In some embodiments, the methods described herein can be conducted at a temperature which is lower than the Tm(e.g., a calculated Tm) for the complementary sequences. In some embodiments, a Tmcan be determined using any of a number of algorithms (e.g., OLIGOTM(Molecular Biology Insights Inc. Colorado) primer design software and VENTRO NTI™ (Invitrogen, Inc. California) 4888-3636-9385.3 43 002806-000113WOPTAttorney Docket No: 002806-000113WOPT design software and programs available on the internet, including Primer3, Oligo Calculator, and NetPrimer (Premier Biosoft; Palo Alto, CA; and freely available on the world wide web (e.g., at premierbiosoft.com / netprimer / netprlaunch / Help / xnetprlaunch.html). In some embodiments, the Tmof the complementary sequences can be calculated using following formula, which is used by NetPrimer software and is described in more detail in Frieir et al. PNAS 198683:9373-9377 which is incorporated by reference herein in its entirety. Tm= ΔH / (ΔS + R * ln(C / 4)) + 16.6 log ([K+] / (1 + 0.7 [K+])) - 273.15 wherein, ΔH is enthalpy for helix formation; ΔS is entropy for helix formation; R is molar gas constant (1.987 cal / °C * mol); C is the nucleic acid concentration; and [K+] is salt concentration. In some embodiments, the closer a hybridization temperature is to the Tm, the more specific is the hybridization.

[0186] As used herein, “specific” when used in the context of the hybridization of two complementary nucleic acids refers to a level of complementarity between the two nucleic acids (or regions thereof) such that there exists an annealing temperature at which the first nucleic acid will anneal to the second nucleic acid and will not anneal to non-target sequences present in a sample.

[0187] Primers according to methods and compositions described herein may comprise a hybridization sequence (e.g., a sequence that anneals with a nucleic acid template) that is less than or equal to 300 nucleotides in length, e.g., less than or equal to 300, or 250, or 200, or 150, or 100, or 90, or 80, or 70, or 60, or 50, or 40, or 30 or fewer, or 20 or fewer, or 15 or fewer, but at least 6 nucleotides in length. In some embodiments, a hybridization sequence of a primer may be 6 to 50 nucleotides in length, 6 to 35 nucleotides in length, 6 to 20 nucleotides in length, 10 to 25 nucleotides in length. Any suitable method may be used for synthesizing oligonucleotides and primers. In some embodiments, commercial sources offer oligonucleotide synthesis services suitable for providing primers for use in methods and compositions described herein, e.g. INVITROGEN™ Custom DNA Oligos; Life Technologies; Grand Island, NY or custom DNA Oligos from IDT; Coralville, IA).

[0188] The term "expression" refers to the cellular processes involved in producing RNA and proteins and as appropriate, secreting proteins, including where applicable, but not limited to, for example, transcription, transcript processing, translation and protein folding, modification and processing. Expression can refer to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from a nucleic acid fragment or fragments of the invention and / or to the translation of mRNA into a polypeptide.

[0189] "Expression products" include RNA transcribed from a gene, and polypeptides obtained by translation of mRNA transcribed from a gene. The term "gene" means the nucleic acid sequence which is transcribed (DNA) to RNA in vitro or in vivo when operably linked to appropriate regulatory sequences. 4888-3636-9385.3 44 002806-000113WOPTAttorney Docket No: 002806-000113WOPT The gene may or may not include regions preceding and following the coding region, e.g.5’ untranslated (5’UTR) or "leader" sequences and 3’ UTR or "trailer" sequences, as well as intervening sequences (introns) between individual coding segments (exons).

[0190] As used herein, the term "detecting" or “measuring” refers to observing a signal from, e.g. a probe, label, or target molecule to indicate the presence and / or distribution of an analyte in a sample. Any method known in the art for detecting a particular label moiety can be used for detection. Exemplary detection methods include, but are not limited to, spectroscopic, fluorescent, photochemical, biochemical, immunochemical, electrical, optical or chemical methods. In some embodiments of any of the aspects, measuring can be a quantitative observation.

[0191] As used herein, the term “nanoparticle” refers to particles that are on the order of about 1 to 1,000 nanometers in diameter or width. The term “nanoparticle” includes nanospheres; nanorods; nanoshells; and nanoprisms; these nanoparticles may be part of a nanonetwork.

[0192] As used herein, “contacting" refers to any suitable means for delivering, or exposing, a first substance (e.g., cell, sample, or molecule) to a second substance (e.g., cell, sample, or molecule). Exemplary delivery methods include, but are not limited to, direct delivery to cell culture medium, perfusion, injection, or other delivery method well known to one skilled in the art. In some embodiments, contacting comprises physical human activity, e.g., an injection; an act of dispensing, mixing, and / or decanting; and / or manipulation of a delivery device or machine.

[0193] The term “statistically significant" or “significantly" refers to statistical significance and generally means a two standard deviation (2SD) or greater difference.

[0194] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The term “about” when used in connection with percentages can mean ±1%.

[0195] As used herein, the term “comprising” means that other elements can also be present in addition to the defined elements presented. The use of “comprising” indicates inclusion rather than limitation.

[0196] The term "consisting of" refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.

[0197] As used herein the term "consisting essentially of" refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.

[0198] As used herein, the term “specific binding” refers to a chemical interaction between two molecules, compounds, cells and / or particles wherein the first entity binds to the second, target entity with 4888-3636-9385.3 45 002806-000113WOPTAttorney Docket No: 002806-000113WOPT greater specificity and affinity than it binds to a third entity which is a non-target. In some embodiments, specific binding can refer to an affinity of the first entity for the second target entity which is at least 10 times, at least 50 times, at least 100 times, at least 500 times, at least 1000 times or greater than the affinity for the third nontarget entity. A reagent specific for a given target is one that exhibits specific binding for that target under the conditions of the assay being utilized.

[0199] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "e.g." is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example."

[0200] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0201] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978- 0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), W. W. Norton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring 4888-3636-9385.3 46 002806-000113WOPTAttorney Docket No: 002806-000113WOPT Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties.

[0202] In all embodiments where a sample is obtained or has been obtained or provided, the sample can be sample taken, obtained, or provided via minimally invasive methods and / or involves only a minor intervention. In some embodiments of any of the aspects, a sample is taken, obtained, or provided by one or more of a blood draw or prick, an epidermal or mucus membrane swab, buccal sampling, saliva sample, a epidermal skin sampling technique, and / or collection of a secreted or expelled bodily fluid (e.g., mucus, urine, sweat, etc), fecal sampling, semen / seminal fluid sampling, or clippings (e.g., of hair or nails). In some embodiments of any of the aspects, the sample comprises, consists of, or consists essentially of blood (or any fraction or component thereof), serum, urine, mucus, epithelial cells, saliva, buccal cells, a secreted or expelled bodily fluid, and / or hair or nail clippings.

[0203] Other terms are defined herein within the description of the various aspects of the invention.

[0204] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[0205] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method 4888-3636-9385.3 47 002806-000113WOPTAttorney Docket No: 002806-000113WOPT steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0206] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

[0207] In some embodiments, the present technology may be defined in any of the following numbered paragraphs: 1. A method comprising: a) contacting a sample comprising at least one nucleic acid molecule with: i) a fixative reagent; ii) a detergent; and iii) optionally a reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids; to provide a fixed sample; b) contacting the fixed sample with an encapsulation solution comprising: i) acrylamide; ii) bis-acrylamide; iii) sodium acrylate; iv) sodium chloride; v) TEMED; vi) ammonium persulfate; and vii) optionally 4HT; to provide a solution comprising the fixed sample; 4888-3636-9385.3 48 002806-000113WOPTAttorney Docket No: 002806-000113WOPT c) contacting the solution comprising the fixed sample with a carrier oil to provide a droplet comprising the fixed sample; d) contacting the droplet comprising the fixed sample with: i) an emulsion breaking solution comprising at least one deemulsifier; ii) a digestion solution comprising at least one protease; and / or iii) a low positive ion expansion solution; thereby by removing the carrier oil, digesting proteins in the droplet comprising the fixed sample, and expanding the droplet comprising the fixed sample to provide an expanded sample; and e) sequencing one or more nucleic acid sequences in the expanded sample and / or detecting the location of one or more nucleic acid sequences in the expanded sample. 2. A method comprising sequencing one or more nucleic acid sequences in an expanded sample and / or detecting the location of one or more nucleic acid sequences in an expanded sample. 3. The method of any one of the preceding paragraphs, wherein the nucleic acid sequence is present in genomic DNA. 4. The method of any one of the preceding paragraphs, wherein the at least one nucleic acid molecule is at least one chromosome. 5. The method of any one of the preceding paragraphs, wherein the fixative reagent is selected from the group consisting of: formaldehyde; paraformaldehyde (PFA); glutaraldehyde (GA); ethylene glycol bis(succinimidyl succinate) (EGS); dimethyl adipimidate (DMA); and discuccinimidyl glutarate (DSG). 6. The method of any one of the preceding paragraphs, wherein the fixative reagent is formaldehyde. 7. The method of any one of the preceding paragraphs, wherein the detergent is selected from the group consisting of: nonyl phenoxypolyethoxylethanol (NP-40); 2-[4-(2,4,4-trimethylpentan-2- yl)phenoxy]ethanol (Triton X-100); polysorbate 20 (Tween 20), and digitonin. 8. The method of any one of the preceding paragraphs, wherein the detergent is NP-40. 9. The method of any one of the preceding paragraphs, wherein the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids is selected from the group consisting of: Methacrylic acid N-hydroxysuccinimide ester (MA-NHS); and LabelX. 4888-3636-9385.3 49 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 10. The method of any one of the preceding paragraphs, wherein the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids is MA-NHS. 11. The method of any one of the preceding paragraphs, wherein contacting the sample comprising the fixed sample comprises contacting at least one cell comprising the at least one nucleic acid molecule. 12. The method of paragraph 11, wherein at least one droplet formed in step c comprises one cell. 13. The method of paragraph 11, wherein at least one droplet formed in step c comprises only one cell. 14. The method of any one of the preceding paragraphs, wherein the step of contacting the solution comprising the fixed sample with a carrier oil is performed on a microfluidic device. 15. The method of paragraph 14, wherein the carrier oil flow rate on the microfluidic device is no greater than 400 µL / minute. 16. The method of paragraph 14, wherein the carrier oil flow rate on the microfluidic device is no greater than 300 µL / minute. 17. The method of paragraph 14, wherein the carrier oil flow rate on the microfluidic device is 150- 300 µL / minute. 18. The method of paragraph 14, wherein the carrier oil flow rate on the microfluidic device is 270 µL / minute. 19. The method of paragraph14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 100 µL / minute. 20. The method of paragraph 14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 50 µL / minute. 21. The method of paragraph 14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is 10-100 µL / minute. 22. The method of paragraph 14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is 25 µL / minute. 23. The method of any one of the preceding paragraphs, wherein the carrier oil is a fluorinated oil 24. The method of any one of the preceding paragraphs, wherein the at least one deemulsifier is selected from the group consisting of: Chloroform; perfluorooctanol (PFO); and a detergent-free hydrofluoroether (HFE) oil. 25. The method of any one of the preceding paragraphs, wherein the at least one deemulsifier is PFO. 26. The method of any one of the preceding paragraphs, wherein the low positive ion expansion solution is a solution comprising less than 2 M of a positive ion. 4888-3636-9385.3 50 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 27. The method of any one of the preceding paragraphs, wherein the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, and Mg2+. 28. The method of any one of the preceding paragraphs, wherein the low positive ion expansion solution is a solution comprising less than 2 M of positively-charged detergent molecules. 29. The method of any one of the preceding paragraphs, wherein the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, Mg2+, and positively-charged detergent molecules. 30. The method of any one of the preceding paragraphs, wherein the low positive ion expansion solution is a solution comprising phosphate buffered saline (PBS), Tris, and / or water. 31. The method of any one of the preceding paragraphs, further comprising contacting the sample comprising at least one nucleic acid molecule, the solution comprising the fixed sample, or the droplet comprising the fixed sample with at least one antibody reagent before contacting the droplet comprising the fixed sample with a digestion solution and / or an expansion solution. 32. The method of any one of the preceding paragraphs, further comprising contacting the sample comprising at least one nucleic acid molecule with at least one antibody reagent or aptamer reagent before contacting the sample comprising at least one nucleic acid molecule with formaldehyde, NP-40, and / or MA-NHS. 33. The method of paragraph 31 or 32, wherein the at least one antibody reagent or aptamer reagent is specific for a nucleic acid or nucleic acid-associated molecule. 34. The method of any one of paragraphs 31-33, wherein the at least one antibody reagent or aptamer reagent comprises a non-proteinaceous label. 35. The method of paragraph 34, wherein the non-proteinaceous label is selected from the group consisting of: biotin; fluorescein isothiocyanate (FITC); digoxigenin; and rhodamine. 36. The method of paragraph 34, wherein the non-proteinaceous label is biotin. 37. The method of any one of paragraphs 31-36, wherein the at least one antibody reagent comprises a primary antibody with a non-proteinaceous label. 38. The method of any one of paragraphs 31-36, wherein the at least one antibody reagent comprises a) a primary antibody and b) a secondary antibody with a non-proteinaceous label. 39. The method of any one of paragraphs 31-38, further comprising contacting the expanded sample with at least one antibody reagent or aptamer reagent specific for the non-proteinaceous label. 4888-3636-9385.3 51 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 40. The method of any one of paragraphs 31-39, further comprising contacting the expanded sample with a) at least one primary antibody reagent specific for the non-proteinaceous label and b) at least one secondary antibody specific for the primary antibody reagent specific for the non- proteinaceous label. 41. The method of any one of the preceding paragraphs, wherein the sequencing comprises next- generation sequencing. 42. The method of any one of the preceding paragraphs, wherein the sequence comprises single-cell sequencing. 43. The method of any one of the preceding paragraphs, wherein the sequencing comprises the use of a transposase-mediated adapter. 44. The method of any one of the preceding paragraphs, wherein the sequencing comprises contacting the expanded sample with at least one transposase. 45. The method of any one of the preceding paragraphs, wherein the sequencing comprises contacting the expanded sample with at least one reagent comprising a transposase conjugated, bound to, or fused with an antibody-binding protein. 46. The method of paragraph 45, wherein the antibody-binding protein binds to the antibody reagent, the primary antibody, and / or the secondary antibody of any of paragraphs 31-40. 47. The method of any one of paragraphs 45-46, wherein the antibody-binding protein binds to the secondary antibody. 48. The method of any one of paragraphs 43-47, wherein the at least one transposase is Tn5. 49. The method of any one of the preceding paragraphs, wherein the sequencing comprises contacting the expanded sample with pA-Tn5, pG-Tn5, or pAG-Tn5. 50. The method of any one of the preceding paragraphs, wherein the sequencing comprises contacting the expanded sample with pAG-Tn5. 51. The method of any one of paragraphs 43-50, wherein the transposase, pA-Tn5, pG-Tn5, or pAG- Tn5 is loaded with next-generation sequencing adapters. 52. The method of any one of the preceding paragraphs, further comprising a step of contacting the expanded sample with a visualization agent. 53. The method of paragraph 52, wherein the visualization agent is selected from the group consisting of: 4′,6-diamidino-2-phenylindole (DAPI); an anthraquinone dye; and a cyanine dye. 54. The method of paragraph 52, wherein the visualization agent is DAPI. 55. The method of any one of the preceding paragraphs, whereby the sample is enlarged or expanded. 4888-3636-9385.3 52 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 56. The method of any one of the preceding paragraphs, whereby the sample is enlarged or expanded for high-resolution single-cell genomics. 57. The method of any one of the preceding paragraphs, wherein multiple samples are enlarged or expanded. 58. The method of any one of the preceding paragraphs, wherein multiple samples are enlarged or expanded, thereby providing a library of samples.

[0208] In some embodiments, the present technology may be defined in any of the following numbered paragraphs: 1. A method comprising: a) contacting a sample comprising at least one nucleic acid molecule with: i) a fixative reagent; ii) an acid; to provide a fixed sample; b) contacting the fixed sample with sequencing adaptors, and optionally Tn5 transposase, to provide a fixed sample comprising linear nucleic acid fragments; c) contacting the fixed sample comprising nucleic linear acid fragments with at least one hairpin adapter to provide a fixed sample comprising circularized nucleic acid fragments; d) optionally immunostaining the fixed sample comprising circularized nucleic acid fragments; e) contacting the fixed sample comprising circularized nucleic acid fragments with at least one amino-oligo hook complementary to the at least one hairpin adapter to provide a fixed sample comprising circularized nucleic acid-adapter fragments; f) contacting the fixed sample comprising circularized nucleic acid-adapter fragments with MA-NHS to provide fixed sample comprising fixed sample comprising circularized nucleic acid-methyl acrylate adapter fragments; g) contacting the expanded sample with an encapsulation solution comprising: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate; v) sodium chloride; vi) TEMED; vii) ammonium persulfate; and 4888-3636-9385.3 53 002806-000113WOPTAttorney Docket No: 002806-000113WOPT viii) optionally 4HT; to provide a gel comprising the fixed sample; h) contacting the gel comprising the fixed sample with: i) a digestion solution comprising at least one protease; and / or ii) a low positive ion expansion solution; thereby digesting proteins in the gel comprising the fixed sample, and / or expanding the gel comprising the fixed sample to provide an expanded sample; i) optionally contacting the expanded sample with a re-embedding solution comprising at least one of: acrylamide; APS; and TEMED; to provide a re-embedded expanded sample; j) optionally contacting the re-embedded expanded sample with at least one of EDC and NHC to provide a passivated expanded sample; and and k) at least one of: i) sequencing one or more nucleic acid sequences in the expanded sample (or re- embedded expanded sample or passivated expanded sample) and / or detecting the location of one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) and ii) imaging or detecting the expanded sample (or re-embedded expanded sample or passivated expanded sample). 2. The method of paragraph 1, wherein the sequencing is rolling circle amplification. 3. The method of any one of the preceding paragraphs, wherein the imaging comprises super- resolution immunofluorescence imaging. 4. The method of any one of the preceding paragraphs, wherein the imaging comprises the use of a diffraction-limited microscope. 5. The method of any one of the preceding paragraphs, wherein the acid is HCl. 6. The method of any one of the preceding paragraphs, wherein the fixative reagent is paraformaldehyde.

[0209] In some embodiments, the present technology may be defined in any of the following numbered paragraphs: 4888-3636-9385.3 54 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 1. A method comprising: a) contacting a sample comprising at least one nucleic acid molecule with: i) a fixative reagent; ii) a detergent; and iii) optionally a reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids; to provide a fixed sample; b) contacting the fixed sample with an encapsulation solution comprising: i) acrylamide; ii) bis-acrylamide; iii) sodium acrylate; iv) sodium chloride; v) TEMED; vi) ammonium persulfate; and vii) optionally 4HT; to provide a solution comprising the fixed sample; c) contacting the solution comprising the fixed sample with a carrier oil to provide a droplet comprising the fixed sample; d) contacting the droplet comprising the fixed sample with: i) an emulsion breaking solution comprising at least one deemulsifier; ii) a digestion solution comprising at least one protease; and / or iii) a low positive ion expansion solution; thereby by removing the carrier oil, digesting proteins in the droplet comprising the fixed sample, and expanding the droplet comprising the fixed sample to provide an expanded sample; and e) sequencing one or more nucleic acid sequences in the expanded sample and / or detecting the location of one or more nucleic acid sequences in the expanded sample. 2. A method comprising sequencing one or more nucleic acid sequences in an expanded sample and / or detecting the location of one or more nucleic acid sequences in an expanded sample. 3. The method of any one of the preceding paragraphs, wherein the nucleic acid sequence is present in genomic DNA. 4. The method of any one of the preceding paragraphs, wherein the at least one nucleic acid molecule is at least one chromosome. 4888-3636-9385.3 55 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 5. The method of any one of the preceding paragraphs, wherein the fixative reagent is selected from the group consisting of: formaldehyde; paraformaldehyde (PFA); glutaraldehyde (GA); ethylene glycol bis(succinimidyl succinate) (EGS); dimethyl adipimidate (DMA); and discuccinimidyl glutarate (DSG). 6. The method of any one of the preceding paragraphs, wherein the fixative reagent is formaldehyde. 7. The method of any one of the preceding paragraphs, wherein the detergent is selected from the group consisting of: nonyl phenoxypolyethoxylethanol (NP-40); 2-[4-(2,4,4-trimethylpentan-2- yl)phenoxy]ethanol (Triton X-100); polysorbate 20 (Tween 20), and digitonin. 8. The method of any one of the preceding paragraphs, wherein the detergent is NP-40. 9. The method of any one of the preceding paragraphs, wherein the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids is selected from the group consisting of: Methacrylic acid N-hydroxysuccinimide ester (MA-NHS); and LabelX. 10. The method of any one of the preceding paragraphs, wherein the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids is MA-NHS. 11. The method of any one of the preceding paragraphs, wherein contacting the sample comprising the fixed sample comprises contacting at least one cell comprising the at least one nucleic acid molecule. 12. The method of paragraph 11, wherein at least one droplet formed in step c comprises one cell. 13. The method of paragraph 11, wherein at least one droplet formed in step c comprises only one cell. 14. The method of any one of the preceding paragraphs, wherein the step of contacting the solution comprising the fixed sample with a carrier oil is performed on a microfluidic device. 15. The method of paragraph 14, wherein the carrier oil flow rate on the microfluidic device is no greater than 400 µL / minute. 16. The method of paragraph 14, wherein the carrier oil flow rate on the microfluidic device is no greater than 300 µL / minute. 17. The method of paragraph 14, wherein the carrier oil flow rate on the microfluidic device is 150- 300 µL / minute. 18. The method of paragraph 14, wherein the carrier oil flow rate on the microfluidic device is 270 µL / minute. 4888-3636-9385.3 56 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 19. The method of paragraph14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 100 µL / minute. 20. The method of paragraph 14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 50 µL / minute. 21. The method of paragraph 14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is 10-100 µL / minute. 22. The method of paragraph 14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is 25 µL / minute. 23. The method of any one of the preceding paragraphs, wherein the carrier oil is a fluorinated oil 24. The method of any one of the preceding paragraphs, wherein the at least one deemulsifier is selected from the group consisting of: Chloroform; perfluorooctanol (PFO); and a detergent-free hydrofluoroether (HFE) oil. 25. The method of any one of the preceding paragraphs, wherein the at least one deemulsifier is PFO. 26. The method of any one of the preceding paragraphs, wherein the low positive ion expansion solution is a solution comprising less than 2 M of a positive ion. 27. The method of any one of the preceding paragraphs, wherein the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, and Mg2+. 28. The method of any one of the preceding paragraphs, wherein the low positive ion expansion solution is a solution comprising less than 2 M of positively-charged detergent molecules. 29. The method of any one of the preceding paragraphs, wherein the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, Mg2+, and positively-charged detergent molecules. 30. The method of any one of the preceding paragraphs, wherein the low positive ion expansion solution is a solution comprising phosphate buffered saline (PBS), Tris, and / or water. 31. The method of any one of the preceding paragraphs, further comprising contacting the sample comprising at least one nucleic acid molecule, the solution comprising the fixed sample, or the droplet comprising the fixed sample with at least one antibody reagent before contacting the droplet comprising the fixed sample with a digestion solution and / or an expansion solution. 32. The method of any one of the preceding paragraphs, further comprising contacting the sample comprising at least one nucleic acid molecule with at least one antibody reagent or aptamer reagent before contacting the sample comprising at least one nucleic acid molecule with formaldehyde, NP-40, and / or MA-NHS. 4888-3636-9385.3 57 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 33. The method of paragraph 31 or 32, wherein the at least one antibody reagent or aptamer reagent is specific for a nucleic acid or nucleic acid-associated molecule. 34. The method of any one of paragraphs 31-33, wherein the at least one antibody reagent or aptamer reagent comprises a non-proteinaceous label. 35. The method of paragraph 34, wherein the non-proteinaceous label is selected from the group consisting of: biotin; fluorescein isothiocyanate (FITC); digoxigenin; and rhodamine. 36. The method of paragraph 34, wherein the non-proteinaceous label is biotin. 37. The method of any one of paragraphs 31-36, wherein the at least one antibody reagent comprises a primary antibody with a non-proteinaceous label. 38. The method of any one of paragraphs 31-36, wherein the at least one antibody reagent comprises a) a primary antibody and b) a secondary antibody with a non-proteinaceous label. 39. The method of any one of paragraphs 31-38, further comprising contacting the expanded sample with at least one antibody reagent or aptamer reagent specific for the non-proteinaceous label. 40. The method of any one of paragraphs 31-39, further comprising contacting the expanded sample with a) at least one primary antibody reagent specific for the non-proteinaceous label and b) at least one secondary antibody specific for the primary antibody reagent specific for the non- proteinaceous label. 41. The method of any one of the preceding paragraphs, wherein the sequencing comprises next- generation sequencing. 42. The method of any one of the preceding paragraphs, wherein the sequence comprises single-cell sequencing. 43. The method of any one of the preceding paragraphs, wherein the sequencing comprises the use of a transposase-mediated adapter. 44. The method of any one of the preceding paragraphs, wherein the sequencing comprises contacting the expanded sample with at least one transposase. 45. The method of any one of the preceding paragraphs, wherein the sequencing comprises contacting the expanded sample with at least one reagent comprising a transposase conjugated, bound to, or fused with an antibody-binding protein. 46. The method of paragraph 45, wherein the antibody-binding protein binds to the antibody reagent, the primary antibody, and / or the secondary antibody of any of paragraphs 31-40. 47. The method of any one of paragraphs 45-46, wherein the antibody-binding protein binds to the secondary antibody. 4888-3636-9385.3 58 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 48. The method of any one of paragraphs 43-47, wherein the at least one transposase is Tn5. 49. The method of any one of the preceding paragraphs, wherein the sequencing comprises contacting the expanded sample with pA-Tn5, pG-Tn5, or pAG-Tn5. 50. The method of any one of the preceding paragraphs, wherein the sequencing comprises contacting the expanded sample with pAG-Tn5. 51. The method of any one of paragraphs 43-50, wherein the transposase, pA-Tn5, pG-Tn5, or pAG- Tn5 is loaded with next-generation sequencing adapters. 52. The method of any one of the preceding paragraphs, further comprising a step of contacting the expanded sample with a visualization agent. 53. The method of paragraph 52, wherein the visualization agent is selected from the group consisting of: 4′,6-diamidino-2-phenylindole (DAPI); an anthraquinone dye; and a cyanine dye. 54. The method of paragraph 52, wherein the visualization agent is DAPI. 55. The method of any one of the preceding paragraphs, whereby the sample is enlarged or expanded. 56. The method of any one of the preceding paragraphs, whereby the sample is enlarged or expanded for high-resolution single-cell genomics. 57. The method of any one of the preceding paragraphs, wherein multiple samples are enlarged or expanded. 58. The method of any one of the preceding paragraphs, wherein multiple samples are enlarged or expanded, thereby providing a library of samples. 59. A method comprising: a) contacting a sample comprising at least one nucleic acid molecule with: i) a fixative reagent; and ii) an acid; to provide a fixed sample; b) contacting the fixed sample with sequencing adaptors, and optionally transposase, to provide a fixed sample comprising linear nucleic acid fragments; c) contacting the fixed sample comprising linear nucleic acid fragments with at least one hairpin adaptor to provide a fixed sample comprising circularized nucleic acid fragments; d) optionally immunostaining the fixed sample comprising circularized nucleic acid fragments; 4888-3636-9385.3 59 002806-000113WOPTAttorney Docket No: 002806-000113WOPT e) contacting the fixed sample comprising circularized nucleic acid fragments with at least one amino-oligo hook complementary to the at least one hairpin adapter to provide a fixed sample comprising circularized nucleic acid-adapter fragments; f) contacting the fixed sample comprising circularized nucleic acid-adapter fragments with MA-NHS to provide a fixed sample comprising circularized nucleic acid-methyl acrylate adapter fragments; g) contacting the fixed sample comprising circularized nucleic acid-methyl acrylate adapter fragments with an encapsulation solution comprising: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate; v) sodium chloride; vi) TEMED; vii) ammonium persulfate; and viii) optionally 4HT; to provide a gel comprising the fixed sample; h) contacting the gel comprising the fixed sample with: i) a digestion solution comprising at least one protease; and / or ii) a low positive ion expansion solution; thereby digesting proteins in the gel comprising the fixed sample, and / or expanding the gel comprising the fixed sample to provide an expanded sample; i) optionally contacting the expanded sample with a re-embedding solution comprising at least one of: acrylamide; APS; and TEMED; to provide a re-embedded expanded sample; j) optionally contacting the re-embedded expanded sample with at least one of EDC and NHS to provide a passivated expanded sample; and and k) at least one of: 4888-3636-9385.3 60 002806-000113WOPTAttorney Docket No: 002806-000113WOPT i) sequencing one or more nucleic acid sequences in the expanded sample (or re- embedded expanded sample or passivated expanded sample) and / or detecting the location of one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) and ii) imaging or detecting the expanded sample (or re-embedded expanded sample or passivated expanded sample). 60. The method of paragraph 59, wherein the nucleic acid sequence is present in genomic DNA. 61. The method of any one of paragraphs 59-60, wherein the at least one nucleic acid molecule is at least one chromosome. 62. The method of any one of paragraphs 59-61, wherein the acid is HCl. 63. The method of any one of paragraphs 59-62, wherein the fixative reagent is selected from the group consisting of: formaldehyde; paraformaldehyde (PFA); glutaraldehyde (GA); ethylene glycol bis(succinimidyl succinate) (EGS); dimethyl adipimidate (DMA); and discuccinimidyl glutarate (DSG). 64. The method of any one of paragraphs 59-63, wherein the fixative reagent is paraformaldehyde. 65. The method of any one of paragraphs 59-64, wherein step b comprising contacting the fixed sample with sequencing adaptors and transposase. 66. The method of any one of paragraphs 59-65, wherein the transposase is Tn5 transposase. 67. The method of any one of paragraphs 59-66, wherein the at least one hairpin adaptor comprises a double stranded stem, a primer binding site, and a single-stranded region complementary to the sequencing adaptor. 68. The method of any one of paragraphs 59-67, wherein the at least one hairpin adaptor comprises a barcode. 69. The method of any one of paragraphs 59-68, wherein the at least one hairpin adaptor comprises a unique molecular identifier barcode. 70. The method of any one of paragraphs 69, wherein the MA-NHS in step f) is present at 5-10 mM in 1xPBS. 71. The method of any one of paragraphs 59-70, comprising the further step of immunostaining the fixed sample comprising circularized nucleic acid fragments. 72. The method of any one of paragraphs 59-71, wherein immunostaining comprises contacting with one or more antibody reagents comprising a detectable label. 4888-3636-9385.3 61 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 73. The method of any one of paragraphs 59-72, wherein the at least one amino-oligo hook comprises an oligonucleotide having a 5’ end and a 3’ end; an amino group at the 3’ end; an acrydite group at the 5’ end; and a region complementary to the hairpin adaptor. 74. The method of any one of paragraphs 59-73, wherein the encapsulation solution comprises: iii) N,N-dimethylacrylamide; iv) acrylamide; v) bis-acrylamide; vi) sodium acrylate; vii) sodium chloride; viii) TEMED; and ix) ammonium persulfate. 75. The method of any one of paragraphs 59-74, wherein the encapsulation solution comprises: x) N,N-dimethylacrylamide; xi) acrylamide; xii) bis-acrylamide; xiii) sodium acrylate; xiv) sodium chloride; xv) TEMED; xvi) ammonium persulfate; and xvii) 4HT. 76. The method of any one of paragraphs 59-75, wherein the digestion solution comprises a) Tris- HCl, b) EDTA, c) guanidine HCl and / or NaCl, and d) Triton X-100. 77. The method of any one of paragraphs 59-76, wherein the at least one protease comprises proteinase K, trypsin, ArgC, LysC, or pepsin. 78. The method of any one of paragraphs 59-77, wherein the low positive ion expansion solution is a solution comprising less than 2 M of a positive ion. 79. The method of any one of paragraphs 59-78, wherein the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, and Mg2+. 80. The method of any one of paragraphs 59-79, wherein the low positive ion expansion solution is a solution comprising phosphate buffered saline (PBS), Tris, and / or water. 4888-3636-9385.3 62 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 81. The method of any one of paragraphs 59-80, wherein step h) comprises contacting the gel comprising the fixed sample with a digestion solution comprising at least one protease; and a low positive ion expansion solution. 82. The method of any one of paragraphs 59-81, wherein step h) comprises contacting the gel comprising the fixed sample with a digestion solution comprising at least one protease. 83. The method of any one of paragraphs 59-82, wherein step h) comprises contacting the gel comprising the fixed sample with a low positive ion expansion solution. 84. The method of any one of paragraphs 59-83, wherein the method comprises the step of contacting the expanded sample with a re-embedding solution comprising at least one of: acrylamide; APS; and TEMED; to provide a re-embedded expanded sample. 85. The method of any one of paragraphs 59-84, wherein the re-embedding solution comprises acrylamide; APS; and TEMED. 86. The method of any one of paragraphs 59-85, wherein the method comprises the further step of contacting the re-embedded expanded sample with at least one of EDC and NHS to provide a passivated expanded sample. 87. The method of any one of paragraphs 59-86, wherein the method comprises the further step of contacting the re-embedded expanded sample with EDC and NHS to provide a passivated expanded sample. 88. The method of any one of paragraphs 59-87, wherein the method further comprises performing rolling circle amplification before the sequencing step. 89. The method of any one of paragraphs 59-88, wherein the imaging comprises super-resolution immunofluorescence imaging. 90. The method of any one of paragraphs 59-89, wherein the imaging comprises the use of a diffraction-limited microscope. 91. The method of any one of paragraphs 59-90, comprising: i) sequencing one or more nucleic acid sequences in the expanded sample (or re- embedded expanded sample or passivated expanded sample) and / or detecting the location of one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) and 4888-3636-9385.3 63 002806-000113WOPTAttorney Docket No: 002806-000113WOPT ii) imaging or detecting the expanded sample (or re-embedded expanded sample or passivated expanded sample). 92. The method of any one of paragraphs 59-91, wherein multiple samples are enlarged or expanded, thereby providing a library of samples.

[0210] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting. EXAMPLES EXAMPLE 1

[0211] Introduction

[0212] Technologies that profile transcriptomes and genomes at the single-cell level commonly rely on barcoding of single cells through either microfluidic droplet encapsulation or combinatorial indexing. However, common droplet encapsulation strategies are limited in their throughput and rely on specialized equipment that can be prohibitively expensive, and combinatorial indexing approaches often have issues with cell clumping, ambient nucleic acid mixing, and cell loss. Additionally, genomic sequencing techniques have often lagged behind their counterparts with transcriptomic readouts for several reasons, including the inherent sparsity of genomic data (with a theoretical maximum of two copies of any DNA locus in diploid cells) and the extreme density of packaged DNA in the cell’s nucleus.

[0213] Techniques such as CUT&Tag (Kaya-Okur et al.2019), in which regions bound to a specific epitope are selectively cut and attached to sequencing adapters by antibody-guided transposition, are inherently inhibited in regions of dense DNA - reflecting heterochromatin which makes up >70% of the human genome. For example, in heterochromatic regions marked by histone modifications (e.g. H3K9me3), the theoretical maximum number of epitopes that can guide transposition is extremely low when considering the percentage of volume filled by chromatin is over 50% in some regions (Ou et al. 2017) and that each unique transposition event represents binding of a primary antibody, a secondary antibody, and a loaded pAG-Tn5 transposome. Other enzymatic reactions necessary for profiling of various genomic modalities are similarly limited in their resolution by spatial occlusion of the large complexes required for their function.

[0214] Contemplated herein are methods in which single-cell sequencing techniques could assay various genomic modalities by increasing the physical space available for antibodies and enzymatic complexes. As described herein, the inventors have overcome the inhibitory effects of heterochromatin inherent to genomics tools by physically expanding the genomes of individual cells. Specifically, cells are encapsulated into individual expandable acrylamide droplets, protease treated (removing all proteins), and 4888-3636-9385.3 64 002806-000113WOPTAttorney Docket No: 002806-000113WOPT expanded. The data demonstrate that nuclear structure is preserved and that both DNA and RNA are retained within expansion gels.

[0215] The inventors further demonstrate “epitope replacement”, wherein protein epitopes bound before expansion can be replaced by chemical groups (e.g. biotin) which are then used for imaging and sequencing of protein-DNA contacts.

[0216] Last, the data demonstrate the power of the approach for single-cell genomics with single-cell expansion whole genome sequencing (sc-Ex-WG-seq) and single-cell expansion CUT&Tag (sc-Ex- CUT&Tag). Using sc-Ex-CUT&Tag, a ~100-fold improvement in yield was obtained, demonstrating Expansion Genomics as a powerful platform for high-throughput and high-resolution genomic sequencing.

[0217] Results

[0218] In one embodiment of the methods described herein, cells are formaldehyde fixed, permeabilized, and treated with MA-NHS to allow the linking of peptides to the gel network (Fig.2A). They are then resuspended into an expandable acrylamide mixture of acrylamide, bis-acrylamide, sodium acrylate, and sodium chloride known as StockX with added TEMED, ammonium persulfate, and 4HT and then encapsulated into droplets in carrier oil on a microfluidic device designed for DroNc-seq (Habib et al. 2017). Upon polymerization, oil is removed and then droplets are expanded and proteins are removed during a digestion. Cells are expanded several times linearly, and the volumetric expansion and clearing of proteins permits enzymatic reactions necessary for genomic assays to occur with high efficiency. Gels expand immediately upon introduction to the digestion buffer, but they can be expanded further in low-salt buffers or water (Fig.1). For example, gels in digestion buffer have an average diameter of 71 µm, gels already partially expanded in PBS have an average diameter of 103 µm, and upon several washes in water, gels expand to an average of 226 µm, representing a volumetric expansion of over 32x. In all subsequent steps, buffer exchange happens through several washes on 20 µm mini-strainers.

[0219] For whole genome sequencing, after encapsulation and digestion, gels are transposed with high- efficiency Tn5 transposase loaded with adapters for Nextera sequencing for 1 hour at 37° in a low-salt transposition buffer with 5 mM MgCl2 before washing out excess Tn5 and staining with DAPI to visualize DNA. Single gels can be picked into wells with unique primers for single-cell PCR.

[0220] In preliminary results, 8 single encapsulated cells from the K562 immortalized leukemia cell line were picked into individual PCR wells and their whole genomes were sequenced. The average library size of these whole genome sequencing libraries was 5.8 million unique reads per cell, representing over 45% coverage of the genome in each cell. Copy number across each cell and in aggregate was calculated 4888-3636-9385.3 65 002806-000113WOPTAttorney Docket No: 002806-000113WOPT and compared to gold-standard whole genome sequencing data from K562s generated as part of the ENCODE consortium, showing remarkable concordance with a few interesting chromosome number variations (CNVs) specific to the K562s used in this study (Figs.2B-2C). This technology can be used to call variants and CNVs at unprecedented resolution in single-cells in a high-throughput manner when combined with combinatorial indexing approaches.

[0221] Another application of expansion genomics is the use of Ex-CUT&Tag. In traditional CUT&Tag, transposition occurs after pAG-Tn5 is selectively bound to antibodies against an epitope of interest. However, during the digestion step of Expansion Genomics, antibodies are digested into small peptides, necessitating an alternative approach. Demonstrated herein is such an approach, which is referred to herein as “epitope replacement”, in which cells are stained with a primary antibody against an epitope of interest followed by secondary staining with a biotinylated antibody prior to gel encapsulation. After digestion, gels are stained with an antibody that recognizes biotin and a secondary antibody for signal amplification before pAG-Tn5 binding and transposition (Fig.3A). The specificity of this epitope replacement approach was visualized using fluorophore-conjugated secondary antibodies as well as pAG- Tn5 loaded with fluorescent oligos for laminA / C, localized at the nuclear periphery, and H3K27me3, distributed at facultative heterochromatin foci throughout the nucleus (Fig.3B).

[0222] To verify the specificity of Ex-CUT&Tag, 12 single gels with transposed cells were transferred into wells of a plate with PCR mix with specific barcoded primers and sequenced them. It was found that the average library size was over 140,000 unique reads per cell, vastly outperforming other CUT&Tag methods. The read for the 12 cells were aggregated, and it was found that the genomic tracks closely resembled gold-standard ENCODE ChIP-seq data for H3K27me3 in K562s (Figs.3C-3D). Library sizes from H3K9me3 Ex-CUT&Tag were on average around 300,000 unique reads per cell, an improvement of over an order of magnitude over published methods (Bartlett et al. 2021; Wu et al.2021; Bartosovic, Kabbe, and Castelo-Branco 2021; Zhang et al.2022).

[0223] Single-cell and single-nucleus transcriptomics have become essential tools in molecular biology, so to demonstrate the compatibility of Expansion Genomics with transcriptomic profiling, an encapsulated cell was stained for RNA using SYTO RNASelect and it was found that nuclear RNA was largely preserved in its expected distribution, indicating Expansion Genomics can be used as a platform for single-cell multiomic assay such as whole genome sequencing or CUT&Tag combined with transcriptome profiling (Fig.4)

[0224] Discussion

[0225] Expansion Genomics is a platform that leverages advances in microscopy to allow high- throughput single-cell genomic assays to be performed with unprecedented resolution. Expansion whole 4888-3636-9385.3 66 002806-000113WOPTAttorney Docket No: 002806-000113WOPT genome sequencing can be used for CNV and SNV calling in single cells at a scale that permits unperturbed lineage tracing in single cells at a scale previously unknown. In addition, with the approach termed “epitope replacement”, CUT&Tag in expanded cells outperforms all other CUT&Tag methods in terms of unique reads per cell. This is essential for future low-input CUT&Tag uses.

[0226] Moreover, Expansion Genomics can be easily applied to additional genomic assays. For instance, through assays such as bisulfite sequencing or TAPS (Liu et al.2019), DNA methylation could be detected in single cells. Expansion Genomics can also be used to improve the yield of assays such as DipC, which measure the 3D conformation of the genome in single cells (Tan et al.2021). It is demonstrated herein that RNA is retained in the nucleus of expanded cells in droplets and therefore multiomic assays combining these genomic assays and transcriptomic profiling would also be compatible with Expansion Genomics.

[0227] Methods

[0228] Cell Culture. K562s were cultured in RPMI 1640 medium supplemented with 10% FBS and 1% penicillin-streptomycin in 5% CO2at 37° and maintained in the exponential phase. Fixation and Permeabilization Cells were collected and spun down at 500 rcf for 3 minutes at 4° and washed once in PBS. Cells were brought to a final concentration of 1 million / ml and fixed in a final concentration of 1% formaldehyde for 5 minutes at room temperature. The reaction was quenched by adding glycine to a final concentration of 118 mM, Tris-HCl pH 8.0 to a final concentration of 42 mM, and BSA to a final concentration of 0.084% and incubated on ice for 2 minutes. Cells were then spun down at 500 rcf for 3 minutes at 4° and washed twice with PBS. To permeabilize, cells were resuspended in NI (10 mM Tris-HCl pH 7.5, 10 mM NaCl, 3 mM MgCl2) with 0.1% NP-40 at a concentration of 10 million / ml and incubated for 10 minutes on ice. Nuclei mixture was diluted 1:10 in NI and spun down for 3 minutes at 800 rcf at 4°.

[0229] Antibody Staining. Nuclei were resuspended at 2 million / ml in NI with 0.01% digitonin and stained with 0.5 µl antibody per 100 thousand cells with appropriate antibody and incubated overnight at 4° while rotating. Nuclei were then spun down once and resuspended in NI with 0.01% digitonin with 0.5 µl species-specific biotinylated secondary antibody added per 100 thousand cells and incubated at room temperature for 1 hour while rotating. Nuclei were spun down and washed twice with resuspending in NI with 0.01% digitonin and spun down again.

[0230] MA-NHS Treatment. Nuclei were resuspended in NI with 0.01% digitonin and 5 mM MA-NHS and incubated for 1 hour at room temperature. Nuclei were then washed twice in NI with 0.01% digitonin.

[0231] Encapsulation. Nuclei were resuspended in 200 µl StockX (8.6% sodium acrylate, 2.5% acrylamide, 0.15% N,N′-Methylenebisacrylamide, 2 M NaCl, 1X PBS) and spun down once. Nuclei were 4888-3636-9385.3 67 002806-000113WOPTAttorney Docket No: 002806-000113WOPT then resuspended in StockX with 0.4% TEMED and 0.01% 4-Hydroxy-TEMPO (4HT), together called the Tubing 1 Mix. An equivolume mix of StockX with 0.4% APS and 2% added water was also made called the Tubing 2 Mix. Oil with 0.4% TEMED was prepared as well. To encapsulate cells into acrylamide droplets, each solution was first transferred into a syringe attached to a 29 gauge needle. After ensuring air bubbles were removed, syringes were attached to a DroNc-seq microfluidic device with polyethylene microtubing and flowed through the device at speeds of 270 µl / minute for the oil and 25 µl / minute for the other mixes with oil in the top port, Tubing 1 Mix in the second port, and Tubing 2 Mix in the bottom port. Droplets were collected into microcentrifuge tubes on ice with 300 µl mineral oil in each, and the emulsion was incubated at 37° undisturbed for 2 hours to allow gel polymerization.

[0232] Emulsion Breaking. Equivolume amounts of digestion buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.5% Triton X-100, 800 mM Guanidine HCl), 1H,1H,2H,2H-Perfluoro-1-octanol (PFO), and emulsion from the oil / aqueous interface were mixed together through gentle vortexing, allowed to settle at room temperature for 2 minutes, and then spun down briefly on a tabletop centrifuge. The gel mixture (aqueous phase) was moved to a new tube, and proteinase K (NEB) was added to a final concentration of 8 units / µl and incubated at 37° for 3 hours or at room temperature overnight. After proteinase K digestion, PMSF was added to a concentration of 5 mM for 10 minutes at room temperature.

[0233] Epitope Replacement Imaging. Gels were washed with PBS at least five times on a 20 µm PluriSelect filter, allowing them to expand, and then resuspended in PBS with Alexa Fluor™488 streptavidin added to a final concentration of 5 µg / ml and transferred to a new tube. The mix was incubated for 30 minutes at room temperature, and then gels were washed with PBS at least five times, including once with PBS containing DAPI, on a 20 µm PluriSelect filter. Gels were resuspended in a small volume of PBS and imaged at 60x.

[0234] Expansion Whole-Genome Sequencing. Gels were washed with PBS at least five times on a 20 µm PluriSelect filter, allowing them to expand, and then transferred into 200 µl tagmentation buffer (10 mM Tris, 1% DMF, 5 mM MgCl2) with 2 µl loaded Tn5 added. Tagmentation happened at 37° for 1 hour while shaking at 500 rpm.

[0235] Expansion CUT&Tag. Gels containing cells stained with a primary and biotinylated secondary antibody were washed with PBS at least five times on a 20 µm PluriSelect filter, allowing them to expand, and then resuspended in 500 µl PBS and moved to a new tube.5 µl anti-biotin antibody was added, and the mix was incubated at room temperature while rotating for 2 hours. Gels were then washed with PBS at least five times on a 20 µm PluriSelect filter and 4888-3636-9385.3 68 002806-000113WOPTAttorney Docket No: 002806-000113WOPT resuspended in 500 µl PBS and transferred to a new tube.5 µl species-specific secondary antibody was added, and the mix was incubated at room temperature while rotating for 1 hour. Gels were once again washed with PBS at least five times on a 20 µm PluriSelect filter and then resuspended in 500 µl PBS and transferred to a new tube.12.5 µl loaded pAG-Tn5 was added, and the mix was incubated at room temperature while rotating for 1 hour. Gels were washed at least five times with first 2x PBS and then tagmentation buffer on a 20 µm PluriSelect filter and then resuspended in 500 µl tagmentation buffer and transferred to a new tube. The tagmentation reaction occurred during a 1 hour incubation at 37° while shaking at 500 rpm.

[0236] Single-Cell Library Preparation. Gels were then washed at least 5 times with PBS on a PluriSelect filter and stained with DAPI for visualization. Individual gels containing cells were picked into separate PCR reactions (25 µl NEBNext High-Fidelity 2X master mix, 1 µl 25 µM Ad1 primer, 1 µl 25 µM Ad2 primer, 23 µl water) and amplified using the following PCR conditions: 72° for 30 minutes, 98° for 30 seconds, then 5 cycles of 98°C for 20 seconds, and 72°C for 3 minutes. Samples were then amplified by the number of cycles to reach ⅓ of saturation as determined by qPCR. For qPCR, 5 µl of the reaction mixture was added to 10 µl of qPCR mix (5 µl NEBNext High-Fidelity 2X master mix, 0.2 µl 25 µM Ad1 primer, 0.2 µl 25 µM Ad2 primer, 0.9 µl 10x SYBR green, 3.7 µl water) and amplified using the following protocol: 95° for 3 minutes, and then 30 cycles at 98° for 30 seconds and 72° for 3 minutes. After final amplification, 1 µl ExoI was added to each PCR reaction and incubated at 37° for 15 minutes before cleaning up with a Qiagen MinElute PCR Purification kit according to manufacturer’s instructions. Samples were pooled at equimolarity and sequenced on a Next-seq instrument (Read 1: 30 cycles, Index 1: 8 cycles, Index 2: 8 cycles, Read 2: 30 cycles).

[0237] Data Processing. BCLs were demultiplexed to individual sample FASTQ files using bcl2fastq. Reads were trimmed using a custom python script and then aligned to the hg38 genome using bowtie2. Low quality reads and readsmapping to chrY and chrM were removed with samtools, and duplicates were removed using Picard tools. bigWigs were generated using igvtools count and UCSC’s wigToBigWig.

[0238] References Alon, Shahar, Daniel R. Goodwin, Anubhav Sinha, Asmamaw T. Wassie, Fei Chen, Evan R. Daugharthy, Yosuke Bando, et al.2021. “Expansion Sequencing: Spatially Precise in Situ Transcriptomics in Intact Biological Systems.”Science 371 (6528). doi.org / 10.1126 / science.aax2656. Bartlett, Daniel A., Vishnu Dileep, Tetsuya Handa, Yasuyuki Ohkawa, Hiroshi Kimura, Steven Henikoff, and David M. Gilbert.2021. “High-Throughput Single-Cell Epigenomic Profiling by Targeted Insertion of Promoters (TIP-Seq).”The Journal of Cell Biology 220 (12). doi.org / 10.1083 / jcb.202103078. 4888-3636-9385.3 69 002806-000113WOPTAttorney Docket No: 002806-000113WOPT Bartosovic, Marek, Mukund Kabbe, and Gonçalo Castelo-Branco.2021. “Single-Cell CUT&Tag Profiles Histone Modifications and Transcription Factors in Complex Tissues.”Nature Biotechnology 39 (7): 825– 35. Chen, Fei, Paul W. Tillberg, and Edward S. Boyden.2015. “Optical Imaging. Expansion Microscopy.”Science 347 (6221): 543–48. Fan, Yuhang, Žaneta Andrusivová, Yunming Wu, Chew Chai, Ludvig Larsson, Mengxiao He, Liqun Luo, Joakim Lundeberg, and Bo Wang.2023. “Expansion Spatial Transcriptomics.”Nature Methods, June. doi.org / 10.1038 / s41592-023-01911-1. Habib, Naomi, Inbal Avraham-Davidi, Anindita Basu, Tyler Burks, Karthik Shekhar, Matan Hofree, Sourav R. Choudhury, et al.2017. “Massively Parallel Single-Nucleus RNA-Seq with DroNc- Seq.”Nature Methods 14 (10): 955–58. Kaya-Okur, Hatice S., Steven J. Wu, Christine A. Codomo, Erica S. Pledger, Terri D. Bryson, Jorja G. Henikoff, Kami Ahmad, and Steven Henikoff.2019. “CUT&Tag for Efficient Epigenomic Profiling of Small Samples and Single Cells.”Nature Communications 10 (1): 1930. Liu, Yibin, Paulina Siejka-Zielińska, Gergana Velikova, Ying Bi, Fang Yuan, Marketa Tomkova, Chunsen Bai, Lei Chen, Benjamin Schuster-Böckler, and Chun-Xiao Song.2019. “Bisulfite-Free Direct Detection of 5-Methylcytosine and 5-Hydroxymethylcytosine at Base Resolution.”Nature Biotechnology 37 (4): 424–29. Ou, Horng D., Sébastien Phan, Thomas J. Deerinck, Andrea Thor, Mark H. Ellisman, and Clodagh C. O’Shea.2017. “ChromEMT: Visualizing 3D Chromatin Structure and Compaction in Interphase and Mitotic Cells.” Science 357 (6349). doi.org / 10.1126 / science.aag0025. Tan, Longzhi, Wenping Ma, Honggui Wu, Yinghui Zheng, Dong Xing, Ritchie Chen, Xiang Li, Nicholas Daley, Karl Deisseroth, and X. Sunney Xie.2021. “Changes in Genome Architecture and Transcriptional Dynamics Progress Independently of Sensory Experience during Post-Natal Brain Development.”Cell 184 (3): 741–58.e17. Wu, Steven J., Scott N. Furlan, Anca B. Mihalas, Hatice S. Kaya-Okur, Abdullah H. Feroze, Samuel N. Emerson, Ye Zheng, et al.2021. “Single-Cell CUT&Tag Analysis of Chromatin Modifications in Differentiation and Tumor Progression.”Nature Biotechnology 39 (7): 819–24. Zhang, Bingjie, Avi Srivastava, Eleni Mimitou, Tim Stuart, Ivan Raimondi, Yuhan Hao, Peter Smibert, and Rahul Satija.2022. “Characterizing Cellular Heterogeneity in Chromatin State with scCUT&Tag- Pro.” Nature Biotechnology, March. doi.org / 10.1038 / s41587-022-01250-0. 4888-3636-9385.3 70 002806-000113WOPTAttorney Docket No: 002806-000113WOPT EXAMPLE 2: Expansion in situ genome sequencing reveals nuclear abnormalities induce stochastic local repression of euchromatin

[0239] We previously developed In situ Genome Sequencing (IGS) (20), a method for sequencing genomic DNA within intact nuclei to study spatial chromatin organization. IGS combines advantages of genomics and microscopy approaches –like genomics, it provides untargeted genome-wide measurements; like microscopy, it provides direct 3D localization and is compatible with multiplexed protein imaging. However, the genomic resolution of IGS is constrained by the number of DNA amplicons that fit within the nucleus, whereas the spatial resolution is subject to the diffraction limit of optical microscopy. To transcend these limits, we sought to combine IGS with a superresolution imaging technique called Expansion Microscopy (ExM) (21). In ExM, samples are embedded in a hydrogel that expands uniformly with water, causing nearby molecules to move apart while preserving their relative positions, which enables superresolution imaging using diffraction-limited microscopes. We previously developed methods for imaging and in situ sequencing of RNA transcripts in expanded contexts(22, 23), and separately, approaches for imaging DNA(24) and nuclear features(25, 26) in expanded nuclei have been demonstrated. However, no method currently exists for simultaneously sequencing genomic DNA and imaging nuclear features at nanoscale resolution.

[0240] Here, we present Expansion In situ Genome Sequencing (ExIGS), a new technology for measuring the organization of chromatin within single nuclei at enhanced genomic and spatial resolution. ExIGS integrates and builds upon two existing methods, In situ Genome Sequencing (IGS)(20) and Expansion Microscopy (ExM)(21), to permit both sequencing of genomic DNA and superresolution immunofluorescence imaging directly within expanded samples. The workflow for ExIGS consists of three phases: 1) expansion library construction and immunofluorescence, 2) in situ and ex situ sequencing, and 3) computational multi-omic integration.

[0241] In Phase 1, we link transposed genomic DNA and proteins to an acrylamide gel for imaging and subsequent sequencing in expanded samples. To do this, we first fix cells and perform a mild acidic treatment to make chromatin more accessible for whole-genome coverage. We then use Tn5 transposase to integrate sequencing adapters into the genome, creating DNA fragments retaining their native spatial positions(27) (Fig.5A, i). Next, we circularize these fragments by ligating DNA hairpin adapters containing unique molecular identifiers (UMIs), followed by immunostaining of nuclear proteins (Fig. 5A, ii). To preserve relative spatial information during expansion, we developed a novel protocol to link both genomic DNA and protein fragments to the acrylamide gel. For DNA, we add an acrydite-amino oligo hook complementary to the hairpin. We then perform a chemical treatment converting amines in the hook and all proteins to acydites, allowing both to co-polymerize with the gel. We then digest, expand, 4888-3636-9385.3 71 002806-000113WOPTAttorney Docket No: 002806-000113WOPT and re-embed the samples in a secondary gel to prepare cells for superresolution immunofluorescence imaging (Fig.5A, iv). Once imaging is complete, we perform rolling circle amplification (RCA) to create clonal DNA amplicons for in situ sequencing in Phase 2 (Fig.5A, v).

[0242] In Phase 2, we resolve the 3D locations of genomic DNA fragments using the bi-modal sequencing strategy from IGS(20) where we read out 3D locations and UMI barcodes in situ, while acquiring genomic DNA sequences and UMI barcodes from an “ex situ” Illumina sequencer. However, for the in situ sequencing, we found that the commonly-used sequencing-by-ligation (SBL) chemistry showed extremely diminished signal intensity in expanded gels. In order to rapidly sequence up to 21 bases in an expanded gel environment, we developed an optimized in situ sequencing-by-synthesis (SBS) protocol(28) (Fig.5B) with innovations in gel porosity for increased enzymatic diffusion (Fig.6), a split barcode design to minimize signal decay (Fig.7), and computational methods to correct spectral bleed- through and molecular phasing (Fig.8). Following in situ sequencing, we amplify DNA fragments for ex situ paired-end sequencing of the transposed genome and UMI (Fig.5C).

[0243] In Phase 3, we computationally integrate in situ and ex situ sequencing modalities, superresolution imaging of nuclear proteins, and expansion factor quantification. To do this, we first identify in situ 3D amplicons (Fig.9) and match them to ex situ paired-end sequencing reads via their UMIs, resulting in spatially resolved genomic reads (Fig.5D, 5E, Fig.10). To integrate these reads with the superresolution protein imaging, we register and segment images for each protein and calculate the nearest distance to every read (Fig.5F, Fig.11). Lastly, we scale all observed spatial distances between genomic reads and proteins by the expansion factor, which is calculated by computationally aligning a low-resolution image of the sample before and after expansion (Fig.5G, Fig. S12). Taken together, these three phases of the ExIGS workflow enable genomic library construction, in situ sequencing, and multi- modal data integration in expanded nuclei.

[0244] Upon developing this workflow, we first sought to demonstrate that ExIGS provides enhanced genomic and spatial resolution compared to existing methods. To assess genomic resolution, we generated ExIGS data from 63 skin fibroblasts (AG08486) and directly compared it to previously published IGS data of 106 skin fibroblasts (PGP1, (20)). We observed that ExIGS increased the median number of reads per nucleus from 328 + / - 114 in unexpanded fibroblasts to 4875 ± 1425 X + / - Y in expanded fibroblasts, an increase of over 10-fold (Fig.5H). As expected, reads from each chromosome occupied distinct spatial territories in the nucleus (36) (Fig.12). To validate that ExIGS preserves 3D genome structure, we clustered reads into homologous chromosomes (Methods) and observed that the average pairwise distances between genomic regions strongly resembled Hi-C data (Figs.13A-13B). Finally, we quantified genomic fragment resolution (25 to 400 bp), transcription start site enrichment 4888-3636-9385.3 72 002806-000113WOPTAttorney Docket No: 002806-000113WOPT scores, and evenness of whole-genome coverage (Figs.14A-14C), and found that they were similar to that of IGS.

[0245] To assess genomic resolution, we generated ExIGS data from 63 skin fibroblasts and compared it with published IGS data for 106 skin fibroblasts (20) (PGP1). We observed that ExIGS increased the median number of reads per nucleus from 328 ± 114 in unexpanded fibroblasts to 4875 ± 1425 in expanded fibroblasts, an increase of >10-fold (Fig.1H). As expected, reads from each chromosome occupied distinct spatial territories in the nucleus (53) (Fig.12). To further validate that ExIGS preserves 3D genome structure, we clustered reads into homologous chromosomes (see the Materials and methods) and saw that the average pairwise distances between genomic regions strongly resembled Hi-C data (Fig. 13A-13B). Finally, we quantified genomic fragment resolution (25 to 400 bp), transcription start site enrichment scores, and evenness of whole-genome coverage (Figs.14A-14C), and found that they were similar to that of IGS.

[0246] To assess our improved ability to measure nanoscale protein co-localization using expansion, we also generated ExIGS data from 109 IMR-90 fibroblasts, a commonly used cell line in genome regulation and structure studies (29). This data was paired with expansion immunofluorescence imaging of lamin A, H3K9me3 (constitutive heterochromatin), and SC35 (nuclear speckles). To quantify spatial resolution, we calculated full width at half maximum (FWHM) values for DNA amplicons and the nuclear lamina with and without expansion, which revealed a substantial improvement in the diffraction-limited lamina stain (222 nm vs.561 nm, Fig.15). We annotated ExIGS reads contacting each protein stain (Methods); notably, 33.6% of distances were smaller than 200 nm, a lower bound of the diffraction barrier (30). To validate the accuracy of the protein-DNA contacts, we partitioned the genome into 500 kb bins and compared the Lamin A / C, H3K9me3, and SC35 contact frequency in each bin to bulk IMR-90 ATAC-seq (Fig.5G). We found that nuclear lamina and H3K9me3 contacts were correlated to inaccessible regions across all cells (r = 0.52 and 0.26), whereas nuclear speckles contacts were correlated with accessible regions (r = 0.51). Collectively, these analyses demonstrate that ExIGS is capable of measuring genomic DNA and nuclear proteins at enhanced genomic and spatial resolution.

[0247] To evaluate our ability to colocalize DNA and proteins using expansion, we generated ExIGS data from 109 IMR-90 fibroblasts, a commonly used cell line in epigenetics and genome structure studies (54). These data were paired with expansion IF imaging of lamin A / C, H3K9me3 (constitutive heterochromatin), and SC35 (nuclear speckles). To quantify spatial resolution, we calculated full width at half maximum (FWHM) values for DNA amplicons and the nuclear lamina with and without expansion, which revealed a substantial improvement for the IF (222 nm with versus 561 nm without; Fig.15). We also located ExIGS reads relative to each protein stain (Fig.10 and see the Materials and methods); 4888-3636-9385.3 73 002806-000113WOPTAttorney Docket No: 002806-000113WOPT notably, 33.6% of distances were <200 nm, a lower estimate of the optical diffraction barrier (55). To validate the accuracy of DNA-protein contacts, we calculated lamin A / C, H3K9me3, and SC35 contact frequencies (<200 nm) for non-overlapping 500-kb genomic bins and compared them with bulk IMR-90 assay for transposase-accessible chromatin sequencing (ATAC-seq) data (Fig.1I). Across the genome, we found that nuclear speckle contact frequency was correlated with chromatin accessibility (ρ = 0.31), whereas nuclear lamina and H3K9me3 contact frequencies were correlated with inaccessibility (ρ = 0.42 and 0.21). We also show that ExIGS enables measurement of DNA-protein associations at higher genomic resolution (up to 10 kb) across a greater proportion of the genome compared with diffraction- limited IGS or DNA FISH–based methods (Fig.16). Collectively, these analyses demonstrate that integration of untargeted 3D genome sequencing and expansion can greatly enhance the genomic and spatial resolution of DNA and protein measurements.

[0248] Discussion

[0249] Finally, we anticipate that future iterations of ExIGS will expand measurement capabilities in the molecular, spatial, and temporal dimensions. In the molecular dimension, expansion imaging workflows already exist for RNA (22, 23, 46) and protein measurements (47). We note that all of these modalities are compatible with DNA barcoding, and that our optimized in situ SBS sequencing protocol can read out over 20 bases, sufficient to uniquely label over one trillion molecules per experiment. In the spatial dimension, we expect that it will be possible to further enhance both the genomic and spatial resolution by integrating ExIGS with iterative expansion protocols that can achieve 15 to 20x linear expansion (48, 49). Further, given the diversity of nuclear shapes we observed via expansion immunofluorescence imaging of young and old tissues, optimizing hydrogel-based tissue clearing techniques (50) for use with ExIGS will enable study of in vivo nuclear mechanotransduction (51) in healthy and diseased tissues. Lastly, in the temporal dimension, we anticipate that our algorithm for matching images of samples before and after expansion may also be easily adapted to integrate live imaging modalities. For example, by performing live imaging readouts of T cell function or heterogeneous drug response on one imaging system and ExIGS on another, we will be able to directly connect cell behavior to high-resolution genomic measurements. In summary, we anticipate that ExIGS will serve as a launching point for a new generation of spatial methods that connect superresolution imaging phenotypes to diverse genomic readouts.

[0250] Methods

[0251] Cell Culture, Cell Fixation, and Permeabilization

[0252] Human skin fibroblast cell lines AG08468, AG09602, and Hutchinson-Gilford Progeria Syndrome cell lines (AG01972) were obtained from the Coriell Institute and cultured in Eagle's Minimum Essential Medium (ATCC, 30-2003) with non-essential amino acids, L-glutamine, 15% FBS, and 1x 4888-3636-9385.3 74 002806-000113WOPTAttorney Docket No: 002806-000113WOPT Penicillin-Streptomycin (Hyclone #SV30010) at 37°C with 5% CO2. For immunofluorescence staining and IGS experiments, approximately 5000 cells were seeded on ethanol-sterilized 40 mm coverslips (Bioptechs #40-1313-0319) in silicone gaskets (Grace Bio-Labs 621301) and allowed to attach for 24 hours. Cells were washed twice with 1X PBS for 5 minutes each, fixed with 4% methanol-free paraformaldehyde in PBS for 10 minutes at room temperature (Biotium #22023), and quenched with 100mM Tris pH 8 in PBS for 10 minutes with gentle shaking. Following three washes with 1X PBS, cells were permeabilized with 0.5% Triton X-100 in PBS for 10 minutes and washed again. Cells were then treated with 0.1N HCl for 10 minutes and washed three more times with 1X PBS. Next, cells were stained with DAPI (1 μg / ml in PBS) for 10 minutes, washed with PBST, and a pre-expansion 10x10 montage was taken using a 10x objective and 1x zoom with a 2-micron Z-step. Nuclei were counted before tagmentation, and pre-expanded nuclei were registered to measure the expansion factor. Cells were then ready for tagmentation.

[0253] Expansion In Situ Sequencing

[0254] Adapter Annealing: Adapter sequences (Table 3) and Mosaic end complement (ME) were resuspended at 100μM in nuclease-free water. Adapter1 and Adapter2 were annealed separately with ME (50μM adapter + 50μM ME) using a thermal ramp from 95°C to 25°C over 1 hour in a thermocycler. Annealed adapters were mixed with glycerol (1:1) and stored at -20°C. Tn5 loading buffer was prepared and stored at -20°C in aliquots. Tn5 was loaded with adapters using the loading reaction buffer (25μM each of Ad1 and Ad2 adapters, 50μM ME, 10mM Tris pH 8, and 50mM NaCl) and incubated for 30 minutes at room temperature. Loaded Tn5 was stored at -20°C until library preparation.

[0255] Tn5 loading and Tagmentation: For loading of the Tn5 enzyme, 1µl of Tn5 was mixed with 1µl of annealed adapters and 2µl of Tn5 loading buffer (50mM Tris-HCl pH 8, 100mM NaCl, 0.1mM EDTA, 0.1% NP-40, 1mM DTT, and 50% glycerol), and incubated at room temperature for 30 minutes. For tagmentation, cells were pre-incubated with loaded Tn5 in a fresh 2X high salt tagmentation buffer containing 66mM Tris acetate, 132mM potassium acetate, and 33% DMF, excluding Mg-acetate, for 1-3 hours on ice or at 4°C. The first tagmentation reaction was initiated by adding Mg-acetate to a final concentration of 10mM and incubating cells at 37°C in a humidified box for 1 hour. Following the first tagmentation, cells were washed three times for 10 minutes each with Tn5 wash buffer (50mM EDTA, 0.01% SDS in 1X PBS) at 45°C, followed by two washes with 1X PBST. This process was repeated for a second tagmentation overnight at 37°C. Post-tagmentation, cells were washed three times for 10 minutes each with Tn5 wash buffer, followed by a wash with 40% formamide / 2X SSC at 37°C for 15 minutes, and two final washes with 1X PBST before proceeding with hairpin annealing. 4888-3636-9385.3 75 002806-000113WOPTAttorney Docket No: 002806-000113WOPT

[0256] Hairpin Annealing and Hybridization: Hairpin oligos (listed in Table 3) were combined at a concentration of 250nM each in 4x SSC and annealed using a thermocycler programmed with an initial denaturation step at 95°C for 5 minutes, followed by a gradual cooling ramp from 95°C to 20°C at a rate of 1°C per cycle. Cells were incubated with the hairpin mix for 2 hours at 37°C, followed by three washes with 1X PBST at room temperature.

[0257] Gap-Fill Ligation: Cells were washed with 1X Ampligase buffer at room temperature. Next, the gap-fill ligation mix, containing 1x Ampligase buffer, 50mM KCl, 2U / µl Phusion polymerase, 10% formamide, 0.1U / µl Ampligase, and 10mM dNTPs, was added to the cells. The sample was then incubated for 1 hour on ice or at 4°C with gentle shaking to facilitate diffusion. Subsequently, the cells were incubated at 37°C for 1 hour, followed by 45°C for 1 hour. After incubation, the cells were washed with PBST at room temperature.

[0258] Immunofluorescence: After the gap-fill ligation reaction, cells were blocked in 2% BSA in 1X PBST for 1 hour at room temperature. Cells were then stained with primary antibodies diluted in 2% BSA / PBST (Tables 4 and 5) overnight at 4°C without shaking. After primary antibody staining, cells were washed three times for 10 minutes each with 1X PBST at room temperature. Cells were then stained with secondary antibodies (Tables 4 and 5) diluted 1:200 in 2% BSA in PBST for 1 hour at room temperature. Following incubation, cells were washed three times for 10 minutes each with 1X PBST.

[0259] Hairpin Lock Oligo Hybridization: Hairpin lock oligos (Table 3) have an amino group on the 3' end and an acrydite group on the 5’end. The amino group gets converted to a Methyl Acrylate group during MA-NHS treatment, which facilitates the secure locking of hairpins to the acrylamide gel polymer during the expansion gel embedding step. The lock oligos were hybridized at 2µM final concentration in 10% formamide / 4X SSC at 37°C for 3 hours. Cells were then washed twice with 20% Formamide / 2X SSC for 15 minutes each at 37°C, followed by three 5-minute washes with PBST to remove any remaining lock wash buffer.

[0260] MA-NHS Treatment: A 1M stock solution of MA-NHS (Methacrylic acid N-hydroxysuccinimide ester (Sigma-Aldrich, cat# 730300) was prepared by dissolving 183.16 mg of MA-NHS ester in 1000 μL of anhydrous dimethyl sulfoxide (DMSO) (Thermo Fisher Scientific, catalog number 276855). Aliquots (each containing 20 μL) were stored at -20°C until use. For treatment, an aliquot of MA-NHS ester was thawed and diluted to a 5 mM solution with phosphate-buffered saline (PBS). Cells were then treated with the 5 mM MA-NHS ester solution for 1 hour at room temperature, followed by three washes with 1X PBST for 10 minutes each.

[0261] Expansion gel formulation: The Magnify expansion gel formulation was adapted from Klimas et al.2023 (52) and optimized for expansion genome sequencing. The optimized formulation provided a 4888-3636-9385.3 76 002806-000113WOPTAttorney Docket No: 002806-000113WOPT dense network of acrylamide polymers, ensuring maximum linking efficiency of genomic fragments while maintaining a comparable expansion factor for nanoscale resolution of genomic structures. The final gel composition included 4% N,N-Dimethylacrylamide (Cat# 274135, Sigma-Aldrich), 6% acrylamide (Cat# A4058, Sigma-Aldrich), 34% sodium acrylate (Cat# R624, AK Scientific), 0.001% N,N'-Methylenebis(acrylamide) (bis-acrylamide; Cat# M7279, Sigma-Aldrich), 1% NaCl (Cat# S7653, Sigma-Aldrich), 0.15% ammonium persulfate (APS; Cat# A3678, Sigma-Aldrich), and 0.15% N,N,N',N'- Tetramethylethylenediamine (TEMED; Cat# T9281, Sigma-Aldrich) in 1X PBS. The gel stock was prepared and stored in aliquots at -20°C for long-term storage.

[0262] Sample embedding and expansion: We prepared a gel chamber using a microscope glass slide and strips of scotch tape on both sides, leaving a gap in the middle. The glass slide was treated with sigmacote to avoid sticking of glass to the gel. Next, the gasket from the cell coverslip was carefully removed with a razor and the coverslip was cut to the size of the gel chamber. The coverslip was then inverted on a glass slide with spacers. The setup was clamped with paper clamps ensuring the formation of a leak proof chamber around cells. Next, the expansion gel solution (94 µl Magnify gel, 1.5 µl 10% TEMED, 1.5 µl 0.05% 4HT, 1.5 µl 10% APS and 1.5ul of H2O) was added to the chamber using a 20 µl tip. The setup was incubated on ice or at 4°C for 30 minutes, then transferred to a humidified box and incubated at 37°C for 2 hours to polymerize.

[0263] Gel embedding and expansion: A gel chamber was prepared using a microscope glass slide and strips of Scotch tape on both sides, leaving a gap in the middle. The glass slide was treated with SIGMACOTE™ to prevent the gel from sticking to the glass. The gasket from the cell coverslip was carefully removed with a razor, and the coverslip was cut to the size of the gel chamber. The coverslip was then inverted on a glass slide with spacers, and the setup was clamped with paper clamps to ensure the formation of a leak-proof chamber around the cells. The expansion gel solution (94 µl Magnify gel, 1.5 µl 10% TEMED, 1.5 µl 0.05% 4HT, 1.5 µl 10% APS, and 1.5 µl H2O) was added to the chamber using a 20 µl tip. The setup was incubated on ice or at 4°C for 30 minutes, then transferred to a humidified box and incubated at 37°C for 2 hours to polymerize. The gel was then trimmed to the size of the sample and incubated in digestion buffer (50mM Tris-HCl pH 8.5, 1mM EDTA, 0.8M Guanidine HCl, 0.5% Triton X-100) containing 8 U / ml of Proteinase K overnight at room temperature. The gel was allowed to expand by washing three times for 20 minutes each with nuclease-free water.

[0264] Re-embedding and passivation of expanded gel: To re-embed and passivate the expanded gel, we initially stabilized the gel on a glass-bottom 6-well plate by embedding it into a secondary acrylamide gel. The expanded gel was sectioned into small pieces, with each piece transferred to a well of a glass-bottom 6-well plate treated with 0.6% Bind-Silane (Cat# M6514, Sigma-Aldrich). The gel pieces were re- 4888-3636-9385.3 77 002806-000113WOPTAttorney Docket No: 002806-000113WOPT embedded by immersing them in a solution of 2.7% acrylamide (Cat# A3553, Sigma-Aldrich), 0.005% ammonium persulfate (APS; Cat# A3678, Sigma-Aldrich), and 0.005% N,N,N',N'- tetramethylethylenediamine (TEMED; Cat# T9281, Sigma-Aldrich) for 10 minutes on ice. Excess acrylamide solution was then removed by aspiration, followed by nitrogen perfusion in a humid airtight container and incubation at 37°C for 1 hour. To neutralize the charge on the gel polymers due to sodium acrylate, we performed gel passivation using 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC; Cat# E7750, Sigma-Aldrich) and N-Hydroxysuccinimide (NHS; Cat# 130672, Sigma-Aldrich) chemistry in a two-step reaction. Initially, the gel was treated with 150 mM EDC, 150 mM NHS, and 2 M ethanolamine (Cat# E9508, Sigma-Aldrich) in 100 mM 2-(N-morpholino)ethanesulfonic acid (MES; Cat# M1317, Sigma-Aldrich) buffer (pH 6.8) for 2 hours at room temperature. Following this reaction, the solution was discarded, and the gel was washed with 2 M ethanolamine in 62.5 mM sodium borate (Thermo scientific, AAJ62902AK; pH 8.5) for 40 minutes at room temperature, followed by three washes with 1X PBST, each for 5 minutes.

[0265] Rolling circle amplification:For rolling circle amplification (RCA), a 2 µM RCA primer was hybridized in 20% formamide / 2xSSC for 3 hours at 37°C. The sample was then washed three times with 20% formamide / 2xSSC and three times with PBST. Following this, an overnight RCA reaction was performed using a mixture containing 500 µM dNTP (NEB, Cat# N0447S), 50 µM amino-allyl-dUTP (Thermo Scientific, Cat# R1091), 1 mM DTT (Thermo Scientific, Cat# R0861), and 1 U / µl EquiPhi29 (Thermo Scientific, Cat# A39392) in 1X EquiPhi29 buffer. A 2.5 mm thick rubber gasket was placed around the gel, 300 µL of the RCA mix was added, and the sample was incubated at 30°C for 16 hours. The next day, the gel was washed three times with PBST and then crosslinked with 5 mM BS(PEG)9 in PBS (Thermo Scientific, Cat# 21582) for 1 hour at room temperature. The crosslinking was quenched by washing the gel with 1 M Tris-HCl (pH 8) for 20 minutes at room temperature, followed by three additional washes with PBST. Finally, free 3’OH groups were blocked by incorporating dideoxy nucleotides using terminal transferase in a mixture containing 200 µM ddNTP mix (AAT Bioquest, Cat# 17205), 250 µM CoCl2, and 0.4 U / µl terminal transferase (NEB, Cat# M0315S) in 1X TdT buffer, incubating for 1 hour at 37°C.

[0266] References I. Jerkovic, G. Cavalli, Understanding 3D genome organization by multidisciplinary methods. Nat. Rev. Mol. Cell Biol.22, 511–528 (2021). 2. A. Hafner, A. Boettiger, The spatial organization of transcriptional control. Nat. Rev. Genet.24, 53–68 (2023). 3. S. E. Johnstone, A. Reyes, Y. Qi, C. Adriaens, E. Hegazi, K. Pelka, J. H. Chen, L. S. Zou, Y. Drier, V. 4888-3636-9385.3 78 002806-000113WOPTAttorney Docket No: 002806-000113WOPT Hecht, N. Shoresh, M. K. Selig, C. A. Lareau, S. Iyer, S. C. Nguyen, E. F. Joyce, N. Hacohen, R. A. Irizarry, B. Zhang, M. J. Aryee, B. E. Bernstein, Large-Scale Topological Changes Restrain Malignant Progression in Colorectal Cancer. Cell 182, 1474–1489.e23 (2020). 4. L. Tan, J. Shi, S. Moghadami, B. Parasar, C. P. Wright, Y. Seo, K. Vallejo, I. Cobos, L. Duncan, R. Chen, K. Deisseroth, Lifelong restructuring of 3D genome architecture in cerebellar granule cells. Science 381, 1112–1119 (2023). 5. M. A. Ricci, C. Manzo, M. F. García-Parajo, M. Lakadamyali, M. P. Cosma, Chromatin fibers are formed by heterogeneous groups of nucleosomes in vivo. Cell 160, 1145–1158 (2015). 6. A. N. Boettiger, B. Bintu, J. R. Moffitt, S. Wang, B. J. Beliveau, G. Fudenberg, M. Imakaev, L. A. Mirny, C.-T. Wu, X. Zhuang, Super-resolution imaging reveals distinct chromatin folding for different epigenetic states. Nature 529, 418–422 (2016). 7. H. D. Ou, S. Phan, T. J. Deerinck, A. Thor, M. H. Ellisman, C. C. O’Shea, ChromEMT: Visualizing 3D chromatin structure and compaction in interphase and mitotic cells. Science 357 (2017). 8. A. Szczurek, L. Klewes, J. Xing, A. Gourram, U. Birk, H. Knecht, J. W. Dobrucki, S. Mai, C. Cremer, Imaging chromatin nanostructure with binding-activated localization microscopy based on DNA structure fluctuations. Nucleic Acids Res.45, e56 (2017). 9. T. Nozaki, R. Imai, M. Tanbo, R. Nagashima, S. Tamura, T. Tani, Y. Joti, M. Tomita, K. Hibino, M. T. Kanemaki, K. S. Wendt, Y. Okada, T. Nagai, K. Maeshima, Dynamic Organization of Chromatin Domains Revealed by Super-Resolution Live-Cell Imaging. Mol. Cell 67, 282–293.e7 (2017). 10. E. Miron, R. Oldenkamp, J. M. Brown, D. M. S. Pinto, C. S. Xu, A. R. Faria, H. A. Shaban, J. D. P. Rhodes, C. Innocent, S. de Ornellas, H. F. Hess, V. Buckle, L. Schermelleh, Chromatin arranges in chains of mesoscale domains with nanoscale functional topography independent of cohesin. Sci Adv 6 (2020). 11. L. Xie, P. Dong, X. Chen, T.-H. S. Hsieh, S. Banala, M. De Marzio, B. P. English, Y. Qi, S. K. Jung, K.-R. Kieffer-Kwon, W. R. Legant, A. S. Hansen, A. Schulmann, R. Casellas, B. Zhang, E. Betzig, L. D. Lavis, H. Y. Chang, R. Tjian, Z. Liu, 3D ATAC-PALM: super-resolution imaging of the accessible genome. Nat. Methods 17, 430–436 (2020). 12. J. Xu, X. Sun, K. Kim, R. M. Brand, D. Hartman, H. Ma, R. E. Brand, M. Bai, Y. Liu, Ultrastructural visualization of chromatin in cancer pathogenesis using a simple small-molecule fluorescent probe. Sci Adv 8, eabm8293 (2022). 13. M. Gelléri, S.-Y. Chen, B. Hübner, J. Neumann, O. Kröger, F. Sadlo, J. Imhoff, M. J. Hendzel, M. Cremer, T. Cremer, H. Strickfaden, C. Cremer, True-to-scale DNA-density maps correlate with major accessibility differences between active and inactive chromatin. Cell Rep.42, 112567 (2023). 14. J. Xu, H. Ma, J. Jin, S. Uttam, R. Fu, Y. Huang, Y. Liu, Super-Resolution Imaging of Higher-Order 4888-3636-9385.3 79 002806-000113WOPTAttorney Docket No: 002806-000113WOPT Chromatin Structures at Different Epigenomic States in Single Mammalian Cells. Cell Rep.24, 873–882 (2018). 15. H. Q. Nguyen, S. Chattoraj, D. Castillo, S. C. Nguyen, G. Nir, A. Lioutas, E. A. Hershberg, N. M. C. Martins, P. L. Reginato, M. Hannan, B. J. Beliveau, G. M. Church, E. R. Daugharthy, M. A. Marti- Renom, C.-T. Wu, 3D mapping and accelerated super-resolution imaging of the human genome using in situ sequencing. Nat. Methods 17, 822–832 (2020). 16. J.-H. Su, P. Zheng, S. S. Kinrot, B. Bintu, X. Zhuang, Genome-Scale Imaging of the 3D Organization and Transcriptional Activity of Chromatin. Cell 182, 1641–1659.e26 (2020). 17. Y. Takei, J. Yun, S. Zheng, N. Ollikainen, N. Pierson, J. White, S. Shah, J. Thomassie, S. Suo, C.-H. L. Eng, M. Guttman, G.-C. Yuan, L. Cai, Integrated spatial genomics reveals global architecture of single nuclei. Nature 590, 344–350 (2021). 18. Y. Takei, S. Zheng, J. Yun, S. Shah, N. Pierson, J. White, S. Schindler, C. H. Tischbirek, G.-C. Yuan, L. Cai, Single-cell nuclear architecture across cell types in the mouse brain. Science 374, 586–594 (2021). 19. T. Lu, C. E. Ang, X. Zhuang, Spatially resolved epigenomic profiling of single cells in complex tissues. Cell 185, 4448–4464.e17 (2022). 20. A. C. Payne, Z. D. Chiang, P. L. Reginato, S. M. Mangiameli, E. M. Murray, C.-C. Yao, S. Markoulaki, A. S. Earl, A. S. Labade, R. Jaenisch, G. M. Church, E. S. Boyden, J. D. Buenrostro, F. Chen, In situ genome sequencing resolves DNA sequence and structure in intact biological samples. Science 371 (2021). 21. F. Chen, P. W. Tillberg, E. S. Boyden, Optical imaging. Expansion microscopy. Science 347, 543– 548 (2015). 22. F. Chen, A. T. Wassie, A. J. Cote, A. Sinha, S. Alon, S. Asano, E. R. Daugharthy, J.-B. Chang, A. Marblestone, G. M. Church, A. Raj, E. S. Boyden, Nanoscale imaging of RNA with expansion microscopy. Nat. Methods 13, 679–684 (2016). 23. S. Alon, D. R. Goodwin, A. Sinha, A. T. Wassie, F. Chen, E. R. Daugharthy, Y. Bando, A. Kajita, A. G. Xue, K. Marrett, R. Prior, Y. Cui, A. C. Payne, C.-C. Yao, H.-J. Suk, R. Wang, C.-C. J. Yu, P. Tillberg, P. Reginato, N. Pak, S. Liu, S. Punthambaker, E. P. R. Iyer, R. E. Kohman, J. A. Miller, E. S. Lein, A. Lako, N. Cullen, S. Rodig, K. Helvie, D. L. Abravanel, N. Wagle, B. E. Johnson, J. Klughammer, M. Slyper, J. Waldman, J. Jané-Valbuena, O. Rozenblatt-Rosen, A. Regev, IMAXT Consortium, G. M. Church, A. H. Marblestone, E. S. Boyden, Expansion sequencing: Spatially precise in situ transcriptomics in intact biological systems. Science 371 (2021). 4888-3636-9385.3 80 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 24. G. Wen, M. Vanheusden, V. Leen, T. Rohand, K. Vandereyken, T. Voet, J. Hofkens, A Universal Labeling Strategy for Nucleic Acids in Expansion Microscopy. J. Am. Chem. Soc.143, 13782–13789 (2021). 25. M. A. Woodworth, K. K. H. Ng, A. R. Halpern, N. A. Pease, P. H. B. Nguyen, H. Y. Kueh, J. C. Vaughan, Multiplexed single-cell profiling of chromatin states at genomic loci by expansion microscopy. Nucleic Acids Res.49, e82 (2021). 26. M. E. Pownall, L. Miao, C. E. Vejnar, O. M’Saad, A. Sherrard, M. A. Frederick, M. D. J. Benitez, C. W.Boswell, K. S. Zaret, J. Bewersdorf, A. J. Giraldez, Chromatin expansion microscopy reveals nanoscale organization of transcription and chromatin. Science 381, 92–100 (2023). 27. X. Chen, Y. Shen, W. Draper, J. D. Buenrostro, U. Litzenburger, S. W. Cho, A. T. Satpathy, A. C. Carter, R. P. Ghosh, A. East-Seletsky, J. A. Doudna, W. J. Greenleaf, J. T. Liphardt, H. Y. Chang, ATAC-see reveals the accessible genome by transposase-mediated imaging and sequencing. Nat. Methods 13, 1013–1020 (2016). 28. D. Feldman, A. Singh, J. L. Schmid-Burgk, R. J. Carlson, A. Mezger, A. J. Garrity, F. Zhang, P. C. Blainey, Optical Pooled Screens in Human Cells. Cell 179 (2019). 29. Roadmap Epigenomics Consortium, A. Kundaje, W. Meuleman, J. Ernst, M. Bilenky, A. Yen, A. Heravi-Moussavi, P. Kheradpour, Z. Zhang, J. Wang, M. J. Ziller, V. Amin, J. W. Whitaker, M. D. Schultz, L. D. Ward, A. Sarkar, G. Quon, R. S. Sandstrom, M. L. Eaton, Y.-C. Wu, A. R. Pfenning, X. Wang, M. Claussnitzer, Y. Liu, C. Coarfa, R. A. Harris, N. Shoresh, C. B. Epstein, E. Gjoneska, D. Leung, W. Xie, R. D. Hawkins, R. Lister, C. Hong, P. Gascard, A. J. Mungall, R. Moore, E. Chuah, A. Tam, T. K. Canfield, R. S. Hansen, R. Kaul, P. J. Sabo, M. S. Bansal, A. Carles, J. R. Dixon, K.-H. Farh, S. Feizi, R. Karlic, A.-R Kim, A. Kulkarni, D. Li, R. Lowdon, G. Elliott, T. R. Mercer, S. J. Neph, V. Onuchic, P. Polak, N. Rajagopal, P. Ray, R. C. Sallari, K. T. Siebenthall, N. A. Sinnott-Armstrong, M. Stevens, R. E. Thurman, J. Wu, B. Zhang, X. Zhou, A. E. Beaudet, L. A. Boyer, P. L. De Jager, P. J. Farnham, S. J. Fisher, D. Haussler, S. J. M. Jones, W. Li, M. A. Marra, M. T. McManus, S. Sunyaev, J. A. Thomson, T. D. Tlsty, L.-H. Tsai, W. Wang, R. A. Waterland, M. Q. Zhang, L. H. Chadwick, B. E. Bernstein, J. F. Costello, J. R. Ecker, M. Hirst, A. Meissner, A. Milosavljevic, B. Ren, J. A. Stamatoyannopoulos, T. Wang, M. Kellis, Integrative analysis of 111 reference human epigenomes. Nature 518, 317–330 (2015). 30. B. Huang, H. Babcock, X. Zhuang, Breaking the diffraction barrier: super-resolution imaging of cells. Cell 143, 1047–1058 (2010). 31. R. de Leeuw, Y. Gruenbaum, O. Medalia, Nuclear Lamins: Thin Filaments with Major Functions. Trends Cell Biol.28, 34–45 (2018). 4888-3636-9385.3 81 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 32. B. Nmezi, J. Xu, R. Fu, T. J. Armiger, G. Rodriguez-Bey, J. S. Powell, H. Ma, M. Sullivan, Y. Tu, N. Y. Chen, S. G. Young, D. B. Stolz, K. N. Dahl, Y. Liu, Q. S. Padiath, Concentric organization of A-and B-type lamins predicts their distinct roles in the spatial organization and stability of the nuclear lamina. Proc. Natl. Acad. Sci. U. S. A.116, 4307–4315 (2019). 33. N. Briand, P. Collas, Lamina-associated domains: peripheral matters and internal affairs. Genome Biol.21, 85 (2020). 34. K. L. Reddy, J. M. Zullo, E. Bertolino, H. Singh, Transcriptional repression mediated by repositioning of genes to the nuclear lamina. Nature 452, 243–247 (2008). 35. H. Wang, X. Xu, C. M. Nguyen, Y. Liu, Y. Gao, X. Lin, T. Daley, N. H. Kipniss, M. La Russa, L. S. Qi, CRISPR-Mediated Programmable 3D Genome Positioning and Nuclear Organization. Cell 175, 1405–1417.e14 (2018). 36. B. C. Capell, F. S. Collins, Human laminopathies: nuclei gone genetically awry. Nat. Rev. Genet.7, 940–952 (2006). 37. L. B. Gordon, W. Ted Brown, F. S. Collins, Hutchinson-Gilford Progeria Syndrome (University of Washington, Seattle, 2023). 38. R. D. Goldman, D. K. Shumaker, M. R. Erdos, M. Eriksson, A. E. Goldman, L. B. Gordon, Y. Gruenbaum, S. Khuon, M. Mendez, R. Varga, F. S. Collins, Accumulation of mutant lamin A causes progressive changes in nuclear architecture in Hutchinson-Gilford progeria syndrome. Proc. Natl. Acad. Sci. U. S. A 101, 8963–8968 (2004). 39. D. K. Shumaker, T. Dechat, A. Kohlmaier, S. A. Adam, M. R. Bozovsky, M. R. Erdos, M. Eriksson, A. E. Goldman, S. Khuon, F. S. Collins, T. Jenuwein, R. D. Goldman, Mutant nuclear lamin A leads to progressive alterations of epigenetic control in premature aging. Proc. Natl. Acad. Sci. U. S. A.103, 8703–8708 (2006). 40. J. Perovanovic, S. Dell’Orso, V. F. Gnochi, J. K. Jaiswal, V. Sartorelli, C. Vigouroux, K. Mamchaoui, V. Mouly, G. Bonne, E. P. Hoffman, Laminopathies disrupt epigenomic developmental programs and cell fate. Sci. Transl. Med.8, 335ra58 (2016). 41. F. Köhler, F. Bormann, G. Raddatz, J. Gutekunst, S. Corless, T. Musch, A. S. Lonsdorf, S. Erhardt, F. Lyko, M. Rodríguez-Paredes, Epigenetic deregulation of lamina-associated domains in Hutchinson- Gilford progeria syndrome. Genome Med.12, 46 (2020). 42. E. Sebestyén, F. Marullo, F. Lucini, C. Petrini, A. Bianchi, S. Valsoni, I. Olivieri, L. Antonelli, F. Gregoretti, G. Oliva, F. Ferrari, C. Lanzuolo, SAMMY-seq reveals early alteration of heterochromatin and deregulation of bivalent genes in Hutchinson-Gilford Progeria Syndrome. Nat. Commun.11, 6274 (2020). 4888-3636-9385.3 82 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 43. R. P. McCord, A. Nazario-Toole, H. Zhang, P. S. Chines, Y. Zhan, M. R. Erdos, F. S. Collins, J. Dekker, K. Cao, Correlated alterations in genome organization, histone methylation, and DNA-lamin A / C interactions in Hutchinson-Gilford progeria syndrome. Genome Res.23, 260–269 (2013). 44. T. J. Stevens, D. Lando, S. Basu, L. P. Atkinson, Y. Cao, S. F. Lee, M. Leeb, K. J. Wohlfahrt, W. Boucher, A. O’Shaughnessy-Kirwan, J. Cramard, A. J. Faure, M. Ralser, E. Blanco, L. Morey, M. Sansó, M. G. S. Palayret, B. Lehner, L. Di Croce, A. Wutz, B. Hendrich, D. Klenerman, E. D. Laue, 3D structures of individual mammalian genomes studied by single-cell Hi-C. Nature 544, 59–64 (2017). 45. R. Patrick, M. Naval-Sanchez, N. Deshpande, Y. Huang, J. Zhang, X. Chen, Y. Yang, K. Tiwari, M. Esmaeili, M. Tran, A. R. Mohamed, B. Wang, D. Xia, J. Ma, J. Bayliss, K. Wong, M. L. Hun, X. Sun, B. Cao, D. L. Cottle, T. Catterall, H. Barzilai-Tutsch, R.-L. Troskie, Z. Chen, A. F. Wise, S. Saini, Y. M. Soe, S. Kumari, M. J. Sweet, H. E. Thomas, I. M. Smyth, A. L. Fletcher, K. Knoblich, M. J. Watt, M. Alhomrani, W. Alsanie, K. M. Quinn, T. D. Merson, A. P. Chidgey, S. D. Ricardo, D. Yu, T. Jardé, S. W. Cheetham, C. Marcelle, S. K. Nilsson, Q. Nguyen, M. D. White, C. M. Nefzger, The activity of early-life gene regulatory elements is hijacked in aging through pervasive AP-1-linked chromatin opening. Cell Metab., doi: 10.1016 / j.cmet.2024.06.006 (2024). 46. Y. Wang, M. Eddison, G. Fleishman, M. Weigert, S. Xu, T. Wang, K. Rokicki, C. Goina, F. E. Henry, A. L.Lemire, U. Schmidt, H. Yang, K. Svoboda, E. W. Myers, S. Saalfeld, W. Korff, S. M. Sternson, P. W.Tillberg, EASI-FISH for thick tissue defines lateral hypothalamus spatio-molecular organization. Cell 184,6361–6377.e24 (2021). 47. Y. Bai, B. Zhu, J.-P. Oliveria, B. J. Cannon, D. Feyaerts, M. Bosse, K. Vijayaragavan, N. F. Greenwald, D.Phillips, C. M. Schürch, S. M. Naik, E. A. Ganio, B. Gaudilliere, S. J. Rodig, M. B. Miller, M. Angelo, S. C.Bendall, X. Rovira-Clavé, G. P. Nolan, S. Jiang, Expanded vacuum-stable gels for multiplexed high-resolution spatial histopathology. Nat. Commun.14, 4013 (2023). 48. J.-B. Chang, F. Chen, Y.-G. Yoon, E. E. Jung, H. Babcock, J. S. Kang, S. Asano, H.-J. Suk, N. Pak, P. W.Tillberg, A. T. Wassie, D. Cai, E. S. Boyden, Iterative expansion microscopy. Nat. Methods 14, 593– 599(2017). 49. O. M’Saad, J. Bewersdorf, Light microscopy of proteins in their ultrastructural context. Nat. Commun.11,3850 (2020). 50. K. Chung, J. Wallace, S.-Y. Kim, S. Kalyanasundaram, A. S. Andalman, T. J. Davidson, J. J. Mirzabekov,K. A. Zalocusky, J. Mattis, A. K. Denisin, S. Pak, H. Bernstein, C. Ramakrishnan, L. Grosenick, V.Gradinaru, K. Deisseroth, Structural and molecular interrogation of intact biological systems. Nature 497,332–337 (2013). 51. C. Uhler, G. V. Shivashankar, Regulation of genome organization and gene expression by nuclear 4888-3636-9385.3 83 002806-000113WOPTAttorney Docket No: 002806-000113WOPT mechanotransduction. Nat. Rev. Mol. Cell Biol.18, 717–727 (2017). 52. A. Klimas, B. R. Gallagher, P. Wijesekara, S. Fekir, E. F. DiBernardo, Z. Cheng, D. B. Stolz, F. Cambi, S.C. Watkins, S. L. Brody, A. Horani, A. L. Barth, C. I. Moore, X. Ren, Y. Zhao, Magnify is a universal molecular anchoring strategy for expansion microscopy. Nat. Biotechnol.41, 858–869 (2023). 53. T. Cremer, M. Cremer, Chromosome territories. Cold Spring Harb. Perspect. Biol.2,a003889 (2010). doi: 10.1101 / cshperspect.a003889; pmid: 2030021737. 54. A. Kundaje et al., Integrative analysis of 111 reference human epigenomes. Nature 518,317–330 (2015). doi: 10.1038 / nature14248; pmid: 2569356338. 55. B. Huang, H. Babcock, X. Zhuang, Breaking the diffraction barrier: Super-resolutionimaging of cells. Cell 143, 1047–1058 (2010). doi: 10.1016 / j.cell.2010.12.002;pmid: 2116820139.

[0267] Table 1 sample_name # of cells # of cells with > # of cells # of % of amplicons sequenced 1k matched with high putative recovered %%%% %

[0268] Table 2 # Species Association rule: Basal+extension: 5000 bp l4888-3636-9385.3 8 002806-000113WOPTAttorney Docket No: 002806-000113WOPT # Term Binom Hyper Hyper Ontol Name Bin Bino Bino Bino Bino Region Hy FDR Q- Hyper Hype Hy Gene ogy om m m m m Set pe Val Fold r per Set ra 56 04 52 65 82 63 76 83 94 47 02 42 94 47 40 094888-3636-9385.3 85 002806-000113WOPTAttorney Docket No: 002806-000113WOPT GO contractil 11 4.15 6.28 2.195 124 0.0210 44 0.0051 1.415 87 22 0.0169 Cellul e fiber 4 E-15 E-14 422 8126 65703 29 5 5906 ar 59 41 61 34 34 29 42 02 07 25 68 12 46 63 81 35 33 844888-3636-9385.3 86 002806-000113WOPTAttorney Docket No: 002806-000113WOPT onent GO cytoplas 23 3.52 2.56 5.008 13 0.0022 67 0.0206 2.928 8 10 0.0015 lll i i 54Name Sequence SEQID4888-3636-9385.3 87 002806-000113WOPTAttorney Docket No: 002806-000113WOPT primer5 Ex situ forward AATGATACGGCGACCACCGAGATCTACAC 15 rim rN - unique Mixed bases

[0270] a e For in situ sequencing:Primary Antibodies4888-3636-9385.3 88 002806-000113WOPTAttorney Docket No: 002806-000113WOPT

[0271] Table 5 For expansion immunoflouresence:Primary AntibodiesProtein Vendor Catalog Number RRID 6

[0272] Table 6 For imaging of in situ sequencing bases:Excitation Emission Laser Exposure l i h i fil iFor immunofluorescence imaging: 4888-3636-9385.3 89 002806-000113WOPTAttorney Docket No: 002806-000113WOPT Dichro Emission Excitation laser ic filters Flourophores 44888-3636-9385.3 90 002806-000113WOPT

Claims

Attorney Docket No: 002806-000113WOPT What is claimed herein is:

1. A method comprising: a) contacting a sample comprising at least one nucleic acid molecule with: i) a fixative reagent; ii) a detergent; and iii) optionally a reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids; to provide a fixed sample; b) contacting the fixed sample with an encapsulation solution comprising: i) acrylamide; ii) bis-acrylamide; iii) sodium acrylate; iv) sodium chloride; v) TEMED; vi) ammonium persulfate; and vii) optionally 4HT; to provide a solution comprising the fixed sample; c) contacting the solution comprising the fixed sample with a carrier oil to provide a droplet comprising the fixed sample; d) contacting the droplet comprising the fixed sample with: i) an emulsion breaking solution comprising at least one deemulsifier; ii) a digestion solution comprising at least one protease; and / or iii) a low positive ion expansion solution; thereby by removing the carrier oil, digesting proteins in the droplet comprising the fixed sample, and expanding the droplet comprising the fixed sample to provide an expanded sample; and e) sequencing one or more nucleic acid sequences in the expanded sample and / or detecting the location of one or more nucleic acid sequences in the expanded sample.

2. A method comprising sequencing one or more nucleic acid sequences in an expanded sample and / or detecting the location of one or more nucleic acid sequences in an expanded sample. 4888-3636-9385.3 91 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 3. The method of any one of the preceding claims, wherein the nucleic acid sequence is present in genomic DNA.

4. The method of any one of the preceding claims, wherein the at least one nucleic acid molecule is at least one chromosome.

5. The method of any one of the preceding claims, wherein the fixative reagent is selected from the group consisting of: formaldehyde; paraformaldehyde (PFA); glutaraldehyde (GA); ethylene glycol bis(succinimidyl succinate) (EGS); dimethyl adipimidate (DMA); and discuccinimidyl glutarate (DSG).

6. The method of any one of the preceding claims, wherein the fixative reagent is formaldehyde.

7. The method of any one of the preceding claims, wherein the detergent is selected from the group consisting of: nonyl phenoxypolyethoxylethanol (NP-40); 2-[4-(2,4,4-trimethylpentan-2- yl)phenoxy]ethanol (Triton X-100); polysorbate 20 (Tween 20), and digitonin.

8. The method of any one of the preceding claims, wherein the detergent is NP-40.

9. The method of any one of the preceding claims, wherein the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids is selected from the group consisting of: Methacrylic acid N-hydroxysuccinimide ester (MA-NHS); and LabelX.

10. The method of any one of the preceding claims, wherein the reagent that introduces an acrylic or methacrylic moiety to peptides and / or nucleic acids is MA-NHS.

11. The method of any one of the preceding claims, wherein contacting the sample comprising the fixed sample comprises contacting at least one cell comprising the at least one nucleic acid molecule.

12. The method of claim 11, wherein at least one droplet formed in step c comprises one cell.

13. The method of claim 11, wherein at least one droplet formed in step c comprises only one cell.

14. The method of any one of the preceding claims, wherein the step of contacting the solution comprising the fixed sample with a carrier oil is performed on a microfluidic device.

15. The method of claim 14, wherein the carrier oil flow rate on the microfluidic device is no greater than 400 µL / minute. 4888-3636-9385.3 92 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 16. The method of claim 14, wherein the carrier oil flow rate on the microfluidic device is no greater than 300 µL / minute.

17. The method of claim 14, wherein the carrier oil flow rate on the microfluidic device is 150-300 µL / minute.

18. The method of claim 14, wherein the carrier oil flow rate on the microfluidic device is 270 µL / minute.

19. The method of claim 14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 100 µL / minute.

20. The method of claim 14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is no greater than 50 µL / minute.

21. The method of claim 14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is 10-100 µL / minute.

22. The method of claim 14, wherein the solution comprising the fixed sample’s flow rate on the microfluidic device is 25 µL / minute.

23. The method of any one of the preceding claims, wherein the carrier oil is a fluorinated oil 24. The method of any one of the preceding claims, wherein the at least one deemulsifier is selected from the group consisting of: Chloroform; perfluorooctanol (PFO); and a detergent-free hydrofluoroether (HFE) oil.

25. The method of any one of the preceding claims, wherein the at least one deemulsifier is PFO.

26. The method of any one of the preceding claims, wherein the low positive ion expansion solution is a solution comprising less than 2 M of a positive ion.

27. The method of any one of the preceding claims, wherein the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, and Mg2+.

28. The method of any one of the preceding claims, wherein the low positive ion expansion solution is a solution comprising less than 2 M of positively-charged detergent molecules.

29. The method of any one of the preceding claims, wherein the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, Mg2+, and positively-charged detergent molecules.

30. The method of any one of the preceding claims, wherein the low positive ion expansion solution is a solution comprising phosphate buffered saline (PBS), Tris, and / or water.

31. The method of any one of the preceding claims, further comprising contacting 4888-3636-9385.3 93 002806-000113WOPTAttorney Docket No: 002806-000113WOPT the sample comprising at least one nucleic acid molecule, the solution comprising the fixed sample, or the droplet comprising the fixed sample with at least one antibody reagent before contacting the droplet comprising the fixed sample with a digestion solution and / or an expansion solution.

32. The method of any one of the preceding claims, further comprising contacting the sample comprising at least one nucleic acid molecule with at least one antibody reagent or aptamer reagent before contacting the sample comprising at least one nucleic acid molecule with formaldehyde, NP-40, and / or MA-NHS.

33. The method of claim 31 or 32, wherein the at least one antibody reagent or aptamer reagent is specific for a nucleic acid or nucleic acid-associated molecule.

34. The method of any one of claims 31-33, wherein the at least one antibody reagent or aptamer reagent comprises a non-proteinaceous label.

35. The method of claim 34, wherein the non-proteinaceous label is selected from the group consisting of: biotin; fluorescein isothiocyanate (FITC); digoxigenin; and rhodamine.

36. The method of claim 34, wherein the non-proteinaceous label is biotin.

37. The method of any one of claims 31-36, wherein the at least one antibody reagent comprises a primary antibody with a non-proteinaceous label.

38. The method of any one of claims 31-36, wherein the at least one antibody reagent comprises a) a primary antibody and b) a secondary antibody with a non-proteinaceous label.

39. The method of any one of claims 31-38, further comprising contacting the expanded sample with at least one antibody reagent or aptamer reagent specific for the non-proteinaceous label.

40. The method of any one of claims 31-39, further comprising contacting the expanded sample with a) at least one primary antibody reagent specific for the non-proteinaceous label and b) at least one secondary antibody specific for the primary antibody reagent specific for the non- proteinaceous label.

41. The method of any one of the preceding claims, wherein the sequencing comprises next- generation sequencing.

42. The method of any one of the preceding claims, wherein the sequence comprises single-cell sequencing.

43. The method of any one of the preceding claims, wherein the sequencing comprises the use of a transposase-mediated adapter. 4888-3636-9385.3 94 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 44. The method of any one of the preceding claims, wherein the sequencing comprises contacting the expanded sample with at least one transposase.

45. The method of any one of the preceding claims, wherein the sequencing comprises contacting the expanded sample with at least one reagent comprising a transposase conjugated, bound to, or fused with an antibody-binding protein.

46. The method of claim 45, wherein the antibody-binding protein binds to the antibody reagent, the primary antibody, and / or the secondary antibody of any of claims 31-40.

47. The method of any one of claims 45-46, wherein the antibody-binding protein binds to the secondary antibody.

48. The method of any one of claims 43-47, wherein the at least one transposase is Tn5.

49. The method of any one of the preceding claims, wherein the sequencing comprises contacting the expanded sample with pA-Tn5, pG-Tn5, or pAG-Tn5.

50. The method of any one of the preceding claims, wherein the sequencing comprises contacting the expanded sample with pAG-Tn5.

51. The method of any one of claims 43-50, wherein the transposase, pA-Tn5, pG-Tn5, or pAG-Tn5 is loaded with next-generation sequencing adapters.

52. The method of any one of the preceding claims, further comprising a step of contacting the expanded sample with a visualization agent.

53. The method of claim 52, wherein the visualization agent is selected from the group consisting of: 4′,6-diamidino-2-phenylindole (DAPI); an anthraquinone dye; and a cyanine dye.

54. The method of claim 52, wherein the visualization agent is DAPI.

55. The method of any one of the preceding claims, whereby the sample is enlarged or expanded.

56. The method of any one of the preceding claims, whereby the sample is enlarged or expanded for high-resolution single-cell genomics.

57. The method of any one of the preceding claims, wherein multiple samples are enlarged or expanded.

58. The method of any one of the preceding claims, wherein multiple samples are enlarged or expanded, thereby providing a library of samples.

59. A method comprising: a) contacting a sample comprising at least one nucleic acid molecule with: i) a fixative reagent; and 4888-3636-9385.3 95 002806-000113WOPTAttorney Docket No: 002806-000113WOPT ii) an acid; to provide a fixed sample; b) contacting the fixed sample with sequencing adaptors, and optionally transposase, to provide a fixed sample comprising linear nucleic acid fragments; c) contacting the fixed sample comprising linear nucleic acid fragments with at least one hairpin adaptor to provide a fixed sample comprising circularized nucleic acid fragments; d) optionally immunostaining the fixed sample comprising circularized nucleic acid fragments; e) contacting the fixed sample comprising circularized nucleic acid fragments with at least one amino-oligo hook complementary to the at least one hairpin adapter to provide a fixed sample comprising circularized nucleic acid-adapter fragments; f) contacting the fixed sample comprising circularized nucleic acid-adapter fragments with MA-NHS to provide a fixed sample comprising circularized nucleic acid-methyl acrylate adapter fragments; g) contacting the fixed sample comprising circularized nucleic acid-methyl acrylate adapter fragments with an encapsulation solution comprising: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate; v) sodium chloride; vi) TEMED; vii) ammonium persulfate; and viii) optionally 4HT; to provide a gel comprising the fixed sample; h) contacting the gel comprising the fixed sample with: i) a digestion solution comprising at least one protease; and / or ii) a low positive ion expansion solution; thereby digesting proteins in the gel comprising the fixed sample, and / or expanding the gel comprising the fixed sample to provide an expanded sample; i) optionally contacting the expanded sample with a re-embedding solution comprising at least one of: acrylamide; 4888-3636-9385.3 96 002806-000113WOPTAttorney Docket No: 002806-000113WOPT APS; and TEMED; to provide a re-embedded expanded sample; j) optionally contacting the re-embedded expanded sample with at least one of EDC and NHS to provide a passivated expanded sample; and and k) at least one of: i) sequencing one or more nucleic acid sequences in the expanded sample (or re- embedded expanded sample or passivated expanded sample) and / or detecting the location of one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) and ii) imaging or detecting the expanded sample (or re-embedded expanded sample or passivated expanded sample).

60. The method of claim 59, wherein the nucleic acid sequence is present in genomic DNA.

61. The method of any one of claims 59-60, wherein the at least one nucleic acid molecule is at least one chromosome.

62. The method of any one of claims 59-61, wherein the acid is HCl.

63. The method of any one of claims 59-62, wherein the fixative reagent is selected from the group consisting of: formaldehyde; paraformaldehyde (PFA); glutaraldehyde (GA); ethylene glycol bis(succinimidyl succinate) (EGS); dimethyl adipimidate (DMA); and discuccinimidyl glutarate (DSG).

64. The method of any one of claims 59-63, wherein the fixative reagent is paraformaldehyde.

65. The method of any one of claims 59-64, wherein step b comprising contacting the fixed sample with sequencing adaptors and transposase.

66. The method of any one of claims 59-65, wherein the transposase is Tn5 transposase.

67. The method of any one of claims 59-66, wherein the at least one hairpin adaptor comprises a double stranded stem, a primer binding site, and a single-stranded region complementary to the sequencing adaptor.

68. The method of any one of claims 59-67, wherein the at least one hairpin adaptor comprises a barcode.

69. The method of any one of claims 59-68, wherein the at least one hairpin adaptor comprises a unique molecular identifier barcode. 4888-3636-9385.3 97 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 70. The method of any one of claims 69, wherein the MA-NHS in step f) is present at 5-10 mM in 1xPBS.

71. The method of any one of claims 59-70, comprising the further step of immunostaining the fixed sample comprising circularized nucleic acid fragments.

72. The method of any one of claims 59-71, wherein immunostaining comprises contacting with one or more antibody reagents comprising a detectable label.

73. The method of any one of claims 59-72, wherein the at least one amino-oligo hook comprises an oligonucleotide having a 5’ end and a 3’ end; an amino group at the 3’ end; an acrydite group at the 5’ end; and a region complementary to the hairpin adaptor.

74. The method of any one of claims 59-73, wherein the encapsulation solution comprises: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate; v) sodium chloride; vi) TEMED; and vii) ammonium persulfate.

75. The method of any one of claims 59-74, wherein the encapsulation solution comprises: i) N,N-dimethylacrylamide; ii) acrylamide; iii) bis-acrylamide; iv) sodium acrylate; v) sodium chloride; vi) TEMED; vii) ammonium persulfate; and viii) 4HT.

76. The method of any one of claims 59-75, wherein the digestion solution comprises a) Tris-HCl, b) EDTA, c) guanidine HCl and / or NaCl, and d) Triton X-100.

77. The method of any one of claims 59-76, wherein the at least one protease comprises proteinase K, trypsin, ArgC, LysC, or pepsin. 4888-3636-9385.3 98 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 78. The method of any one of claims 59-77, wherein the low positive ion expansion solution is a solution comprising less than 2 M of a positive ion.

79. The method of any one of claims 59-78, wherein the low positive ion expansion solution is a solution comprising less than 2 M of Na+, Li+, Ca2+, and Mg2+.

80. The method of any one of claims 59-79, wherein the low positive ion expansion solution is a solution comprising phosphate buffered saline (PBS), Tris, and / or water.

81. The method of any one of claims 59-80, wherein step h) comprises contacting the gel comprising the fixed sample with a digestion solution comprising at least one protease; and a low positive ion expansion solution.

82. The method of any one of claims 59-81, wherein step h) comprises contacting the gel comprising the fixed sample with a digestion solution comprising at least one protease.

83. The method of any one of claims 59-82, wherein step h) comprises contacting the gel comprising the fixed sample with a low positive ion expansion solution.

84. The method of any one of claims 59-83, wherein the method comprises the step of contacting the expanded sample with a re-embedding solution comprising at least one of: acrylamide; APS; and TEMED; to provide a re-embedded expanded sample.

85. The method of any one of claims 59-84, wherein the re-embedding solution comprises acrylamide; APS; and TEMED.

86. The method of any one of claims 59-85, wherein the method comprises the further step of contacting the re-embedded expanded sample with at least one of EDC and NHS to provide a passivated expanded sample.

87. The method of any one of claims 59-86, wherein the method comprises the further step of contacting the re-embedded expanded sample with EDC and NHS to provide a passivated expanded sample.

88. The method of any one of claims 59-87, wherein the method further comprises performing rolling circle amplification before the sequencing step.

89. The method of any one of claims 59-88, wherein the imaging comprises super-resolution immunofluorescence imaging.

90. The method of any one of claims 59-89, wherein the imaging comprises the use of a diffraction- limited microscope. 4888-3636-9385.3 99 002806-000113WOPTAttorney Docket No: 002806-000113WOPT 91. The method of any one of claims 59-90, comprising: i) sequencing one or more nucleic acid sequences in the expanded sample (or re- embedded expanded sample or passivated expanded sample) and / or detecting the location of one or more nucleic acid sequences in the expanded sample (or re-embedded expanded sample or passivated expanded sample) and ii) imaging or detecting the expanded sample (or re-embedded expanded sample or passivated expanded sample).

92. The method of any one of claims 59-91, wherein multiple samples are enlarged or expanded, thereby providing a library of samples. 4888-3636-9385.3 100 002806-000113WOPT

Citation Information

Patent Citations

  • In situ nucleic acid sequencing of expanded biological samples

    US20160304952A1

  • In Situ ATAC Sequencing

    US20190032128A1

  • Droplet-Based Method And Apparatus For Composite Single-Cell Nucleic Acid Analysis

    US20190127782A1

  • Compositions and methods for using fixed biological samples in partition-based assays

    US20210190770A1

  • High-resolution spatial and quantitative DNA assessment

    US20220389409A1